Physiological and Molecular Plant Pathology 106 (2019) 23–29

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology

journal homepage: www.elsevier.com/locate/pmpp

Hydrogen peroxide protects pepper (Capsicum annuum L.) against pepper T

golden mosaic geminivirus (PepGMV) infections
Laura Mejía-Tenientea,b,1, Blanca A. Durán-Floresa,1, Irineo Torres-Pachecoa,
Mario Martín González-Chavirac, Rafael F. Rivera-Bustamanted, Ana A. Feregrino-Pereza,
Iza Pérez-Ramíreze, Nuria E. Rocha-Guzmánf, Rosalía Reynoso-Camachoe,
Ramón G. Guevara-Gonzáleza,∗
a
C.A. Ingeniería en Biosistemas, Facultad de Ingeniería, Universidad Autónoma de Querétaro, Campus Amazcala, Carretera a Chichimequillas S/N, Km 1, CP76265, El
Marqués, Querétaro, Mexico
b
C.A Biotecnología, Sustentabilidad e Ingeniería, Departamento de Ingeniería Agroindustrial, Universidad de Guanajuato, Campus Celaya-Salvatierra, Av. Mutualismo Esq.
Prolongation Rio Lerma S/N, Celaya, Guanajuato, 38060, Mexico
c
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Campo Experimental Bajío, Unidad de Biotecnología, Celaya-San Miguel de Allende, km 6,
CP38010, Celaya, Guanajuato, Mexico
d
Centro de Investigación y de Estudios Avanzados Unidad-Irapuato, Depto. Ingeniería Genética, Carretera Irapuato-León, Km. 9.6, Libramiento Norte, CP36821, Irapuato,
Guanajuato, Mexico
e
Programa de Posgrado de Alimentos del Centro de la República Mexicana, Facultad de Química, Universidad Autónoma de Querétaro, C.U Cerro de las Campanas, S/N,
Col. Las Campanas, CP76010, Querétaro, Querétaro, Mexico
f
Grupo de Investigación de Alimentos Funcionales y Nutraceuticos, Departamento de Ingenierías Química y Bioquímica, Instituto Tecnológico de Durango, Felipe Pescador
1830 Ote, 34080, Durango, Dgo, Mexico

A R T I C LE I N FO A B S T R A C T

Keywords: Hydrogen peroxide is an important signal molecule in plant defense against biotic and abiotic stress. Pepper
Geminiviruses golden mosaic virus (PepGMV) is a whitefly-transmitted geminivirus causing significant yield and quality losses
Plant defense in pepper and other horticultural crops in Mexico. Several pesticides have been used trying to control whiteflies
Hydrogen peroxide and thus, PepGMV disease in host crops. The present work examined the effect of exogenous application of
Elicitors
hydrogen peroxide (H2O2) on inducing resistance to PepGMV infection in pepper plants. Experiments were
Whiteflies
carried out under greenhouse conditions aiming to evaluate phenotypical, biochemical and molecular features in
Enzymatic and molecular studies
these pepper plants. Hydrogen peroxide at 6, 14 and 18 mM induced tolerance to PepGMV either by absence of
symptoms as well as by attenuating and/or delaying them. The protection observed was directly dependent on
the concentration of H2O2 sprayed on plants. Moreover, PepGMV DNA levels were inversely proportional to the
protection level. Enzymatic and gene expression profiles related with plant defense were induced in protected, in
comparison to susceptible control plants. Interestingly, the levels of some phenolic compounds were also as-
sociated with plant protection. Taking together, these results suggested that exogenous foliar applications of
H2O2 protect pepper plants against PepGMV infection inducing the plant host defense arsenal.

1. Introduction member of the genus Topocuvirus is transmitted by a treehopper and

The geminiviruses are a family of small, non-enveloped viruses with
single-stranded, circular DNA genomes of 2500–5200 bases. Insects as
whiteflies, leafhoppers, treehoppers and aphids transmit Geminiviruses.
Members of the genus Begomovirus are transmitted by whiteflies, those
in the genera Becurtovirus, Curtovirus, Grablovirus, Mastrevirus and
Turncurtovirus are transmitted by specific leafhoppers, the single
one member of the genus Capulavirus is transmitted by an aphid [1].
Genus Begomovirus is the most widespread and diverse worldwide,
causing crop losses ranging from 30 to 100% [2]. Pepper Golden Mosaic
Virus (PepGMV) is a whitefly-transmitted begomovirus widely dis-
tributed in Mexico, and considered as the major viral pathogen of
pepper (Capsicum annuum L.) in the country [3,4]. Yield losses ranging
from 20 to 100% have been observed in pepper fields affected by

∗
Corresponding author.
E-mail address: ramon.guevara@uaq.mx (R.G. Guevara-González).
1
Both authors contributed equal to this work.

https://doi.org/10.1016/j.pmpp.2018.11.008
Received 14 October 2018; Received in revised form 27 November 2018; Accepted 27 November 2018
Available online 29 November 2018
0885-5765/ © 2018 Elsevier Ltd. All rights reserved.
L. Mejía-Teniente et al.
PepGMV in Mexico [5–7]. There are reports that 75% of Mexican
producers use several synthetic pesticides trying to cope whiteflies to
diminish geminivirus infections, with dangerous toxic effects on both
environment and people [8]. Plants are frequently exposed to a range of
biotic and abiotic stresses. These environmental stresses can cause
biochemical alterations as generation of hydrogen peroxide (H2O2),
resulting in an early response of the plant defense mechanisms [9–11].
Hydrogen peroxide is a form of reactive oxygen species (ROS), which
are generated as a result of oxidative stress, and it is involved in the
control and regulation of biological processes, such as growth, cell
cycle, programmed cell death, hormone signaling, responses to biotic/
abiotic stress, and development [12]. The interplay between the ROS-
producing and ROS-scavenging pathways will determine the intensity,
duration and localization of the ROS signals [13]. Usually, high in-
tensity cellular signaling via ROS is generated by biotic stress, parti-
cularly in plant-pathogen interactions. However, this signaling cascade
can also be activated by the use of elicitors that induce an immune
defense response in plants [14,15]. Elicitor-induced plant signaling,
serves as a guide to a series of intracellular events that end in the ac-
tivation of transduction cascades and hormonal pathways, which
trigger induced resistance and consequently activate plant immunity to
environmental stresses [4]. Many substances have been discovered that
work as elicitors of host plant defense mechanisms [16]. Some ex-
amples are jasmonates, such as methyl jasmonate (MeJa) and jasmonic
acid (JA); other groups include salicylic acid (SA), benzothiadiazole
(BTH), Etephon, oligosaccharides such as chitosan, and hydrogen per-
oxide, among other compounds [12]. In a previous work, H2O2 exo-
genous applications, induced gene and enzymatic defense responses in
pepper plants cv. Benito without affecting plant performance [12].
Thus, the aim of the present study was to evaluate the protective effects
of pepper plants against PepGMV infection by exogenous foliar appli-
cations of H2O2. Our results are discussed related to plant defense re-
sponse and the levels of plant protection against PepGMV, as well as
possible applications in crop protection.
2. Materials and methods
2.1. Biological material
PepGMV-susceptible C. annuum cv. Don Benito was provided by
INIFAP-Guanajuato. PepGMV components A and B used in the study
were cloned in pBluescript [4]. For clarity, all experimental approaches
evaluated and specific times during the study are displayed in a time
line manner (Fig. 1).
2.2. Plant growth, PepGMV inoculation and H2O2 applications
Pepper plants were growth in a greenhouse of 500 m2 throughout
the experiments essentially as reported in Ref. [12]. Steiner solution
was used as fertilizer, and growth conditions for pepper plants were
according to previous work [12]. Foliar applications of H2O2 at 6, 14
and 18 mM, were carried out fortnightly during the cultivation (90
days) starting at 4–6 leaves stage plants. The volume applied on each
plant was as drop point of each concentration evaluated [12]. PepGMV
inoculation onto pepper plants was carried out by a biolistic procedure
according to Guevara-Olvera et al. [4]. Positive disease control plants
were treated with tap water and inoculated with PepGMV using a
biolistic procedure immediately after the first H2O2 application as
abovementioned [4]. Negative disease control plants were biolistically
mock-inoculated using pBluescript plasmid [4] and treated with tap
water or each of the same H2O2 treatments applied forthnightly; an-
other negative disease control group consisted in only applications of
H2O2 in the evaluated concentrations without pBluescript or PepGMV
inoculation. Pepper plants were incubated during 90 days under
greenhouse conditions. During the cultivation in order to avoid the
presence of natural whiteflies (likely carrying geminiviruses including
24
Physiological and Molecular Plant Pathology 106 (2019) 23–29
PepGMV), daily observations searching for whiteflies in the leaves and
in sticky screens traps distributed within the greenhouse, as well as
periodic applications (every 30 days) of confidor (Imidacloprid, Bayer
CropScience) were carried out according recommendations of the
manufacturer. Plant growth variables as height, basal stem diameter
and fruit yield per plant, were measured as indicators of plant perfor-
mance at 45 days post-start the cultivation for height and basal stem
diameter and at 90 dpi for the number, visual aspect and size of fruits
per plant according to Mejía-Teniente et al. [12]. The cv. Don Benito
produces mature fruits at 90 dpi in our greenhouse conditions with
natural illumination (photoperiod of 13 h light/11 h dark, temperature
between 25 and 28 °C, and relative humidity between 55 and 65%).
Symptoms were measured every day post-virus inoculation (dpvi) ac-
cording to a scale reported by Torres-Pacheco et al. [3], rated from 0 to
9 as: 0 = absence of symptoms; 1 = slight distortion of apical leaves
and visible yellow points on leaves exposed to light; 2 = visible yellow
points in isolated patches in apical leaves; 3 = isolated patches of
yellow points start to join forming a net on the leaf base of apical leaves;
4 = net of visible yellow spots is clearly formed; 5 = leaves curled in
their middle part; 6 = slight curving of leaves; 7 = crumpling leaves
distorted slightly; 8 = complete leaf distortion; and 9 = leaves of in-
fected plants smaller than control plants. The obtained results were
averaged from 20 plants for each treatment in three independent ex-
periments (60 plants in total).
2.3. PepGMV detection
Relative concentration of PepGMV at 45 dpvi was evaluated by
quantitative PCR (qPCR) as previously reported [17]. These experi-
ments were carried out by triplicate.
2.4. H2O2 detection
Quantitative detection of H2O2 in apical leaves of treated pepper
and control plants was carried out according to Mejía-Teniente et al.
[12]. Briefly, 100 μL of plant extract was mixed with Hydrogen Per-
oxide Substrate Solution (90 μL) containing ferrous iron and xylenol
orange (Hydrogen Peroxide Assay Kit, National Diagnostics Atlanta,
GA, USA), the blank was prepared in the same manner except that
100 μL of 0.05 M potassium phosphate (pH 7.0) was used instead of the
sample. The mixture was incubated at room temperature for 30 min.
The absorbance at 560 nm was measured for each sample and com-
pared with a standard curve made by measuring known hydrogen
peroxide concentrations. Experiments were performed in triplicate.
Samples of leaves of all treatments at 45 days before and immediately
after H2O2 application were collected and then daily during 5 days, to
detect H2O2 levels (i.e from 45 to 50 dpvi).
2.5. Total phenolics and flavonoids quantification
Pepper leaves of all treatments were collected in the same times as
mentioned for H2O2 measurements. Briefly, 50 mg of leaves were ex-
tracted with methanol for 24 h at 40 rpm and 25 °C; centrifuged at
4000g for 10 min; then methanol was removed by rotary evaporation,
and samples were stored in dark flasks until phenolics and flavonoids
determinations. Phenolics were assayed using the Folin-Ciocalteu
method [18], and flavonoids by the method of Feregrino-Perez et al.
[19]. Data analyses were carried out by triplicate.
2.6. PAL and CAT enzymatic activity determination
Determination of phenylalanine ammonia lyase (PAL) and catalase
(CAT) enzyme activities were carried out as described in Mejía-Teniente
et al. [12] in the same times for H2O2 measurements, total phenolics
and flavonoids aforementioned. CAT activity assays consisted of 1 mL of
plant extract and 1 mL of 0.022 M H2O2. The blank was prepared in the
L. Mejía-Teniente et al. Physiological and Molecular Plant Pathology 106 (2019) 23–29

Fig. 1. Time line of the experiments carried out in this study.

same manner except that 1 mL of 0.05 M potassium phosphate (pH 7.0)
was used instead of the sample. An aliquot of the extract was used to
determine protein content through the Bradford method [20], using
bovine serum albumin as standard. The enzyme-specific activity was
expressed as μmol of oxidized H2O2 per mg of protein, per minute (μmol
H2O2/mg protein/min). For PAL activity assays, plant extracts were
prepared similarly to CAT tests using 0.1 M borate buffer (pH 8.8). PAL
activity was determined spectrophotometrically at 290 nm by the for-
mation of trans-cinnamic acid (SIGMA) as the method described by
Gerasimova et al. [21] with some modifications. The standard curve
was performed using different concentrations of cinnamic acid. The
reaction mix contained 100 μL of plant extract and 100 μL of 60 μM L-
phenylalanine (MERCK, Naucalpan, Edo. Mexico, Mexico) solution.
Reaction mixtures were incubated at 37 °C for 1 h. In control samples,
borate buffer replaced the extract. The reaction was stopped by adding
50 μL 1 M trichloroacetic acid (J.T. Baker, Phillipsburg, NJ, USA).
Protein concentration was measured according to the method described
by Bradford [20]. Enzyme activity was expressed by the amount of
cinnamic acid produced in μmol/mg protein/h. All assays were carried
out by triplicate.
2.8. Downstream gene expression analysis
The expression pattern of some defense-related genes in pepper
plants at 45 dpvi was carried out by triplicate using qRT-PCR. Specific
primers to evaluate downstream gene expression to stress response in
the pepper plants are shown in Table 1. Total RNA was extracted using
TRIZOL® Reagent (Invitrogen) at 45 days post-first H2O2 application.
First chain of cDNA of each plant sample was obtained according to
manufacturer's instructions (Superscript One-Step RT-PCR System; In-
vitrogen, Carlsbad, CA). To amplify the genes a CFX96 Real Time
System (BIORAD Laboratories) using sybrgreen was used. Reaction
conditions for all the genes were: 5 s at 94 °C and 40 cycles of 5 s at
94 °C and 30 s at 60 °C.
2.9. Statistical analysis
All experiments throughout the study were arranged in a completely
randomized design, (P = 0.05). Data were subjected to analysis of
variance by the general linear models (GLM) procedure. Means com-
parison was done by Tukey's test with SAS/STAT® 9.1 software (SAS

2.7. HPLC determination of phenolic compounds Table 1

Sequences of primers used for analysis of downstream gene expression by qRT-
Plant extracts were obtained from leaves collected at 45 dpvi onto PCR in pepper plants.
the plants. Extracts were carried out with 5 mg in 5 mL methanol; Name Sequence (5’-3’) No. accession
samples were sonicated by 40 min and then filtered (0.025μ). The ex- GenBank
tracts were injected in a HPLC-DAD (Waters 600), equipped with au-
CaPR1-F CTTTTGCTATATTTCACTCAACACAAGCCC AF053343
tomated injection (Waters 717 plus) and detector UV/Vis (Waters CaPR1-R TGCTGGATTTATTTTCCTTTTAACACATGA
2487). Separation was carried out during 67 min in a phenomenex CaWRKYd -F GCCGATTAAACCCGAAAAAT GQ249255.1
column ODS-C18 (250 × 4.6 mm, 5 μm). 10 μL of each sample were CaWRKYd -R TGATCATGTCCTCCTGGTGA
injected and separated in a flux of 1 mL/min. Mobile phase in gradient CaWRKY1 -F GTTTTAGATCATTGGACTCACCTG AY229992.1
CaWRKY1 -R TTGATGGTTGTGGACACCCT
elution consisted in: (A) formic acid-water (1:99 v/v), and acetonitrile, CaMKK1-F GATAGTGACCCGGAGATTCG GQ249256.1
in a relationship (A/B) of 98/2 at 0 min, 68/32 at 30 min, 45/55 at CaMKK1-R AAGTGTCCGGATCAAACCTT
48 min, 5/95 at 53 min and 98/2 at 57 min. Detection was carried out CaMK1-F ATGGTTGATGCAAATATGGGT AF247135
measuring absorbance at 260–320 nm. The standard compounds for CaMK1-R ACGGAGAAGCTGATACATGAA
CaMK2-F ATGGATGGTCCAGCTCAGCAA AF247136.1
chlorogenic acid, epicatechin, hesperidin, cumaric acid, caffein acid,
CaMK2-R CACGCAACGTTCTCTTGGCAT
epigalocatechin palate, rutin, sinapic acid, elagic acid, vanillin, ros- CaNPR1-F AGGAAGAAGATGGCTGATGC DQ648785.1
marinic acid, quercetin and resveratrol used were purchased from CaNPR1-R CAAGTCATCAGCATCCATGA
SIGMA-ALDRICH. All assays were carried out by triplicate. β-TUB-F GGAAGTTATTTGCGACGAGCACGGC EF495259.1
β-TUB-R CGGGGATCTGCAGCGCACATCATAT

25
L. Mejía-Teniente et al. Physiological and Molecular Plant Pathology 106 (2019) 23–29

Table 2
Effect of hydrogen peroxide foliar applications on percentage of symptomatic
plant disease severity, and days for symptoms appearance (dpvi) after PepGMV
inoculation at 45 days post-virus inoculation (dpvi).
Treatment % Symptomatic Severity Symptoms
plants average+ appearance
(dpvi)

H2O2 6 mM 20b 3b 11a

H2O2 14 mM 10c 2b 12a
H2O2 18 mM 0d 0c ND
Positive control* 100a 8a 5b
Negative controls:**
pBluescript (alone or 0d 0c ND
with H2O2 6, 14 or
18 mM)***
H2O2 6 mM 0d 0c ND
H2O2 14 mM 0d 0c ND
Fig. 2. Effect of H2O2 applications on plant height of pepper at 45 dpvi. The
H2O2 18 mM 0d 0c ND
evaluated concentrations were as shown in the figure. In the case of 0 mM, for
simplicity the disease negative control treated only with tap water is shown (the Results are from 20 plants per treatment in three independent experiments
rest of the H2O2 treatments displayed the same results as this 0 mM treatment, (total of 60 plants analyzed by treatment).+Based on the scale of severity re-
data not shown). ported by Torres-Pacheco, 1996. * Positive control, plants treated with PepGMV
and no H2O2. ** Negative controls, no-PepGMV inoculated plants and sub-
Institute Inc. 2004. SAS/STAT® 9.1 User's Guide. Cary, NC: SAS Institute mitted to H2O2 applications; and in the case of pBluescript, instead PepGMV
Inc). DNA, pBluescript was biolistically inoculated and tap water applications used
during the study. *** pBluescript treatment (No PepGMV-inoculated) and
treated with each of the H2O2 concentrations evaluated, displayed the same
3. Results result as the one shown for pBluescript only. Different letter in each column
means significant difference Tukey's test (P = 0.05). ND, not determined be-
cause symptoms did not present in at least 45 dpvi.
3.1. Plant performance and symptomatology in H2O2 treated pepper plants

The treatments of H2O2 applications in the study did not display
significant change in basal stem diameter and number, visual aspect
and size of fruits (not shown) on the pepper plants during all the ex-
periments; however plant height was significantly increased in all cases
(Fig. 2). Moreover, typical symptomatology in PepGMV-infected and
H2O2-treated pepper plants at 45 dpvi was either absent (rated = 0) in
treatment 18 mM or slight and delayed in at least one week (rate
average 2) in treatments 6 and 14 mM (Fig. 3). Positive disease control
plants displayed typical symptoms since 5 dpvi (rate average 6, not
shown) and reaching the highest severity rate in the study (rate average
8) at 45 dpvi (Table 2), maintaining this severity until 90 dpvi (not
shown), as expected according to previous reports [22]. Negative
disease control plants displayed no symptoms during all the incubation
time (rate 0). The higher concentration of H2O2 treatment (18 mM) did
not show any symptomatic plant (rated = 0) during the experiments
carried out in this study at 45 dpvi (Table 2). Thus, H2O2 applications in
the three concentrations evaluated displayed significant reduction in
symptomatic plants during all the experiments in a dose dependent
manner.
3.2. PepGMV detection throughout inoculated plants
In order to verify the PepGMV presence within the inoculated plants
regardless symptoms presence, virus detection by a specific qPCR assay

Fig. 3. Typical phenotype at 30 dpi of pepper

plant treated with hydrogen peroxide and in-
oculated with PepGMV. Panel A, symptomatic
plant treated with H2O2 18 mM; Panel B,
asymptomatic plant treated with H2O2 18 mM;
panel C, positive control with typical PepGMV
symptoms; panel D, mock-inoculated asympto-
matic plant as negative control. Control plants
were sprayed with water, and inoculated with
PepGMV or Bluescript plasmid (mock-inocula-
tion), for positive or negative controls, respec-
tively. Images in thr figure correspond at 30
days post-PepGMV inoculation (dpi).

26
L. Mejía-Teniente et al.
Fig. 4. Relative level of Pepper golden mosaic virus (PepGMV) in apical and
basal leaves of pepper plants treated or not with H2O2 at 45 dpvi. Primers for
Rep gene were used to determine the level of PepGMV and primers for 18 S RNA
plant gene were used for normalization. C (−), disease negative control in-
oculated with pBluescript and no H2O2 treated. C (+), disease positive control
consis&ng in PepGMV inocula&on and no H2O2 treatment. Data were obtained
by triplicate and the bars indicate the standard deviation of three measure-
ments. (S), symptomatic plants; (A), asymptomatic plants.
was carried out at 45 dpi in plants treated or not with H2O2 (Fig. 4). As
shown in Fig. 4, both in symptomatic and asymptomatic plants
PepGMV DNA was detected both in apical and basal leaves, suggesting
the systemic presence of the pathogen within the inoculated plants. In
addition, the PepGMV levels were lower in asymptomatic in compar-
ison to symptomatic plants. Meanwhile, in symptomatic plants treated
with H2O2, the PepGMV levels were significantly lower in comparison
to disease positive controls (Fig. 4).
3.3. H2O2 levels in pepper plants
Based on the result that at 45 dpvi the positive disease control plants
reached the highest severity by PepGMV infections, an analysis of H2O2
levels was carried out at that time in the pepper plants trying to cor-
relate them with plant protection (Fig. 5). This analysis was accom-
plished in apical leaves of pepper plants following the evaluation of
H2O2 every day during the next 5 days after a H2O2 application (i.e,
from day 45–50 dpvi). As shown, H2O2 levels were higher in H2O2-
treated than in control plants, in a dose dependent manner (Fig. 5).
Moreover, H2O2 levels displayed rapid and significant endogenous
H2O2 induction since 5 min after H2O2 applications regardless the
concentration (Fig. 5). However, H2O2 levels were significant higher in
a dose depending manner (Fig. 5).
27
Physiological and Molecular Plant Pathology 106 (2019) 23–29
Fig. 6. Total phenolics and flavonoids levels from 45 (0 and 5 min), 46 (1 day)
and 50 (5 days) post-virus inoculation in pepper plants treated or not with
H2O2. The control treatment means the negative disease control inoculated
with pBluescript and treated with tap water. The bars indicate the standard
deviation of three measurements. The samples consisted in apical leaves (see
materials and methods).
3.4. Phenolics and flavonoids levels in pepper plants
Total levels of phenolics and flavonoids, were evaluated at 45 (at 0
and 5 min after H2O2 application), 46 (day 1 after H2O2 application)
and 50 (day 5 after H2O2 application) dpvi. Both types of compounds
displayed significant increase during the evaluated days after H2O2-
application in comparison to control plants (Fig. 6). Regarding specific
phenolics and flavonoids detected by HPLC, chlorogenic acid, epica-
techin, elagic acid and rosmarinic acid displayed significant increases in
H2O2-treated in comparison to control plants (Table 3). Interestingly,
chlorogenic and rosmarinic acid levels were strongly associated to
asymptomatic plants, likewise, epicatechin and elagic acid were related
to milder symptomatic plants (Severity rate 2) in comparison to disease
Fig. 5. H2O2 endogenous levels from 45 (0 and
5 min) to 50 (from days 1–5 of the experiment)
dpvi in pepper plants treated with exogenous
H2O2. Control indicates, the disease negative
control inoculated with pBluescript and treated
with tap water. The bars indicate the standard
deviation of three measurements. The samples
consisted in apical leaves (see materials and
methods).
L. Mejía-Teniente et al. Physiological and Molecular Plant Pathology 106 (2019) 23–29

Table 3
Levels of specific phenolic compounds in symptomatic and asymptomatic pepper plants treated with exogenous H2O2 foliar applications at 45 days post-PepGMV
inoculation (dpvi).
Compound (ug/mL) Symptomatic (Severity rate 2)** Asymptomatic (14 mM)*** Asymptomatic (18 mM)*** Positive Control (Severity rate 8)

Chlorogenic acid 2817.51b* 2928.55a 2931.73a 2712.3c

Epicatechin 890.48a 883.12a 880.91a 853.87b
Caffeic acid 16.48a 16.52a 16.29a 16.91a
Elagic acid 20.7a 11.36b 10.5b 11.42b
Rosmarinic acid 6.56b 7.23a 7.14a 6.08c
Quercetin 20.41a 20.75a 20.88a 20.14a
Resveratrol 41.86a 40.89a 41.78a 40.74a

*Different letter in each row means significant difference Tukey's test (P = 0.05). Plant samples were taken at 45 dpvi. Results are the average of three samples for
each treatment. **Symptomatic plants treated with H2O2 14 mM and PepGMV inoculated.***Asymptomatic (Severity rate 0) treated with H2O2 14 or 18 mM and
PepGMV inoculated. Positive Control, plants treated with tap water applications and PepGMV inoculation.

positive controls (Severity rate 8). These results might suggest some
relationship for these compounds with pepper protection to PepGMV
infections.
3.5. PAL and CAT enzymatic activities
PAL and CAT activities were evaluated in the same samples of apical
leaves from pepper plants mentioned for total phenolics and flavonoids
analysis. PAL activity was significantly induced since the 5 min after
H2O2 application in a dose dependent manner (Fig. 7). The case of CAT
activity displayed significant inductions after 1-day post H2O2-appli-
cation, especially in the doses of 14 and 18 mM (Fig. 7).
only asymptomatic plants was studied and compared with positive and
negative disease controls (Fig. 8). As shown in Fig. 8, per se H2O2
18 mM induced the gene expression of mkk1, mk1, mk2, npr1 and pr1,
and repressed the expression of transcription factors wrkyd and wrky1
in the negative disease control plants at 45 dpvi. Moreover, PepGMV
inoculated and H2O2 18 mM-treated plants (all asymptomatic to
PepGMV) displayed a similar gene expression pattern in comparison to
the latter mentioned negative disease control (Fig. 8). Interestingly, the
positive disease control plants showed significant increase in all the
evaluated genes but mk2.
4. Discussion

3.6. Downstream defense genes expression in pepper plants
The expression of some MAP kinase pathway genes as well as for
wrkyd, wrky1, npr1 and pr1 was evaluated at 45 dpi in symptomatic
and asymptomatic pepper plants (Fig. 8). In this analysis only the gene
expression patterns of the treatment with H2O2 18 mM that displayed
Fig. 7. PAL and CAT activities from 45 (0 and 5 min), 46 (1 day) and 50 (5
days) post-virus inoculation in pepper plants treated or not with H2O2. The
control treatment means the disease negative control inoculated with
pBluescript and treated with tap water. The bars indicate the standard deviation
of three measurements. The samples consisted in apical leaves (see materials
and methods).
Pepper plants protection against PepGMV disease was accomplished
with all the H2O2 treatments evaluated in this work. When plants dis-
played symptoms, these were milder and delayed in appearance time in
comparison to positive disease control plants (Figs. 3 and 4, and
Table 2). These results suggested that exogenous applications of H2O2
induced defense arsenal in pepper plants to cope against PepGMV in-
fections. Interestingly, transgenic tobacco plants expressing CchGLP
gene encoding a Mn-SOD induced higher endogenous H2O2 levels and
also displayed resistance to geminivirus diseases, including PepGMV
[4]. The asseveration of inducing the arsenal defense in H2O2-treated
pepper plants was evaluated by measuring endogenous H2O2 levels in
these plants in a kinetic study from 45 to 50 dpvi; in this time in our
study, all positive disease control plants and H2O2 6 and 14 mM-treated
plants expressed PepGMV symptoms. H2O2 accumulation was sig-
nificantly induced since the 5 min after the H2O2 application at 45 dpvi
and throughout at least 5 more days (50 dpvi; see Fig. 5). These results
agree with those reported in pepper plants cv. Don Benito for H2O2
applications, where plant performance was evaluated after these
treatments [12]. In the latter study, fortnightly H2O2-treated plants
displayed H2O2 induction during 30 days post-application in cv. Don
Benito, although with significant diminish at 15 dpi. Thus, in the pre-
sent study fortnightly H2O2-application was carried out to maintain a
higher level of endogenous H2O2, trying to increase plant protection
and evaluate effects on performance. Total phenolics and flavonoids, as
well as PAL and CAT activities, were found to be significant higher in
H2O2-treated than in negative disease control plants (Figs. 6 and 7).
Moreover, downstream gene expression of MAP kinases pathway, npr1
and pr1, displayed induction by H2O2 applications (Fig. 8). The case of
pr-1 was also reported as induced in C. annuum L. (cv. Sonora Anaheim)
treated with benzothiadiazole (BTH), which showed PepGMV protec-
tion, however BTH caused some plant symptoms without affecting plant
productivity [23]. In the present study plant performance was not af-
fected by H2O2 applications, only a significant increase in plant height
at 45 dpvi was shown (Fig. 2). These significant increases in height
were also displayed at 90 dpvi (not shown). The productivity of these
plants including fruit yield and quality (visual aspects and size of fruits)
were also unaffected by H2O2 applications (data not shown). Currently

28
L. Mejía-Teniente et al.
Fig. 8. Gene expression analysis of MAP kinase pathway genes (mkk1, mk1 and mk2), wrkyd, wrky1, npr1 and pr1 in symptomatic (treated with H2O2 14 mM) and
asymptomatic (treated with 18 mM) pepper plants. Β-tubulin gene was used as housekeeping gene to normalize the data. The results are the average of three
measurements, and bars indicate standard deviation.
in our group, studies with deep-sequencing strategies are in progress in
PepGMV inoculated and H2O2-treated pepper plants (asymptomatic and
symptomatic), trying to unravel in more detail the molecular mechan-
isms of pepper protection to PepGMV caused by H2O2 exogenous ap-
plications described in this study. Taken together, these phenotypical,
biochemical and molecular results suggested, that the fortnightly H2O2
treatments evaluated, induced defense mechanisms that at least par-
tially, might explain the resistance to PepGMV infection showed in the
pepper plants studied, without affecting performance under greenhouse
conditions. This strategy of “controlled elicitation” could be included as
a part of pest management of PepGMV infections in greenhouse pro-
ductions of pepper as suggested by other authors [24]. Finally, it will be
interesting to evaluate the effects of these H2O2 treatments carried out
in open field cultivation in order to extend the possibilities of this
strategy outside greenhouse.
Acknowledgements
Authors thanks to FORDECYT (193512), SAGARPA-CONACYT
(2012-02-187907), and Ciencia Básica SEP-CONACYT-2016 (283259),
for support provided to this research.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.pmpp.2018.11.008.
References
[1] F.M. Zerbini, R.W. Briddon, A. Idris, D.P. Martin, E. Moriones, J. Navas-Castillo,
R. Rivera-Bustamante, P. Roumagnac, A. Varsani, I.R. Consortium, ICTV virus
taxonomy profile: geminiviridae, J. Gen. Virol. 98 (2017) 131–133.
[2] M. Lugo, U. Guzmán, E. García, J. Félix, Geminivirus transmitted by white fly
(Bemisia tabaci) in tomato, in the agricultural valley of Culiacan, Sinaloa, Rev. mex.
fitopatol 29 (2011) 109–118.
[3] I. Torres-Pacheco, J.A. Garzón-Tiznado, J.K. Brown, A. Becerra-Flora, R.F. Rivera-
Bustamante, Detection and distribution of geminiviruses in Mexico and the
southern United States, Phytopathology 86 (1996) 1186–1192.
[4] L. Guevara-Olvera, M. Ruíz-Nito, R. Rangel-Cano, I. Torres-Pacheco, R. Rivera-
Bustamante, C. Muñoz-Sánchez, M. González-Chavira, A. Cruz-Hernandez,
R. Guevara-González, Expression of a germin-like protein gene (CchGLP) from a
geminivirus-resistant pepper (Capsicum chinense Jacq.) enhances tolerance to ge-
minivirus infection in transgenic tobacco, Physiol. Mol. Plant Pathol. 78 (2012)
45–50.
[5] Y. Godínez-Hernández, J.L. Anaya-López, R. Díaz-Plaza, M. González-Chavira,
I. Torres-Pacheco, R.F. Rivera-Bustamante, R.G. Guevara-González,
Characterization of resistance to pepper huasteco geminivirus in chili peppers from
Yucatán, México, HortScience 36 (2001) 139–142.
[6] J. Anaya-López, I. Torres-Pacheco, M. González-Chavira, J. Garzón-Tiznado,
J. Pons-Hernandez, R. Guevara-Gonzalez, C. Muñoz-Sánchez, L. Guevara-Olvera,
R. Rivera-Bustamante, S. Hernandez-Verdugo, Resistance to geminivirus mixed
29
Physiological and Molecular Plant Pathology 106 (2019) 23–29
infections in Mexican wild peppers, Hortscience 38 (2003) 251–255.
[7] J.L. Anaya-López, E. Pérez-Mora, I. Torres-Pacheco, M. González-Chavira,
C. Muñoz-Sánchez, L. Guevara-Olvera, R. Guevara-González, N. Ochoa-Alejo,
R. Rivera-Bustamante, Inducible gene expression by Pepper huasteco virus in
Capsicum chinense plants with resistance to geminivirus infections, J. Indian Dent.
Assoc. 27 (2005) 276–282.
[8] R.E. Ruiz Nájera, J.A. Ruiz Nájera, S. Guzmán Gonzalez, E.D.J. Pérez Luna, Manejo
y control de plagas del cultivo de tomate en Cintalapa, Chiapas, México, Rev. Int.
Contam. Ambient. 27 (2011) 129–137.
[9] S.J. Neill, R. Desikan, A. Clarke, R.D. Hurst, J.T. Hancock, Hydrogen peroxide and
nitric oxide as signalling molecules in plants, J. Exp. Bot. 53 (2002) 1237–1247.
[10] T.S. Gechev, J. Hille, Hydrogen peroxide as a signal controlling plant programmed
cell death, J. Cell Biol. 168 (2005) 17–20.
[11] A. Pitzschke, H. Hirt, Mitogen-activated protein kinases and reactive oxygen species
signaling in plants, Plant Physiol. 141 (2006) 351–356.
[12] L. Mejía-Teniente, F.D.D. Durán-Flores, A.M. Chapa-Oliver, I. Torres-Pacheco,
A. Cruz-Hernández, M.M. González-Chavira, R.V. Ocampo-Velázquez,
R.G. Guevara-González, Oxidative and molecular responses in Capsicum annuum L.
after hydrogen peroxide, salicylic acid and chitosan foliar applications, Int. J. Mol.
Sci. 14 (2013) 10178–10196.
[13] R. Mittler, S. Vanderauwera, M. Gollery, F. Van Breusegem, Reactive oxygen gene
network of plants, Trends Plant Sci. 9 (2004) 490–498.
[14] L. Mejía-Teniente, I. Torres-Pacheco, M.M. González-Chavira, R.V. Ocampo-
Velazquez, G. Herrera-Ruiz, A.M. Chapa-Oliver, R.G. Guevara-González, Use of
elicitors as an approach for sustainable agriculture, Afr. J. Biotechnol. 9 (2010)
9155–9162.
[15] D. Duran-Flores, M. Heil, Damaged-self recognition in common bean (Phaseolus
vulgaris) shows taxonomic specificity and triggers signaling via reactive oxygen
species (ROS), Front. Plant Sci. 5 (2014) 585.
[16] L. García-Mier, R.G. Guevara-González, V.M. Mondragón-Olguín, B. Del Rocío
Verduzco-Cuellar, I. Torres-Pacheco, Agriculture and bioactives: achieving both
crop yield and phytochemicals, Int. J. Mol. Sci. 14 (2013) 4203–4222.
[17] J. Carrillo-Tripp, E. Lozoya-Gloria, R.F. Rivera-Bustamante, Symptom remission
and specific resistance of pepper plants after infection by Pepper golden mosaic
virus, Phytopathology 97 (2007) 51–59.
[18] V.L. Singleton, R. Orthofer, R.M. Lamuela-Raventós, Analysis of total phenols and
other oxidation substrates and antioxidants by means of folin-ciocalteu reagent,
Methods Enzymol. (1999) 152–178 Elsevier.
[19] A.A. Feregrino-PéRez, L.C. Berumen, G. García-Alcocer, R.N.G. Guevara-Gonzalez,
M. Ramos-Gomez, R.A. Reynoso-Camacho, J.A. Acosta-Gallegos, G. Loarca-PiñA,
Composition and chemopreventive effect of polysaccharides from common beans
(Phaseolus vulgaris L.) on azoxymethane-induced colon cancer, J. Agric. Food
Chem. 56 (2008) 8737–8744.
[20] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem.
72 (1976) 248–254.
[21] N. Gerasimova, S. Pridvorova, O. Ozeretskovskaya, Role of L-phenylalanine am-
monia Lyase in the induced resistance and susceptibility of sotato plants, Appl.
Biochem. Microbiol. 41 (2005) 103–105.
[22] A. Barrera-Pacheco, A.D.J. Joaquin-Ramos, I. Torres-Pacheco, M.M. Gonzalez-
Chavira, M.C.I. Perez-Perez, L. Guevara-Olvera, R.G. Guevara-Gonzalez, Analysis of
transcriptional expression induced in Capsicum chinense BG-3821 under conditions
of biotic and abiotic stress, Agrociencia 42 (2008) 95–106.
[23] D. Trejo-Saavedra, M. García-Neria, R. Rivera-Bustamante, Benzothiadiazole (BTH)
induces resistance to Pepper golden mosaic virus (PepGMV) in pepper (Capsicum
annuum L.), Biol. Res. 46 (2013) 333–340.
[24] G. Cardenas-Manríquez, I. Vega-Muñoz, A. Villagómez-Aranda, M. León-Galvan,
A. Cruz-Hernandez, I. Torres-Pacheco, R. Rangel-Cano, R. Rivera-Bustamante,
R. Guevara-Gonzalez, Proteomic and metabolomic profiles in transgenic tobacco (N.
tabacum xanthi nc) to CchGLP from Capsicum chinense BG-3821 resistant to biotic
and abiotic stresses, Environ. Exp. Bot. 130 (2016) 33–41.