Professional Documents
Culture Documents
Blood culture-negative endocarditis (BCNE)—that is, 2.5%–31% of all cases of endocarditis [1]. This varia-
endocarditis in which no causative microorganism can tion in incidence may be explained by several factors,
be grown in a culture taken from a blood sample by including (i) differences in the diagnostic criteria used;
using the usual laboratory methods—accounts for (ii) specific epidemiological factors, as for fastidious
zoonotic agents; (iii) variations in the early use of an-
tibiotics prior to blood sampling; (iv) differences in
sampling strategies [2]; or (v) involvement of unknown
Received 18 December 2009; accepted 20 March 2010; electronically published
11 June 2010. pathogens.
Reprints or correspondence: Dr. Didier Raoult, Unité de Recherche sur les In our laboratory, we have diversified the diagnostic
Maladies Infectieuses et Tropicales Emergentes, CNRS-IRD UMR 6236, Faculté de
médecine, Université de la Méditerranée, 27 Blvd. Jean Moulin, 13385 Marseille tests used over the past few years for the diagnosis of
cedex 05, France (didier.raoult@gmail.com). BCNE. In particular, we have demonstrated the use-
Clinical Infectious Diseases 2010; 51(2):131–140 fulness of systematic serological testing for the detec-
2010 by the Infectious Diseases Society of America. All rights reserved.
1058-4838/2010/5102-0002$15.00 tion of fastidious agents, especially Coxiella burnetii and
DOI: 10.1086/653675 Bartonella species, but also Brucella species, Legionella
pneumophila, and Mycoplasma species [2, 3]. Two other meth- among fastidious bacteria, the role of Chlamydia pneumoniae
ods that exhibited great potential for the diagnosis of BCNE in BCNE remains uncertain, as is the case for viruses [13].
were histological examination [4] and broad-range polymerase Consequently, diagnosis of BCNE remains a challenge, as high-
chain reaction (PCR), particularly when applied to valvular lighted by the 21% rate of cases without any identified causative
biopsies [5]. The few studies using PCR for the diagnosis of agent in the largest series of BCNE cases reported to date [3].
BCNE published to date have highlighted the importance of Since our previous publication of a large series of BCNE
streptococci and fastidious bacteria, although their respective cases [3], our laboratory received an increasing number of spec-
prevalence has not been estimated [3, 5–12]. In addition, imens from patients with BCNE. Here, we prospectively used
a comprehensive strategy incorporating a battery of laboratory described [3]. Specific antibodies to Brucella melitensis and My-
techniques [3, 5, 14], including several new ones, to increase coplasma pneumoniae were detected with an immunoenzymatic
the rate of diagnoses in patients with BCNE and to evaluate antibody test (titer, ⭓1:200) and the Platellia M. pneumoniae
the prevalence of various agents missed by standard blood cul- IgM kit (Bio-Rad), respectively. Because of a lack of standard-
tures, including fastidious bacteria and viruses. We also esti- ization, antibodies to Mycoplasma hominis were not investi-
mated the incidence of noninfective causes of endocarditis. gated. When results of first-rank tests were negative, we sys-
tematically performed Western blot using Bartonella species
PATIENTS AND METHODS antigens [16], as described in the Appendix, which appears
Patients only in the electronic version of the journal.
From 1 June 2001 to 1 September 2009, we prospectively in- Molecular detection methods. Bacterial DNA was extract-
cluded all patients with suspected BCNE for whom specimens ed from surgically excised valves, or EDTA blood when no valve
were referred to our laboratory (Figure 1 and Table 1). For was available, using the QIAmp Tissue kit (QIAGEN) as de-
each studied patient, a questionnaire was completed by the scribed by the manufacturer. PCR primers and targets are de-
physician in charge. The questions asked are detailed in Tables tailed in Table 4, and PCR and sequencing conditions are de-
2 and 3. Answers were not obtained for all questions from all scribed in the Appendix. Primer extension enrichment reaction
patients. When results of all assays were negative, we recon- (PEER) was performed on valvular biopsies from patients for
tacted physicians in charge of patients to enquire about any whom results of other tests were negative, as previously de-
neoplasic or automimmune disease that would have been di- scribed [22, 23]. We used the buffy coat obtained from each
agnosed elsewhere. The study was approved by the local ethics patient following antibiotic therapy as control tissue (“driver”).
committee under reference 07–015. The study was also ap- Cell culture. Homogenized cardiac valve specimens suit-
proved by the Commission Nationale Informatique et Libertés able for culture—that is, frozen at ⫺80C following surgery
under reference 1223186. and sent in dry ice—and heparinized blood specimens pro-
cessed in the same way were inoculated onto human endothelial
Diagnostic Procedures cells (ECV 304) grown in shell vials, as reported elsewhere [24].
Serological analysis. Indirect immunofluorescence assays to Three weeks after inoculation, bacteria detected by Gimenez
detect significant levels of antibodies to C. burnetii (phase I and acridine orange staining, electron microscopy, or immu-
immunoglobulin [Ig] G titer, 11:800), Bartonella quintana, nofluorescence using the patient’s serum, were identified by
Bartonella henselae (IgG titer, ⭓1:800), and L. pneumophila amplification and sequencing of the 16S rRNA gene as previ-
(total antibody titer, ⭓1:256) were performed as previously ously described [8].
Patients
P by univariate Relative risk (95% CI) P by multivariate
with an a a,b
analysis by univariate analysis analysis
identified Definite Possible
agent patients patients Definite Possible Definite Possible Definite Possible
Variable (n p 476) (n p 73) (n p 191) patients patients patients patients patients patients
Male-to-female ratio 3.2 1.4 1.9 !.01 !.01 1.1 (1.03–1.2) 1.2 (1.04–1.3) .4 .09
Age, years
Mean SD 57.9 15.7 60.7 16.0 58.3 17.1 .15 .8
Median 58 62 59
Known preexisting valvular defect 94.3 94.0 83.4 .6 !.01 1.0 (0.9–1.1) 1.5 (1.1–1.9) ND !.01
Valve involved
Native valve 67.9 63.4 62.6 .5 .3 1.0 (0.9–1.1) 1.0 (0.9–1.2)
NOTE. Data are percentage of patients, unless otherwise indicated. CI, confidence interval; ND, not determined.
a
P values !.05 are in boldface type.
b
Only variables for which the P value obtained in univariate analysis was ⭐.1 were included in the multivariate logistic regression analysis.
Table 3. Comparison of the Clinical Features, Laboratory Results, and Outcome of the 476 Patients with an Etiological Agent Identified
to Those of the 73 Definite Patients without any Diagnosis, and the 191 Possible Patients
Patients
P by univariate Relative risk (95% CI) P by multivariate
with an analysis
a
by univariate analysis analysisa,b
identified Definite Possible
agent patients patients Definite Possible Definite Possible Definite Possible
Variable (n p 476) (n p 73) (n p 191) patients patients patients patients patients patients
Previous antibiotic therapy 39.8 63.9 60.6 !.01 !.01 0.9 (0.8–0.9) 0.8 (0.7–0.9) .2 !.01
Clinical symptoms
Fever (temperature, ⭓38.5C) 92.0 93.1 81.4 .8 !.01 1.4 (1.1–1.8) 1.4 (1.1–1.8) ND !.01
Cardiac murmur 72.9 79.3 68.0 .3 .3 1.0 (0.9–1.0) 1.0 (0.9–1.2)
Arterial emboli 13.3 46.5 9.0 !.01 .2 0.7 (0.6–0.8) 1.1 (1.0–1.3) !.01 ND
Digital clubbingc 7.2 8.6 6.2 .7 .7 1.0 (0.8–1.1) 1.0 (0.8–1.3)
Osler nodesc 1.7 1.7 0.7 .9 .4 1.0 (0.7–1.3) 1.2 (0.9–1.6)
Glomerulonephritisc 9.4 6.9 5.5 .5 .1 1.0 (0.9–1.2) 1.1 (1.0–1.3)
Laboratory results
Leukocytosisc 49.0 51.7 47.2 .7 .7 1.0 (0.9–1.1) 1.0 (0.9–1.1)
c
Anemia 51.8 50.0 45.8 .8 .2 1.0 (0.9–1.1) 1.1 (1.0–1.2)
Rheumatoid factorc 6.9 31.0 11.1 !.01 .1 0.6 (0.5–0.8) 0.8 (0.6–1.1) !.01 ND
Death 3.1 6.8 5.8 .2 .2 0.8 (0.6–1.1) 0.8 (0.5–1.1)
NOTE. Data are percentage of patients, unless otherwise indicated. CI, confidence interval; ND, not determined.
a
P values !.05 are in boldface type.
b
Only variables for which the P value obtained in univariate analysis was ⭐.1 were included in the multivariate logistic regression analysis.
c
Data were not available for all patients.
Microorganisms
Primer name Nucleotide sequence, 5r3 detected Molecular target Reference
a
536F CAGCAGCCGCGGTAATAC All bacteria 16S rRNA [8]
RP2b ACGGCTACCTTGTTACGACTT
a
CUF TCCGTAGGTGAACCTGCGG Fungi 18S rRNA [17]
b
CUR GCTGCGTTCTTCATCGATGC
IS1111fa CAAGAAACGTATCGCTGTGGC Coxiella burnetii htpAB-associated element [18]
b
IS1111R CACAGAGCCACCGTATGAATC
c
IS1111probe CCGAGTTCGAAACAATGAGGGCTG
ITS Fa GGGGCCGTAGCTCAGCTG Bartonella species 16S-23S rRNA spacer [19]
ITS Rb TGAATATATCTTCTCTTCACAATTTC
Statistical Methods a myxoma of the left atrium (1 patient). Among the remaining
To identify the variables associated with absence of diagnosis, 759 patients with endocarditis, 19 (2.5%) were classified as
we compared the 476 patients with an identified etiological having noninfective endocarditis. Among these, histopathology
agent with the 73 definite patients without etiological agents identified a marantic endocarditis, Libmann-Sacks endocarditis,
and with the 191 possible patients, using the Mantel-Haenszel and Behcet disease in 7, 4, and 1 cases, respectively. Subse-
x2 test. Mean ages were compared using the Anova and quently, by evaluating the presence of antinuclear antibodies
Bartlett’s tests. The variables independently associated with the of 129 of 290 patients for whom results of all assays were
negativity of all diagnostic tests were identified using an un- negative and by calling their physicians in charge, we identified
conditional logistic regression analysis (Tables 2 and 3 and the an additional 7 patients in whom a diagnosis of autoimmune
Supplementary Results in the Appendix). We also compared disease had been done elsewhere using diagnostic criteria [27,
the diagnoses obtained by our strategy with those of other 28], including 5 patients with Libmann-Sacks endocarditis and
published BCNE series, using the Mantel-Haenszel x2 test. All 2 with rheumatic arthritis. Of the 740 patients putatively clas-
tests were performed using the EPI info software, version 3.3.2 sified as having infective endocarditis, 549 (74.2%) were clas-
(http://www.cdc.gov/epiinfo/index.htm). Observed differences sified as having definite endocarditis using the Duke criteria
were considered significant when P was !.05 for 2-tailed tests. [15], including 476 for whom our diagnostic strategy allowed
identification of an infectious agent (Table A1 in the online
RESULTS
Appendix), and 73 for whom no etiological agent could be
Patients. Specimens from 819 new patients from France or found. The remaining 191 patients (25.8%) were classified as
abroad were included in this study (Figure 1). By using the possible patients. The epidemiological data of the 740 patients
modified Duke criteria [15], 60 patients (7.3%) were excluded with definite or possible endocarditis are presented in Table 1.
from the diagnosis of endocarditis, including 57 who did not Diagnostic procedures. Serological analysis using immu-
meet criteria for possible endocarditis, and 3 for whom his- nofluorescence assay provided a diagnosis for 356 (47.8%) of
topathological results identified angiosarcoma (2 patients ) and 745 tested patients (Figure 2). Chronic Q fever (IgG titer to
phase I C. burnetii, 11:800) was diagnosed in 274 patients in 4 patients: Mycobacterium tuberculosis, Micrococcus luteus,
(77%). Eighty patients (22.5%) had an IgG titer to B. quintana Candida dubliniensis, and Cryptococcus laurentii. Sequences ob-
and/or B. henselae ⭓1:800 (Table A1). One patient had a titer tained from these microorganisms have been deposited in
of 1:2048 to L. pneumophila and a positive result of L. pneumo- GenBank under accession numbers EU139422, EU139419,
phila urinary antigen assay. One patient had a titer of 1:256 to EU139420, and EU139421, respectively. Results for negative
Legionella anisa and was later diagnosed as having L. long- controls remained negative.
beachae endocarditis on the basis of both culture and PCR Cell culture of heparinized blood allowed bacterial recovery
of a valvular biopsy. Among the patients for whom no diag- in 7 (4.1%) of 169 patients. When applied to valvular biopsies,
nosis was obtained with other tests, serum was available for culture was positive for 58 (45.7%) of 127 patients. Culture
Bartonella Western blot for 148 patients. For these patients, a did not provide any diagnosis that was not made by another
diagnosis of B. quintana infection was obtained for 4 patients method. Detailed results are presented in Table A1.
who were seronegative using immunofluorescence assay. Culture and PCR of valvular biopsies (positive for 58 of 127
Additionally, 16S ribosomal DNA (rDNA) and 18S rDNA patients and 157 of 227 patients, respectively) were significantly
PCR assays performed on EDTA blood provided diagnoses for more sensitive than were culture and PCR of blood (positive
35 (13.6%) and 1 (0.4%) of 257 patients, respectively. Also, for 7 of 169 patients and 36 of 257 patients, respectively; P !
16S rDNA and 18S rDNA PCR assays of valvular specimens .01 for both). In addition, PCR was significantly more sensitive
were positive for 150 (66.1%) and 7 (3.0%) of 227 patients, than was culture for valvular biopsies (P ! .01 ). The sensitivity
respectively (Table A1). PCR amplification of C. burnetii, Bar- of our diagnostic strategy (478 etiological agents identified
tonella species, and Tropheryma whipplei was positive for 16, among 740 patients [64.6%]) was significantly higher than that
12, and 5 EDTA blood specimens, respectively, and for 30, 26 obtained for a previous series from France (15 [17.0%] of 88;
and 17 valvular biopsies, respectively. Results for negative con- P ! .01), Great Britain (31 [49.2%] of 63; P p .01), and Algeria
trols were in all assays. Overall, PCR identified a causative agent (28 [45.1%] of 62; P ! .01) but was significantly smaller than
in 109 seronegative patients, including 106 by PCR of valvular that obtained for our previous series from France (271 [77.9%]
specimens and 3 by PCR of blood only. PCR assays for cyto- of 348; P ! .01) (Table 5). However, in the latter study, we had
megalovirus, enteroviruses, and C. pneumoniae were negative considered only patients classified as having definite endocar-
for all tested specimens. PEER, performed on 49 valvular bi- ditis and identified an agent different from C. burnetii and
opsies from patients for whom all other diagnostic methods Bartonella species in only 5 patients, compared with 110 pa-
failed to identify a causative agent, identified a microorganism tients in the present study (P ! .01).
NOTE. Data are percentages. HACEK, Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, Kingella.
a
Patients classified as excluded were not included in this analysis.
species as an agent in a patient. To date, PCR assays targeting In our study, the main bacterial agents identified by PCR were
fungi have been used in a limited number of studies [9, 11]. streptococci (mainly Streptococcus gallolyticus), T. whipplei, Bar-
Given the fact that these agents are not covered by most em- tonella species, and staphylococci. These diagnoses suggest that,
pirical antibiotic therapies used for BCNE, we propose that this unlike for blood specimens, broad-range PCR may be preferred
assay should form part of the diagnostic strategy for BCNE. as the first-line test for valvular specimens. We detected no viral
Valvular biopsies, when available, proved to be of great di- agent or Chlamydia species. Among assays newly applied for
agnostic value, allowing the detection of a microorganism in this purpose, Western blot for Bartonella species, PEER, and
157 patients. The 16S rDNA and 18S rDNA PCR assays of autoimmunohistochemistry provided a diagnosis for 4, 4, and
valves were positive for 150 (66.1%) and 7 (3.0%) of 227 pa- 1 patients, respectively, for whom results of all other methods
tients, respectively (Table A1). In recent studies, broad-range were negative. Such findings suggest that these methods should
PCR for bacteria was demonstrated to be highly valuable for be considered only when others fail.
valvular specimens [3, 6–11, 14], with the identification of Of the identified agents, zoonotic bacteria were the most
streptococci and fastidious bacteria as main agents (Table 5). frequent (Supplementary Comments and Table A1 in the Ap-