See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/221881373

Beta-lactams resistance and presence of class 1 integron in Pseudomonas spp.

isolated from untreated hospital effluents in Brazil

Article  in  Antonie van Leeuwenhoek · March 2012

DOI: 10.1007/s10482-012-9714-2 · Source: PubMed

CITATIONS READS

14 110

4 authors, including:

Letícia Muner Otton Gertrudes Corção

Universidade Federal do Rio Grande do Sul Universidade Federal do Rio Grande do Sul
9 PUBLICATIONS   39 CITATIONS    122 PUBLICATIONS   383 CITATIONS   

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Gertrudes Corção on 17 April 2017.

The user has requested enhancement of the downloaded file.

Antonie van Leeuwenhoek (2012) 102:73–81
DOI 10.1007/s10482-012-9714-2
ORIGINAL PAPER
Beta-lactams resistance and presence of class 1 integron
in Pseudomonas spp. isolated from untreated hospital
effluents in Brazil
Aline Spindler • Letı́cia Müner Otton •
Daiane Bopp Fuentefria • Gertrudes Corção
Received: 2 December 2011 / Accepted: 20 February 2012 / Published online: 1 March 2012
Ó Springer Science+Business Media B.V. 2012
Abstract The aim of the present study was to
investigate the resistance profile, to detect the pres-
ence of beta-lactam resistance genes, phenotypic
expression of efflux pump systems and class 1
integrons in Pseudomonas spp. strains obtained from
untreated hospital effluents. Effluent samples were
collected from four hospitals in Porto Alegre, RS,
Brazil. Pseudomonas were isolated on MacConkey
agar plates and the identification was confirmed by
16S rRNA PCR and biochemical tests. Susceptibility
testing was determined by disk-diffusion method
using 11 different beta-lactams and MIC assays were
performed on isolates resistant to imipenem and
ceftazidime. The beta-lactamase genes blaIMP, bla-
VIM, blaSPM-1, blaOXA-23-like, blaOXA-24-like, blaOXA-51-
like and the intl1 gene from class 1 integron were
analysed by PCR. One hundred and twenty-four
isolates were recovered and the most common species
A. Spindler  L. M. Otton  G. Corção (&)
Departamento de Microbiologia, Imunologia e
Parasitologia, Instituto de Ciências Básicas da Saúde
(ICBS), Universidade Federal do Rio Grande do Sul
(UFRGS), Rua Sarmento Leite, 500. Cidade Baixa, Porto
Alegre, RS 90050-170, Brazil
e-mail: corcao@ufrgs.br
D. B. Fuentefria
Clinical Pathology Laboratory, São Vicente de Paulo
Hospital, GRUPO SANI, Passo Fundo, RS, Brazil
was Pseudomonas pseudoalcaligenes. The resistance
found among the isolates was considered high, 62
(50%) isolates were multiresistant. No isolate carrying
the beta-lactamase genes tested was found among the
strains. Seven isolates showed reduction of MIC for
imipenem and ceftazidime in the presence of cyanide
m-chlorophenylhydrazone, indicating the hyper
expression of efflux pumps. From the 124 isolates,
52 (41.9%) were identified as carrying the class 1
integron gene, intI1. Untreated hospital effluents
could be a source of environmental contamination
due to discharge of antimicrobial resistant bacteria
which can carry integron class 1 and act as a reservoir
of resistance genes and have efflux pump systems.
Keywords Pseudomonas spp.  Beta-lactams
resistance  Hospital sewage  Integrons
Introduction
Studies have demonstrated that hospital effluents are
highly selective environments and that they contribute
to the high rates of resistant bacteria that are being
discharged in the natural environment (Meirelles-
Pereira et al. 2002; Prado et al. 2008; Yang et al. 2009;
Li et al. 2009; Fuentefria et al. 2011; Ferreira et al.
2011). The increase of pathogenic bacteria resistant to
beta-lactams has been of public health units concern
all around the world, since the misuse of these drugs is
strongly related to this process. Throughout the last
123
74
years, resistance to practically all the antimicrobials
available for clinical treatment has increased consid-
erably, as well as the outbreaks involving multiresis-
tant strains. These events have been noticed in several
countries around the world, mainly due to non-
fermenter bacteria such as Pseudomonas (Zavascki
et al. 2005; Almuzara et al. 2007; Empel et al. 2007;
Sekiguchi et al. 2007; Bogaerts et al. 2008). Species
belonging to this genus can accumulate several
resistance mechanisms, either acquired or intrinsic,
to beta-lactams. Production of beta-lactamases is the
most common one (Livermore 2002; Poirel et al.
2009), although the resistance mediated by hyper
expression of multidrug efflux pumps and loss or
decrease of porin expression is also present (Poole
2005; Wolter et al. 2007; Henrichfreise et al. 2007;
Jeannot et al. 2008). Some beta-lactamases genes,
most metallo-beta-lactamases and some oxacillinases,
are found as gene cassettes in class 1 integrons (Walsh
et al. 2005; Strateva and Yordanov 2009). This
structure is present in Gram-positive and Gram
negative bacteria and represents a potential genetic
resource by which bacteria can adapt through the
acquisition of new genetic material in a variety of
environments (Roe et al. 2003; Henriques et al. 2006;
Wright et al. 2008).
Bacteria belonging to Pseudomonas genus are
widely distributed in the environment, such as water
and soil. It has the ability of staying viable in aquatic
environment for long periods and it is well known for
its intrinsic resistance mechanisms (Mah et al. 2003;
Meirelles-Pereira et al. 2002). Even though most
studies give emphasis to P. aeruginosa, other species
belonging to this genus have already shown some
relevance, since they can also be found in the
environment, causing infections in humans and carry-
ing resistance genes and integrons as well (Hsueh et al.
1998; Bogaerts et al. 2008). Until now, few studies
have been done relating beta-lactams resistance and
integrons in Pseudomonas spp. associated to waste-
water (Quinteira et al. 2005; Pellegrini et al. 2009).
Pathogenic bacteria, also found in this environment,
can act as an environmental reservoir of antibiotic
resistance genes and contribute to their dissemination
through other microorganisms which can be also
source of human infection.
The aim of this study was to identify the susceptible
profile of Pseudomonas spp. strains obtained from
untreated hospital effluents, as well as the presence of
123
Antonie van Leeuwenhoek (2012) 102:73–81
beta-lactams resistance genes, phenotypic expression
of efflux pumps and class 1 integron in the different
species isolated, in order to determine the possible
mechanisms of beta-lactams resistance present in this
environment.
Materials and methods
Wastewater sampling and bacteriological
identification
The four hospitals that participated in the study were
acute-care university-affiliated hospitals. Untreated
effluent sampling was performed at the end of the
hospital-building networks. It was done twice during
the year 2007, in a non-intentional and non-regular
way, by convenience and without defined seasonal
relationship. Samples were collected by submerging
one liter sterile bottles in the sampling points and then
these bottles were kept refrigerated (4°C) until
processed in the laboratory, within eight hours after
sampling. Aliquots of 100 ml were filtered on mem-
branes of mixed esters of 0.45 lm porosity, which
were transferred to MacConkey agar. All the isolated
colonies with typical characteristics of non-fermenter
bacteria were selected from the plates and pre-
identified with the following tests: Gram stain, glucose
fermentation with OF media and catalase. Affiliation
to Pseudomonas genus was confirmed by amplifica-
tion of the 16S rRNA gene (Table 1). All isolates
confirmed by specific PCR for the genus were
included in this study and all of them were tested
with specific primers for P. aeruginosa (Table 1). The
PCR reactions were carried in a volume of 25 ll with
5 ll of genomic DNA, 0.30 mM of each dNTPs, 1 lM
of each primer, 19 of Taq polymerase buffer and 1 U
of Taq DNA polymerase (Invitrogen). The amplifica-
tion conditions were as follows: an initial denaturation
at 95°C for 2 min followed by 30 cycles of 1 min at
94°C, annealing for 1 min, according to Table 1,
1 min and 30 s at 72°C and a final extension at 72°C
for 5 min. The amplicons were analyzed by electro-
phoresis on 1% agarose gels in 19 TAE buffer stained
with ethidium bromide (0.5 lg/ml). The ones consid-
ered negative in the PCR were identified by biochem-
ical tests: glucose, maltose and starch oxidation with
OF media (1% concentration), TSB growth at 42°C,
oxidase and gelatin hydrolysis (Garrity 1984).
Antonie van Leeuwenhoek (2012) 102:73–81 75

Table 1 PCR primers and conditions used in the present study for bacteria identification, resistance and integrase genes detection
Target gene or primer Sequence (50 –30 ) PCR MgCl2 (mM) Annealing References
product temperature
(bp) (°C)

Pseudomonas sp. 16S GACGGGTGAGTAATGCCTA 618 2.8 54 Spilker et al.

rRNA gene CACTGGTGTTCCTTCCTATA 2004
P. aeruginosa 16S rRNA GGGGGATCTTCGGACCTCA 956 2.0 60 Spilker et al.
gene TCCTTAGAGTGCCCACCCG 2004
blaIMP AAAGATACTGAAAAGTTAGT 446 3.0 44 Gräf et al. 2008
TCYCCAAYTTCACTRTGACT
blaVIM AGTGGTGAGTATCCGACA 400 3.0 62 Gräf et al. 2008
ATGAAAGTGCGTGGAGAC
blaSPM-1 TCG GATCATGTCGACTTGCC 350 3.2 54 Fuentefria et al.
CCTTCGCTTCAGATCCTCGT 2009
blaOXA-23-like GATCGGATTGGAGAACCAGA 501 5.0 51 Woodford et al.
ATTTCTGACCGCATTTCCAT 2006
blaOXA-24-like GGTTAGTTGGCCCCCTTAAA 246 5.0 54 Woodford et al.
AGTTGAGCGAAAAGGGGATT 2006
blaOXA-51-like TAATGCTTTGATCGGCCTTG 353 5.0 53 Woodford et al.
TGGATTGCACTTCATCTTGG 2006
hep 35 and hep 36 primers TGCGGGTYAARGATBTKGATTT 491 Master mix 55 White et al. 2001
CARCACATGCGTRTARAT GoTaq
intI1 CGGAATGGCCGAGCAGATC 879 Master mix 55 Sandvang et al.
CAAGGTTCTGGACCAGTTGCG GoTaq 2002

Antimicrobial susceptibility tests
Antimicrobial susceptibility was determined for all
isolates by disk-diffusion method (Clinical and Labo-
ratory Standards Institute/NCCLS 2005), using the
beta-lactams aztreonam, ceftazidime, cefepime, cefope-
razone, cefpirome, imipenem, meropenem, piperacillin,
piperacillin-tazobactam, ticarcillin, and ticarcillin-cla-
vulanato. Imipenem and ceftazidime minimum inhibi-
tory concentration (MIC) tests were performed for the
isolates presenting reduced susceptibility to these anti-
biotics, according to Clinical and Laboratory Standards
Institute/NCCLS (2005). Pseudomonas aeruginosa
ATCC 27853 and Escherichia coli ATCC 25922 were
used as controls. Multidrug resistant (MDR) isolates
were considered as referred by Paterson (2006) and
resistant and intermediary phenotypes were considered
as reduced susceptibility phenotype. For detection of
the efflux system, cyanide m-chlorophenylhydrazone
(CCCP, Sigma) was used as an inhibitor. Previously,
tests were performed with various concentrations of
CCCP for each isolate and the concentration 10 lM was
chosen because it didn’t inhibit microbial growth. The
presence of the efflux system was inferred by decreasing
the MIC of imipenem and ceftazidime in the presence of
the inhibitor.
Detection of bla genes and intl1 gene by PCR
All isolates with reduced susceptibility to beta-lactams
were tested for blaIMP, blaVIM, blaSPM-1, blaOXA-23-like,
blaOXA-24-like and blaOXA-51-like genes (Table 1). All
the DNA extractions were made using the WhatmanÒ
FTAÒ Elute kit. The PCR reactions were carried out in
a volume of 25 ll with 2 ll of genomic DNA,
0.30 mM of each dNTPs, 1.5 lM of each primer, 19
of Taq Polymerase Buffer and 1 U de Taq DNA
polymerase (Invitrogen). The amplification conditions
were as follows: an initial denaturation at 95°C for
2 min followed by 30 cycles of 1 min at 94°C,
annealing for 1 min according to Table 1, 1 min at
72°C and a final extension at 72°C for 10 min.
All isolates were tested for the presence of integrase
genes using the degenerated primers hep 35 and hep 36

123
76 Antonie van Leeuwenhoek (2012) 102:73–81

(Table 1). All isolates positive for these primers were
tested for intl1 gene (Table 1). The PCR reactions
were carried in a volume of 25 ll with 5 ll of genomic
DNA, 12.5 ll of GoTaq Master mix (Promega) and
1 lM of each primer. The amplification conditions
were as follows: an initial denaturation at 95°C for
2 min followed by 30 cycles of 1 min at 94°C,
annealing for 1 min, according to Table 1, 3 min at
72°C and a final extension at 72°C for 7 min. Beta-
lactamase producer strains were used as positive
controls in all PCR reactions and as negative controls
P. putida ATCC 15175 was used.
(Table 2). All the 124 isolates were negative for the
presence of beta-lactamase genes tested by PCR.
The MIC analysis in the presence and absence of
CCCP was performed only in isolates with resistance
to imipenem and ceftazidime. In a general way, the
isolates presented a higher sensitivity to the carba-
penems imipenem and meropenem, only fifteen iso-
lates were resistant to imipenem and none of the
isolates presented intermediary phenotype to this
antibiotics. In MIC assays, all these isolates were
classified into low (16 lg/ml) to moderate (32 lg/ml)
level of resistance to this antibiotic, in the absence of

Results

After the specific PCR reactions and biochemical tests,

124 isolates were obtained. Eight different species of
Pseudomonas spp. were found and the most frequent one
was P. pseudoalcaligenes, followed by P. aeruginosa,
P. mendocina, P. putida, P. fluorescens, P. oryzihabi-
tans, P. luteola and P. alcaligenes (Fig. 1).
The highest rates of reduced susceptibility were
found to ticarcillin followed by cefoperazone, ceft-
adizime, piperacillin and cefepime (Fig. 2). Hetero-
geneous susceptibility profiles to the antibiotics tested
were found among the isolated species. A high number
of MDR isolates was also observed, a total of 62
isolates (50.0%) and P. alcaligenes was the only Fig. 2 Susceptible profile of Pseudomonas spp. isolated from
species where MDR isolates were not detected untreated hospital sewage to beta-lactams antibiotics tested

Fig. 1 Species distribution

of Pseudomonas spp.
isolates (a) and their
phylogenetic relationship
based on 16S rDNA
sequences (b) which were
used to construct a
maximum likelihood
phylogenetic tree after
aligning the sequences with
CLC Workbench 3.0
Program. Numbers at the
nodes represent bootstrap
support values

123
Antonie van Leeuwenhoek (2012) 102:73–81 77

CCCP. A reduction of MIC in the presence of CCCP CCCP, the MIC ranged from 512 mg/ml to 4 mg/ml
was observed in 11 isolates and in all tested species and in the presence of CCCP, from 256 mg/ml
(Table 3). The MIC for ceftazidime was performed in to \1 mg/ml, this was also observed in all tested
59 isolates and a reduction of MIC in the presence of species (Table 3). Fifteen isolates were resistant to
CCCP was observed in 26 (44.07%). In the absence of both imipenem and ceftazidime and seven of these
showed reduction of MIC in the presence of CCCP.
Sixty-eight isolates (54.93%) were considered
Table 2 Distribution of susceptibility profiles, number of positive with the primers hep 35 and hep 36, which
MDR isolates and occurrence of integron class 1 among the hybridize to conserved regions of integron-encoded
Pseudomonas species isolated from untreated hospital effluents
integrase genes intI1, intI2 e intI3 (White et al. 2001).
Species (number of Susceptibility MDR Integron Thirty-seven (54.41%) of these 68 integron positive
isolates) profiles isolates class 1
isolates were MDR and nine (13.23%) were suscep-
P. pseudoalcaligenes (66) 33 30 41 tible to all the antimicrobials tested. Integron positive
P. aeruginosa (26) 19 14 8 isolates presented several susceptibility profiles and
P. mendocina (9) 7 9 0 the results showed that there was some association
P. putida (7) 7 4 2 between MDR strains and the presence of integrons.
P. fluorescens (6) 5 3 0 Fifty-two (76.47%) out of these 68 isolates were
P. oryzihabitans (5) 4 1 0 confirmed as having class 1 integron with intl 1
P. luteola (3) 3 1 1 primers. Only strains of P. pseudoalcaligenes,
P. alcaligenes (2) 2 0 0 P. aeruginosa, P. putida and P. luteola species were
class 1 integrons positive and the higher frequency was

Table 3 Distribution of the

Number of isolates Ceftazidime MIC results Imipenem MIC results MDR
MIC with and without CCCP
(total/tested)
for imipenem and Without With Without With
ceftazidime resistant isolates CCCP CCCP CCCP CCCP
among the analyzed species
and number of MDR isolates P. pseudoalcaligenes (66/29) 512 256 32 16 and \1 7
with MIC reduction 512 2 16 8 2
256 128
128 64
64 32
32 8
8 \1
4 \1
P. aeruginosa (26/16) 512 256 32 4 and 2 1
512 16 16 4 3
128 64
64 \1
16 8
1 \1
8 4
4 \1
P. mendocina (9/8) 8 \1 nt nt –
P. putida (7/3) 32 16 nt nt –
P. fluorescens (6/1) 8 2 nt nt –
P. oryzihabitans (5/1) 512 64 32 \1 1
P. luteola (3/1) 512 128 nt nt –

123
78
observed among the P. pseudoalcaligenes strains
(Table 2).
Discussion
Pseudomonas species are widely distributed in the
environment, easily isolated from different kinds of
waste sources and, most of the time, related to a
biodegradation or bioremediation process. P. pseud-
oalcaligenes, the most common species found, is often
isolated from environmental samples and has also been
also related to antibiotic resistance (Quinteira et al.
2005). Resistant P. aeruginosa have been commonly
found in hospital effluents (Fonseca et al. 2005;
Fuentefria et al. 2008; Tuméo et al. 2008; Yang et al.
2009; Fuentefria et al. 2011). It is important to consider
the presence of resistant isolates from other Pseudo-
monas species, since they may represent a possible
reservoir of resistance determinants in the hospital
effluent, as shown by Koh et al. (2004). Although the
antimicrobial susceptibility profiles found in our work
showed reduced susceptibility to beta-lactams among
the strains, few studies have related non-clinical
isolates of Pseudomonas genus to this group of
resistance genes. Fuentefria et al. (2009) have identi-
fied nine strains of P. aeruginosa positive to gene
blaSPM-1, isolated from samples of untreated hospital
effluents in Brazil. Quinteira et al. (2005) found, in a
sample of urban sewage receiving untreated hospital
effluents, an environmental strain of P. pseudoalca-
ligenes VIM-2 producer. Pellegrini et al. (2009) found
a new metallo-beta-lactamase gene, blaIMP-22, in a
class 1 integron in P. fluorescens environmental strains
(urban wastewater). These studies reiterated that
resistance to carbapenems, widely disseminated
among clinical strains, is already, but not frequently,
detected among environmental isolates.
In our study, the resistance to beta-lactams could not
be related to the presence of the bla genes tested. Thus it
seems that these resistance genes may not be the primary
cause of the resistance to beta-lactams observed in this
study. When the resistance phenotypes from the present
study where analysed using the interpretative reading
criterion (Livermore et al. 2004), they were speculated to
be caused by membrane-bound multidrug efflux pump
(mainly MexXY-OprM, MexCD-OprJ and MexEF-
OprN), AmpC beta-lactamase, OXA beta-lactamases
(mainly OXA-3, OXA-15, OXA-31 and OXA-32) and
123
Antonie van Leeuwenhoek (2012) 102:73–81
some other beta-lactamases (mainly GES and TEM).
Although the presence of carbapenemases cannot be
excluded, the low or moderate MIC results observed for
imipenem also suggested an association with intrinsic
mechanisms of resistance. Usually, when the resistance
is due to the presence of carbapenemases the MIC is
[32 lg/mL. On the other hand, most of the time when
the resistance is due to hyper expression of efflux pumps
and/or loss or decrease of the expression of OprD porin
associated or not to the derepression of chromosomal
gene beta-lactamase AmpC, the MIC is usually low to
moderate (8–32 lg/ml) (Kim et al. 2005). Kim et al.
(2005), in a study with clinical isolates of P. aeruginosa,
observed that among 14 strains with a high level of
imipenem MIC ([128 lg/ml), 12 were positive to the
gene blaVIM-2. Ziha-Zarifi et al. (2007) showed that
hyper expression of chromosomally encoded beta-
lactamase AmpC and the efflux pump MexAB-OprM
were related to MICs up to 16 lg/ml. In the same study it
was possible to observe resistance to a variety of beta-
lactams from different subclasses, which was also found
in the isolates in our study. The MIC results for
ceftazidime in our isolates ranged from 512 to 4 mg/
ml, so high, moderate and low levels of resistance were
observed to this antibiotic. On the other hand, for
imipenem it ranged from 32 to 16 mg/ml, moderate and
low levels of resistance. A reduction of MIC for both
antibiotics was observed in isolates of all tested species,
some with a high reduction (P. pseudoalcaligenes,
P. aeruginosa, P. oryzihabitans and P. luteola) and other
with a low reduction (P. putida, P. mendocina and
P. fluorescens). Four P. pseudoalcaligenes, two P. aeru-
ginosa and one P. oryzihabitans showed reduction in
both MIC assays for imipenem and ceftazidime. There-
fore, in these isolates, this non-enzymatic energy-
dependent resistance mechanism, hyper expression of
efflux pumps, can be also related to the antibiotic
resistance observed.
Multiple mechanisms are related to the develop-
ment of resistance in the Pseudomonas genus but not
all of them are related to integrons. This structure is an
important and additional element to acquire several
mechanisms of resistance but not the only one likely to
determine this characteristic, though they can consid-
erably contribute to the dissemination and accumula-
tion of resistance mechanisms (Livermore 2002).
Multidrug efflux pumps have emerged as relevant
elements in the intrinsic and acquired antibiotic
resistance of bacterial pathogens and they should also
Antonie van Leeuwenhoek (2012) 102:73–81
have another role relevant to the bacteria in their
natural environments aside from resistance to antibi-
otics (Martinez et al. 2009).
Although there are no data about the incidence of
class 1 integrons in isolates obtained from hospital
effluents in Pseudomonas, there are many studies of this
nature in soil and superficial water industrially contam-
inated and contaminated with animal waste (Smalla and
Sobecky 2002; Wright et al. 2008). Wright et al. (2008)
have demonstrated that intl1 gene was more abundant in
contaminated-exposed communities, indicating a certain
degree of gene transfer in these environments and that
this group of mobile elements could play a substantial
role in the acquisition of a diverse array of gene cassettes.
Interestingly, in the present study the presence of
integrons class 1 was detected in P. luteola, apart from
the other species of Pseudomonas, and the prevalence of
integrons in P. pseudoalcaligenes (*62%) was higher
than in P. aeruginosa (*31%). According to the
INTEGRALL database (http://integrall.bio.ua.pt/)
(Moura et al. 2009), among Pseudomonas genus, class 1
integrons have only been reported in P. aeruginosa,
P. alcaligenes, P. fluorescens, P. mendocina, P. pseud-
oalcaligenes, P. putida and P. stutzeri, while class 2
integrons were only reported in P. aeruginosa and most
of them concerns to clinical settings. In this same data-
base the prevalence of integron class 1 in P. aeruginosa
is 88%, higher than the other species.
Considering that resistance genes are commonly
presented in integrons and these are normally located
in plasmids and transposon, we must consider the
importance of the high percentage of positive class 1
integron strains found in the present study. As these
strains were recovered from untreated hospital efflu-
ent and as the species are associated to environment,
they might be acting like a reservoir of resistance
genes and contributing to their dissemination.
Untreated hospital effluents can be a potential source
for environmental contamination, since this multidrug
and integron positive bacteria can be introduced into
the environment in significantly higher concentrations
than occur naturally. The main concern resides in the
fact that their mobile nature and capacity to accumu-
late resistance genes, due to the presence of integrons,
could lead to a wide dissemination of these genes.
Acknowledgments This research was supported by CAPES
(Brazilian Government Supporting Agency) and Rio Grande do
Sul State Supporting Agency FAPERGS. The authors would
79
like to thanks Dr. Ana Cristina Gales who kindly provided the
strains used as positive controls in this study. The authors are
also grateful to Clarissa Branco Haas, Lyvia Moreira de Oliveira
and Gabriela Rosa da Cunha for the technical assistance.
References
Almuzara M, Radice M, de Gárate N, Kossman A, Cuirolo A,
Santella G, Famiglietti A, Gutkind G, Vay V (2007) VIM-
2-producing Pseudomonas putida, Buenos Aires. Emerg
Infect Dis 13:668–669
Bogaerts P, Huang TD, Rodriguez-Villalobos H, Bauraing C,
Deplano A, Struelens MJ, Glupczynski Y (2008) Nosoco-
mial infections caused by multidrug-resistant Pseudomo-
nas putida isolates producing VIM-2 and VIM-4 metallo-
beta-lactamases. J Antimicrob Chemother 61:749–751
Clinical and Laboratory Standards Institute/NCCLS (2005)
Performance standards for antimicrobial susceptibility
testing; 15th informational supplement. Clinical and Lab-
oratory Standards Institute, Wayne
Empel J, Filczak K, Mrowka A, Hryniewicz W, Livermore DM,
Gniadkowski M (2007) Outbreak of Pseudomonas aeru-
ginosa with PER-1 extended-spectrum beta-lactamase in
Warsaw, Poland; further evidence for an international
clonal complex. J Clin Microbiol 45:997–1007
Ferreira AE, Marchetti DP, Oliveira LM, Gusatti CS, Fuentefria
DB, Corção G (2011) Presence of oxa-23-producing iso-
lates of Acinetobacter baumannii in wastewater from
hospitals in Southern Brazil. Microb Drug Resist 17(2):
221–227
Fonseca EL, Vieira VV, Cipriano R, Vicente ACP (2005) Class
1 integrons in Pseudomonas aeruginosa isolates from
clinical settings in the Amazon region, Brazil. FEMS
Immunol Med Microbiol 44:303–309
Fuentefria DB, Ferreira, Gräf T, Corção G (2008) Pseudomonas
aeruginosa: disseminação de resistência antimicrobiana
em efluente hospitalar e água superficial. Rev Soc Bras
Med Trop 41:470–473
Fuentefria DB, Ferreira AE, Gräf T, Corção G (2009) Spread of
metallo-beta-lactamases: screening reveals the presence of
a blaSPM-1 gene in hospital sewage in southern Brazil. Braz
J Microbiol 40:82–85
Fuentefria DB, Ferreira AE, Corção G (2011) Antibiotic-resis-
tant Pseudomonas aeruginosa from hospital wastewater
and superficial water: Are they genetically related?
J Environ Manag 92:250–255
Garrity GM (1984) Bergey’s manual of systematic bacteriology.
Springer, New York
Gräf T, Fuentefria DB, Corção G (2008) Occurrence of multi-
resistant strains of Pseudomonas aeruginosa producing
metallo-b-lactamase blaSPM-1 in clinical samples. Rev Soc
Brasil Med Trop 41:306–308
Henrichfreise B, Wiegand I, Pfister W, Wiedemann B (2007)
Resistance mechanisms of multiresistant Pseudomonas
aeruginosa strains from Germany and correlation with
hypermutation. Antimicrob Agents Chemother 51:
4062–4070
Henriques IS, Fonseca F, Alvesa A, Saavedra MJ, Correia A
(2006) Occurrence and diversity of integrons and beta-
123
80
lactamase genes among ampicillin-resistant isolates from
estuarine waters. Res Microbiol 157:938–947
Hsueh PR, Teng LJ, Pan HJ, Chen YC, Sun CC, Ho SW, Luh KT
(1998) Outbreak of Pseudomonas fluorescens bacteremia
among oncology patients. J Clin Microbiol 36:2914–2917
Jeannot K, Elsen S, Kohler T, Attree I, van Delden C, Plesiat P
(2008) Resistance and virulence of Pseudomonas aeru-
ginosa clinical strains overproducing the mexCD-oprJ
efflux pump. Antimicrob Agents Chemother 52:2455–2462
Kim IS, Lee NY, Ki CS, Oh WS, Peck KR, Song JH (2005)
Increasing prevalence of imipenem-resistant Pseudomonas
aeruginosa and molecular typing of metallo-beta-lacta-
mase producers in a Korean hospital. Microb Drug Resist
11:355–359
Koh TH, Wang GCY, Sng LH (2004) IMP-1 and a novel me-
tallo-beta-lactamase, VIM-6, in fluorescent Pseudomonads
isolated in Singapore. Antimicrob Agents Chemother
48:2334–2336
Li D, Yang M, Hu J, Zhang J, Liu R, Gu X, Zhang Y, Wang Z
(2009) Antibiotic-resistance profile in environmental bac-
teria isolated from penicillin production wastewater treat-
ment plant and the receiving river. Environ Microbiol
11:1506–1517
Livermore DM (2002) Multiple mechanisms of antimicrobial
resistance in Pseudomonas aeruginosa: Our worst night-
mare? Clin Infect Dis 34:634–640
Livermore DM, Winstanley TG, Shannon KP (2004) Interpre-
tative reading: recognizing the unusual and inferring
resistance mechanisms from resistance phenotypes. J
Antimicrob Chemother 48:87–102
Mah TF, Pitts B, Pellock B, Walker GC, Stewart PS, O’Toole
GA (2003) A genetic basis for Pseudomonas aeruginosa
biofilm antibiotic resistance. Nature 426:306–310
Martinez JL, Sanchez MB, Solano LM, Hernandez A, Gar-
mendia L, Fajardo A, Ortega CA (2009) Functional role of
bacterial multidrug efflux pumps in microbial natural
ecosystems. FEMS Microbiol Rev 33:430–449
Meirelles-Pereira F, Pereira MAS, Silva MCG (2002) Ecolog-
ical aspects of the antimicrobial resistance in bacteria of
importance to human infections. Braz J Microbiol 33:
287–293
Moura A, Soares M, Pereira C, Leitão N, Henriques I, Correia A
(2009) INTEGRALL: a database and search engine for
integrons, integrases and gene cassettes. Bioinformatics
25:1096–1098
Paterson DL (2006) The epidemiological profile of infections
with multidrug-resistant Pseudomonas aeruginosa and
Acinetobacter species. Clin Infect Dis 43:S43–S48
Pellegrini C, Mercuri PS, Celenza G, Galleni M, Segatore B,
Sacchetti E, Volpe R, Amicosante G, Perilli M (2009)
Identification of bla(IMP-22) in Pseudomonas spp. in
urban wastewater and nosocomial environments: bio-
chemical characterization of a new IMP metallo-enzyme
variant and its genetic location. J Antimicrob Chemother
63:901–908
Poirel I, Carrër A, Pitout JD, Nordmann P (2009) Integron
mobilization unit as a source of mobility of antibiotic
resistance genes. Antimicrob Agents Chemother 53:
2492–2498
Poole K (2005) Efflux-mediated antimicrobial resistance J
Antimicrob Chemother 56:20–51
123
Antonie van Leeuwenhoek (2012) 102:73–81
Prado T, Pereira WC, Silva DM (2008) Detection of extended-
spectrum-b-lactamase-producing Klebsiella pneumoniae
in effluents and sludge from a hospital sewage treatment
plant. Lett Appl Microbiol 46:136–141
Quinteira S, Ferreira H, Peixe L (2005) First isolation of blaVIM-
2 in an environmental isolate of Pseudomonas pseudoal-
caligenes. Antimicrob Agents Chemother 49:2140–2141
Roe MT, Vega E, Pillai SD (2003) Antimicrobial resistance
markers of class 1 and class 2 integron-bearing Escherichia
coli from irrigation water and sediments. Emerg Infect Dis
9:822–829
Sandvang D, Diggle M, Platt DJ (2002) Translocation of in-
tegron-associated resistance in a natural system: acquisi-
tion of resistance determinants by Inc P and Inc W plasmids
from Salmonella enterica Typhimurium DT104. Microb
Drug Res 8:151–160
Sekiguchi JI, Asagi T, Miyoshi-Akiyama T, Kasai A, Mizuguchi
Y, Araake M, Fujino T, Kikuchi H, Sasaki S, Watari H,
Kojima T, Miki H, Kanemitsu K, Kunishima K, Kikuchi Y,
Kaku M, Yoshikura H, Kuratsuji T, Kirikae T (2007)
Outbreaks of multidrug-resistant Pseudomonas aeruginosa
in community hospitals in Japan. J Clin Microbiol 45:
979–989
Smalla K, Sobecky PA (2002) The prevalence and diversity of
mobile genetic elements in bacterial communities of dif-
ferent environmental habitats: insights gained from dif-
ferent methodological approaches. FEMS Microbiol Ecol
42:165–175
Spilker T, Coenye T, Vandamme P, LiPuma JJ (2004) PCR-
based assay for differentiation of Pseudomonas aeruginosa
from other Pseudomonas species recovered from cystic
fibrosis patients. J Clin Microbiol 42:2074–2079
Strateva T, Yordanov D (2009) Pseudomonas aeruginosa—a
phenomenon of bacterial resistance. J Med Microbiol 58:
1133–1148
Tuméo E, Gbaguidi-Haore H, Patry I, Bertrand X, Thouverez M,
Talon D (2008) Are antibiotic-resistant Pseudomonas
aeruginosa isolated from hospitalized patients recovered in
the hospital effluents? Int J Hyg Environ Health 21:
200–204
Walsh TR, Toleman MA, Poirel L, Nordmann P (2005) Metallo-
b-lactamases: The quiet before the storm? Clin Microbiol
Rev 18:306–325
White PA, McIver CJ, Rawlinson WD (2001) Integrons and
gene cassettes in the Enterobacteriaceae. Antimicrob
Agents Chemother 45:2658–2661
Wolter DJ, Schmidtke AJ, Hanson ND, Lister PD (2007)
Increased expression of ampC in Pseudomonas aeruginosa
mutants selected with ciprofloxacin. Antimicrob Agents
Chemother 51:2997–3000
Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME,
Brown S, Amyes SG, Livermore DM (2006) Multiplex
PCR for genes encoding prevalent OXA carbapenemases
in Acinetobacter spp. Int J Antimicrob Agents 27:351–353
Wright MS, Austin CB, Lindell AH, Stepanauskas R, Stokes
HW, McArthur JV (2008) Influence of industrial contam-
ination on mobile genetic elements: class 1 integron
abundance and gene cassette structure in aquatic bacterial
communities. Int Soc Microb Ecol J J 2:417–428
Yang CM, Lin MF, Liao PC, Yeh HW, Chang BV, Tang TK,
Cheng C, Sung CH, Liou ML (2009) Comparison of
Antonie van Leeuwenhoek (2012) 102:73–81
antimicrobial resistance patterns between clinical and
sewage isolates in a regional hospital in Taiwan. Lett Appl
Microbiol 48:560–565
Zavascki AP, Gaspareto PB, Martins AF, Gonçalves AL,
Barth AL (2005) Outbreak of carbapenem-resistant Pseu-
domonas aeruginosa producing SPM-1 metallo-beta-lac-
tamase in a teaching hospital in southern Brazil.
J Antimicrob Chemother 56:1148–1151
View publication stats
81
Ziha-Zarifi I, Llanes C, Köhler T, Pechere JC, Plesiat P (2007)
In vivo emergence of multidrug-resistant mutants of
Pseudomonas aeruginosa overexpressing the active efflux
system mexA-mexB-oprM. Antimicrob Agents Chemother
43:287–291
123