Characterisation of fungal

symbionts and microbial

communities of
Austroplatypus incompertus
(Platypodinae) and other
Australian ambrosia beetle species

Robert Mueller
Hawkesbury Institute for the Environment
Western Sydney University

A thesis submitted for the degree of

Doctor of Philosophy

June 2019
 Statement of Authentication

The work presented in this thesis is, to the best of my knowledge and
belief, original except as acknowledged in the text. I hereby declare that
I have not submitted this material, either in full or part, for a degree at
this or any other institution.

4th of June, Robert Mueller

 Acknowledgements

There are a lot of people that deserve recognition for their support in
support me throughout my candidature and I apologise to the people who
I forgot to the mention.
Firstly, I would like to acknowledge my advisors, Associate Professor Dr
Markus Riegler, Dr Shannon M. Smith and Associate Professor Jeff R.
Powell. Without their guidance, countless discussions and patience I could
not step confident into the academic world.
The PhD candidature is a rocky journey and I can say that without
the support of my fellow colleagues, who also went on this road trip
with me, I would have given up several times. Therefore, I would like
to thank Coline Deveautour, Jonathan Finch, Elle McDonald, Johanna
Pihlblad, Marvin, Johanna Wong, Namraj Dhami, Desi Quintans, Laura
Castaneda-Gomez, Leah Laws, Rohan Riley, Jinyan Yang, Anthea Chal-
lis, Anita Wesolowski , Nicola Hanrahan, Dushan Kumarathunge, Sachin
Chavan, Deane Woruba, Jessica Rigg, Jeff Chieppa, Donovin Coles, Jen-
nifer Peters, Alice Gauthey and Alexis Renchon. Special thanks goes also
to James Bickerstaff, who supported me in the lab work and fieldwork,
as well as continuing the reseach in Australian ambrosia beetles. I would
also like to thank my office mates, Timothy Sutton, Olivia Bernauer,
Alihan Katlav, Andrew Gherlenda, Lena Schmidt and Aidan Hall for their
support and for keeping up with me in such a tiny space.
Of course, I can not forget to mention the other people, who made my 3
years in Richmond so enjoyable and would like to start with Alex Watson-
Lazowski, Agnieszka and Norbert Klause, Laura Brettell, Anne Griebel,
Casey Hall and Rebecca Vandegeer. Furthermore, special thanks to Ger-
ard Devine and Daniel Metzen for our awesome programming sessions and
brainstorming. I hope FriPy, our weekly Python meeting will continue. I
would also like to thank Marcus Klein for his advice in the molecular lab
and Thomas Jeffries, Jennifer Morrow and Alexie Papanicolaou for the
fruitful discussions about microbiome analysis and bioinformatics.
Last but not least, I would like to thank my family for their countless
support and love and especially my grandpa, without who I would not
have pursued a career in biology.
Thanks a lot to all the people who supported me throughout this journey
and I know for sure without you it would have not been possible.
 Abstract

Insects are the most diverse taxonomic class and live often in a tight sym-
biotic associations with a microbial cosmos that is expected to be even
more diverse. One of these symbioses is fungal farming, the ability to
propagate, cultivate and harvest fungi as a primary food source. This
ability evolved independently in three major insect orders, attine ants,
macrotermitine termites and ambrosia beetles. While many studies have
been conducted on the former two orders, the diversity and mechanisms of
fungal farming in ambrosia beetles are less understood. Ambrosia beetles
include two subfamilies, Scolytinae (bark beetles) and Platypodinae (pin-
hole borers). Platypodinae species are almost all fungal famers evolved
roughly 90 million years ago, and fungal farming is likely to have evolved
once in this lineage. Therefore, they possibly constitute the oldest lineage
of fungal farming insects, while fungal farming in Scolytinae evolved mul-
tiple times and is much younger (∼ 50 million years). There are 1,400
species of described Platypodinae species, however less than 1% of their
fungal associates have been described. The diversity lurking in tropical
biogeographic regions of South America, Asia and Australia is expected
to be large, and this, therefore, creates a great opportunity to discover
and describe new species in these regions.
The aim of this thesis was to contribute to a better understanding of the
fungal farming in Platypodinae by investigating the microbial community
of four Australian platypodine species. So far 46 Platypodinae species
have been recorded for this continent, however none of their fungal or
bacterial partners have been formally described.
The first experimental data chapter of this thesis investigated the only
eusocial beetle, Austroplatypus incompertus, which is also a basal lin-
eage within the tribe Platypodini, and two more derived species, Platypus
semigranosus and Platypus subgranosus. To date there have been a few
speculations about its fungal symbionts without any systematic attempt
of their characterisation. The chapter tested the hypothesis that these
beetle species farm fungal species within the order of Ophiostomatales.
An extensive sampling regime was conducted for A. incompertus beetles
emerging from trees across a large part of its species range in eastern Aus-
tralia (mostly in New South Wales, NSW). Culture-dependent methods
and selective media were used to obtain pure cultures of fungal associates.
For P. semigranosus fungi were isolated from beetles originating from an
infested tree in southern NSW, and fungi previously isolated from Tas-
manian P. subgranosus became available for characterisation. Three new
Raffaelea species, were described: Raffaelea kentii associated with A. in-
compertus and a closely related species, Raffaelea kilii, associated with
P. subgranosus. Raffaelea spirulatus with distinct spiral hyphal forma-
tions was described from P. semigranosus. These three new Raffaelea
species grouped with the Raffaelea sensu stricto clade, which also con-
tains Raffaelea species from other Platypodinae. Through the sampling
of ancient and more derived platypodine species it was demonstrated that
the evolutionary age of beetle lineages did not influence the identity of
their Raffaelea fungi. Furthermore, growth experiments conducted with
these fungal isolates revealed that they are fairly slow growing, and that
they have a negative response to ethanol contained in the growth sub-
strate. These characteristics match the ecological niche requirements for
these fungi.
The second experimental data chapter characterised the fungal and bac-
terial communities of A. incompertus spanning its distribution, approx-
imately 1,000 km along the Great Dividing Range of eastern Australia.
Targeted PCR was used to detect the previously described primary fungal
symbiont Raffaelea kentii and high-throughput amplicon sequencing was
used to characterise fungal and bacterial communities of beetles. For the
analyses emerging beetles were collected from individual galleries, each
established by a foundress female and her offspring, across trees and sites.
The aim was to understand the relative importance of beetle characteris-
tics (genetic relationship and presence of R. kentii ) and habitat variation
(tree characteristics and spatial positions) on beetle-associated microbial
communities. The data demonstrated that the spatial position of the
colonised trees within a site was a strong predictor for the fungal commu-
nity composition and structure. Furthermore, it was demonstrated that
the northernmost A. incompertus population had a distinct mitochondrial
lineage, but harboured microbial communities that were indistinguishable
from populations further south. The previously described fungal associate
R. kentii was not detected in all beetles, but this did not influence the
presence and relative proportions of other microbiota. The relative effects
of beetle family relationships and host trees on microbial diversity has still
to be tested across multiple galleries inhabiting the same tree and across
trees .
The third experimental data chapter investigated the fungal and bacterial
associations of another ancient lineage within the Platypodinae occurring
within Australia, Notoplatypus elongatus, basal to the Tesserocerini tribe.
The biology of this platypodine is even more elusive than the one of A.
incompertus, and mostly based on personal communication with now re-
tired forest entomologist Deborah Kent and our personal observations.
The adult beetles of this species are hypothesized to start galleries in
wounds at the base of living trees. The larvae then excavate a vertical
tunnel towards the top of trees where they complete their development.
The aim of this chapter was to characterise the microbiota associated with
N. elongatus. For this, fungi were isolated and cultured from the gut and
the surface of beetle larvae from one infested tree, sequence-typed and
characterised in growth experiments. Furthermore, culture independent
next generation amplicon-sequencing techniques were used to investigate
the diversity of fungal and bacterial associates within the gut of beetle lar-
vae. This lead to the discovery of two novel Raffaelea species (including
the presence of these two within single larvae) and several yeast species.
Furthermore, highly abundant bacterial taxa within the Rhodospirillales,
including one highly prevalent Gluconacetobacter bacterium, were found.
These bacteria may have beneficial effects on the larvae that develop in
nutrient poor environments and play an important role in the beetles
biology. Further research is required to investigate their interactions with
the two isolated Raffaelea species and their host.
This thesis is the first systematic analysis and characterisation of the fun-
gal symbionts and the microbiome of Australian Platypodinae species. It
provides a first insight in the microbial community diversity and mech-
anisms shaping these communities in two ancient and two more derived
ambrosia beetle species, and therefore constitutes an important contribu-
tion to the study of the ecology and evolution of ambrosia beetles.
 Preface

This PhD thesis consists of five chapters. The thesis introduction (Chap-
ter 1) is a literature review and sets out the conceptual framework for the
thesis, with the identification of knowledge gaps, leading to the formu-
lation of the scope and aims of the research. Chapters 2, 3 and 4 form
experimental data chapters. These chapters are kept in manuscript for-
mat so that they can be submitted to peer-reviewed journals in the near
future. For this reason the introductory sections of each of these three
chapters may include some repetition of content across these chapters,
while the questions, experiments and results across the three chapters are
distinct. Chapter 5 highlights as thesis discussion the findings of all exper-
imental work, places the findings in the wider research context, discusses
limitations and provides an outlook and recommendations for future work.
I am the lead author on all the chapters of the thesis, and have been in-
volved in the conceptualisation of individual thesis chapters together with
Markus Riegler and Shannon Smith. I have collected and analysed all data
and results presented in this thesis under supervision of Markus Riegler,
Jeff Powell (both at Hawkesbury Institute for the Environment, Western
Sydney University, Australia) and Shannon Smith (previously at HIE,
now at Macquarie University, Australia), with the contribution of James
Bickerstaff to some fieldwork and lab work of the COI haplotype analyses
of A. incompertus. Wilhelm de Beer (Forestry and Agricultural Biotech-
nology Institute, University of Pretoria, South Africa) has contributed
with his taxonomic and phylogenetic expertise to the development of the
first experimental data chapter. Furthermore, I have received very valu-
able advice from Deborah Kent about the beetles' biology and ecology.
My PhD project and scholarship was supported by a grant of the Aus-
tralian Biological Resources Study awarded to Markus Riegler (primary
investigator) and Shannon Smith (postdoctoral research fellow).
Contents

1 General Introduction 1
1.1 Insect symbiosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.2 High-throughput sequencing and accelerated discoveries in the world
of microbes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.3 Agriculture in insects . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.3.1 Ants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.3.2 Termites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.3.3 Ambrosia beetles . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.3.3.1 Scolytinae . . . . . . . . . . . . . . . . . . . . . . . . 7
1.3.3.2 Platypodinae . . . . . . . . . . . . . . . . . . . . . . 7
1.3.3.3 Ambrosia fungi of Platypodinae and Scolytinae . . . 8
1.3.3.4 Biosecurity and ambrosia beetles . . . . . . . . . . . 10
1.4 Aims and scope of the thesis . . . . . . . . . . . . . . . . . . . . . . . 13

2 Fungal farming down under: characterisation and description of

three new Raffaelea species (Ophiostomatales) isolated from three
Australian ambrosia beetles (Platypodinae) with different life his-
tory traits 15
2.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
2.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.3 Material and methods . . . . . . . . . . . . . . . . . . . . . . . . . . 21
2.3.1 Collection of A. incompertus and fungal isolation . . . . . . . 21
2.3.2 Isolates of Raffaelea sp. from Platypus semigranosus and Platy-
pus subgranosus . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.3.3 Growth rate, morphology and microscopy . . . . . . . . . . . 22
2.3.4 Ethanol response assay . . . . . . . . . . . . . . . . . . . . . . 23
2.3.5 DNA extraction and PCR amplification . . . . . . . . . . . . . 23
2.3.6 Phylogenetic analyses . . . . . . . . . . . . . . . . . . . . . . . 24

i
 2.4 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
2.4.1 Molecular characterisation of the Raffaelea isolates . . . . . . 27
2.4.2 Phylogenetic analysis and placement of the three new Raffaelea
species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
2.4.3 Growth of different Raffaelea species at different temperatures
and their response to ethanol . . . . . . . . . . . . . . . . . . 30
2.4.4 Taxonomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.5 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

3 Microbial communities of the uniquely eusocial ambrosia beetle,

Austroplatypus incompertus, exhibit structure at small spatial scales
and overlap in composition at large spatial scales 39
3.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
3.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.3 Material and methods . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.3.1 Beetle collection and metadata . . . . . . . . . . . . . . . . . 43
3.3.2 DNA extraction and sequencing . . . . . . . . . . . . . . . . . 44
3.3.3 Detection of the symbiotic fungus of Austroplatypus incompertus 45
3.3.4 Phylogeographic analysis of Austroplatypus incompertus . . . . 48
3.3.5 Processing of the fungal ITS2 and 16S rRNA gene amplicons . 48
3.3.6 Statistical analyses . . . . . . . . . . . . . . . . . . . . . . . . 49
3.4 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
3.4.1 Detection of Raffaelea kentii in Austroplatypus incompertus . . 51
3.4.2 Population structure of Austroplatypus incompertus across its
distribution . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
3.4.3 Amplicon sequence analysis . . . . . . . . . . . . . . . . . . . 54
3.4.4 Fungal and bacterial community structure . . . . . . . . . . . 54
3.4.5 Influence of Austroplatypus incompertus phylogeography and
tree spatial structure within populations on fungal and bacterial
communities . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
3.4.6 Taxonomic identification of fungi and bacteria . . . . . . . . . 59
3.5 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

4 Isolation of new Raffaelea species from larvae of the ancient am-

brosia beetle species Notoplatypus elongatus (Curculionidae: Platy-
podinae) with diverse bacterial and fungal communities 70
4.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

ii
 4.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
4.3 Material and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 74
4.3.1 Samples and fungal isolation . . . . . . . . . . . . . . . . . . . 74
4.3.2 Fungal DNA extraction, identification and growth experiments 74
4.3.3 Phylogenetic placement within the Ophiostomatales . . . . . . 76
4.3.4 Amplicon-sequencing of the ITS2 and 16S rRNA gene . . . . . 76
4.4 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
4.4.1 Fungal isolates and growth rates . . . . . . . . . . . . . . . . . 78
4.4.2 Growth rate of Raffaelea isolates . . . . . . . . . . . . . . . . 79
4.4.3 Phylogenetic analysis of the Raffaelea isolates . . . . . . . . . 80
4.4.4 Amplicon-sequencing of the 16S rRNA gene and ITS2 of N.
elongatus larvae . . . . . . . . . . . . . . . . . . . . . . . . . . 83
4.4.5 Taxonomic assignment of bacterial and fungal sequence reads 84
4.5 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87

5 General Discussion 89
5.1 Summary of the objectives . . . . . . . . . . . . . . . . . . . . . . . . 89
5.2 Summary of the results . . . . . . . . . . . . . . . . . . . . . . . . . . 90
5.2.1 Fungal associates of ambrosia beetles in Australia and their
description . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
5.2.2 Microbial communities of the uniquely eusocial ambrosia beetle,
A. incompertus, exhibit structure at small spatial scales and
overlap in composition at large spatial scales . . . . . . . . . . 92
5.2.3 Isolation of new Raffaelea species from larvae of the ancient
ambrosia beetle species N. elongatus with diverse bacterial and
fungal communities . . . . . . . . . . . . . . . . . . . . . . . . 93
5.3 Critical discussion of the finding and their limitations . . . . . . . . . 94
5.4 Concluding remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96

A Supplementary Figures and Tables 97

A.1 Chapter 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
A.2 Chapter 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
A.3 Coauthored paper, not part of PhD project . . . . . . . . . . . . . . 105

References 112

iii
List of Figures

2.1 Map of Australia with the collection sites of beetles and isolates. . . . 22
2.2 Phylogenetic tree based on Maximum-likelihood inference with 1000
bootstraps displaying the phylogenetic placement of the three newly
described Raffaelea species within Raffaelea sensu stricto. A fourth
species (CMW50197) has been isolated from an individual of Austro-
platypus incompertus from Eucalyptus piperita but still requires formal
description. Tree is based on two genes and a number of 1457 bp.
Numbers close to nodes represent bootstrap values, scale bar repre-
sents branch lengths. The phylogenetic tree is based on concatenated
28S rRNA and beta-tubulin (exons) gene sequences. . . . . . . . . . . 29
2.3 Growth rates of the different isolates, presented as the mean colony
diameter when grown at different temperatures for 14 days. Boxes
represent quartiles, and whiskers extend to show the rest of the distri-
bution. Diamonds represent outliers. No colonies were formed for R.
kentii at 30 °C, and no colonies for all three fungi at 35 °C. . . . . . . 30
2.4 Response to ethanol of three Raffaelea isolates from three Australian
platypodine species and Quambalaria sp. isolated from A. incompertus.
The letters indicate the statistical difference (Tukey test) within each
species. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.5 Raffaelea kentii (CMW49903) Top left: morphology when grown at
20 °C (scale bar = 1 cm); top right and bottom left: hyphal bridges
and hyphal fusions; elongated spores formed at the tip of the hyphae;
bottom right: elongated and ovoid spores (scale bars = 10 µm). . . . 32
2.6 Raffaelea kilii (DAR50136) Top left: morphology when grown at 25°C
(scale bar = 1 cm); top right: yeast-like cells with elongate to ovoid
cells; bottom left: hyphae with elongated and ovoid conidia at the tips;
bottom right: ovoid conidia fromimg from hyphae (scale bars = 10 µm). 34

iv
2.7 Raffaelea spirulatus (DAR82893). Top left: morphology and colour
of mycelium in culture at 25 °C (scale bar = 1 cm); top right: spiral
pattern of hyphae and conidia formed laterally; bottom left and right:
hyphae form spiral patterns and have ovoid conidia at the tips (scale
bars = 20 µm). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

3.1 Collection sites for Austroplatypus incompertus in New South Wales,

Australia. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
3.2 Detection success for Raffaelea kentii from beetles emerging from dif-
ferent host tree species at the different sites. . . . . . . . . . . . . . . 51
3.3 Maximum Likelihood Phylogeny of the mitochondrial COI haplotypes
of A. incompertus (each haplotype is listed with a single individual
that is representative of this haplotype) based on a sequence matrix of
594 bp obtained from 131 beetles. Platypus cylindrus was included as
an outgroup. The numbers below the nodes represent bootstrap values
and the scale bar represents the branch length. . . . . . . . . . . . . . 53
3.4 Numbers (log-transformed) of bacterial (top) and fungal (bottom) taxa
detected at sampling sites. Sorted from the southern (left) to the
northern populations of Austroplatypus incompertus. . . . . . . . . . . 56
3.5 Beta-diversity of the bacterial and fungal communities over all sample
sites. Circles represent beetles that were PCR-negative for Raffaelea
kentii, triangles represent beetles that were PCR-positive for R. kentii. 57
3.6 Fungal beta diversity per site. Colour codes represent the different
Eucalyptus tree species, shapes represent individual beetles from the
same galleries. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
3.7 top: shared bacterial ASVs and bottom shared fungal OTUs. . . . . . 62
3.8 Heatmap displaying the relative frequency (equals the sum of the pres-
ence/absence in sample divided by total number of beetles per pop-
ulation) of fungi on the phylum level associated with Austroplatypus
incompertus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
3.9 Heatmap displaying the relative frequency (equals the sum of the pres-
ence/absence in sample divided by total number of beetles per popu-
lation) of bacteria on the phylum level associated with Austroplatypus
incompertus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

v
4.1 Taxonomic assignment of the isolated fungi (902 CFUs) and their re-
spective counts. Fungi were isolated from larvae that had been surface
treated, and from the wash solution obtained when washing larvae with
water. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
4.2 Boxplot representing the growth of isolates of two Raffaelea ssp. at
different temperatures. Boxes represent the quartiles of the data, while
whiskers extend to explain the rest of the distribution of the data.
Diamonds represent outliers. . . . . . . . . . . . . . . . . . . . . . . . 80
4.3 Maximum-likelihood phylogenetic analysis of the large ribosomal sub-
unit (LSU; 28S rRNA gene, 891bp) of fungal isolates from N. elongatus
(labels in dark, beginning with the DAR accession code as deposited
in the NSW Plant Pathology and Mycology Herbarium). . . . . . . . 82
4.4 Barplots for the relative abundance and taxonomic assignment based
on the bacterial 16S rRNA gene (top) and the fungal ITS2 sequence
reads (bottom). The sample Ne6 had only nine 16S rRNA gene se-
quence reads and all of these reads were unassigned and therefore this
sample was not included in the bacterial community analysis. . . . . . 85
4.5 Rarefaction curves for bacterial and fungal reads. . . . . . . . . . . . 86

A.1 Maximum-likelihood analysis of ITS2 for the described isolates of Raf-

faelea ssp. from Australia. Raffaelea spirulatus sp. nov. was chosen as
a outgroup. Please note that the additional undescribed isolate from
Austroplatypus incompertus clusters with the described isolates from
this host species. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
A.2 Maximum-likelihood analysis of the exons of the beta-tubulin gene for
the described isolates of Raffaelea ssp. from Australia. We included
also sequences for isolates for Platypus semigranosus we isolated from
Bondi State Forest, but were lost through a mite infestation. . . . . . 98
A.3 Rarefaction curves of bacterial and fungal reads . . . . . . . . . . . . 99
A.4 Relative abundance of phyla of bacteria of Austroplatypus incompertus
in each population. Bars showing the percentage of bacteria found in
the different beetles per population. . . . . . . . . . . . . . . . . . . . 102
A.5 Relative abundance of phyla of fungi of Austroplatypus incompertus in
each population. Bars showing the percentage of bacteria found in the
different beetles per population. . . . . . . . . . . . . . . . . . . . . . 103

vi
A.6 Relative abundance of family of bacteria of Austroplatypus incompertus
in each population. Bars showing the percentage of bacteria found in
the different beetles per population. . . . . . . . . . . . . . . . . . . . 104
A.7 Relative abundance of family of fungi of Austroplatypus incompertus
in each population. Bars showing the percentage of funi found in the
different beetles per population. . . . . . . . . . . . . . . . . . . . . . 105

vii
List of Tables

2.1 List of ambrosia fungi isolated from Platypodinae. The table summa-
rizes the known fungal symbionts of Platypodinae based on published
literature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
2.2 Isolation of different fungi from Austroplatypus incompertus across
three different forest sites in New South Wales. The number of beetles
represent the individuals from which particular fungi were isolated.
Some individuals delivered more than one fungal species, while from
other beetles no fungi were isolated. In total we isolated fungi from 50
out of 72 beetles. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

3.1 List of Austroplatypus incompertus specimens. Beetles were collected

from different Eucalyptus species (some of known, others of unknown
species identity). Trees were labeled with numbers (1-17) and galleries
are labeled with letters (A-E). The collection year was also included in
brackets after the gallery letter. . . . . . . . . . . . . . . . . . . . . . 46
3.2 List of forward (-F) and reverse primers (-R) primers for beta-tubulin
or elongation factor of Raffaelea kentii. The primers were designed
with different softwares as listed. . . . . . . . . . . . . . . . . . . . . 47
3.3 The table list the results for the ordistep and variation partitioning.
The p-values represent the results after the correspondence-analysis
followed by an ANOVA. . . . . . . . . . . . . . . . . . . . . . . . . . 55
3.4 The table list the results after the ordistep and variation partitioning
for each sample site, were we calculated the principal coordinates of
the distance matrix of the different trees. . . . . . . . . . . . . . . . . 59

viii
4.1 The sample ID consists of the three letters (NP for Notoplatypus elon-
gatus and A, B or C for billet ID) and the number of the individual
larvae which were used. For sample NPC5 and NPC10 we could not
distinguish whether they contain Raffaelea sp. 1 or 2 due to a poor
chromatogram, which allowed only assignment to genus but not to
species. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
4.2 The number of sequence reads per sample and the number of unique
ASVs per sample. The sample Ne6 had only nine 16S rRNA gene
sequence reads and all of these reads were unassigned and therefore
removed from the bacterial community analysis. . . . . . . . . . . . . 83

A.1 Variables measured and tested as influencing factors of the fungal and
bacterial communities . . . . . . . . . . . . . . . . . . . . . . . . . . 99
A.2 Variation explained by phylogenetic distances computed from the UP-
GMA (unweighted pair group method with arithmetic mean) tree after
removing the outliers sample C22 and D12. . . . . . . . . . . . . . . . 100
A.3 Analysis of the alpha diversity for the number of fungal ASVs between
different Austroplatypus incompertus populations. . . . . . . . . . . . 100
A.4 Analysis of the alpha diversity for the number of bacterial OTUs be-
tween different Austroplatypus incompertus populations. . . . . . . . 101

ix
Chapter 1

General Introduction

1.1 Insect symbiosis

Over the 4 billion years of biological evolution, the interactions between organisms
have driven and shaped biodiversity (Ishikawa, 2003). The best example of this can
be found in insects, the most speciose class of animals, many of which live in close
associations with plants and microbe (Samways, 1993; Mueller et al., 2005; Frago
et al., 2012; Biere and Bennett, 2013). Microbial symbionts such as viruses, bacteria,
protists and fungi are widespread amongst insects and symbiotic relationships are
thought to have driven their rapid diversification (e.g. Kiers and West, 2015). These
microbes live outside and within the body and can provide nutrition or defence,
and manipulate host behaviour or reproduction (Buchner, 1965; Moran et al., 2008;
Hosokawa et al., 2010). Symbiotic microbes can contribute to the development and
survival of insects in a vast array of terrestrial habitats (Buchner, 1965; Glenner
et al., 2006). Some insects have become entirely reliant on the nutrient provisioning
provided by their microbial partners. These primary microbial symbionts (obligate
symbionts) involved in these obligate mutualistic interactions are necessary for host
development and are often restricted to specialized organs, such as the endosymbiotic
bacteria in Hemiptera (Moran et al., 2008; Hosokawa et al., 2010). Endosymbiotic
bacteria are usually transmitted vertically from parent to offspring. Well studied
examples are bacteria involved in nutrient provisioning e.g. Buchnera aphidicola in
aphids and Wigglesworthia glossinidia in tsetse flies (Shigenobu et al., 2000; Akman
et al., 2002).

Insects can also have a secondary bacterial endosymbionts (facultative symbionts),

which occur in various cell types of their host and can also be acquired by hori-
zontal transmission from other individuals or the surrounding environment (Moran

1
et al., 2008; Ebert, 2013; Salem et al., 2015). These facultative symbionts can affect
the host in two different ways, by providing fitness benefits in a context-dependent
way, or by manipulating the host reproductive system, e.g. Wolbachia (Moran et al.,
2008). Some of these endosymbiont lineages can be widespread such as Wolbachia
that occurs in about 52% arthropod species (Weinert et al., 2015). Besides bacteria,
many insects are closely associated with fungi (Blackwell, 1994; Gibson and Hunter,
2010). The development of mutualistic relationships with fungi has resulted in many
morphological, chemical and behavioural adaptations in insects and their fungal part-
ners. Similar to bacteria, fungi can be involved in a tight endosymbiosis, living in
special organs of the host e.g. yeasts (Gibson and Hunter, 2010), as ectosymbionts
on substrate in the host's environment, housed temporarily outside the body on the
insects integument, or within special organs of ectodermal origin for the purpose of
dispersal (Francke-Grosmann, 1956). Insect-fungal interactions can also be obligate
and mutualistic, as seen in fungal farming insects, where the fungal symbiont provides
the main or sole food source to the insect partner.

1.2 High-throughput sequencing and accelerated

discoveries in the world of microbes
In recent years the leap in technological advances in sequencing has made it more
affordable to use hightroughput technologies to investigate the microbial ecology of
insect symbioses. These techniques allow the generation and analysis of many se-
quences from complex microbial samples in a rapid approach. Initial investigations
into entire microbial ecosystems used 16S rRNA gene sequencing, first performed
in 1990 (Giovannoni et al., 1990), (Ward et al., 1990). The first sequencing ap-
proaches were a slow process, however, today, millions of sequences can be generated
overnight, using next-generation sequencing platforms such as Illumia, PacBio, and
Oxford Nanopore (Branton et al., 2008; Kozich et al., 2013; Fichot and Norman,
2013).

The most common and affordable approach to characterise microbial communities

using next-generation sequencing is the use of amplicon sequencing of specific gene
fragments like the 16S rRNA gene of bacteria or the ITS2 locus of fungi (Lauber
et al., 2009; Caporaso et al., 2012; Ihrmark et al., 2012; Taylor et al., 2016). This
approach relies on PCR to amplify a specific gene region and via different approaches,

2
like the bridge-amplification in Illumina, and rapidly sequences the forward and re-
verse strands. However, amplification of genomic DNA through PCR can introduce
errors, such as the incorporation of incorrect basepairs, which are then multiplied ex-
ponentially through repeated copying (Wang and Wang, 1997; Schirmer et al., 2015).
This makes it difficult to determine the actual identity of the microbial targets due
to the artificial introduced errors. Furthermore, targeted marker genes such as 16S
rRNA genes and ITS may have multiple copy numbers within genomes, and there-
fore vary in their sequence within species and individuals (Dryden and Kaplan, 1990;
Klappenbach et al., 2001; Rooney and Ward, 2005). Another major problem is the
assignment of sequences to a species or higher taxonomic level, for two reasons. First,
short marker gene sequence may not be sufficient to reliably provide a match to just
one species but rather match to a group of species that share this marker, leaving the
taxonomic assignment unresolved. Furthermore, the assignment is dependent on the
available sequences data in well curated databases.

To date, for bacteria, roughly two million sequences of the SSU gene are catalogued in
the SILVA database (https://www.arb-silva.de/documentation/release-132/)
and for fungi roughly one million ITS sequences in the UNITE database (Nilsson et al.,
2019). However, this represents only a fraction of diversity in these two kingdoms
(Blackwell, 2011; Locey and Lennon, 2016). In addition, for fungi we can see that
limited species discovery in less studied areas, such as Australia and South America
can be a problem in assigning new taxa based on sequence approaches alone (Nilsson
et al., 2019). Furthermore, approaches relying on a single primer set can capture just
a small percentage of the biological diversity. For example the 16S rRNA amplicon-
sequencing of bacteria from human and environmental samples could capture as low
as 9.6% of the overall bacterial diversity due to primer choice and difficulties with the
amplification of some bacterial taxa (Eloe-Fadrosh et al., 2016).

Despite all of this, other approaches such as metagenomic shotgun sequencing can
reveal a full picture of an environmental sample (Eloe-Fadrosh et al., 2016; Karst
et al., 2018), however this is a more expensive, and computationally a more complex
approach. The most recent improvements of amplicon sequencing involves sequenc-
ing of the full length 16S and 18S rRNA genes by using extracted RNA, building
the double-stranded cDNA via poly(A)tailing and tagging both ends with unique
identifiers, which allow sequencing even with short read sequencing technologies like
Illumina Miseq, but also long-read technologies like the increasingly popular Oxford

3
Nanopore (Karst et al., 2018). The cost of these technologies is still high and the
error rate for some long-read technologies like Nanopore can range from 5% to 40%
(Goodwin et al., 2015). However, the rapid advances in technology will overcome
these shortcomings within the next few years.

Despite the limitations, next-generation amplicon sequencing allows the character-

isation of the diversity of microbes in samples which otherwise might be hard to
investigate because of their size. The relationships between insects and microbes
can sometimes be difficult to determine, because some insects lack specific morpho-
logical features such as bacteriomes that house bacterial endosymbionts, and because
many insects are very small, which make dissections very hard. Furthermore, culture-
dependent methods might be failing if the growing conditions of symbiotic microbes
are unknown and difficult to simulate (Kikuchi et al., 2007; Shi et al., 2010; Pros-
docimi et al., 2015).

1.3 Agriculture in insects

Agriculture as a process of planting, cultivating and harvesting crops for food has
arisen several times in the animal kingdom (Mueller et al., 2005) and it often seems
linked to the formation of complex societies (Richerson and Boyd, 1999). Indeed,
the adoption of agricultural strategies by humans in the Middle East close to 13,000
years ago (Diamond and Ordunio, 1999), and independently in Australia in a poten-
tially much earlier era (Pascoe, 2014), was arguably the main innovation which led
to human civilization which we know today. The development (and independently
repeated development) of farming is not unique to humans. Insects evolved agricul-
tural strategies close to 40-90 million years ago. More specifically, fungal farming
arose independently in at least three insect orders, namely Hymenoptera (once in
ants, ∼50-60 million years ago), Blattodea (once in termites, 31 million years ago)
and Coleoptera (in beetles, several times in Scolytinae ∼50 Million years ago, and
once in Platypodinae ∼90 Million years ago) (Mueller et al., 2001; Mueller and Ger-
ardo, 2002; Nobre et al., 2011; Jordal and Cognato, 2012; Jordal, 2015; Vanderpool
et al., 2017).

4
1.3.1 Ants
Fungus growing ants mostly belong to the tribe Attini and are a model system for
studying obligate mutualism (Weber, 1966; Chapela et al., 1994; Currie, 2001). Fungal
cultivation in these groups evolved only once, close to 50 million years ago (Mueller
et al., 2001). The symbiotic fungus mostly belongs to the Lepiotaceae within the
Basidiomycota (Mueller et al., 1998; Mueller, 2002). These fungi live saprotrophically
and are significant decomposers of litter in the neotropics, where the coevolution
between ants and fungi likely originated (Mueller, 2002).

The specialized asexual forms of the fungal symbionts of ants are called gongylidia
(Martin, 1970). These hyphal swellings are rich in lipids and carbohydrates and
provide a food source for the attine ants (Martin, 1970; Quinlan and Cherrett, 1979;
Currie, 2001). Phylogenetically, the tribe Attini is divided into a monophyletic group
of the higher attines and the paraphyletic lower attines (Mueller, 2002). Interestingly
in the higher attine ants, also known as the leaf-cutter ants, fungi are normally
dispersed vegetatively as asexual clones within the nest and are vertically transmitted
by the queen and dispersing offspring founding new nests (Mueller et al., 1998; Currie,
2001; Poulsen and Boomsma, 2005). Only in a few cases, mainly in lower attine
ants, horizontal transmission of different fungal genotypes between nest of different
populations within the same ant species can occur since these ants live in association
with free-living forms of Lepiotaceae (Mueller et al., 1998; Mikheyev et al., 2006).
Higher attine ants consistently farm fungal monocultures. This makes the fungal
gardens especially vulnerable to diseases and parasites.

In the leaf cutter ants, this includes highly specialised parasitic and virulent fungi
in the genus Escovopsis (Ascomycota). These fungi can be transmitted horizontally
between ant colonies and can destroy the fungus-garden of the colony (Currie et al.,
1999a). However, in this coevolutionary system of ants, their fungal symbionts and
parasites, a fourth partner has coevolved, a bacterium in the genus Streptomyces. This
bacterium is found in all fungus-growing ants and helps in suppressing the growth of
Escovopsis. The bacterium is transmitted vertically from parent to daughter nests,
promotes the growth of the mutualistic fungus and produces highly specific antibiotics
against the parasitic fungi (Currie et al., 1999b). This coevolution involving several
taxa makes ants an extraordinary evolutionary study system for symbiosis, that has
been well studied. In contrast, other fungal farming insects are less studied.

5
1.3.2 Termites
Fungal cultivation in termites most likely originated in the African savannah about
31 million years ago (Aanen and Eggleton, 2005; Nobre et al., 2011). Fungus growing
termites belong to the subfamily Macrotermitinae and their associated fungal crop is
a member of the Termitomyces within the Basidiomycota (Aanen and Eggleton, 2005;
Nobre and Aanen, 2012). Their fungal symbiont is dispersed via sexually produced
spores that are spread by wind. The fruiting of the fungus and the emergence of the
workers is simultaneous, so that the fungus is also distributed throughout the nest.
The fungus is rich in nitrogen, sugars and enzymes (Martin, 1992; Korb and Aanen,
2003). Interestingly, the fungus also grows in its asexual stage and these spores are
indigestible to termites, which means that they are distributed by passing through
the gut unharmed (Mueller et al., 2005). Some species of termites use this technique
for the foundation of new colonies by inoculating a new nest with the undamaged
asexual spores from their gut (Martin 1992).

1.3.3 Ambrosia beetles

The order Coleoptera contain the oldest fungal farming insect lineages. Ambrosia bee-
tles have an obligatory symbiosis with their fungal partners as their sole food source,
similar to the interactions seen in attine ants and microtermitine termites. Within the
Coleoptera, ambrosia beetles are the only beetles that solely rely on cultivated fungi,
while there are other beetle taxa that can have fungal associations that enhance and
contribute to their survival (such as some bark beetles, longicorn beetles and others)
(Farrell et al., 2001; Gibson and Hunter, 2010; Scully et al., 2014). Ambrosia beetles
include species of two subfamilies within the family Curculionidae (weevils); Scolyti-
nae (mostly bark beetles) where fungal farming likely evolved independently at least
16 times, for the first time around 50 million years ago (Johnson et al., 2018), and
Platypodinae (pinhole borers) which are (except for one scarcely studied species) all
considered fungal farmers, the oldest fungal farming insect lineage that originated
close to 90 million years ago (Francke-Grosmann, 1967; Batra, 1985; Beaver et al.,
1989; Jordal and Cognato, 2012; Jordal, 2015; Vanderpool et al., 2017).

Worldwide, the biodiversity of ambrosia beetles includes all Platypodinae (more than
1,400 species), and some but not all Scolytinae (2,000 out of 7,000 species). The
majority of ambrosia beetles live in tropical or subtropical climates (Farrell et al.,
2001; Jordal and Cognato, 2012). It is therefore hypothesised that the evolution of

6
fungal farming in beetles originated in these tropical and subtropical regions (Farrell
et al., 2001; Jordal and Cognato, 2012). Despite being the most ancient fungus
farming insects Platypodinae are far less studied than scolytine ambrosia beetles. In
general, very little is known about the role of other microbes in the fungal farming
systems of ambrosia beetles. However it appears likely that other microbial associates
besides their fungal food source are important for these beetles (Cardoza et al., 2006;
Scott et al., 2008). For example oral secretions in the mouthpart of some Scolytinae
species can contain bacteria that specifically suppress non-symbiotic fungi and may
therefore help beetles weeding their garden (Cardoza et al., 2006). These mutualistic
bacteria belong to the Actinomycetes (as in the ants) and coevolved with their beetle
hosts (Scott et al., 2008).

1.3.3.1 Scolytinae

The subfamily of Scolytinae is very diverse and occurs in many forest habitats from
cold temperate to warm subtropical and tropical environments. Some scolytines are
significant pest species in temperate and tropical forests (Sauvard et al., 2010; Hulcr
and Dunn, 2011; Tarno et al., 2016). Out of the 6,000 currently recognised scolytine
beetles, 2,000 are true fungal farmers and actively cultivate fungi (Jordal and Cognato,
2012). Ambrosia beetles within the Scolytinae excavate their tunnel systems within
the sapwood (Francke-Grosmann, 1956). The majority of research on ambrosia beetles
focuses on these scolytine beetles and their associated fungi, because some can be
destructive pest species (Kirkendall and Faccoli, 2010; Hulcr and Dunn, 2011). The
origin of Scolytinae is dated back to around 100 million years ago (Jordal and Cognato,
2012). However, the evolution of fungal farming within Scolytinae is much younger,
and appears to have evolved independently at least 16 times, with the oldest fungal-
farming node arising about 50 million years ago (Farrell et al., 2001; Jordal and
Cognato, 2012; Johnson et al., 2018).

1.3.3.2 Platypodinae

Platypodinae, also known as pinhole borers, is another subfamily within Curculion-

idae. Platypodinae usually excavate their galleries in stressed, dying or recently
deceased trees (Francke-Grosmann, 1967; Sauvard et al., 2010). It is thought that all
1,400 species of Platypodinae are obligately associated with a fungal partner (except
for one little studied species (Kirkendall et al., 2015; Jordal, 2015). The long phylo-
genetic branches and lack of robust phylogenetic data has historically made the exact
placement of these beetles within Curculionidae difficult (Jordal et al., 2014). They

7
have at times been considered along with Scolytinae as the superfamily Scolytoidea,
and then as a subfamily closely related with Scolytinae. It is now clear that despite
their similar life histories and common morphological traits, Platypodinae are more
distantly related to Scolytinae (Jordal and Cognato, 2012). It is hypothesized that
the very first fungus farming insects (now extinct) were actually related to Platypo-
dinae in the Cretaceous (66 to 145 million years ago), because of the discovery of a
Burmese amber fossil which was dated back to this time period, and supported by
molecular data (McKenna et al., 2009; Jordal and Cognato, 2012; Jordal, 2015).

1.3.3.3 Ambrosia fungi of Platypodinae and Scolytinae

The fungal associates of ambrosia beetles, in the form of mycelia or spores, are their
host's sole food source. The name ambrosia refers to the food of gods in Greek mythol-
ogy and arose due to the sweet smell of secondary metabolites released by the fungi
in the decomposition process of the wood (Batra, 1985). The larvae of most ambrosia
beetles feed exclusively on fungal structures (i.e. they are mycetophagous) in beetle
galleries, whereas adult beetles can sometimes feed on both wood and fungi (xy-
lomycetophagous) (Francke-Grosmann, 1967). In rare cases larvae can feed on both
fungi and wood (Francke-Grosmann, 1963, 1967). The fungal symbiosis is essential for
ambrosia beetles because the fungi produce enzymes that can break down cellulose,
and these enzymes are missing in the repertoire of the beetle genome (Bärlocher,
1985; Ulyshen, 2016). Whilst the fungi contain more nutrients and vitamins than
the surrounding xylem and phloem (Bärlocher, 1985), the nutritional value of the
mycelium can vary with gallery age and environmental conditions (Bärlocher, 1985).
Fungal symbionts may also have evolved to detoxify secondary defence metabolites
produced by the tree (Bärlocher, 1985; Dowd, 1992).

To ensure successful growth of the fungal gardens, it is thought that ambrosia beetles
carry a community of different fungal spores with them (Beaver et al., 1989). These
are often distinguished into primary and auxiliary fungi. The primary fungi can be
highly specific to individual beetles species and occur immediately after the estab-
lishment of the gallery, whereas auxiliary fungi are less specific, transient and may
appear well after the development of the gallery (Batra, 1963, 1985). In scolytine
and platypodine beetles, primary fungi are most often transported in specific ecto-
dermal structures called mycetangia or mycangia (Francke-Grosmann, 1967; Batra,
1985; Cassier et al., 1996). These special structures can be pouches, cavities or pits
of various sizes which are usually associated with glandular cells (Nakashima, 1971;

8
Kent, 2008b). The mycangia can occur in different body regions of beetles. My-
cangia of Scolytinae are most commonly prothoracic pleural, promesonotal, elytral,
prosternal-subcoxal and oral (Francke-Grosmann, 1967). For Platypodinae typical
mycangia are pro- and mesocoxal mycangia, pits on the prothorax or single pouch
preoral cavities (Table 1). (Mayers et al., 2015) hypothesised that the structure and
size of the mycangia has a major influence on the fungal community composition in
ambrosia beetles.

Fungal symbioses have evolved several times in beetles and several different groups
of fungi are known to form these insect-fungal symbioses (Hulcr et al., 2007a; Mas-
soumi Alamouti et al., 2009; Kasson et al., 2013). The most common obligate fungal
mutualists of ambrosia beetles belong to the classes Sordariomycetes (orders Mi-
croascales and Ophiostomatales) and Saccharomycetes (yeasts) within the phylum
Ascomycota as well as some species in the phylum Basidiomycota (Massoumi Alam-
outi et al., 2009; Biedermann et al., 2013; Dreaden et al., 2014; You et al., 2015;
Mayers et al., 2015).

Microascales (Ascomycota: Sordariomycetes)

The order of Microascales (Ascomycota: Sordariomycetes) includes four families Cer-

atocystidaceae, Gondwanamycetaceae, Halosphaeriaceae and Microascaceae (Réblová
et al., 2011). Ambrosia beetles within the Scolytinae are often associated with fungal
species in the family Ceratocystidaceae (Six et al., 2009; Mayers et al., 2015). Two
examples are (1) female beetle species of the genera Xylosandrus spp. (Xyleborini),
which harbour Ambrosiella spp. in their large mesotonal mycangia and (2) bee-
tle species within the genus Trypodendron (Xyloterini) which carry Phialophoropsis
spp. (Ceratocystidaceae) in their prothoracic pleural mycangia (Batra, 1967; Francke-
Grosmann, 1967; Batra, 1985; Hulcr and Cognato, 2010; Mayers et al., 2015). The
polyphyletic genus Ambrosiella is assumed to be a true fungal symbiont and is as-
sociated with a variety of scolytine beetles (Mayers et al., 2015). Ceratocystidaceae
are often associated with large and elaborate mycangia that are entirely set inside
the beetle body, whereas smaller mycangia are associated with Ophiostomatales. It
is assumed that ambrosia beetles with large mycangia derived from other genera with
smaller and simpler mycangia, which normally harbour Raffaelea spp. (Harrington
et al., 2014).

9
Ophiostomatales (Ascomycota: Sordariomycetes)

The order Ophiostomatales includes six lineages including Ophiostoma sensu stricto,
Raffaelea sensu stricto, Ceratocystiopsis, Fragosphaeria, Graphilbum and Leptographium
sensu lato (de Beer and Wingfield, 2013). In contrast to the primary fungal symbionts
of Scolytinae, Platypodinae are often associated with the polyphyletic genus Raffaelea
ssp. in the lineages Raffaelea sensu stricto and Leptographium sensu lato (Table: 2.1
in chapter 2). The majority of Raffaelea spp. live as saprophytes colonizing dead or
dying wood but some species can cause significant damage to forest trees like Raffae-
lea quercivora and Raffaelea quercus-mongolicae associated with Platypus quercivorus
(Kinuura, 2002; Kim et al., 2009; Endoh et al., 2011; Dreaden et al., 2014)

Saccharomycetes (Ascomycota: Sordariomycetes)

The order of Saccharomycetes includes yeasts that can also be found in the mycangia
of ambrosia beetles. Their exact function has long been queried (Baker and Kreger-
van Rij, 1964). It is assumed that yeasts within the symbiosis of ambrosia beetles
may have the following roles (Graham, 1967; Davis, 2015): (1) they can enhance
the growth of insect beneficial microbes as well as inhabit competitive microbes; (2)
they can produce semiochemicals which can attract or repel beetle heterospecifics,
conspecifics, predators or parasitoids; (3) they can detoxify plant chemicals such as
terpenoids or can produce chemicals which may influence the performance of the
beetle and their associated microbes; (4) they may have a direct nutritional role for
the insect, because they can contribute sterols and amino acids. However, these
four potential roles are still elusive and need further testing. Furthermore, a clear
generalization of the function of yeast associates may be challenging or impossible
(Davis, 2015).

1.3.3.4 Biosecurity and ambrosia beetles

While the majority of ambrosia beetle species are important in ecosystem functioning
by contributing to nutrient cycling and forest regeneration, several ambrosia beetle
species are regarded as serious pests which threaten forest ecosystems, because of their
tunnelling behaviour, fungiculture and ability to transmit aggressive tree pathogens
(Farris and Funk, 1965; Hulcr and Dunn, 2011). An example of an economically
important ambrosia symbiosis within the Scolytinae is the redbay ambrosia beetle
Xyleborus glabratus and its primary fungus Raffaelea lauricola (Fraedrich et al., 2008;

10
Harrington et al., 2011). This beetle-fungus association causes a vascular wilt in red
bay and other Lauraceae species, and has led to massive dieback of red bay trees in
the USA (Fraedrich et al., 2008).

Within Platypodinae, Platypus cylindrus, P. quercivorus and Megaplatypus mutatus

are well studied examples illustrating the threat that ambrosia beetles place on native
and managed forests. Platypus cylindrus occurs in oak trees in Europe where it can
cause cork oak mortality in Portugal (Henriques et al., 2009). The fungal associates of
P. cylindrus are diverse, and thought to include Raffaelea species, together with other
Ascomycota that appear to be involved in the dieback (Inácio et al., 2010; Belhoucine
et al., 2011; Inácio et al., 2012). The other two species, P. quercivorus and M. mutatus,
which occur in other parts of the world, e.g Asia and South America, are common
pest species attacking weakened living trees and cause substantial losses to the timber
industry (Kusumoto et al., 2015; Alfaro et al., 2007). Platypus quercivorus attacks,
like P. cylindrus, oak trees and is distributed throughout Japan and other regions of
Asia. The first occurrence of oak wilt was in the 1980s (Ito et al., 1998). The female
bores a horizontal gallery whereas the male plugs the entrance hole with its abdomen
to prevent natural enemies and competitors from invading the gallery (Kirkendall
et al., 1997). The mycangia are on the thorax of the females and contain the spores
of Raffaelea quercivora (Kamata et al., 2002). This fungus causes a tree wilt by
blocking the sapwood (Kamata et al., 2002; Kubono and Ito, 2002; Endoh et al., 2011).
Megaplatypus mutatus is a major pest species in poplar plantations in Argentina and
other parts of the world. This beetle is one of only a few of Platypodinae that attack
live and healthy trees (Alfaro et al., 2007; Guerrero, 1966). The beetle excavates large
internal tunnels in the xylem which can lead to windbreak of trees. Their emerging
season is late spring (September to November) and, the male beetles initiate the
gallery (Funes et al., 2011). Females join shortly after the successful attack, mate and
then construct the majority of the gallery system. Their primary ambrosia fungus is
Raffaelea santoroi (Alfaro et al., 2007).

The previously listed species are examples of scolytine and platypodine ambrosia
beetles are economically important in their regions and can also threaten biosecurity
worldwide, if the beetle and its associated fungi is accidentally introduced to other
regions for example by timber trade or timber used for packaging. However, examples
of endemic species which cause a threat to the local forest resources are rarer than
introduced species.

11
The specific fungal partners involved in obligate mutualisms of platypodine beetles
are relatively unknown compared to those of Scolytinae. Platypus cylindrus, P. quer-
civorus and M. mutatus are only a small number of well-studied species within Platy-
podinae (see Table: 2.1 in Chapter 2). Few studies have been conducted on Platy-
podinae from southern hemisphere tropical and subtropical regions in Africa and
Australasia. This is striking as these regions are currently thought to be a centre of
origin, and expected to be biodiversity hotspots for ambrosia beetles (Jordal, 2015).
More studies of the biodiversity in these regions could lead to a better understanding
of fungal farming in ambrosia beetles and offers the opportunity to discover new ob-
ligate microbial mutualists of Platypodinae. For example, an African research group
recently investigated the colonization of the important African trees Olea capensis
and Rapanea melanophloeos by beetles. They found a platypodine species (Platy-
pus sp.) associated with an undescribed fungus, Raffaelea sp. and revealed for the
first time the sexual stage of these ophiostomatoid fungus (Musvuugwa et al., 2015).
These findings highlight the research gaps in this field and confirm that investigations
of mutualistic fungal and bacterial symbionts of Platypodinae may reveal many new
fungal species and unknown interactions.

The Australian Platypodinae beetles are an excellent study system to investigate the
evolution of fungal farming. The basal lineages of Tesserocerini, Notoplatypus elon-
gatus and Platypodini Austroplatypus incompertus are endemic to Australia, as well
as several other lineages of more recently evolved Platypodini species. Notoplatypus
elongatus and A. incompertus are likely to have originated close to 90 and 60 million
years ago, respectively (Jordal, 2015) (Figure 2). The identity of their fungal partners
is currently unknown, and knowledge about their identity may allow a better inter-
pretation of the evolution of fungal farming in ambrosia beetles, and more widely.
Both are extraordinary species within Platypodinae, highly specialised because they
inhabit living Eucalyptus trees, and, in the case of A. incompertus, can colonize host
trees for an extensive time period without causing harm to the host tree (Smith et al.,
2018). The biology of N. elongatus has not yet been extensively studied. This species
appears to attack wounded and stressed trees (D. Kent, personal communication,
personal observation). Furthermore, beetle galleries have a clear staining indicative
of the presence of fungi. Similarly, the fungal symbionts and microbial communities
of the only eusocial beetle, A. incompertus, are unknown.

12
1.4 Aims and scope of the thesis
This thesis aims to establish, for the first time, the identity of the fungal symbionts of
the only known eusocial beetle A. incompertus and other Platypodinae in Australia,
and to characterise their microbial communities. An extensive sampling program
was undertaken for A. incompertus along eastern Australia. Besides A. incompertus,
other Australian Platypodinae were also studied by characterising already existing
fungal isolates samples from previous collections and by accessing their fungal isolates
kept at the New South Wales Department of Primary Industry Plant Pathology and
Mycology Herbarium. Furthermore, individuals of N. elongatus, were collected from
an infested tree that was discovered by chance.

The thesis addressed the following questions:

1. What fungi are associated with A. incompertus across different populations?

To address this question different populations of A. incompertus were sampled and

culture-dependent methods applied to isolate and examine the fungal associates. This
lead to the description of newly found ambrosia fungi species and placed them into a
phylogenetic context with previously known symbionts of other ambrosia beetles

2. What fungal and bacterial communities are associated with A. incompertus and
what genetic and environmental factors influence the composition and structure of
these microbial communities?

For this question, beetle galleries of A. incompertus throughout its distribution in

New South Wales, Australia were accessed. Culture-independent methods such as
amplicon-sequencing were used to determine the microbial community composition
and structure and multivariate statistics used to explain the effects of genetic and
environmental factors on the observed microbial community patterns.

3. What microbes are associated with N. elongatus and in what way are they different
from the microbial communities of A. incompertus?

To achieve this, N. elongatus larvae were sampled from an infested tree and culture-
dependent as well as culture-independent techniques used to determine the microbial

13
associates of this beetle species.

This thesis is the first systematic and comprehensive investigation of fungal sym-
bionts and other microbial isolates in two ancient and two more derived Australian
Platypodinae lineages.

14
Chapter 2

Fungal farming down under:

characterisation and description of
three new Raffaelea species
(Ophiostomatales) isolated from
three Australian ambrosia beetles
(Platypodinae) with different life
history traits

2.1 Abstract
Ambrosia beetles farm fungi as their primary food source. They include two sub-
families, Scolytinae (bark beetles) and Platypodinae (pinhole borers). In contrast to
scolytines, platypodines are the phylogenetically older lineage and all species but one
are considered fungal farmers. However, fungal associates have been characterised
for only 15 of the estimated 1,400 species. Australia hosts phylogenetically diverse
platypodines and several basal lineages, including Austroplatypus incompertus, and
more derived species such as Platypus semigranosus and Platypus subgranosus. All
three differ in their life histories, host tree use and impact: A. incompertus is the only
eusocial beetle species and develops in longlasting galleries in living Eucalyptus trees
without noticeably affecting tree health; P. semigranosus and P. subgranosus are not
eusocial and develop in dead or already dying trees, and the latter species can trans-
mit a tree pathogen within Australia. Here, we characterise fungal symbionts from
Australian platypodines for the first time, and describe three new Raffaelea species
(Ascomycota: Ophiostomatales): we collected A. incompertus from Eucalyptus pilu-

15
laris from three distant sites and cultured their fungi, including Raffaelea kentii sp.
nov. and a Qualambaria species. At one site a related Raffaelea variant was isolated
from A. incompertus on Eucalyptus piperita. Furthermore we described Raffaelea
spirulatus sp. nov., previously isolated from P. semigranosus, and Raffaelea kilii sp.
nov., previously isolated from P. subgranosus. The new species belong to Raffaelea
sensu stricto; R. kentii and R. kilii are sibling species whereas R. spirulatus is related
to Raffaelea albimanens first isolated in South Africa, but had distinct hyphae that
formed spiral structures. In contrast to another recent study, we report high ethanol
sensitivity in all Australian Raffaelea species and a particularly slow growth rate of
R. kentii. These traits may be linked with the fungi's ecology; R. kentii occurs with a
eusocial beetle species that develops within living Eucalyptus trees over considerable
time without seriously impacting tree health. Our study confirms presence of related
Raffaelea species across ancient and more derived platypodines within a single bio-
geographic region and therefore suggests that evolutionary age of beetle lineages does
not influence the identity of their ambrosia fungi.

2.2 Introduction
Intricate mutualistic interactions between insects and fungi have fascinated biolo-
gists since the 19th century (Buchner, 1965). Insect fungiculture is perhaps the most
advanced form of the this mutualism, as it involves farming practices with striking
similarities to our own such as active propagation, manipulation of growth conditions,
protection, harvesting and dispersal of fungi (Mueller et al., 2005). In return, the sym-
biotic fungi are the primary food source and provide fungal farming insects with nutri-
ents that they would otherwise not be able to assimilate from the surrounding environ-
ment (Graham, 1967; Francke-Grosmann, 1967). Fungal farming arose independently
in three insect orders: (1) Blattodea represented by fungus-growing termites within
the subfamily Macrotermitinae; (2) Hymenoptera represented by fungus-growing ants
within the tribe Attini and (3) Coleoptera represented by ambrosia beetles within two
weevil (Curculionidae) subfamilies, Scolytinae and, the least studied group, Platy-
podinae (Mueller et al., 2001; Aanen et al., 2002; Mueller and Gerardo, 2002; Farrell
et al., 2001).

Fossil evidence places the origin of Platypodinae at roughly 90 million years ago,
prior to the divergence of Scolytinae and other fungal farming insects, suggesting
that they are the most ancient group of insects with fungiculture (Vanderpool et al.,

16
2017). Platypodine diversity is estimated to include about 1,400 species (Jordal,
2015). However, recent studies suggest that this number may be an underestimate
because many species are still undescribed (Kirkendall, 2017). Platypodines mostly
occur in the tropical and subtropical regions of Africa, South America, Southeastern
Asia and Australasia, and it is estimated that the Neotropics host the highest species
diversity (Jordal, 2015).

Most Platypodinae develop in dead or dying trees and, therefore, they play a vital role
in nutrient cycling within ecosystems (Ulyshen, 2016). However, fungal associates
have so far only been described from about 15 platypodine species (Table: 2.1). The
fungal communities of ambrosia beetles are, therefore, less studied for Platypodinae.
The fungi associated with Scolytinae are diverse and can consist of species belonging
to different orders (e.g. Ophiostomatales and Hypocreales) and functional guilds with
regard to tree interactions: commensals, bionecrotrophs (including pathogens), and
saprophytes (Kostovcik et al., 2015). Ambrosia fungi are reliant on the beetles for
dispersal and survival. An evolutionary outcome of this codependency was the evolu-
tion of mycangia, specialized morphological structures on or within ambrosia beetles
that contain fungal propagules, and are important for the dispersal of fungi to new
beetle galleries and host trees. In Platypodinae mycangia are predominantly located
on the beetles prothorax, and consist of pit-like structures that harbour spores or
hyphae of the fungal symbionts (Mayers et al., 2015). The few studies that investi-
gated fungal symbionts of platypodines revealed fungi of the genus Raffaelea within
the order Ophiostomatales (Ascomycota) that also includes severe phytopathogens
like the Dutch elm disease agents within the genus Ophiostoma (Dreaden et al., 2014;
Massoumi Alamouti et al., 2009).

The genus Raffaelea is polyphyletic and can be grouped into two subclades, Raf-
faelea sensu stricto and Leptographium sensu lato (de Beer and Wingfield, 2013).
The only known pythopathogens within Raffaelea are Raffaelea lauricola, Raffaelea
quercus-mongolicae and Raffaelea quercivorus; the other known Raffaelea species are
assumed to be saprophytic (Dreaden et al., 2014; Harrington et al., 2008; Kim et al.,
2009; Kubono and Ito, 2002). The overall still sparsely described species diversity
within this genus and the question about its origin is a major challenge in resolving
their evolutionary history with Platypodinae and Scolytinae. Recently a new species
of a new ambrosia fungus genus, Afroraffaelea, was described and the authors con-
cluded that it might be a basal species within the ambrosia fungi (Bateman et al.,

17
2017). This fungus was found in association with a scolytine developing in decaying
wood, indicative of a saprophytic origin of the fungus. However, this species was asso-
ciated with a scolytine when, in contrast to this, platypodines are considered the more
basal and more ancient fungal farmers (Vanderpool et al., 2017). Therefore, the diver-
sity of fungal symbionts of Platypodines will require more extensive characterisation.
One of the basal lineages of the subfamily Platypodinae is the monotypic Australian
endemic species Austroplatypus incompertus. Its eusocial behaviour is unique within
ambrosia beetles, and also within beetles in general (Kent and Simpson, 1992). Gal-
leries of this Eucalyptus specialist are established by a mated single foundress female
that then spends 30 or more years in producing offspring cohorts without noticeably
impacting tree health. Male and most female offspring leave the galleries while several
daughters remain and effectively become non-reproducing workers in the foundress
gallery (Smith et al., 2018).

It has previously been reported that the fungal symbiont of A. incompertus may be
an Ambrosiella sp. (Kent and Simpson, 1992) which would be in contrast to the fact
that all fungal symbionts isolated from platypodines are Raffaelea species. However,
this fungal symbiont has so far not been isolated and adequately described. Therefore,
we aimed to isolate and characterise the fungal symbiont of this species. Based on
descriptions of ambrosia fungi from other platypodines, and based on the fact that A.
incompertus is an ancient platypodine lineage, we hypothesized that this beetle forms
symbioses with an ancestral Ophiostomatales species. However, its host tree genus
Eucalyptus is relatively young (Crisp et al., 2011) and therefore this beetle-host tree
association would have evolved more recently, potentially allowing a more recent ac-
quisition of a fungal symbiont. We expected to find a fungus within the polyphyletic
genus of Raffaelea as nearly all known associates of individual platypodine species
are one or more Raffaelea species (Table: 2.1). Furthermore we analysed the fungal
symbionts that have previously been isolated from two phylogenetically younger Aus-
tralian ambrosia beetle species, Platypus semigranosus and Platypus subgranosus, in
order to investigate whether they are also associated with Raffaelea and to explore the
diversity of these fungi in Australia. These two Platypus species are not eusocial and
develop in dead or already dying trees, and the latter can transmit a phytopathogen,
Davidsoniella (Chalara) australis, in Nothofagus cunninghamii (Kile and Hall, 1988).

Our study is the first report of newly described Raffaelea species from Australian
Platypodinae and advances the study of fungal systematics for ambrosia beetles. In

18
addition, we characterised growth rates at different temperatures and response to
ethanol of these three new Raffaelea species. For growth rates, we expected that
the fungal symbiont of A. incompertus with long-lasting gallery systems in living
trees would be slow growing and better adapted to cooler conditions than the fungal
symbionts of the platypodines developing in dying or dead trees. A recent study
by Ranger et al. (2018) demonstrated that ambrosia fungi of scolytines grow better
than environmental competitors like Aspergillus when on media containing 1 to 2.5%
ethanol. The authors concluded, that ambrosia fungi are adapted to ethanol that
develop in fermentation processes during wood decay, and ethanol emission might
also be an important factor in host tree finding by the beetles. Therefore, we tested if
fungal symbionts of Australian platypodines also have a positive response to ethanol
contained in the growth medium. We hypothesised that ambrosia fungi of P. semigra-
nosus and P. subgranosus would have growth and responses to ethanol rates similar
to Raffaelea species as described in the study by (Ranger et al., 2018), because these
two beetle species attack dying or dead trees. In contrast, for the fungal symbiont
of A. incompertus we expected that it would have a negative response to ethanol,
because it develops in living Eucalyptus trees without causing significant wood decay.

19
Table 2.1: List of ambrosia fungi isolated from Platypodinae. The table summarizes
the known fungal symbionts of Platypodinae based on published literature

20
2.3 Material and methods
2.3.1 Collection of A. incompertus and fungal isolation
Adults of A. incompertus emerging from galleries were collected from Olney and
Termeil State Forests and Dorrigo National Park in New South Wales (Figure: 2.1)
from March to May 2016. Beetles were trapped using brass gauze mini-cages which
were attached to beetle gallery entries approximately at breast height on living mature
Eucalyptus pilularis (blackbutt) and Eucalyptus piperita (Sydney peppermint) trees
(Kent, 2008a, 2001). The mini-cages were checked every week and individuals were
transferred into microcentrifuge tubes, brought to the laboratory alive and stored at
4 °C until further investigation. At each site, one gallery from each of three trees
was accessed. Three females and three males were collected per gallery. In total, 72
beetles were analysed for all three sites: 36 beetles from Olney (E. pilularis and E.
piperita) and 18 beetles per site from Termeil and Dorrigo (E. pilularis).

The beetles were washed vigorously in 500 µl sterilized water and 100 µl aliquotes of
this wash solution were spread on each of four 2% malt-extract agar (MEA) plates
containing streptomycin (100 mg/mL) and penicillin (7 mg/mL). In addition, one
100 µl aliquot was spread on 2 % MEA containing 500 mg/L cycloheximide (CSMA)
as a selective agent for ophiostomatoid fungi which are not inhibited by this anti-
fungal agent (Harrington, 1981). Furthermore, mycangia from female beetles were
dissected after the washing step and placed onto 2% MEA containing streptomycin
(100 mg/mL) and penicillin (7 mg/mL). This step was performed without sterilizing
the beetle surface because a previous study indicates that the pronotal mycangia of
A. incompertus are relatively shallow (Kent, 2008b) and surface sterilization could
result in the destruction or removal of any fungi within it. After plating, all plates
were kept in an incubator at a temperature of 25 °C and without light. Plates were
checked each day for up to four weeks and growing mycelia were transferred onto 2
% MEA to establish pure cultures after counting the number of established fungal
colonies on each plate. Cultures were assessed in the first weeks of growth and were
sorted into morphotypes according to their morphological features such as growth
structure, texture and colour of the mycelium.

Initially, one isolate for each morphotype was sequenced (beta-tubulin gene) to link
the different morphotypes to DNA sequence data and to allow comparisons with
DNA sequences deposited in databases. Based on sequence similarity all Raffaelea

21
 Dorrigo

Olney

Termeil
km
200

Figure 2.1: Map of Australia with the collection sites of beetles and isolates.

morphotypes were characterised further. Isolates that were not sequenced were kept
in the unidentified category in order to avoid false species identifications based on
morphospecies groupings.

2.3.2 Isolates of Raffaelea sp. from Platypus semigranosus

and Platypus subgranosus
Four isolates of Raffaelea sp. were obtained from the New South Wales Department
of Primary Industries (NSW DPI) culture collection in Orange, New South Wales.
DAR 34208 was isolated by Glen A. Kile from Platypus subgranosus in Smithton
in Tasmania in 1977. DAR 50136 and DAR 50137 were isolated from the same
beetle species collected in Arve Valley in Tasmania in 1982 and 1984. The isolate
DAR 82893 was isolated from Platypus semigranosus infesting Pinus radiata in Bondi
State Forest in southern New South Wales by Angus Carnegie and Chris Anderson
from the Department of Primary Industries in Orange in 2015. Furthermore, we
also isolated Raffaelea sp. from other P. semigranosus specimens from the same
forest and characterised the beta-tubulin gene of these isolates (Figure: A.2). The
beta-tubulin gene was used due to reliable amplification and good qualtity of the
sequences. However, due to a mite infestation, we lost these independent isolates and
therefore base the description of the fungal symbiont of this beetle species on the
culture obtained from NSW DPI.

2.3.3 Growth rate, morphology and microscopy

The growth of all Raffaelea isolates was measured by harvesting fresh mycelium of
the subcultured isolate with a 5 mm cork borer and transferring it onto 2% MEA.
The mycelia were then incubated at six different temperatures (10 to 35 °C) with

22
increments of 5 °C. After 14 days the diameter of each isolate was measured and
scanned. Morphological characterization of the isolated species was conducted using
a Nikon Eclipse microscope mounted with a Nikon D2 camera. In addition to the
observation of morphological characteristics on 2% MEA plates, slide cultures of all
isolates were prepared using a previously described technique (Riddell, 1950). For
each Raffaelea isolate the size of 50 spores and 15 conidiophores were measured when
available and the median diameter and standard deviation were calculated.

2.3.4 Ethanol response assay

Fresh fungal mycelium of all three ambrosia fungi isolated from the three Australian
platypodines as well as mycelium of the plant pathogen Quambalaria sp. isolated
from the surface of A. incompertus and confirmed with the marker ITS2 (Ihrmark
et al., 2012), was extracted with a 3 mm cork borer, placed on a piece of cellophane
on 3% MEA. The media contained ethanol that was added after the media was
cooled down to 40 °C to achieve concentrations of 1% (v/v), 2.5% (v/v) and 5%
(v/v). Sterile water was added as a control. After 14 days we measured the fresh
weight of the mycelium by scraping it from the plate and transferring it into an
microcentrifuge tube. The tube was transferred into a drying oven at 37 °C and the
dry weight was measured after 6 weeks. The effect of the ethanol concentration on
mycelium dry weight of the fungal species was tested using R 3.4.2 (R Development
Core Team 2016) by fitting a linear model using the lm() function and computing
marginal estimated means (least-square means) on ethanol concentration by species
using the emmeans package. Tukeys range test was than used for comparing the four
ethanol concentrations.

2.3.5 DNA extraction and PCR amplification

DNA from one to two week old mycelium, grown on cellophane placed over a 2 %
MEA plate containing streptomycin (100 mg/mL) and penicillin (7 mg/mL), was
extracted using the MoBio Powersoil Kit (MO BIO Laboratories, Inc., Carlsbad, CA,
USA) following the manufacturer’s instructions. Then, three fungal gene regions were
successfully amplified: ITS2 using the primers fITS7/ITS4, the beta-tubulin gene
using the primers Bt2b/T10 and the large ribosomal subunit (LSU) or the 28S rRNA
gene using the primers LROR/LR5 (Donaldson et al., 1995; Vilgalys and Hester,
1990; O’Donnell and Cigelnik, 1997). The PCR was carried out in a total volume of
10 µl containing 2 µl MyTaq buffer (including MgCl2, dNTPs, and reaction buffer),

23
0.2 µl of each primer (20 pmol/µl), 5.9 µl PCR grade water, 0.5 µl (5% DMSO (V/V)) ,
0.2 µl MyTaq polymerase (Bioline, USA) and 1 µl template . The amplification cycles
were as the following: for the beta-tubulin gene an initial denaturation step at 95 °C
for 3 min followed by 36 cycles of 95 °C denaturation for 45 sec, annealing at 48 °C
for 45 sec, extension at 72 °C for 1 min and a final extension step at 72 °C for 4 min;
for the 28S rRNA gene an initial denaturation step of 92 °C for 2 min followed by 40
cycles of 95 °C denaturation for 30 sec, annealing at 55 °C for 30 sec, extension at
72 °C for 1 min and a final extension step at 72 °C for 8min; for the ITS2 region an
initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C
for 30 sec, annealing at 51 °C for 30 sec, elongation at 72 °C for 1 min and a final
extension at 72 °C for 8min.

PCR products were purified using the Promega KitWizard SV Gel and PCR Clean-Up
System (Promega, Madison,WI, USA) in case of strong primer dimers. Preparation
of PCR amplicons for direct sequencing involved treatment with a combination of
0.5 U Exonuclease I (New England Biolabs, Ipswich, MA, USA) and 0.25 U Shrimp
Alkaline Phosphatase (Promega), with incubation at 37 °C for 30 min, then 95 °C for
5 min. Then, the PCR products were sequenced with both the forward and reverse
primers on an Applied Biosystems 3500 Genetic Analyser.

2.3.6 Phylogenetic analyses

The obtained sequences were compared with sequences on the NCBI Database (http:
//ncbi.nlm.nih.gov) by using BLAST (Basic Local Alignment Search Tool) (Altschul
et al., 1990). Due to an insufficient number of Raffaelea ITS2 sequences in the NCBI
database we utilized the 28S rRNA and beta-tubulin genes for phylogenetic analyses.
Homologous sequences from within the Ophiostomatales were used to place the Aus-
tralian Raffaelea species in a phylogenetic context (Suppl. Table1). Sequences were
aligned using the online version of MAFFT (Katoh et al., 2017) with the G-INS-1
method and the alignment was visualized in Seaview (Galtier et al., 1996) to check
and correct the alignment by eye. For the beta-tubulin gene we used the exons 3,
4, 5 and 6 (de Beer and Wingfield, 2013; DiGuistini et al., 2011; Yin et al., 2015)
to build the phylogenetic inferences, and for LSU the entire gene region was used.
We concatenated both gene alignments using Geneious and used Partitionfinder 2 to
obtain the best partition scheme and substitution models for both genes using the
codon positions for the protein-coding gene. Maximum-Likelihood inferences (ML)
were computed using IQ-Tree (Nguyen et al., 2015) with 1,000 bootstrap replicates

24
using UFBoot (Minh et al., 2013). The tree was generated using the python API
ETE3 (Huerta-Cepas et al., 2016).

25
2.4 Results
We successfully isolated Raffaelea from 20 of the 72 A. incompertus beetles, with
Raffaelea sp. comprising 8.7% of all colony forming units (CFUs) and these were
also confirmed by sequence analysis. Furthermore, we grouped other isolates into
a Raffaelea-like morphotype without sequencing them, and together with Raffaelea
these comprised 21.5% of all CFUs. In addition, in the quest of identifying Raffaelea
sp. via sequencing we obtained for some fungal isolates BLAST search hits to fungi in
the genus Quambalaria and other fungal pathogens. Due to the large number not all
fungal isolates were characterised by sequence analysis and these fungi were grouped
into an unidentified category (Table: 2.2).

Table 2.2: Isolation of different fungi from Austroplatypus incompertus across three
different forest sites in New South Wales. The number of beetles represent the indi-
viduals from which particular fungi were isolated. Some individuals delivered more
than one fungal species, while from other beetles no fungi were isolated. In total we
isolated fungi from 50 out of 72 beetles.

Location Number of Beetles Colony forming Unit (CFU/100 µl) Fungal Species

27 1876 unidentified
13 222 Raffaelea sp.
1 41 Cryptococcus sp.
1 36 Quambalaria sp.
Olney State Forest
1 30 Penicillium sp.
1 25 Rhodoturula sp.
2 4 Cladosporium sp.
7 None no fungi isolated

7 462 unidentified
2 34 Phaemoniella sp.
Termeil State Forest 2 32 Raffaelea sp.
1 1 Rhinocladiella sp.
11 None no fungi isolated

11 243 unidentified
Dorrigo National Park 5 9 Raffaelea sp.
4 None no fungi isolated

26
2.4.1 Molecular characterisation of the Raffaelea isolates
Sequence analysis of the 28S rRNA and beta-tubulin genes resulted in the detection
of three distinct Raffaelea species, which were later named Raffaelea kentii sp. nov.
from A. incompertus, Raffaelea kilii sp. nov. from P. subgranosus, and Raffaelea
spirulatus sp. nov. from P. semigranosus.

2.4.2 Phylogenetic analysis and placement of the three new

Raffaelea species
The phylogenetic analysis of the concatenated 28S rRNA and the beta-tubulin genes
showed that Raffaelea is polyphyletic, with the Raffaela sulphurea complex residing
in Leptographium sensu lato (100% ML bootstrap) and Raffaelea sensu stricto be-
ing the sister clade (96% ML bootstrap). All isolates from Australian platypodines
grouped within the Raffaelea sensu stricto clade (Figure: 2.2). The culture DAR82893
(Raffaelea spirulatus sp. nov.) isolated from P. semigranosus was closely related to
Raffaelea albimanens previously isolated from the surface of Crossotarsus externeden-
tatus found in Ficus sycomorus (sycamore fig) in South Africa (Scott and Du Toit,
1970) with a node split of 100%. The Raffaelea isolates from P. semigranosus and
P. subgranosus formed a clade. The three isolates from P. subgranosus (DAR 50137,
DAR 50136 and DAR 34208) were diverged from three isolates from A. incompertus
(CMW 49901, CMW 49902, CMW 49903) with a ML bootstrap support of 100%. Fur-
thermore, the isolate DAR34208 was very similar (with few SNPs) and was therefore
considered a variant of the isolates DAR 50137 and DAR 50136. The three isolates
obtained from A. incompertus collected from E. pilularis across three different sites
were identical to each other in all three gene amplicons. Interestingly, a Raffaelea
sp. isolate from A. incompertus inhabiting E. piperita (CMW50197) had a one base
pair substitution in the beta tubulin gene, compared to other Raffaelea isolates of A.
incompertus while still being part of this clade. All new species of Raffaelea s. str.
possessed the complete set of the beta-tubulin introns 3, 4 and 5, and the isolates
from P. subgranosus and A. incompertus formed a distinct clade within Raffaelea s.
str. (95% ML bootstrap). The sequence matrix for the 28S rRNA and beta-tubulin
genes will be deposited in TreeBASE. Furthermore, the beta-tubulin gene sequences
obtained from the additional fungal isolates from P. semigranosus that were then
lost to a mite infestation confirmed the presence of R. spirulatus in these beetles, but
also delivered an additional new beta-tubulin sequence suggesting further Raffaelea
diversity in P. semigranosus as well.

27
Figure 2.2: Phylogenetic tree based on Maximum-likelihood inference with 1000
bootstraps displaying the phylogenetic placement of the three newly described Raf-
faelea species within Raffaelea sensu stricto. A fourth species (CMW50197) has been
isolated from an individual of Austroplatypus incompertus from Eucalyptus piperita
but still requires formal description. Tree is based on two genes and a number of 1457
bp. Numbers close to nodes represent bootstrap values, scale bar represents branch
lengths. The phylogenetic tree is based on concatenated 28S rRNA and beta-tubulin
(exons) gene sequences.

Raffaelea lauricola
complex

Raffaelea
sensu lato

Raffaelea sulphurea
complex

Leptographium
sensu lato

28
2.4.3 Growth of different Raffaelea species at different tem-
peratures and their response to ethanol
The growth for all three Raffaelea species varied; Raffaelea kentii sp. nov. from A.
incompertus grew best at 20 °C; Raffaelea spirulatus sp. nov. from P. semigranosus
and Raffaelea kilii sp. nov. from P. subgranosus both grew best at 25 °C. Further-
more, the fungal species from A. incompertus was slower growing than the other two
species and did not show any growth at 30 °C (Figure: 2.3).

The dry weight for all Raffaelea species decreased significantly with increasing ethanol
concentration in the medium. In contrast, Quambalaria sp. performed slightly better
at 1% ethanol compared to the control. Furthermore, the Raffaelea species from A.
incompertus had the lowest biomass compared other tested fungi (Figure: 2.4)

Figure 2.3: Growth rates of the different isolates, presented as the mean colony
diameter when grown at different temperatures for 14 days. Boxes represent quartiles,
and whiskers extend to show the rest of the distribution. Diamonds represent outliers.
No colonies were formed for R. kentii at 30 °C, and no colonies for all three fungi at
35 °C.

29
 a
a
0.015 a
a

ab b
b
Ethanol
dry weight in mg

0.010 b a Concentration
a 0

c 1
b 2.5
5

0.005
c

c
c
c

0.000

Quambalaria sp. Raffaelea kentii Raffaelea kilii Raffaelea spirulatus

Fungal species

Figure 2.4: Response to ethanol of three Raffaelea isolates from three Australian
platypodine species and Quambalaria sp. isolated from A. incompertus. The letters
indicate the statistical difference (Tukey test) within each species.

2.4.4 Taxonomy
Raffaelea kentii sp. nov. Robert Mueller and Wilhelm de Beer

Etymology: The epithet kentii refers to the entomologist Deborah S. Kent, who
dedicated part of her career to the research of A. incompertus and other Platypodinae
in Australia.

Diagnosis: Conidiogenous cells 14.52 µm(±22.5) × 1.81 µm(±0.31), hyaline, some-

times irregular; conidia either at conidiogenous cell apex or sessile and lateral; coni-
dia globose to ovoid 5.22 µm(±0.7) × 2.73 ( ± 0.35), and elongate 8.73 µm(±1.36) ×
2.32 µm(±0.35), oval truncated at base, hyaline, yeast-like budding. Hyphae showed
anastomosis like features (hyphal fusions).

Type: Australia: New South Wales: Termeil State Forest, cultured from A. in-
compertus collected from E. pilularis, April 2016, Robert Mueller and Shannon M.

30
Smith (CMW49903 holotype; CMW 49903 ex-type culture); additional specimens
examined: CMW 49901, CMW 49904.

Description: Colonies vary in colour between populations of isolation. On MEA

plates all are initially cream coloured and change from cream to dark green with age.
After 14 days in the dark, the colony diameter was 24.06 (±3.4) mm at the opti-
mal growth temperature of 20 °C; 13.6 (±4.7) mm at 25 °C; no growth occurred at
35 °C. Conidiogenous cells were hyaline, micronematous, with conidia forming at the
apex, occasionally sessile and lateral. Conidia produced were single, aseptate, hyaline,
globose to ovoid, sometimes elongate, and often truncated at the base, 5.22(±0.7) ×
2.73(±0.35) m round spores, elongate spores 8.73 µm(±1.36)×2.32 µm(±0.35). Coni-
dia produced budding cells. Sexual morph unknown.

Figure 2.5: Raffaelea kentii (CMW49903) Top left: morphology when grown at 20
°C (scale bar = 1 cm); top right and bottom left: hyphal bridges and hyphal fusions;
elongated spores formed at the tip of the hyphae; bottom right: elongated and ovoid
spores (scale bars = 10 µm).

31
Raffaelea kilii sp. nov. Robert Mueller and Wilhelm de Beer

Etymology: The epithet kilii refers to forest pathologist Glen A. Kile who isolated
this fungus and published key studies of fungal associates of P. subgranosus, the vector
of Davidsoniella (formerly Chalara) australis (Microascales) causing myrtle wilt in
Nothofagus cunninghamii.

Diagnosis: Conidiogenous cells 14.22 µm(±8.28) × 2.57 µm(±0.36), hyaline, conidia

either at conidiogenous cell apex or sessile and lateral; conidia globose to ovoid,
6.097059(1.22) 4.71(0.45) m, oval truncated at base, hyaline, yeast-like budding.

Type: Australia: Tasmania, Arve Valley, cultured from P. subgranosus, 1982, Glen
A. Kile (DAR50136 holotype; DAR 50136 ex-type culture); additional specimens
examined: DAR 50137, DAR 34208.

Description: Colonies initially cream coloured, varying with age from cream to light
green on MEA plates; reverse subhyaline. After 14 days in the dark, colony diameter
was 39.94 (±1.18) mm at the optimal growth temperature of 25 °C; 32.50 (±1.44) mm
at 20 °C; no growth occurred at 35 °C. Conidiogenous cells hyaline, micronematous,
with conidia forming at apex, occasionally sessile and lateral. Conidia produced
singly, aseptate, hyaline, globose to ovoid, sometimes elongate, and often truncated
at base, 6.1 µm(±1.22) × 4.71 µm(±0.45). Conidia produced budding cells. Sexual
morph unknown.

Raffaelea spirulatus sp. nov. Robert Mueller and Wilhelm de Beer

Etymology: The epithet spirulatus refers to the mycelium forming spiraling hyphal
structures in culture.

Diagnosis: Conidiogenous cells 16.37 µm(±12.29) × 1.95 µm(±0.75), hyaline, some-

times irregular; hyphae form spirals with conidia at conidiogenous cell apex; conidia
globose to ovoid, 5.41 µm(±0.77) × 4.72 µm(±0.71), oval truncated at base, hyaline,
yeast-like budding.

32
Figure 2.6: Raffaelea kilii (DAR50136) Top left: morphology when grown at 25°C
(scale bar = 1 cm); top right: yeast-like cells with elongate to ovoid cells; bottom
left: hyphae with elongated and ovoid conidia at the tips; bottom right: ovoid conidia
fromimg from hyphae (scale bars = 10 µm).

Type: Australia: New South Wales: Bondi State Forest, cultured from P. semigra-
nosus collected from dead Pinus radiata, October 2015, Angus Carnegie (DAR 82893
holotype; DAR 82893 ex-type culture);

Description: Colonies initially cream, varying with age from cream to dark green
on MEA. After 14 days in the dark, the colony diameter was 34.61 (±0.60) mm at
the optimal growth temperature of 25 °C ; 28.33 (±1.30) mm at 20 °C; no growth
occurred at 35 °C. Conidiogenous cells hyaline, with conidia forming at apex. Conidia
produced singly, aseptate, hyaline, globose to ovoid, and often truncated at base,

33
5.41 µm(±0.77) × 4.72 µm(±0.71). Conidia produced budding cells. Sexual morph
unknown.

Figure 2.7: Raffaelea spirulatus (DAR82893). Top left: morphology and colour of
mycelium in culture at 25 °C (scale bar = 1 cm); top right: spiral pattern of hyphae
and conidia formed laterally; bottom left and right: hyphae form spiral patterns and
have ovoid conidia at the tips (scale bars = 20 µm).

34
2.5 Discussion

Ambrosia beetles are one of the oldest animal lineages that evolved the ability to farm
fungi as their primary food source 50 to 90 million years ago (Farrell et al., 2001;
Jordal, 2015; Vanderpool et al., 2017). In contrast to one of the two ambrosia beetle
subfamilies, Scolytinae, the other ambrosia beetle subfamily Platypodinae is sub-
stantially older and may have evolved fungal farming prior to Scolytinae. Therefore,
Platypodinae are likely the oldest lineage of fungal farmers (Vanderpool et al., 2017).
However, the evolutionary ecology of Platypodinae is not yet fully resolved. It has re-
cently been demonstrated that two Australian-endemic species are ancient monotypic
genera; N. elongatus is basal to the Platypodinae tribe Tesserocerini, and A. incom-
pertus is basal to the tribe Platypodini (Jordal, 2015), confirming that Australasia is
an important source for Platypodinae diversity. Our study is first to investigate the
fungal associates of three platypodine species from Australia, including the ancient
lineage A. incompertus, and more derived P. semigranosus and P. subgranosus.

We demonstrate that Raffaelea ssp. are fungal associates of these three Australian
species, and describe three new Raffaelea species. The genus Raffaelea is commonly
associated with ambrosia beetles in the subfamily Platypodinae (Table: 2.1). How-
ever, several studies have found that ambrosia beetles can be associated with different
Raffaelea species throughout their range (Ceriani-Nakamurakare et al., 2016; Inácio
et al., 2008; Li et al., 2018b; Scott and Du Toit, 1970).

For A. incompertus we predominantly isolated Raffaelea kentii sp. nov. from spec-
imens emerging from E. pilularis across three geographically distant sites, while we
also found a diverged Raffaelea sp. from E. piperita tree at one of these three sites.
For P. semigranosus and P. subgranosus we were only able to access fungal isolates
that have previously been obtained from beetle specimens collected at one site per
beetle species. This approach resulted in the description of R. spirulatus sp. nov.
from P. semigranosus and R. kilii sp. nov. from P. subgranosus with a sequence
variant also found for the latter. Whether these beetle species are associated with
more Raffaelea species will require further investigation in the future. Using mi-
crobiological isolation techniques such as plating of fungal washes from beetles, or
plating of myangial tissues may bias the results due to high intraspecific competition

35
on the plate, and the media used may select for certain fungi. That said, a possi-
ble biological reason for a limited diversity of fungal symbionts in A. incompertus
could be its unusual life history as a long-lived beetle that inhabits the same gallery
over a substantial period of time, together with its symbiotic fungus and without
noticeably affecting tree health. This indicates an environment that should be fairly
stable through longer time periods and may not allow a rapid a succession of different
Raffaelea species and other fungi within a gallery.

For P. semigranosus and P. subgranosus the hypothesis of multiple associated Raf-

faelea species, due their shorter life cycles seems more plausible, since other studies
revealed that there is succession of fungal species within one gallery of scolytine
ambrosia beetles, which might be due to the short inhabitation of these galleries
(Biedermann et al., 2013).

The Raffaelea species associated with A. incompertus and P. subgranosus are closely
related, and form a Australasian clade. However, R. spirulatus sp. nov. is a closely
related species to Raffaelea albimanens. This fungus was isolated from Crossotarsus
externendatus collected from an African sycamore fig in South Africa; however this
beetle species may have originated from the oriental region (Beaver and Liu, 2013)
from where it may have accidentally been introduced by humans. As a side note,
the P. semigranosus specimens were collected from Pinus radiata struck by lightning
(A. Carnegie, personal communication) and this constitutes a new host tree record
to the many host tree species that this beetle can develop in (J. Bickerstaff, personal
communication).

We tested ethanol sensitivity for the three new Raffaelea species from Platypodinae
and found that all three fungi are negatively impacted by ethanol, and, in contrast
to Scolytinae, ethanol might not play an important selective role in the evolution of
fungal farming in platypodines. However, the experiment was only conducted at room
temperature. The different fungi have different growth maxima, so the response to
ethanol might vary at different growing temperatures and this needs further testing.
In addition, we did not test if the concentration of ethanol was stable over the two
weeks.

Furthermore, phylogenetic analyses based on two genes placed the species Afroraffae-
lea ambrosiae associated with Premnobius cavipennis at the base of Raffaelea s. l.,

36
yet this species had previously been suggested to be an ancestral lineage of ambrosia
fungi (Bateman et al., 2017). Other studies have already raised doubts as to whether
it is possible to draw conclusions about the origin of fungal farming in ambrosia bee-
tles based on a few marker genes (Vanderpool et al., 2017). Similarly it may not be
conclusive to interpret evolutionary history of ambrosia symbioses based on a small
sample set of beetle populations and/or species. In our study it appears that closely
related Raffaelea taxa were found across one ancient basal and two evolutionarily
more derived Platypodinae taxa. Therefore one could conclude that the evolutionary
age of an ambrosia beetle species may not necessarily mean that it is also associated
with an ancient ambrosia fungus. It will be particularly important to obtain more
information about the fungal association of many lineages, including basal lineages,
and for many populations of individual beetle species. For example a wider analysis
of the microbial communities of A. incompertus across its range will reveal how con-
served its microbiome is. Besides A. incompertus included in this study, the fungal
associates of the basal species N. elongatus of the Platypodinae tribe Tesserocerini
should also be investigated. Genome sequencing efforts of fungi isolated from am-
brosia beetles (Vanderpool et al., 2017) and the discovery of more fungal associates
of these interesting group of insects might shed light on the mysteries in the oldest
fungus farming clade of insects.

37
Chapter 3

Microbial communities of the

uniquely eusocial ambrosia beetle,
Austroplatypus incompertus,
exhibit structure at small spatial
scales and overlap in composition
at large spatial scales

3.1 Abstract

Fungal farming in insects is a form of agricultural practice similar to the one per-
formed by humans. It evolved independently in members of three major insect orders:
attine ants, macrotermitine termites and ambrosia beetles. The microbial diversity
and mechanisms shaping fungal symbioses are less studied in ambrosia beetles than
in ants and termites. Ambrosia beetles belong to two weevil subfamilies, Platypodi-
nae and Scolytinae, and derive their nutrition entirely from farming symbiotic fungi.
Platypodinae evolved about 90 million years ago, and possibly constitute the oldest
lineage of fungal farming insects. Australian endemic Austroplatypus incompertus is
a basal lineage within the tribe Platypodini. It is the only eusocial beetle species and
one amongst few ambrosia beetle species to develop in living trees without noticeably
affecting tree health. Despite this unique biology, little is known about its microbial

38
interactions. Its fungal symbiont, Raffaelea kentii, has recently been described. Here
we characterised the microbial communities of A. incompertus within its distribution
spanning approximately 1,000 km along the Great Dividing Range. We used targeted
PCR to detect the primary fungal symbiont and high-throughput DNA sequencing to
characterise fungal and bacterial communities of beetles emerging from individual gal-
leries, each established by a foundress female and her offspring, across trees and sites.
Our aim was to understand the relative importance of beetle characteristics (genetic
relationship and presence of R. kentii) and habitat variation (tree characteristics and
spatial positions) on beetle-associated microbial communities. The spatial position
of the colonised trees within sites was a strong predictor for the microbial commu-
nity composition and structure. The northernmost A. incompertus population with
a distinct mitochondrial lineage harboured microbial communities that were indistin-
guishable from populations further south. Furthermore, R. kentii was not detected in
all beetles but this did not influence the other microbiota. It still remains to be tested
whether family relatedness and bacterial diversity influence the microbial community
structure across galleries.

3.2 Introduction

The symbioses between insects and microbes are ubiquitous and diverse. Microbes
play an important role in insect biology, for example, by providing a nutritional
benefit, allowing niche utilization, conferring a competitive advantage, or defending
hosts from external biotic or abiotic factors (Gibson and Hunter, 2010; Feldhaar,
2011). The complexity of microbial symbioses in fungal farming insects is particularly
fascinating because it can involve several phylogenetically-diverse species.

The symbioses of fungus-farming ants (Attinae) are intricate as they involve mutu-
alistic and parasitic fungi as well as symbiotic bacteria. Attine ants depend on fungi
within the Leucocoprineae (Basidiomycota: Agaricales) (Mueller et al., 1998; Schultz
and Brady, 2008). However, Escovopsis fungi (Ascomycota: Hypocreales) can para-
sitise and outcompete the ant-grown fungus and, as a consequence, decimate entire
ant colonies. Some Actinobacteria associated with attine ants can produce antibi-
otics to deter the growth of Escovopsis (Currie et al., 2003; Li et al., 2018a). The

39
highly eusocial behaviour of ants might have contributed to the evolution of this in-
triguing fungal farming system. Other highly eusocial insects have also evolved the
ability of fungal farming, as seen in termites of the Macrotermitinae. These termites
are dependent on Termitomyces species (Basidiomycota: Agaricales) (Aanen et al.,
2002; Aanen and Boomsma, 2006), but their interactions with other microbes are less
known. Ambrosia beetles are a third group of fungal-farming insects.

In contrast to the monophyletic groups of Attinae and Macrotermitinae, ambrosia

beetles consist of two more distantly related subfamilies of weevils, the Scolytinae and
the Platypodinae (Farrell et al., 2001; Hulcr and Stelinski, 2017; Jordal et al., 2011).
The Scolytinae include both bark and ambrosia beetles, with the latter depending
entirely on consumption of farmed fungi throughout their entire development. Scoly-
tine ambrosia beetles are fairly well studied, display several transitions from asocial to
subsocial life histories and an ability to farm Basidiomycota and Ascomycota species
(Batra, 1966; Biedermann and Taborsky, 2011; Kasson et al., 2016; Kirkendall et al.,
1997). In contrast very little is known about the Platypodinae (or pinhole borers)
that are exclusively considered as ambrosia beetles. This subfamily is believed to be
the oldest fungal farming group of insects, with an estimated age of approximately
86 million years (Jordal, 2015; Vanderpool et al., 2017).

So far, species in the subfamily of Platypodinae have been found to only farm fungi
within the Ascomycota and the . The subfamily is split into three tribes: Schedlarini,
Tesserocerini and Platypodini (Jordal, 2015). The latter tribe contains a basal species,
Austroplatypus incompertus, the only known eusocial beetle with several other distinc-
tive characteristics (Jordal, 2015; Kent and Simpson, 1992). Individuals of this species
have been estimated to survive in living trees for up to 40 years without recognisably
affecting tree health (Smith et al., 2018). The dispersal of ambrosia fungi within and
between galleries across trees is completely reliant on ambrosia beetles. In contrast,
the symbiotic fungi of fungal farming ants and termites are not exclusively dispersed
by their insect partners, but they can be dispersed as spores by other vectors and
environmental factors (Mikheyev et al., 2006; Nobre et al., 2011; van de Peppel et al.,
2018). Ants and termites can actively manage their fungal gardens, however, it is
mostly unknown how ambrosia beetles protect their fungal gardens from parasites
(Mueller and Gerardo, 2002). So far, it has only been demonstrated for a scoly-
tine bark beetle species, the southern pine beetle Dendroctonus frontalis, that its
associated actinomycetes can suppress a competitive fungus that invades its primary

40
fungal symbiont (Scott et al., 2008). Symbiotic microbial communities of ambrosia
beetles are shaped by several factors, including the hosts, the hosts interactions with
other species as well as the environment (Foster et al., 2017). Overall, the microbial
communities of insects are dynamic, interactive and can consist of several fungal or
bacterial taxa (Aylward et al., 2014; Batra, 1966; Kostovcik et al., 2015).

Considerable research has been performed on the isolation and characterisation of

the primary fungal symbionts of ambrosia beetles (Simmons et al., 2016; Dreaden
et al., 2014; Bateman et al., 2015; Li et al., 2018b). Ambrosia beetles can carry their
primary fungal symbiont in specialized structures known as mycangia. These can be
found in different beetle body regions such as the mouthparts, the thorax, the wings
or legs (Francke-Grosmann, 1967). However, the overall factors that determine the
fungal and bacterial communities of ambrosia beetles have not been extensively stud-
ied. Previous studies of microbial community composition and structure in ambrosia
beetles were mostly performed on beetles trapped with flight interception traps, and,
therefore, with limited control of beetles origin from particular galleries (Kostovcik
et al., 2015; Bateman et al., 2017).

Here, we aimed to investigate the fungal and bacterial communities associated with
the eusocial platypodine A. incompertus within its distribution in eastern Australia.
This species is basal to the platypodine tribe of Platypodini, and is a specialist of
Eucalyptus trees (Kent, 2008a). It is recognized as the only eusocial beetle. A sin-
gle mated foundress establishes a gallery within healthy trees, together with non-
reproductive female offspring (Smith et al., 2018). A previous study by Smith (2013)
detected phylogeographic structuring across populations, with the most northern
tested population (Kerewong State Forest in northern NSW) carrying a distinct mi-
tochondrial haplotype that differed by 10% from haplotypes in southern populations.
Therefore, we tested whether these phylogeographic patterns influence the microbial
communities. Furthermore, we have previously isolated and described the fungal sym-
biont Raffaelea kentii (Ascomycota: Ophiostomatales) from this species (Chapter 2).
Here, we characterised the overall fungal community associated with this beetle. We
were also interested in the bacterial associates and expected to find relatives of bac-
terial taxa with known antimicrobial properties. The unique life history of eusocial
A. incompertus families developing in galleries formed by a single female and her fe-
male offspring in living and healthy trees enabled us to investigate genetic, ecological
and environmental factors that influence the microbial community composition and

41
structure. Here we investigated the influence of host tree species, host tree diameter
and spatial distribution within each site. We expected to find a core microbiome with
little variability across different populations, mostly defined by transmission within
beetle families and a weaker influence of ecological and environmental factors.

3.3 Material and methods

3.3.1 Beetle collection and metadata

We collected specimens of A. incompertus from living host trees across its distribution
in mesic Eucalyptus forests of New South Wales, Australia (Figure: 3.1) from April
to May in 2016 and 2017. We used micro-cages attached to the access holes of beetle
galleries (they act both as entry and exit holes) and checked the cages for emerging
beetles every 2-3 weeks. These micro-cages consisted of a brass-wire tube (35 mm x
55 mm; mesh size=2mm) fixed to the tree and covered by gauze (mesh size=0.3mm).
We placed emerging beetles into clean 2 mL microcentrifuge tubes and stored them at
4 °C while transported to the laboratory. There, we separated live from dead beetles
and sorted females from males based on the presence of mycangia on the prothorax
and spines on the elytral declivity in females (Kent, 2010). Then, we stored the
beetles at -80 °C until DNA extraction. In total we analysed 154 beetle specimens
collected from several Eucalyptus species (Table: 3.1). From each site, we included
beetle specimens from at least one host tree species, and each host tree species was
represented by one to four trees. From each tree, emerging beetles were collected from
one gallery and, consequently, beetles emerging from this one gallery were expected
to be siblings (Smith et al., 2018). For five of the six sites we analysed three to five
females and one male per gallery. From the Mount Wilson site we had fewer females
available. Furthermore, we collected metadata for each tree (Table: 3.1), including
host species identity (if available), host tree diameter (DBH), tree GPS coordinates,
and altitude.

42
Figure 3.1: Collection sites for Austroplatypus incompertus in New South Wales,
Australia.

3.3.2 DNA extraction and sequencing

We extracted DNA from 154 beetle specimens (Table: 3.1) using the DNeasy Power-
Soil Kit (Qiagen) following a modified protocol. Whole beetles were first ground in
the provided bead tubes with 60 µl C1 Buffer. Then, 4 µl proteinase K (20 mg/mL,
Qiagen) was added and incubated for 3 hours at 96 °C. After this, samples were
treated as per manufacturer’s protocol. DNA was eluted in 50 µl ultrapure water and
the DNA concentration was measured using Nanodrop and Qubit. In addition, two
extractions of ultrapure water were performed without any tissue to control for any
contamination in the kit reagents or purified water (Salter et al., 2014). Furthermore,
two mock communities were prepared to account for the detection success of micro-
bial symbionts and the correct taxonomic classification. The fungal mock community
contained DNA of a R. kentii isolate from A. incompertus (65%), Quambalaria sp.
(20%), Sistotrema sp. (5%), Dothideomycetes sp. (5%) and Candida sp. (5%). For
the bacterial mock community the DNA extract of the psyllid Cardiaspina sp. from
Eucalyptus moluccana with a previously characterised bacterial symbiont community
was included (Morrow et al. 2017). All 158 samples were sequenced with an Illu-
mina Miseq 300 paired end amplicon approach, using the primers fITS7/ITS4 for the
fungal ITS2 region and primers 341F/805R (Sinclair et al., 2015) for the bacterial
16S rRNA gene (Sinclair et al., 2015; Ihrmark et al., 2012). The library preparation,
quality control, clean-up and sequencing were performed at the Next Generation Se-
quencing (NGS) facility of Western Sydney University.

43
3.3.3 Detection of the symbiotic fungus of Austroplatypus
incompertus

The ITS region of Ophiostomatales is GC rich and therefore difficult to amplify.

Other studies have shown that detection of Raffaelea and other known fungal sym-
bionts can be weak or unsuccessful (Kostovcik et al., 2015), and we expected that it
would be difficult to demonstrate the presence of Raffaelea in our amplicon sequenc-
ing approach. Therefore, we designed species-specific primers based on sequences ob-
tained from previously isolated cultures of R. kentii (Chapter 2) using the online tool
Primer3. As input sequences we used the beta-tubulin gene (primers: Bt2b/T10) and
translation elongation factor 1-alpha gene (tef1) (primers: EF1-1018F/EF1-1620R)
(Stielow et al., 2015) of the isolate CMW44903 (Dorrigo National Park). We also used
the online tool PrimerDesign-M, which designs primers based on a multiple sequence
alignment. As the input alignment we used tef1 sequences of Raffaelea from A. incom-
pertus, Platypus semigranosus and Platypus subgranosus (Chapter 2). Furthermore,
we designed the primer RAFF1-BT manually using the sequence alignment of the
beta-tubulin gene of all R. kentii isolates (Table: 3.2). For each primer set we carried
out a temperature gradient PCR to determine the optimal annealing temperatures
using R. kentii as a positive control. The final PCR was carried out in a total volume
of 10 µl including 2 µl of 5x MyTaq Red buffer (with MgCl2, dNTPs, and reaction
buffer), 0.2 µl of each primer (20 mM), 5.9 µl PCR grade water, 0.5 µl (5% DMSO
(V/V)) , 0.2 µl (1 U) MyTaq Red polymerase (Bioline, USA) and 1 µl template DNA
from whole beetle extracts. The PCR cycles for the temperature gradient were as
follows: an initial denaturation step of 94 °C for 4 min, followed by 35 cycles of 94
°C for 45 sec, an annealing temperature gradient (in 5 °C steps from 50 °C to 65 °C)
for 30 sec, a elongation step at 72 °C for 1 min, and a final extension at 72 °C for
4 min. The PCR products were sequenced on an Applied Biosystems 3500 Genetic
Analyser and compared with the previously obtained sequences of R. kentii. For the
screening of R. kentii in all beetle samples, we chose the primer pair Raff7 which had
the strongest band and best amplification results at an annealing temperature of 55
°C.

44
 Location Host Gallery (Year) Coordinates Number of Beetles

4C (2017) 30°210 4500 S152°470 54.600 E

Dorrigo National Park Eucalyptus pilularis 6B(2017) 30°210 46.400 S152°470 53.500 E
5♀, 1♂

12A(2017) 30°210 47.500 S152°470 55.300 E

5♀, 1♂
4♀, 2♂

2B (2017) 33°050 47.800 S151°210 06.800 E 5♀,

12A (2017) 33°050 43.800 S151°210 07.600 E 5♀,
1♂
Eucalyptus pilularis
21A (2016) 33°050 51.700 S151°200 59.600 E 5♀,
1♂

4A (2017) 33°050 47.000 S151°210 05.400 E 3♀,

1♂

Olney State Forest

1♂

14B (2017) 33°050 43.800 S151°210 07.600 E

Eucayptus piperita
16D (2016) 33°050 43.400 S151°210 08.300 E
5♀, 1♂

13C (2016) 33°050 43.800 S151°200 07.600 E

5♀, 1♂
5♀, 1♂

Eucalyptus sp. (A) 1B (2017) 33°290 43.400 S150°240 11.900 E

5B (2016) 33°290 43.800 S150°240 10.400 E
5♀, 1♂

6A (2016) 33°290 46.300 S150°240 08.600 E 2♀

4♀, 2♂
Mount Wilson
2A (2016) 33°290 43.400 S150°240 10.800 E 1♀

Eucayptus sieberi 10A (2016) 33°290 44.900 S150°240 04.000 E 1♀

Eucalyptus sp. (A) 2A (2016) 34°170 51.200 S149°570 00.700 E

45
5♀(dead) , 1♂(dead)

Eucayptus sp. (B) 6B (2016) 34°170 18.100 S149°560 59.500 E 5♀(dead) , 1♂(dead)
Wombeyan Caves
17A (2016) 34°170 00.700 S149°560 36.800 E
Eucayptus sp. (C) 15B (2016) 34°170 01.200 S149°560 37.800 E 2♀(dead)
4♀(dead) , 2♂(dead)

9A (2016) 34°170 20.500 S149°560 57.300 E 4♀(dead)

4A (2017) 35°260 23.300 S150°210 48.200 E

6A (2016-2017) 35°260 22.900 S150°210 49.300 E
5♀, 1♂
Termeil State Forest Eucalyptus pilularis
9A (2016) 35°260 21.800 S150°210 49.300 E
4♀(3♀dead) , 3♂

5A (2016-2017) 35°260 23.300 S150°210 48.200 E 2♀(1♀dead)

2♀(dead) , 1♂

11A (2017) 36°050 35.200 S149°520 18.500 E

Eucalyptus sieberi 15A (2017) 36°050 31.600 S149°520 19.200 E
5♀(1♀dead) , 1♂(dead)

4A (2016) 36°050 35.200 S149°520 18.800 E

5♀(dead) , 1♂(dead)
5♀, 1♂
The collection year was also included in brackets after the gallery letter.

Dampier State Forest

1A (2017) 36°050 34.100 S149°520 19.200 E
2A (2017) 36°050 33.700 S149°520 19.200 E
3♀, 1♂(dead)

Eucayptus fastigata 29A (2017) 36°050 43.800 S149°520 35.400 E

2♀, 2♂

14A (2017) 36°050 33.700 S149°520 21.000 E

4♀(dead) , 2♂
5♀(dead) , 1♂(dead)
Trees were labeled with numbers (1-17) and galleries are labeled with letters (A-E).
from different Eucalyptus species (some of known, others of unknown species identity).
Table 3.1: List of Austroplatypus incompertus specimens. Beetles were collected
 Primer Name Region designed on Software 5 to 3 prime End Forward or Reverse

Raff1-F beta tubulin Raffaelea kentii by eye CGCTTTCTGGTATGTTTGTCCTAG forward

Raff1-R beta tubulin Raffaelea kentii by eye CGAGGCCTGGTAGAACGA reverse
Raff2-F beta tubulin Raffaelea kentii Primer3 TTCGGTAGAGTCGGTGGAAC forward
Raff2-R beta tubulin Raffaelea kentii Primer3 AGCGGCTAACAATCAACAGG reverse
Raff3-F beta tubulin Raffaelea kentii Primer3 CAGAAGATGACCCGAACACA forward
Raff3-R beta tubulin Raffaelea kentii Primer3 TTCGAACCCTACCTCGAATG reverse
Raff4-F beta tubulin Raffaelea kentii Primer3 TTGTCGATCTGGCAACAGAA forward
softwares as listed.
Raff4-R beta tubulin Raffaelea kentii Primer3 TTCGAACCCTACCTCGAA TG reverse
Raff5-F beta tubulin Raffaelea kentii Primer3 TGTCGATCTGGCAACAGAAG forward
Raff5-R beta tubulin Raffaelea kentiil Primer3 CGAACCCTACCTCGAATGAC reverse
Raff6-F beta tubulin Raffaelea kentii Primer-Blast AAGTTGTCAGGGCGGAAGAG forward
Raff6-R beta tubulin Raffaelea kentii Primer-Blast CGACAGCAATGGCGTGTATG reverse
Raff7-F beta tubulin Raffaelea kentii Primer-Blast CCGACTGGCCGAAAACAAAG forward
Raff7-R beta tubulin Raffaelea kentii Primer-Blast TTGGTGCCGCTTTCTGGTAT reverse
Raff8-F beta tubulin Raffaelea kentii Primer-Blast TCGGTGGAACAAACCTCGTT forward
Raff8-R beta tubulin Raffaelea kentii Primer-Blast GCGGCTAACAATCAACAGGC reverse
Raff9-EF-F Elogationfactor Raffaelea kentii Primer3 GGTGGAGGCAGTAAGCATGT forward
Raff9-EF-R Elogationfactor Raffaelea kentii Primer3 GTTCGAGGCTGGTATCTCCA reverse

46
Raff10-EF-F Elogationfactor Raffaelea kentii Primer3 GGTTGTAGCCGACCTTCTTG forward
Raff10-EF-R Elogationfactor Raffaelea kentii Primer3 GTTCGAGGCTGGTATCTCCA reverse
Raff11-EF-F Elogationfactor Raffaelea kentii Primer3 GGTGGAGGCAGTAAGCATGT forward
Raff11-EF-R Elogationfactor Raffaelea kentii Primer3 GATTGTCGCCATCAACAAGA reverse
Raff12-EF-F Elogationfactor Raffaelea kentii Primer3 TGGAGGCAGTAAGCATGTTG forward
Raff12-EF-R Elogationfactor Raffaelea kentii Primer3 GGTGGAGGCAGTAAGCATGT reverse
Raff13-EF-F Elogationfactor all PrimerDesign-M CCTTCTCCCAGCCCTTGTAC forward
Raff13-EF-R Elogationfactor all PrimerDesign-M TGAGTTCGAGGCTGGTATCTCCAAG reverse
Raff14-EF-F Elogationfactor all PrimerDesign-M CCGACCTTCTTGATGAAGTTGGAGG forward
Raff14-EF-R Elogationfactor all PrimerDesign-M GAGGCTGGTATCTCCAAGGATG reverse
Raff15-EF-F Elogationfactor all PrimerDesign-M CTCCTTCTCCCAGCCCTTGTACC forward
Raff15-EF-R Elogationfactor all PrimerDesign-M GTATCTCCAAGGATGGCCAGAC reverse
Raff16-EF-F Elogationfactor all PrimerDesign-M CTCCTTCTCCCAGCCCTTGTAC forward
Raff16-EF-R Elogationfactor all PrimerDesign-M CGAGGCTGGTATCTCCAAGGATGG reverse
Raff17-EF-F Elogationfactor all PrimerDesign-M GCCGACCTTCTTGATGAAGTTGGAG forward
Raff17-EF-R Elogationfactor all PrimerDesign-M GTTCGAGGCTGGTATCTCCAAGG reverse
Raff18-EF-F Elogationfactor all PrimerDesign-M TGGAGGCAGTAAGCATGTTG forward
Raff18-EF-R Elogationfactor all PrimerDesign-M GTTCGAGGCTGGTATCTCCA reverse
or elongation factor of Raffaelea kentii. The primers were designed with different
Table 3.2: List of forward (-F) and reverse primers (-R) primers for beta-tubulin
3.3.4 Phylogeographic analysis of Austroplatypus incomper-
tus

To assess haplotype diversity and to infer the phylogeography of A. incompertus we

amplified the mitochondrial cytochrome oxidase I (COI) region of all beetle specimens
that were submitted to amplicon sequencing. PCR reactions were carried out in a
total of 10 µl containing 6.4 µl of PCR grade water, 2 µl of 5x MyTaq Red buffer,
0.2 µl of each primer (20 mM), and 0.2 µl (1 U) of MyTaq Red (Bioline), and then 1 µl
of template DNA. The COI primer pair was LCO1490/HCO2198. The amplification
conditions included five cycles with denaturation at 94 °C for 1.5 min, annealing at
45 °C for 1.5 min and extension at 72 °C for 1 min. Then 35 cycles of denaturation
at 94 °C for 1.5 min, annealing at 51 °C for 1.5 min and extension at 72 °C for 1 min,
followed by a final extension at 72 °C for 5 min. Stop codons in the amino acid reading
frame (indicative of nuclear copies of mitochondrial genes; NUMTs) were detected in
individuals from Termeil. Therefore, primers S1718 and A2411 (Jordal et al. 2011)
were used to amplify a COI fragment that overlaps with the LCO1490/HCO2198
fragment. The amplification cycles were as outlined in Jordal et al. (2011): 3 min of
initial denaturation at 94 °C, followed by 40 cycles of denaturation at 94 °C for 30
sec, primer annealing at 46 °C for 60 sec, extension at 72 °C for 60 sec, and a final
extension at 72 °C for 10 min. PCR products were sequenced with the forward primers
on an Applied Biosystems 3500 Genetic Analyser. Sequences were then aligned using
the online version of MAFFT (Katoh et al., 2017) with the G-INS-1 method and
the alignment was visualized in Seaview (Galtier et al., 1996) to check and correct
the alignment by eye. Maximum likelihood inferences (ML) were computed using IQ-
Tree (Nguyen et al., 2015) with 1,000 bootstrap replicates using UFBoot (Minh et al.,
2013). As an outgroup we choose the COI sequence of Platypus cylindrus (GenBank:
KP297974; Bellahirech et al., 2016).

3.3.5 Processing of the fungal ITS2 and 16S rRNA gene am-
plicons

The sequence analysis was performed using QIIME2 2018.6. Raw demultiplexed
paired end reads were checked for their quality and evaluated based on the quality
drop offs in the R2 reads (Caporaso et al., 2010). Furthermore, due to the variable

47
length of ITS2 (Schoch et al., 2014; Feibelman et al., 1994), the use of a paired-end
2x300 bp sequence approach can result into sequence reads that include primers which
can cause difficulties when merging the forward and reverse reads. To avoid this, we
trimmed the sequences using the plugin cutadapt in QIIME2 (Martin, 2011) which
allows the removal of the forward and reverse primers within each read. We then
filtered the reads using the DADA2 plugin (Callahan et al., 2016) and set the quality
score to maxEE of 5 for forward and reverse reads. In addition, we clustered fungi
into operational taxonomic units (OTUs) at 97% similarity, and bacteria in amplicon
sequence variants (ASVs) at 100% similarity. This step was done, because of the high
variation in the ITS2 region within species as well as the sequence cut off for poor
sequences. Sequences that were similar to each other were only assigned to different
fungal ASVs based the length of the sequence. For the fungal taxonomic assignments,
the classifier was trained on the full length ITS region from the UNITE database
(Kõljalg et al., 2005). We checked the correct taxon assignment for the samples using
our fungal control sample and the fungal ITS2 database. For the 16S rRNA gene
amplicons, due to the severe quality drop off, only the forward read was used and the
maxEE score was set to the default of 2. The bacterial classifier was trained using the
SILVA database (Silva 132) on the full 16S rRNA gene and all classifiers used a Naive
Bayes approach as outlined in (Bokulich et al., 2018). Taxon assignment was checked
using the bacterial community of a psyllid sample with a known bacterial symbiont
community (Morrow et al., 2017) and with the NCBI database. Furthermore, we
recovered the fungal mock community by extracting the amplicons and checking it
against our established database and NCBI (chapter 2).

3.3.6 Statistical analyses

First, we generated rarefaction curves using the QIIME2 diversity alpha-rarefaction

plugin for both ITS2 and 16S rRNA gene to check for sampling coverage. Following
this step, we generated abundance tables from the QIIME2 2018.6 artefacts using
Pandas (McKinney, 2010) and further analysed them with R 3.4.2 (R Development
Core Team 2016). In addition, we removed fungal sequence reads which could not be
taxonomically assigned and dominated in the northern population of A. incompertus
(Dorrigo). Samples were not rarefied because the rarefaction curves had already
plateaued after 100 reads. Abundance tables were standardised using the ‘decostand’
function with the method ‘hellinger’ in the package ‘vegan’ (Oksanen et al., 2011).

48
For the alpha diversity analysis, we used the function ‘specnumber’ to obtain the
species number per site and fitted a simple linear regression model using the ‘lm()’
function to the data. After inspecting the goodness of fit, we log-transformed the
data to achieve a better fit of our model and then tested for significant differences
in species numbers between different sample sites using ANOVA. For the beta diver-
sity analysis, we used weighted classical multidimensional scaling (weighted principal
coordinates analysis) using the Bray-Curtis dissimilarity index to compute the dis-
tances for the fungal and bacterial communities. Furthermore, in order to test the
statistical significance of different explanatory variables such as beetle sex, location,
year of collection, host tree and further factors (Suppl. Table: A.1), we performed a
stepwise selection approach in both directions for the constrained distances using the
‘ordistep’ function, computing the p-values by permutation.

To determine the effect of the spatial distribution of trees on the fungal and bacterial
communities in the galleries within each site we performed a principal coordinate
analysis of the neighbourhood matrix (PCNM) (Borcard et al., 2004). A previous
study found that a northern population had a mitochondrial haplotype that was dis-
tinct from other A. incompertus populations (Smith, 2013). Therefore, we tested
the effect of beetle mitochondrial phylogeography on the community structure be-
tween the different locations. This analysis was performed with 131 beetles from
which we amplified the COI gene. We generated the phylogenetic distance matrix of
the COI sequences using the ‘cophenetic.phylo’ function the in ‘ape’ library (Paradis
et al., 2004), which computed the pairwise distances between the pairs of tips from a
phylogenetic tree using its branch lengths. This was then used to compute a distance-
based redundancy analysis to estimate phylogenetic inertia (Desdevises et al., 2003).
To determine the coordinate axes which are significant predictors for the fungal and
bacterial communities we used the previously described ‘ordistep’ function. Variance
partitioning was done as explained above with three explanatory variables: location,
host and beetle phylogeny. The shared fungal and bacterial communities were dis-
played using a Venn diagram with the function venn() within the ‘venn’ library (Dusa,
2018).

49
3.4 Results

3.4.1 Detection of Raffaelea kentii in Austroplatypus incom-

pertus

In total, we detected R. kentii in 100 beetles (65%) while the remaining 54 beetles
were negative (35%). A large proportion of the negative beetles were collected from
Eucalyptus piperita in the Olney State Forest and an unidentified Eucalyptus species
in Mount Wilson (Figure: 3.2).

Dampier_State_Forest Dorrigo Mount_Wilson

20

15

10

0
i

ris

ri
a

.
er

sp
be
at

la
eb
tig

us
e
lu
si

si

R. kentii
s

pi

pt
fa

ly
Eu count

s
tu

tu
us

tu

ca
yp

no
p
pt

ly

Eu
ly
l
ca

ca
ly

ca
ca

yes
Eu

Eu
Eu

Olney Termeil_State_Forest Wombeyan_Caves

20

15

10

0
ris

ris

.A

.B

.C
rit
la

la

sp

sp

sp
pe
lu

lu
pi

s
pi

pi

us
tu

tu
us
us

us

pt
p

p
ly

ly

ly
pt
pt

pt

ca

ca

ca
ly
ly

ly
ca

Eu

Eu
ca

ca

Eu
Eu
Eu

Eu

Host

Figure 3.2: Detection success for Raffaelea kentii from beetles emerging from dif-
ferent host tree species at the different sites.

50
3.4.2 Population structure of Austroplatypus incompertus
across its distribution

Good quality COI sequences were obtained with primer set LCO1490/HCO2198 from
129 beetle specimens. Based on these, we established a sequence matrix of 594 bp.
For two samples from Termeil, we used the primers S1718 and A2411 which aligned
with the rest of the sequences without gaps. For 23 samples, we did not obtain good
quality sequences and therefore these specimens were removed from the phylogeo-
graphic analyses. Almost all beetles emerging from the same gallery shared the same
COI haplotypes. However, beetles from within the same galleries in E. sieberi of the
Dampier State Forest had one single nucleotide polymorphism (SNP) site. The COI
phylogeny revealed a geographic structure of A. incompertus populations, with the
northern Dorrigo population being a sister clade to the other populations. Differences
in population structure were also detected within Olney State Forest and Dampier
State Forest with node splits within these sites. The sample L20 from Dampier State
Forest was closely related to samples from Olney State Forest and sample T18 from
Termeil State Forest fell into a Dampier State Forest clade.

51
Figure 3.3: Maximum Likelihood Phylogeny of the mitochondrial COI haplotypes of
A. incompertus (each haplotype is listed with a single individual that is representative
of this haplotype) based on a sequence matrix of 594 bp obtained from 131 beetles.
Platypus cylindrus was included as an outgroup. The numbers below the nodes
represent bootstrap values and the scale bar represents the branch length.

52
3.4.3 Amplicon sequence analysis

The two amplicon sequencing runs generated 4,614,882 fungal ITS and 15,480,164 bac-
terial 16S rRNA gene sequence reads. After quality control, de-noising and chimera
removal, 2,818,473 fungal reads and 2,504,259 bacterial reads remained. The se-
quencing depth between samples varied between 61 and 739,356 for fungal reads, and
between 285 and 509,579 bacterial reads. The clustering produced 1,468 fungal OTUs
at 97% similarity with at least 2 reads, and 9,579 bacterial ASVs at 100% similarity
with at least 2 reads. The alpha diversity rarefaction curves showed enough sampling
depth, which plateaued for fungal OTUs at 110 reads and bacterial ASVs at 100
reads with only two samples not reaching the required sampling depth for bacteria
(Suppl. Figure: A.3). We fully recovered the expected bacterial mock community. In
contrast, R. kentii was not amplified from the fungal mock community. However, the
other three fungal taxa were recovered with an overrepresentation of Quambalaria sp.
amplicons.

3.4.4 Fungal and bacterial community structure

The analysis of the alpha diversity revealed significant differences in fungal OTUs and
bacterial ASVs between the different A. incompertus populations (Figure: 3.4). For
the fungal OTUs, Olney State Forest had a similar fungal diversity as all other pop-
ulations except for Wombeyan Caves and the most southern population in Dampier
State Forest. Furthermore, there was a difference in fungal OTU numbers between
Dampier State Forest and Dorrigo National Park. For bacteria we saw a difference
in ASV numbers in Wombeyan Caves compared to the other populations.

For the bacterial and fungal beta diversity, there was a substantial overlap in the
composition of communities across the different A. incompertus populations, and
the first two axes of the PCoA explained only a small proportion of variation (Fig-
ure: 3.5). Variation partitioning revealed that there were differences in the factors
influencing bacterial community and fungal community structure. However, the vari-
ables explaining most variation were location (sampling site), the beetle health status
(live/dead), the host tree species and the year when it was sampled (Table: 3.3).

53
For bacteria the health status as well as the host tree species were significant pre-
dictors explaining a small portion of the variation, while none of the variables had a
significant effect on the fungal communities (Table: 3.3).

Table 3.3: The table list the results for the ordistep and variation partitioning.
The p-values represent the results after the correspondence-analysis followed by an
ANOVA.

Microbial Associates Variable F R2 adjusted R2 Pr(>F)

Location 2.806 0.047 0.014 0.203

Live or Dead 2.541 0.029 0.022 0.001
Bacteria
Host 1.939 0.04 0.001 0.05
Year 1.601 0.011 0.005 0.848
Location 5.517 0.036 0.004 0.689
Live or Dead 2.555 0.014 0.008 0.749
Fungi
Host 3.069 0.021 -0.005 0.87
Year 4.226 0.011 0.005 0.754

54
Figure 3.4: Numbers (log-transformed) of bacterial (top) and fungal (bottom) taxa
detected at sampling sites. Sorted from the southern (left) to the northern populations
of Austroplatypus incompertus.

55
 Bacterial Communties of Austroplatypus incompertus
0.4

0.2
bacteria_new$Raffaelea
no
yes
Dim2 (5.36%)

Location
0.0
Dampier_State_Forest
Dorrigo
Mount_Wilson
Olney
Termeil_State_Forest
−0.2
Wombeyan_Caves

−0.4

−0.50 −0.25 0.00 0.25 0.50

Dim1 (9.41%)

Fungal Communties of Austroplatypus incompertus

0.4

fungi_new$Raffaelea
no
yes
0.2
Dim2 (6.73%)

Location
Dampier_State_Forest
Dorrigo
0.0
Mount_Wilson
Olney
Termeil_State_Forest
Wombeyan_Caves
−0.2

−0.4
−0.25 0.00 0.25 0.50
Dim1 (7.48%)

Figure 3.5: Beta-diversity of the bacterial and fungal communities over all sample
sites. Circles represent beetles that were PCR-negative for Raffaelea kentii, triangles
represent beetles that were PCR-positive for R. kentii.

56
3.4.5 Influence of Austroplatypus incompertus phylogeogra-
phy and tree spatial structure within populations on
fungal and bacterial communities

We tested whether the phylogeographic relationships of A. incompertus may be an ex-

planatory variable for the fungal and bacterial communities between different sample
sites. COI was amplified from 131 of the 154 beetles and used for the analysis (Ter-
meil State Forest was represented by only three individuals ). This analysis revealed
that less than 1% variation in bacterial communities, and less than 2% variation in
fungal communities is explained by the phylogenetic distance.

The fungal beta diversity within each site showed a strong pattern separating each
community as a possible combined effect of gallery (or beetle family) and host tree
position, with some overlaps in some sites (Figure: 3.6). The spatial separation of
galleries or beetle families (as distance between trees) was a significant explanatory
factor for microbial community composition when looking at each site individually
(Table: 3.4). The fungal communities was particularly strongly influenced by this
spatial structure. For the sites Dampier State Forest (adjusted R2 = 0.274) and
Wombeyan Caves (adj. R2 = 0.216) the spatial structure explained more than 20% of
the variation. Furthermore, the spatial structure explained up to 7% of the variation
in the fungal community in four sites. For the bacterial beta diversity we did not
detect strong patterns of separation between communities within a site. We did
not find a strong influence of spatial distances between trees as it was observed for
fungi, and we did not detect any separation, with one exception: Dampier State
Forest showed a high spatial structure that explained shifts in bacterial communities
between galleries (adj. R2 = 0.264).

57
Table 3.4: The table list the results after the ordistep and variation partitioning for
each sample site, were we calculated the principal coordinates of the distance matrix
of the different trees.

Microbial Associates Location Distance Gallery Distance & Gallery Res. Var.

Olney Sate Forest 0.084 0.084 - 0.913

Dampier State Forest 0.264 - - 0.755
Dorrigo National Park - 0.004 0.016 1.000
Bacteria
Wombeyan Caves 0.042 - 0.080 0.888
Mount Wilson 0.033 0.037 - 0.984
Termeil State Forest - - 0.028 1.046
Olney State Forest 0.165 0.072 - 0.834
Dampier State Forest 0.275 0.073 - 0.665
Dorrigo National Park 0.064 0.069 0.042 0.825
Fungi
Wombeyan Caves 0.216 0.076 - 0.775
Mount Wilson 0.093 0.013 0.077 0.817
Termeil State Forest 0.03576 0.03542 0.062 0.866

3.4.6 Taxonomic identification of fungi and bacteria

The most frequent and abundant taxa of fungi belonged to the Ascomycota and
Basidiomycota. We found taxa of both phyla in all beetles from Dampier State
Forest and Mount Wilson. Furthermore, we found Ascomycota taxa in all beetles
from Olney State Forest and Wombeyan Caves. The majority of fungi could not be
assigned to taxa at or below the family level and were therfore assigned to the king-
dom level. These unidentified fungi were also the most frequently detected. These
included multiple related taxa with similar sequences after blasting as well as dis-
tantly related taxa. Beyond these, the families of Cladosporiaceae, Phaeomoniel-
laceae, Herpotrichiellaceae and Aspergillaceae were most frequently observed, and
found in almost all beetles (Suppl. Figure: A.7). Dorrigo had the lowest relative
sequence read frequency for these observed fungal families, and Wombeyan Caves as
well as Dampier State Forest had the highest. Furthermore, we observed the ento-
mopathogenic/endophytic fungus Beauveria (Ascomycota: Hypocreales: Cordycipi-
taceae) in all sites except Dorrigo National Park, with the highest relative sequence
read frequency in Wombeyan Caves. For the bacterial taxonomy at the phylum level
the most abundant and frequent taxa were Proteobacteria, which we detected in all
beetles from all populations (Suppl. Figure: A.6). At the family level, the most
frequently observed bacterial family were the Comamonadaceae (Betaproteobacteria:

58
 Fungal Community Olney State Forest Fungal Community Dampier State Forest

●
● Eucalyptus fastigata
●
● Eucalyptus sieberi
● ●

0.2
●
●

● ●
●

0.2
●

0.1
0.0

0.0
Dim2 15%

Dim2 13%

−0.1
−0.2

−0.2
−0.4

● 2 ● 1
4 2
12 4
13 11

−0.3
14 14
16 ● Eucalyptus pilularis 15
21 ● Eculayptus piperita 29

−0.4 −0.2 0.0 0.2 −0.4 −0.2 0.0 0.2 0.4

Dim1 17% Dim1 15%

Fungal Community Termeil State Forest Fungal Community in Mount Wilson

● Eucalyptus sp.
● Eucalyptus sieberi

0.4
0.4

0.2

●
0.2

●
●
Dim2 13%

Dim2 14%

0.0

●
● ●
0.0

●
−0.2

●
●
●
●
−0.2

● 1
−0.4

● 4 2
5 5
6 6
9 10

−0.4 −0.2 0.0 0.2 −0.4 −0.2 0.0 0.2

Dim1 22% Dim1 19%

Fungal Community Dorrigo National Park Fungal Community Wombeyan Caves National Park

● Eucalyptus sp.A
0.3

● Eucalyptus sp.B
● Eucalyptus sp.C
0.4

●
0.2

●
0.1

0.2
Dim2 14%

Dim2 11%
0.0

●
0.0
−0.1

● ●
● ●

●
●
−0.2

−0.2
−0.3

● 2
●
6
●
● 4 9
●
6 15
12 17

−0.4 −0.2 0.0 0.2 0.4 −0.2 0.0 0.2 0.4

Dim1 18% Dim1 21%

Figure 3.6: Fungal beta diversity per site. Colour codes represent the different
Eucalyptus tree species, shapes represent individual beetles from the same galleries.

59
Burkholderiales), followed by unidentified families. The family of Enterobacteriaceae
(Alphaproteobacteria) occurred most frequently in Mount Wilson and Olney State
Forest, and had the lowest observation frequency in Dorrigo National Park.

We detected 21 fungal OTUs and 29 bacterial ASVs that were shared amongst all
sites. Mount Wilson had the fewest unique fungal OTUs and bacterial ASVs. Termeil
State Forest had the highest diversity of unique bacterial ASVs and Olney State Forest
the highest diversity of unique fungal OTUs (Figure: 3.7).

60
Figure 3.7: top: shared bacterial ASVs and bottom shared fungal OTUs.

61
 relative frequency of fungi associated Austroplatypus incompertus 
1.0
Ascomycota
Basidiomycota

0.8
unidentified

0.6
Phylum of Fungi
Mortierellomycota

0.4
Chlorophyta
Glomeromycota

0.2
Mucoromycota

0.0
Dampier_State_Forest Dorrigo Mount_Wilson Olney Termeil_State_Forest Wombeyan_Caves
Location

62
Figure 3.8: Heatmap displaying the relative frequency (equals the sum of the pres-
ence/absence in sample divided by total number of beetles per population) of fungi
on the phylum level associated with Austroplatypus incompertus
 relative frequency of bacteria associated Austroplatypus incompertus 
1.0
Proteobacteria

Actinobacteria

Firmicutes

unidentified 0.8

Cyanobacteria

Bacteroidetes

Planctomycetes

0.6
Phylum of Bacteria

Verrucomicrobia

Chloroflexi

Gemmatimonadetes

Armatimonadetes
0.4

Candidate division TM7

WD272

Deinococcus­Thermus

TM6 0.2

Chlamydiae

Fusobacteria

Candidate division SR1
0.0
Dampier_State_Forest Dorrigo Mount_Wilson Olney Termeil_State_Forest Wombeyan_Caves
Location

Figure 3.9: Heatmap displaying the relative frequency (equals the sum of the pres-
ence/absence in sample divided by total number of beetles per population) of bacteria
on the phylum level associated with Austroplatypus incompertus

63
3.5 Discussion

This study is the first to investigate the fungal and bacterial community composition
and structure of an ambrosia beetle species throughout its entire range, and the first
about a platypodine ambrosia beetle. It is also the first study to have analysed this
for a uniquely eusocial ambrosia beetle, A. incompertus. It highlights that replaced-
fungal and bacterialmicrobial communities are structured according to the spatial
distribution of beetle galleries in trees across the landscape while overall also indicat-
ing a surprisingly high conservation of the community composition across the entire
distribution of the beetle species. Beyond this we also demonstrated that A. incom-
pertus populations have a phylogeographic structure, with the northern population of
Dorrigo having a distinct haplotype that is similar to the haplotype found in another
northern population (Kerewong State Forest) by Smith (2013). However, this did not
impact the replacedfungal and bacterialmicrobial community composition of beetles.
Moreover, we did not detect an effect of the phylogenetic distance nor an effect of
the presence of the primary fungal symbiont, R. kentii, on the replacedfungal and
bacterialmicrobial communities of A. incompertus. For the environmental factors,
we demonstrated that the beetle live vs dead status and the host tree species had
significant effects on the bacterial communities.

The fungal community of emerging A. incompertus

The analysis of its fungal diversity revealed unidentified fungi belonging to mul-
tiple unidentified families and the families Cladosporiaceae, Phaeomoniellaceae and
Herpotrichiellaceae. The high proportion of unidentified fungi is a strong indication
for the poor representation of insect-associated taxa in fungal reference databases,
primer choice and, possibly, the unique fungal diversity within Australia. These
yet uncharacterized fungi may include unknown fungal symbionts or unique envi-
ronmental fungi which are adapted to environments of an ambrosia beetle species
developing in living Eucalyptus trees. The cosmopolitan genus Cladosporium within
the Cladosporiaceae occurs in various environments and can either be a pathogen,
parasite, or saprotroph (Bensch et al., 2012). For insects some Cladosporium species
can be entomopathogenic, while others are very abundant on the surface of insects
and may be distributed by the insects to other surfaces like plants (Sun et al., 2018;
Malacrinò et al., 2017). In an earlier study (Chapter 2) Cladosporium sp. was also

64
isolated from the surface of A. incompertus suggesting a possible interaction with
this beetle species or its habitat. Overall, further research is required to determine
the unknown function of species within the Cladosporiaceae on the fungal farming of
ambrosia beetles. Another commonly found fungal family, Phaeomoniellaceae, had
previously been confirmed to occur in A. incompertus by using culture-dependent
approaches (Chapter 2). The third commonly found fungal family in A. incomper-
tus, Herpotrichiellaceae, contains mostly black yeast anamorphs and the majority of
species in this family belong to Capronia (Untereiner et al., 1995). These black fungi
are known for their ability to withstand harsh environments (Gostinčar et al., 2011)
and, therefore, might be important for this ambrosia beetle species. Interestingly we
found entomopathogenic fungi of the family Cordycipitaceae in nearly all sites with
OTUs belonging to Beauveria sp. which might be a pathogen and antagonist of A.
incompertus. Commercially available isolates of Beauveria bassiana are effective in
reducing populations of bark and ambrosia beetles like Ips sexdentatus, Polygraphus
poligraphus and Xylosandrus germanus (Castrillo et al., 2011; Steinwender et al.,
2010; Wegensteiner, 2000).

The role of the fungal families in A. incompertus and their interactions with R. kentii
have still to be established. Most studies on ambrosia beetle symbioses were con-
ducted on Scolytinae with internal mycangia. However the prothoraxal mycangia of
Platypodinae may more likely be exposed to environmental fungi, and therefore our
study is an important test for the generalisation statements often made based on
findings of the symbiotic communities of scolytine ambrosia beetles. Furthermore, it
is known that the beetle body, internal as well as external, can host multiple fungal
communities, which occur in the same niche as the primary fungal symbiont (Kostov-
cik et al., 2015). Nevertheless, the evolution of different shapes of mycangia within
the ambrosia beetles, the fungal pouches where the beetle stores their primary fungal
symbiont and secures the dispersal of fungal spores of their primary symbiont seem
to be selective (Skelton et al., 2019). However, due to the sheer difference in mor-
phology in mycangial types and the undescribed mechanisms of fungal dispersal, the
process of acquiring the primary fungal symbiont is still not described The different
morphological features on the beetles body such as cavities and hairs (Kent, 2008b)
might also play a role in how fungal spores are transported, collected and fungal
communities are shaped. The fungi detected in our study were found on the surface
of emerging beetles and can therefore potentially be distributed by A. incompertus
to new galleries. The process of the new gallery formation by the female beetles

65
also has the risk of loosing the spores of the fungal partners while chewing through
the wood and the mycangia might be protecting these associated fungi. Supporting
this argument is that research shows that within the fungal gardens of ambrosia bee-
tles mostly the primary symbiont dominates (Biedermann et al., 2009; Kasson et al.,
2016). However, the fungal gardens are commonly also colonized by other fungi and
the mechanisms on how the fungal gardens are kept clean are still elusive. The pos-
sibility for the acquisition of additional symbionts is high and environmental fungi
could have functional roles in the symbiosis of ambrosia beetles.

Some of our results have to be interpreted carefully since the commonly used ITS2
primer pair did not detect the fungal partner R. kentii in the amplicon sequencing
run and therefore the relative quantification of the fungal composition in particular
relative to a key symbiont is difficult while the overall presence and relative relation-
ships of other co-occurring symbionts may be well reflected. A similar outcome was
detected in psyllids with their primary bacterial endosymbiont Carsonella having an
extremely high AT bias that inhibited its amplification when using standard bac-
terial amplicon sequencing primers (Morrow et al., 2017). Therefore application of
targeted PCR, sequencing and quantification techniques like qPCR as well as culture
dependent characterisation are crucial. Techniques like the next generation multilo-
cus sequencing typing of environmental samples using longer target sequences with
Nanopore or PacBio might be a good alternative while still expensive or difficult to
assemble and interpret (Quince et al., 2017; Teeling and Glöckner, 2012).

The bacterial community of A. incompertus

The bacterial community might be an important facilitator for ambrosia beetles to

keep their fungal gardens clean of weedy fungi so that only the primary fungal sym-
biont can survive. (Grubbs et al., 2019). In this study we frequently found Coma-
monadaceae which were previously described to occur in low abundance in larvae of
the cabbage looper (Trichoplusia ni) and eggs of non-biting midges (Chironomidae)
(Pennington et al., 2017; Senderovich and Halpern, 2012). In addition, this bacterial
family was isolated from plants like tobacco and might include common environmental
bacteria occurring in the galleries of the beetle (Brinkmann et al., 2008). The high fre-
quency of unidentified bacteria within multiple families indicates a substantial lack
of knowledge about bacteria associated with Australian beetles. Furthermore, the
function of these bacteria and other associated bacteria could not be shown, however

66
this would be a future project since previously it was shown that bark beetles and
eusocial insects like ants are associated with bacteria that help in the maintenance
of pure fungal gardens (Li et al., 2018a; Klepzig and Six, 2004; Grubbs et al., 2019).
The research of ambrosia beetle microbiomes, especially within the Platypodinae, is
still in its infancy, despite being the oldest known fungal farming insects. Therefore,
there is a unique chance for researchers to extend the catalogue of known bacterial
symbionts and how these communities are shaped by investigating more basal lineages
of ambrosia beetle species.

The role of R. kentii on the microbial community of A. incompertus

Females of A. incompertus have pronotal mycangial plates with over 70 pits or my-
cangia that can contain fungal symbionts (Kent, 2008b) or other fungi with them.
While mycangia may be selective towards the primary symbiont and therefore shift
the fungal community towards the beetles primary symbiont, we wanted to test how
the presence of R. kentii influences the fungal community of A. incompertus. The
results showed that the presence of R. kentii was not a strong predictor for the fun-
gal community composition and structure on the beetles surface. However, we used
species-specific primers for the detection of R. kentii and we developed these primers
based on previously obtained isolates. Bias might be introduced by small propagule
sizes of the primary symbiont as well as the mismatching and specificity of the tested
primers. The tested beetles might have different genotypes of R. kentii or carry mul-
tiple Raffaelea species. Another possible explanation could be that A. incompertus
might just need a few spores of its primary symbiont to secure the establishment of
a new gallery, but this low titre might not be enough for the PCR detection.

Importance of environmental variables and phylogeography on microbial

community composition

Eastern Australia hosts different populations of A. incompertus and we wanted to

test the hypothesis that the phylogeographic relationship between the different beetle
populations has an effect on the microbial composition. Based on the analysis of COI
we found that the Dorrigo population has a phylogenetically distant mitochondrial
lineage than the other A. incompertus populations, and this confirmed earlier analyses
(Smith, 2013)) on a smaller dataset. However, this phylogeographic structure did not
have an effect on the microbial community composition. Instead, the sampling sites

67
of beetle populations explained only a small part of the variation within the fungal
(3%) and bacterial (4%) community. This similarity of microbiomes across these
phylogeographically structured populations also indicates that there may still be a
fair amount of nuclear gene flow between populations, and this will need further
testing in the future. While the location of sampling can comprise a lot of different
variables, we looked at each location separately and could show for the first time that
the spatial structure of the trees and the beetles gallery are a strong predictor (3 -
27% of the variation explained) for the fungal composition of A. incompertus. The
location of host trees and galleries within the beetle population might inform us about
the importance of acquisition of communities influenced by either microenvironmental
factors surrounding the gallery or unique fungal community within a gallery. With the
geographical wide sampling in this study we demonstrated that it is crucial to analyse
spatial scales when analyzing the microbial community of ambrosia beetles, especially
when the acquisition of microbial partners is unknown. Nevertheless, we have to be
careful when interpreting these results, since a wide geographical sampling also comes
with significant differences in environmental factors like temperature. However, these
factors might only play a small role since the microbial taxa might be acquired within
the gallery system. The type of mycangia is also a factor contributing to this as
discussed before and more research has to be done on how A. incompertus acquires
its symbionts and focus on the communities present within the pits of the mycangia.
In conclusion, there is still substantial research necessary on ambrosia beetles, and on
Platypodinae more specifically, with a focus on how microbial associates are acquired
and what their contribution is to insect fitness.

68
Chapter 4

Isolation of new Raffaelea species

from larvae of the ancient ambrosia
beetle species Notoplatypus
elongatus (Curculionidae:
Platypodinae) with diverse
bacterial and fungal communities

4.1 Abstract

The pinhole borers (Curculionidae: Platypodinae) are one of the oldest known lin-
eages of fungal farming insects. As ambrosia beetles, they are reliant on their fungal
symbionts which they cultivate in excavated galleries within trees. Australia is home
to two ancient lineages of Platypodinae with unique life histories. The horizontal
borer, Austroplatypus incompertus is the basal lineage of the Platypodini tribe and
the only known eusocial beetle. Its fungal symbiont Raffaelea has recently been
described (Chapter 2). In contrast, very little is known about the older lineage, No-
toplatypus elongatus, a basal species of the Tesserocerini tribe. Adults of this species
are hypothesized to start galleries in wounds at the base of living trees and larvae
excavate a vertical tunnel towards the top of trees where they complete their devel-
opment. It is unclear how much spatial and temporal overlap there is between adults

69
and larvae within the galleries, but potentially larvae of this species do not continu-
ously feed on fungal gardens established by adult beetles, but may have to excavate
long gallery sections in the absence of adults. This also means that adults would not
introduce fungal symbionts in new gallery sections. Therefore, larvae of this species
may have different associations with microbial symbionts when compared with other
ambrosia beetles. Here, we aimed to characterise the microbiota associated with
N. elongatus for the first time. We isolated and cultivated fungi from the gut and
the surface of beetle larvae, sequence-typed them and conducted growth experiments.
Furthermore, we used culture independent next generation amplicon-sequencing tech-
niques to investigate the diversity of fungal and bacterial associates within the gut
of beetle larvae. We discovered two novel Raffaelea species and several yeast species.
We also found highly abundant bacterial taxa within the Rhodospirillales, including
one highly prevalent Gluconacetobacter bacterium. They may have beneficial effects
on the larvae that develop in nutrient poor environments and an important role in
the beetles biology. Further research is required to investigate their interactions with
the isolated Raffaelea species and their host.

4.2 Introduction

Fungal farming is the ability of animals to farm fungi as their primary food source
across all life stages (Mueller et al., 2005). This type of agricultural practice is known
from three insect orders. It evolved once each in a clade of ants and a clade of termites,
and at least sixteen times in two different clades of ambrosia beetles (Johnson et al.,
2018). In the clade Scolytinae fungal farming evolved at least thirteen times and in
Platypodinae once. The fungal symbioses of ambrosia beetles are intriguing due to
their repeated independent evolution and the sheer diversity of interactions. More-
over, ambrosia beetles are believed to be the oldest fungal farmers as they evolved
more than 80 Million years ago (Jordal 2015). In contrast to ants and termites which
provide continuously substrate to their symbiotic fungi within their nests, ambrosia
beetles cultivate fungi on tunnel walls excavated into the wood of trees (Aanen et al.,
2002; Schultz and Brady, 2008; Batra, 1985). Ambrosia beetles are a functional
but not a taxonomic grouping of weevils (Curculionidae). They include about 3,400
species of two subfamilies, Scolytinae (bark beetles) and Platypodinae (pinhole bor-
ers) (Farrell et al., 2001). Not all Scolytinae are fungal farmers, while most if not all

70
Platypodinae are reliant on fungal farming (Jordal, 2015; Farrell et al., 2001). Many
of the fungal-farming Scolytinae pose a major threat when introduced to the forest
ecosystems and timber industries in different countries (Hulcr and Dunn, 2011). One
of the best known examples is Xyleborus glabratus which carries the fungus Raffae-
lea lauricola that threatens the existence of Lauraceae in North America (Fraedrich
et al., 2008; Harrington et al., 2011; Kendra et al., 2013).

Most ambrosia beetles colonize dying or dead wood and therefore have an important
role in nutrient cycling in forest ecosystems (Hulcr et al., 2007b; Kent, 2008a). Within
the Platypodinae, only a few species are able to attack living trees (Ploetz et al., 2013).
Prominent examples are Platypus quercivorus attacking oak trees in Japan (Kubono
and Ito, 2002) and Megaplatypus mutatus attacking poplar trees in South-America
(Alfaro et al., 2007). In contrast to this, only a handful of species attacking living
trees do not visibly affect tree health (Kent and Simpson, 1992; Kirkendall et al.,
1997). Two to three species occur in Australia, and constitute two basal lineages
within Platypodinae: Austroplatypus incompertus within the tribe Platypodini, and
Notoplatypus elongatus within the tribe Tesserocerini (Jordal, 2015), and possibly
the more derived species Platypus tuberculosis (D. S. Kent, personal communication).
These species are highly specialized on Eucalyptus trees, and have unique life histories,
such as the eusociality and extreme longevity of A. incompertus (Kent and Simpson,
1992; Smith et al., 2018) and the potentially unique life cycle of N. elongatus.

Based on observations, N. elongatus does not form horizontal galleries within the tree
trunk at the height of the gallery entrance(Deborah Kent, personal communication).
It is hypothesized that females enter a tree in wounds on the lower part of a tree trunk,
bore towards the heartwood and may die after oviposition. The larvae then bore a
vertical tunnel within the wood towards the top of the tree, where they complete their
galleries with pupation chambers (Deborah Kent, personal communication). Such a
life history with long vertical galleries in the wood of tree trunks has not been de-
scribed in any other ambrosia beetle species. This peculiar life history means that N.
elongatus adults and larvae may develop in spatially different sections of the tree, and
this could pose selection for different types of microbial interactions. Furthermore,
adults and larvae may develop under more extreme environmental conditions than
other ambrosia beetles, such as substantial resin flow (in particular when entering
wounded Eucalyptus trees), very low oxygen in larval galleries and plant secondary

71
compounds within Eucalyptus wood. To survive such harsh environment, microbial
associates might play a key role in the biology of the beetles.

To date, all tested species within the Platypodinae are associated with fungi within
Raffaelea and Ceratocystiopsis(Ophiostomatales), and our previous work showed that
A. incompertus is no exception as it develops in symbiosis with Raffaelea kentii (Chap-
ter 2) (Li et al., 2018b). In contrast, scolytine ambrosia beetles can have more diverse
fungal symbionts (Hulcr and Stelinski, 2017; Massoumi Alamouti et al., 2009). For
N. elongatus the symbionts are yet to be described. Neither females nor males of this
species appear to have visible mycangia on the dorsal pronotal plate. Furthermore,
the gut microbiota may play an important role in beetle survival, and may include
bacteria and yeasts. These gut microbiota can be crucial for digestion of cellulose
and also have nutritional benefits for the insects (Martin, 1983). So far, yeasts have
been sparsely mentioned in the ambrosia beetle literature(Hulcr and Stelinski, 2017).

Our study had several aims. The first objective was to test N. elongatus for the
presence of any Raffaelea fungi that were previously described as known associates
of Platypodines, and to identify them. Based on the general understanding that all
Platypodinae are fungal farmers, we hypothesised to find fungi, and we expected to
find fungal species within the Ophiostomatales genus of Raffaelea. Furthermore, we
assumed that yeasts and bacteria might also have important roles in the development
of N. elongatus. Therefore, another objective was to describe the gut microbiota of N.
elongatus larvae in order to reveal new and potentially unique microbial biodiversity.

4.3 Material and Methods

4.3.1 Samples and fungal isolation

We collected N. elongatus larvae from Eucalyptus agglomerata (blue-leaved stringy-

bark) in the Strickland State Forest, New South Wales, in September 2017. Larvae
of this species were serendipitously discovered emerging from billets obtained from
the middle section of a fallen tall tree that had blocked a road (Alf Britton, personal
communication). Once the presence of N. elongatus was confirmed, three billets (A,
B, C) from the remaining lower part of the trunk (at 2 to 3 m height) were brought to

72
the laboratory and larvae were extracted from each billet. For fungal isolations, we
used 5-10 larvae from each billet. First, we washed each larva in 500 µl of sterilised
water and plated 100 µl per larvae on 2 % malt extract agar (MEA) plates containing
streptomycin (100 mg/mL) and penicillin (7 mg/mL). Following this step, the larvae
were surface sterilised in pure ethanol for 3 min and then washed twice in water to
remove the remaining ethanol. Then each larva was transferred to a fresh microcen-
trifuge tube containing 500 µl of water and crushed with a sterilised pipette tip. The
mixture was then plated onto yeast extract agar (YEA) containing glucose (10 g/L),
tryptone (5 g/L), streptomycin (100 mg/mL) and penicillin (7 mg/mL). The water
from the second washes after the ethanol treatment was also spread on MEA and
YEA as a negative control. All plates were incubated at 25 °C, were checked every
week and the hyphal mass was subcultured on either MEA or YEA plates to obtain
pure cultures. In addition, we counted each colony forming unit (CFU) on each plate
prior to hyphal transfer and assigned a morphotype to the pure culture based on
morphological features such as colour, hyphal growth and density. Fungal isolates
for identified Raffaelea were deposited in the NSW DPI fungal collection. However,
due to subculturing and time issues we were not able to deposit all isolates per new
Raffaelea species.

4.3.2 Fungal DNA extraction, identification and growth ex-

periments

To extract clean DNA, mycelium of the different morphotypes was transferred onto
media (YEA, MEA) with a cellophane sheet. We incubated the fungi at 25 °C for
2-3 weeks and harvested fresh mycelium from the edges of the fungal culture and
placed it into the PowerBead tubes provided by the DNeasy PowerSoil Kit (Qiagen).
Following the manufacturer’s protocol, clean DNA was extracted from each fungal
morphotype and eluted into 50 µl water. To further characterise the morphotypes we
then amplified the large ribosomal subunit (28S rRNA gene) using the LROR/LR5
primer pair for all morphotypes (Vilgalys and Hester, 1990). Furthermore, after
confirmation of the isolates as Raffaelea, we amplified the beta tubulin gene region
using the primer pair Bt2b/T10, as well as the elongation factor 1-alpha gene (tef1)
with the primer pair EF1-1018F/EF1-1620R of these isolates (Donaldson et al., 1995;
Vilgalys and Hester, 1990; Stielow et al., 2015). The PCR amplifications were carried
out in a total volume of 10 µl containing 2 µl 5x MyTaq Red buffer (including MgCl2,

73
dNTPs, and reaction buffer), 0.2 µl of each primer (20 mM), 5.9 µl PCR grade water,
0.5 µl DMSO (5% V/V) , 0.2 µl (1 U) MyTaq polymerase (Bioline, USA) and 1 µl
DNA template. The amplification cycles were for the beta tubulin gene an initial
denaturation step at 95 °C for 3 min, followed by 36 cycles of 95 °C denaturation
for 45 sec, annealing at 48 °C for 45 sec, extension at 72 °C for 1 min, and a final
extension step at 72 °C for 4 min; for the 28S rRNA gene an initial denaturation step
of 92 °C for 2 min, followed by 40 cycles of 95 °C denaturation for 30 sec, annealing
at 55 °C for 30 sec, extension at 72 °C for 1 min, and a final extension step at 72 °C
for 8 min; for tef1 an initial denaturation at 94 °C for 4 min, followed by 35 cycles of
denaturation at 94 °C for 45 sec, annealing at 52.4 °C for 30 sec, elongation at 72 °C
for 1 min, and a final extension at 72 °C for 4min.

PCR amplifications which had two differently sized bands were purified using the
Wizard SV Gel and PCR Clean-Up System (Promega, Madison,WI, USA). Puri-
fied positive PCR reactions were treated with a combination of 0.5 U Exonuclease I
(New England Biolabs, Ipswich, MA, USA) and 0.25 U Shrimp Alkaline Phosphatase
(Promega), with incubation at 37 °C for 30 min, then 95 °C for 5 min. Then, the PCR
products were sequenced with both the forward and reverse primers on an Applied
Biosystems 3500 Genetic Analyser. The sequence quality was checked using SnapGene
Viewer (www.snapgene.com), and for further identification, sequences were compared
with GenBank deposited sequences using NCBI BLAST. Isolates which were closely
related to Raffaelea were assigned to this genus and then transferred to fresh media.
Mycelial growth was measured over 14 days at three different temperatures (15 °C,
20 °C and 25 °C). Pictures of the morphotypes were taken as additional information.

4.3.3 Phylogenetic placement within the Ophiostomatales

The raw .ABI sequence files were visualised using SnapGene (GSL Biotech LLC) and
sequences were trimmed based on quality of the sequence chromatogram. Following
this step we aligned the cleaned sequences using an online version of MAFFT with
the G-INS-1 parameters and an accurate guide tree. Furthermore, the alignments
were checked by eye for any ambiguity in SeaView (Gouy et al., 2010). For the
beta tubulin gene we removed the intron regions 3, 4 and 5 prior to phylogenetic
analysis using the gene map provided by (Yin et al., 2015). For building of maximum
likelihood trees we used the software IQTree with 1000 bootstraps (Nguyen et al.,

74
2015; Minh et al., 2013). This software has ModelFinder included, and as a outgroup
we chose Pedospora decipiens (Genbank: MH871065) (Kalyaanamoorthy et al., 2017).
Phylogenetic trees were drawn using the Python API ETE3 tool kit (Huerta-Cepas
et al., 2010, 2016).

4.3.4 Amplicon-sequencing of the ITS2 and 16S rRNA gene

We extracted DNA from ten N. elongatus larvae using a modified protocol as pro-
vided by DNeasy PowerSoil Kit. The first step was a surface sterilisation of the larvae,
whereby individuals were rinsed once with 1% sodium hypochlorite solution (bleach),
followed by three washes in 5% TritonX to remove any residual sodium hypochlo-
rite, and lastly washed three times in Milli-Q water to remove TritonX. Whole larvae
were then ground in the provided bead tubes with 60 µl C1 buffer. 4 µl proteinase
K was added to each extraction solution and incubated for 3 hours at 65 °C. After
this, samples were treated as per manufacturer’s protocol. DNA was eluted in 500 µl
ultrapure water and DNA quality and concentration were measured using Nanodrop
and Qubit, respectively. In addition, we performed two extractions of ultrapure wa-
ter (without any tissue) to control for contamination either in the provided buffers
or water (Salter et al., 2014). Furthermore, we prepared two mock communities to
account for the detection success of microbial symbionts as well as the right taxo-
nomic classification. The fungal mock community contained an isolate of Raffaelea
kentii isolated from A. incompertus (65%) together with Quambalaria sp. (20%),
Sistotrema sp. (5%), Dothideomycetes sp. (5%) and Candida sp. (5%). As bac-
terial mock community we used DNA extracts of the psyllid Cardiaspina sp. from
Eucalyptus moluccana with a previously characterised bacterial endosymbiont com-
munity (Morrow et al., 2017). We sequenced all 14 samples with the Illumina Miseq
300 paired end amplicon approach, using the primer pair fITS7/ITS4 for the fungal
ITS2 region and primer pair 341F/805R for the bacterial 16S rRNA gene (Sinclair
et al., 2015; Ihrmark et al., 2012). The library preparation, quality control, clean-up
and sequencing was performed at the Next Generation Sequencing (NGS) facility of
Western Sydney University.

The sequence analysis was performed using QIIME2 2018.6. Raw demultiplexed
paired-end reads were checked for their quality and critically evaluated based on
the quality drop offs in the R2 reads (Caporaso et al., 2010). Furthermore, due

75
to the variable length of ITS2 (Schoch et al., 2014; Feibelman et al., 1994), the
use of a paired-end 2x300 bp sequence approach might result into sequence reads
containing both primers which can cause difficulties when merging the forward and
reverse reads. To avoid this, we trimmed the sequences using the plug-in cutadapt
in QIIME2, which allows the removal of the forward and reverse primers within each
read (Martin, 2011). We then filtered the reads using the DADA2 plug-in (Callahan
et al., 2016) and set the quality score to the maxEE 2 for forward and reverse reads.
After checking for the drop-off rate of the sequences, we clustered both fungi and
bacteria as amplicon sequence variants at a 100% similarity (ASVs). While in the
previous chapter, clustering of fungal ASVs was not possible based on the quality of
the sequence reads, we could exclude this issue in this chapter because of the very
good read quality. For the fungal taxonomic assignments, a classifier was trained on
the full length ITS region from the UNITE database (Kõljalg et al., 2005) which is
available on the QIIME2 webpage. We checked the taxon assignment using our fungal
mock community and the fungal ITS2 database. The bacterial classifier was trained
using the SILVA database (version:119, 99%) on the full 16S rRNA gene, which is
also available on the QIIME webpage. All classifiers used a Naive Bayes approach as
outlined in (Bokulich et al., 2018). Taxon assignment was checked using the bacterial
community of a psyllid sample with a known bacterial symbiont community and with
the NCBI database. We checked for sequencing depth using the alpha rarefaction
plug-in in QIIME2 and furthermore excluded the negative and mock community
sample from the microbial community analyses. In addition, we discarded microbial
taxa which occurred at high relative abundances (>40%) in the negative controls and
after checking with available literature made no ecological sense in the meaning of
host and habitat (de Goffau et al., 2018).

4.4 Results

4.4.1 Fungal isolates and growth rates

We counted a total of 902 CFUs across all plates. The CFUs were divided into 12
morphotypes. One of these had morphological features similar to Penicillium ssp.,
and we referred to it as environmental fungus. Another morphotype which was bright
yellow was not further characterised because it was overgrown by different fungi and

76
we were not able to obtain a pure culture of this morphotype. The sequencing of the
remaining 10 morphotypes revealed 18 different fungal species. The largest number of
sequences were of different Raffaelea spp. which made a total of 38% of CFUs obtained
from the washes and the gut extracts from larvae (Figure: 4.1). Furthermore, from
6 samples we isolated Raffaelea ssp. from both, the gut and the washes. We also
detected yeasts like Millerozyma sp., which we found to have a larger prevalence
within the larvae (11.3%) than on the surface (3.4%). Another yeast we which was
only found within the larvae was Candida sp. (0.6%) while Pichia sp. (0.6%) was
only found on the surface.

Figure 4.1: Taxonomic assignment of the isolated fungi (902 CFUs) and their re-
spective counts. Fungi were isolated from larvae that had been surface treated, and
from the wash solution obtained when washing larvae with water.

4.4.2 Growth rate of Raffaelea isolates

In a growth experiment we tested all Raffaelea isolates. Across the three tested tem-
peratures, the highest growth rate was observed at 25 °C. Isolate NG39 (DAR83509)

77
from the gut of larvae appeared to perform slightly better than the other isolates at
all tested temperatures (Figure: 4.2).

Figure 4.2: Boxplot representing the growth of isolates of two Raffaelea ssp. at
different temperatures. Boxes represent the quartiles of the data, while whiskers
extend to explain the rest of the distribution of the data. Diamonds represent outliers.

4.4.3 Phylogenetic analysis of the Raffaelea isolates

The phylogenetic analysis of the large-ribosomal subunit (LSU) revealed two dis-
tinct Raffaelea species. For each species we deposited one to three isolates in the
New South Wales Plant Pathology and Mycology Herbarium of the NSW Depart-
ment of Primary Industries (Figure: 4.3), with the collection specific accession num-
bers (DAR) in parentheses. The phylogenetic analysis showed that the isolate X18
(DAR83510) was closely related to Raffaelea canadensis and Raffaelea cyclorhipidia
with a maximum-likelihood node split of 74. The isolates NG39 (DAR83509), X21
(DAR83509) and X01 (DAR83512) as well as the majority of other Raffaelea isolates
were a sibling species to Raffaelea crossotarsa with a maximum likelihood node split

78
of 83. Furthermore, sequences for isolates X(n), NG(n) and CK(n) that were not
deposited at the NSW DPI collection showed the same phylogenetic relationships
(Figure: 4.3). Both new Raffaelea spp. from N. elongatus were placed within the
same clade of Raffaelea sensu lato of the previously characterised Raffaelea spp. from
other Australian Platypodinae, including from A. incompertus. In addition, we found
two samples having both Raffaelea sp. associated with them.

Table 4.1: The sample ID consists of the three letters (NP for Notoplatypus elongatus
and A, B or C for billet ID) and the number of the individual larvae which were used.
For sample NPC5 and NPC10 we could not distinguish whether they contain Raffaelea
sp. 1 or 2 due to a poor chromatogram, which allowed only assignment to genus but
not to species.

SampleID IsolateID Raffaelea species

NPC1 X05, X03, CK17 Raffaelea sp. (1)

NPB1 X19, X24 Raffaelea sp. (1)
NPC2 CK15, NG7 Raffaelea sp. (1), Raffaelea sp. (2)
NPB2 X20, NG23, NG31 Raffaelea sp. (1)
NPC3 CK12, NG6 Raffaelea sp. (1)
NPA3 NG18 Raffaelea sp. (2)
NPC4 X21, NG39 Raffaelea sp. (1)
NPB4 X12 Raffaelea sp. (1)
NPC5 CK1 Raffaelea sp.
NPB5 X16, X18, NG36 Raffaelea sp. (1), Raffaelea sp. (2)
NPA5 X11, NG15, NG38 Raffaelea sp. (2)
NPC6 X01 Raffaelea sp. (1)
NPC7 X08 Raffaelea sp. (2)
NPC10 NG29, NG24 Raffaelea sp.

79
Figure 4.3: Maximum-likelihood phylogenetic analysis of the large ribosomal sub-
unit (LSU; 28S rRNA gene, 891bp) of fungal isolates from N. elongatus (labels in dark,
beginning with the DAR accession code as deposited in the NSW Plant Pathology
and Mycology Herbarium).

80
4.4.4 Amplicon-sequencing of the 16S rRNA gene and ITS2
of N. elongatus larvae

After quality control, the NGS amplicon sequencing of the 16S rRNA gene and ITS2 of
the ten extracts of N. elongatus larvae yielded a total of 21,413 bacterial and 455,644
fungal reads. These represented 246 bacterial ASVs and 99 fungal ASVs. The highest
number of reads for any bacterial ASV was 13,291 and for any fungal ASV 422,146,
while the lowest number of sequence reads was 2 for bacterial and fungal ASVs. There
was a relatively low diversity of fungi per sample, with a maximum of 25 different
fungal ASVs in one sample. The diversity of bacteria per sample was higher, with a
maximum of 116 ASVs in one sample (Table: 4.2). The rarefaction curves indicated
that we had obtained enough sequencing depth for both microbial kingdoms.

Table 4.2: The number of sequence reads per sample and the number of unique ASVs
per sample. The sample Ne6 had only nine 16S rRNA gene sequence reads and all
of these reads were unassigned and therefore removed from the bacterial community
analysis.

Kingdom Sample number of reads number of unique ASVs

Ne1 54084 21
Ne2 62596 21
Ne3 36805 20
Ne4 74893 21
Ne5 46317 25
Fungi
Ne6 7497 16
Ne7 32051 24
Ne8 46344 16
Ne9 46865 16
Ne10 48192 17

Ne1 606 35
Ne2 288 7
Ne3 67 7
Ne4 15920 116
Ne5 901 25
Bacteria
Ne6 9 0
Ne7 2217 70
Ne8 646 9
Ne9 132 16
Ne10 627 33

81
4.4.5 Taxonomic assignment of bacterial and fungal sequence
reads

One of the ten samples, Ne6, only returned a low number of 16S rRNA gene sequence
reads, and this sample was excluded from the bacterial community analyses. Across
individual samples, the bacterial diversity was dominated by Enterobacteriales in the
samples Ne1 (37%) and Ne9 (35%) and Rhodospirillales in all other samples, ranging
between 23% (sample Ne7) to 95% (sample Ne8). The taxa within Rhodospirillales
were split into seven ASVs, including one that was with 99% of the assigned reads
the most abundant. According to a BLAST against the NCBI database this ASV
was close to a Gluconacetobacter species (97% sequence identity across the entire am-
plicon). Furthermore, other bacterial orders (Corynebacteriales, Pseudomonadales
and Solirubrobacterales) occurred in some samples at higher abundance. The taxo-
nomic assignment of the fungal ITS2 sequence reads revealed one unidentified fungus
compromising over 90% of all sequence reads in nearly all samples. This ASV could
not confidently be assigned to any taxon within the kingdom of fungi using BLAST
against the nucleotide database. Furthermore, one larva (Ne6) had a higher propor-
tion of Pleosporales sequence reads (21%) when compared to the rest of the larvae
where the fungi of Saccharomycetales (yeasts) were the second most abundant order
(1-2%).

82
Figure 4.4: Barplots for the relative abundance and taxonomic assignment based on
the bacterial 16S rRNA gene (top) and the fungal ITS2 sequence reads (bottom). The
sample Ne6 had only nine 16S rRNA gene sequence reads and all of these reads were
unassigned and therefore this sample was not included in the bacterial community
analysis.
83
Figure 4.5: Rarefaction curves for bacterial and fungal reads.

84
4.5 Discussion

This study was the first to investigate the fungi and bacteria associated with larvae
of the ancient platypodine ambrosia beetle N. elongatus. We demonstrated that this
species feeds on two fungi belonging to the genus Raffaelea. We detected both fungi
on the surface of bleached and within washed larvae. Furthermore, we found several
yeasts, including Millerozyma as the most frequently isolated yeast. In addition,
we identified a vast diversity of bacterial 16S rRNA gene amplicons and less diverse
fungal ITS2 amplicons.

The Raffaelea isolates belonged to two distinct species, but because we only obtained
LSU sequences, we could not formally describe them following the International Code
of Botanical Nomenclature requirements as this would also require morphologic a de-
scription and inclusion of more marker gene sequences (Seifert and Rossman, 2010).
Our previous analyses of three other platypodine species only resulted in isolation of
one Raffaelea species per beetle individual (Chapter 2). In two larvae we detected
both new Raffaelea species. Therefore, we propose that being associated with mul-
tiple species of Raffaelea could be a feature of N. elongatus that has to cope with
different environmental conditions than many other ambrosia beetles. In addition, the
two different Raffaelea isolates grouped all within the Raffaelea sensu lato clade. This
clade also includes the fungal isolates of three Australian platypodines, i.e. Raffae-
lea kentii (Austroplatypus incompertus), Raffaelea kilii (Platypus subgranosus) and
Raffaelea spirulatus (Platypus semigranosus). The unique biology of N. elongatus
(larvae develop over presumably long time periods and excavate tunnels from the
base of the tree up to the top were the adult beetles emerge), face low oxygen con-
taining environments and the need to withstand tree defences like substantial resin
flow. Furthermore, we demonstrated that the Raffaelea species are slow growing fun-
gal species under different temperatures and therefore would not rapidly deplete the
nutrients of the woody environment providing longer time frames for the beetles to
develop. However, the slow growth and harsh environmental conditions would make it
difficult for beetles to obtain all nutrients solely by feeding on these associated fungi.
Therefore, we assume that some of the larvae associated bacteria may be important
for larval development, and for the biology of this species in general. The marker
gene sets for bacterial and fungal diversity have different levels of resolution, with an
expected higher resolution for fungal diversity (Lindahl et al., 2013).

85
Nevertheless, we found that the bacteria within larvae were more diverse than the
fungi. This was also found in the case of A. incompertus, while the most preva-
lent bacterial taxa belonged to the Proteobacteria (Chapter 3). The most prevalent
bacterial taxa in N. elongatus belonged to orders of Rhodospirillales (7 ASVs) and
Enterobacteriales (27 ASVs). The sample Ne6 had the highest diversity of bacterial
taxa, however it had also the fewest reads, questioning if the diversity is an artefact of
sequencing. Interestingly one ASV dominated the Rhodospirillales and after blasting
the 402 bp sequence against NCBI, it revealed a close match to the genus Gluconace-
tobacter. These acetic acid bacteria (AAB) are commonly found in insects like bees,
mosquitos, fruit flies and sugar cane mealybugs (Ashbolt and Inkerman, 1990; Cox
and Gilmore, 2007; Favia et al., 2007; White, 1921). They are obligate aerobe bac-
teria, but can also survive unfavorable environments with a low amount of oxygen
(Du Toit and Pretorius, 2002; Joyeux et al., 1984). Rather than being obligate sym-
bionts they mostly serve as secondary symbionts and can be transmitted horizontally
as well as vertically (Damiani et al., 2008). AAB can benefit the insects in several
ways including the possible ability to fix nitrogen (Crotti et al., 2010). These ben-
eficial properties may play a role in the survival of N. elongatus larvae in the harsh
woody environment buried within a tree, but have to be experimentally confirmed.
However, this might proof to be a hard to achieve since there is no confirmed way of
reproducing this beetle under laboratory conditions.

We also isolated yeasts and found them as the second most import family of fungi
associated with N. elongatus larvae. The most abundant yeast was within the genus
Millerozyma (14.7% off all counted CFUs) and was found on the surface of the larvae
as well as within larvae. The importance of these yeasts is unknown but needs further
investigation. Furthermore, the culture independent approach showed that the order
of Saccharomycetales were the second most abundant fungal order within larvae.
However, although yeasts might play a role, their low abundance in the isolation
experiments could also suggest that yeasts may have transient interactions and may
not have any effect. The same may apply to bacteria and we suggest therefore, that
future studies should investigate the effect of yeasts and bacteria on the primary
symbionts as well as the importance in the nutrition of the insect.

86
Chapter 5

General Discussion

5.1 Summary of the objectives

The goal of this research was to establish a better understanding of the microbial
communities and fungal farming strategies of ambrosia beetles in Australia with a
main focus on the eusocial ambrosia beetle Austroplatypus incompertus and three
other Australian platypodine species, Platypus semigranosus, Platypus subgranosus
and Notoplatypus elongatus. More specifically, it characterised fungal and bacterial
communities of fungal farming platypodines and the environmental/ecological param-
eters that can influence the relationship between microbes and beetles.

The thesis addressed the specific questions:

What fungi does A. incompertus farm across its distribution and what fungal sym-
bionts are cultivated by other Platypodinae in Australia? Do they belong to the
genus Raffaelea?

Is the growth of Raffaelea fungi of Australian Platypodinae affected by ethanol con-

centration as recently demonstrated for fungal symbionts of ambrosia beetles where
ethanol content appears to provide a competitive advantage against environmental
fungi?

Do the fungal and bacterial communities associated with A. incompertus vary within

87
and between different beetle families collected from different trees at different sites,
and are microbial community patterns explained by particular biological and ecolog-
ical variables?

What fungi do Notoplatypus elongatus larvae feed on and are the fungal and bacterial
community composition and structure in larvae?

5.2 Summary of the results

5.2.1 Fungal associates of ambrosia beetles in Australia and

their description

This study is the first to investigate the fungal associates of Australian Platypodinae
except for a study conducted on the ambrosia beetle P. subgranosus in the 1980s that
investigated the contribution of this beetle to dieback of Nothofagus cunninghamii
caused by the tree pathogenic fungus Davidsoniella australis (Kile and Hall, 1988;
de Beer et al., 2014). Therefore, the objective of the PhD thesis was to collect different
Australian Platypodinae species from forests within New South Wales and describe
their fungal symbionts, and to also characterise fungi previously isolated from P.
subgranosus and P. semigranosus. Study sites previously established by Smith (2013)
and new field sites were accessed for beetle collections. Fungi were isolated from the
surface of the beetles. Specimens of P. semigranosus were obtained from an infested
pine tree and Raffaelea was isolated from them. Furthermore, cultivated fungi of
two other platypodine species, P. subgranosus and P. semigranosus, were obtained
as isolates that had been lodged with the NSW Department of Primary Industry
Plant Pathology and Mycology Herbarium. The fungi of these two beetle species
have previously not been formerly described.

A key finding was that all three platypodine species are associated with three Raffaela
speices, and consequently these three new fungal species were described. The findings
in the context of previous work on related ambrosia beetles strongly suggest that
these Raffaelea species can be the primary fungal symbionts. However this was not
directly tested in beetle development studies because of the unique biology of these
platypodines and the inability to culture the beetle together with their symbionts.

88
So far, other researchers have shown that all studied Platypodinae are associated
with a fungal species of the genus Raffaelea. Furthermore, I tested the influence
of ethanol on the growth of the different Raffaelea species based on the recently
published evidence of another study to which I contributed (included in the appendix
of the thesis), showing that ethanol added to the growth substrate of fungi provides
ambrosia fungi with a competitive advantage over environmental fungi (Ranger et al.,
2018). However, this effect was not found for the three Raffaelea species isolated from
the Australian Platypodinae, A. incompertus, P. semigranosus and P. subgranosus.
Therefore, I assume that other factors, for example, eucalypt-specific secondary plant
compounds like eucalyptol, terpenoid compounds, or anatomical traits of the wood
could play a role.

In summary, it was demonstrated that Raffaelea species are associated with platypo-
dine beetles within Australia and that in the case of R. kentii of A. incompertus there
was no genetic variation within the LSU and beta-tubulin gene regions between fungal
isolates from distant beetle populations. The cause for this may sit with the biology
of the fungus since the spores are asexually transmitted within the gallery and so far
no sexual state of Raffaelea kentii was found, the genetic markers used not having a
high enough genetic resolution, or, perhaps a more recent acquisition of this fungus
in the evolutionary history of this beetle, and rapid expansion through a selective ad-
vantage. A few other studies found the same patterns in scolytine ambrosia beetles.
For example, the fungal associates of Xylosandrus germanus and Anisandrus dispar
were found to be associated with only one species of Ambrosiella throughout Europe
(van de Peppel et al., 2018). I conclude, that further studies need to be conducted to
investigate the transmission of associated Raffaelea species, investigate the patterns
which shape the fungal gardens of ambrosia beetles and search for genetic structure
in the fungal populations between different beetle populations.

5.2.2 Microbial communities of the uniquely eusocial am-

brosia beetle, A. incompertus, exhibit structure at small
spatial scales and overlap in composition at large spa-
tial scales

The second thesis chapter investigated the community of microbial taxa associated
with Austroplatypus incompertus. I hypothesised that the different populations of

89
A. incompertus would differ in their microbial communities based on the phyloge-
netic differences between the beetles of the northern and southern population of A.
incompertus, which was previously described by Smith (2013). Furthermore, I ex-
pected a shared microbiome across populations of A. incompertus, and expected it to
be confidently transmitted from one generation to the next and across populations,
while environmental variables should exert a small influence on the structure of these
microbial communities. We collected beetles as well as environmental data through-
out the beetles range in New South Wales and extracted DNA from whole beetles.
Using state of the art techniques in high-throughput sequencing, I characterized the
different microbial associates using a marker gene approach for bacteria and fungi.

The results highlight the variables shaping the community of microbial associates of A.
incompertus. The hypothesis, that the phylogenetic relationship of beetles could have
an influence on the microbial structure was not demonstrated, however we can also not
totally discard it yet because the experimental design of the study used one beetle
gallery per tree, making it impossible to entangle family relationship effects from
individual tree effects. Irrespective of this, the results demonstrate a strong pattern of
microbial communities based on the spatial distribution of trees within sites, e.g where
trees (and galleries within) are located. Unfortunately, I only sampled one gallery per
tree, so that I could not investigate the relative contributions of family relationships
within a tree, and the effects of individual trees on microbial communities in beetles
Nevertheless, with the collected data, I was able to demonstrate an effect of trees
on a small spatial scale and a shared microbial community in this beetle species
across a large spatial scale, across most of the beetles range. Furthermore, we could
demonstrate that beetles from the northern population have a distinct mitochondrial
haplotype, and therefore this species has a clear phylogeographic pattern, however
this seems to not have impacted the microbial community composition.

Another takeaway message of this study is that very few reference are available for
the taxonomic assignment of microbial taxa associated with these beetles and that
further studies have to be conducted about the taxonomic diversity and functions of
undescribed microbial taxa associated with A. incompertus. The amplicon sequencing
based approach was a good starting point to obtain a first insight into the associated
taxa at a family level of bacteria and fungi and with the use of these data, specific
primers can be designed. Other high-throughput methods like full-length 16S rRNA
gene sequencing or other approaches might also provide good alternatives.

90
The investigation of yeasts in this beetle species may be particularly interesting,
to discover their diversity and function in the ambrosia symbioses as well as their
interaction with co-occuring bacteria. However, we have to be careful not to over-
emphasize the potential role of yeasts in these microbial communities since these fungi
are very common in the environment and might be therefore be randomly distributed.

5.2.3 Isolation of new Raffaelea species from larvae of the

ancient ambrosia beetle species N. elongatus with di-
verse bacterial and fungal communities

The last experimental data chapter of this thesis was conducted to establish a better
understanding of the biology and ecology of the ancient and basal tesserocerine species
N. elongatus with a particular focus on its microbial associates. We sampled larvae of
this species from one infested tree in the Strickland State Forest, New South Wales.
In contrast to A. incompertus, the presence of N. elongatus is hard to detect in
infested trees since no obvious signs like resin tubes or other signs of infestation can
be seen. Therefore this beetle species is often only discovered in felled trees that
are then processed (personal observation). Across three to four years of intensive
searching for ambrosia beetles in numerous Eucalyptus forests in New South Wales,
we only found two single trees inhabiting N. elongatus. One of these two trees was
cut into billets and dissected larvae from the tunnels for culture-dependent as well
as culture-independent methods. The other tree, a Eucalyptus scias, was located in
Olney State Forest and was not included in this study because of the small amount
of samples we could recover from this tree. We hypothesized to find an association of
Raffaelea species with the larvae of this beetle species and expected a unique microbial
community due to the particularly specialised life history of this beetle species.

This chapter shows that the investigation of Australian Platypodinae can reveal new
species of Raffaelea. We found two Raffaelea isolates, which also grouped within the
Raffaelea sensu lato clade. In contrast to A. incompertus, and as a general novelty for
ambrosia beetles, individual N. elongatus larvae had multiple Raffaelea species asso-
ciated with them. Furthermore, the microbial communities of N. elongatus revealed
a substantial proportion of unidentified fungi in the fungal community, and a high
percentage of Enterobacteriales and Rhodospirillales within the bacterial community.
For the unidentified fungi, even after blasting the ITS2 sequence we were not able

91
to assign them to a family level, which either might be due to primer mismatching
or that these fungi are new species. One amplicon sequence variant was prominently
detected in the bacterial sequence run and was closely related to Gluconacetobacter.
This raises questions on the importance of this unknown fungus and these bacterial
species on the biology of N. elongatus and their interactions with Raffaelea. Further
studies have to be conducted to discovering the taxonomic identity of this other fungus
and bacteria as well as a functional profiling of these microbial species. Furthermore,
I demonstrated a high isolation frequency of yeasts in the larvae of N. elongatus
in the culture-dependent approach as well as in the amplicon sequencing approach.
Yeasts are an understudied group of fungi in the ambrosia research and therefore more
research has to be done unraveling the interaction of yeast with ambrosia beetles.

5.3 Critical discussion of the finding and their lim-

itations

For this thesis I have established methods to study the fungal associates of Australian
ambrosia beetles. My thesis contributes to a substantially improved understanding
of fungal farming in ambrosia beetles, but also highlights current limitations in the
research of these fascinating symbioses. One limitation in the description of new
ambrosia fungi was the culture dependent approach, which can contribute to a mis-
judgment of how many fungi, and in what proportions, are actually associated with
an ambrosia beetle species.We were also limited with access to equipment (incubation
chambers) for the isolates from N. elongatus and therefore could not investigate higher
temperatures above 25°C, which we would suggest for future studies. The use of one
to three different isolation media, can not possibly capture all fungi associated with
beetles. To address this we used culture-independent methods like next-generation
amplicon sequencing, however even this technique has several issues to overcome. The
main issue is the marker choice in order to capture the microbial communities.

I chose to use the generic 16S rRNA gene for bacteria and the ITS2 gene for fungi.
These are two well established gene targets, which were chosen based on the avail-
able databases and previously published literature. Especially, the ITS2 gene was
critical, because studies have shown that the ITS1 sequence in ambrosia fungi such

92
as Raffaelea is hard to amplify (Kostovcik et al., 2015). I also detected this limita-
tion in my research as I was not able to detect the primary fungal symbionts, the
Raffaelea species that I have isolated from the Australian ambrosia beetles by using
culture dependent methods. Furthermore, the Raffaelea species did not amplify in
the mock-communities containing these fungi that were included as controls in the
next-generation amplicon sequencing approach. Other researchers have suggested to
use the 26S rRNA (LSU) region for fungi (Asemaninejad et al., 2016; Mota-Gutierrez
et al., 2019) to avoid this drawback. However, not every sequence facility is covering
this primer and/or may have better experience with the ITS region since it is also
a frequently used primer in the Earth Microbiome Project. In addition, while LSU
might capture Raffaelea species, this marker gene may lack the species resolution and
important community components of the ambrosia symbioses may remain hidden.

These limitations are even more visible in environmental samples, where the influence
of ecological variables like microclimate and different ecosystems may play important
roles. Controlled laboratory conditions may increase the chances of discovering the
roles of fungi and bacteria in ambrosia beetle biology, and how these beetles farm
fungi. However, in contrast to Scolytinae, for which rearing methods have been
established for a few species to study their life cycle and farming techniques of am-
brosia fungi, Platypodinae, due to their long and more concealed life history, still
lack these avenues. Therefore, the establishment of rearing methods of Platypodinae
would be a substantial progress in further elaborating how these ambrosia beetles
farm their fungi. We attempted to overcome this shortcoming by collecting exten-
sively throughout the beetles' distribution. However, this also comes with challenges
due to the overlapping and long-lived nature of generations, which made it hard to
predict which galleries would deliver beetles. This challenge was faced by the second
and third chapter where the microbiomes of A. incompertus and N. elongatus were
investigated. In the case of A. incompertus this was overcome by sampling over a
time period of two years and by accessing many forests across eastern New South
Wales in order to visit old field sites and establish new field sites. For N. elonga-
tus the limitation of available study sites with populations of this species was even
higher. We sampled from ten trees for which we assumed they had been colonised by
N. elongatus but only two of these trees were infested, and the study of only one of
these two trees was possible.

In extension to our intensive field efforts we were strongly reliant also on collaborators

93
throughout Australia who helped pointing us towards sites with potential platypodine
ambrosia beetle activity and we demonstrated that a strong effort in interacting with
forester and researcher community is crucial in progressing ambrosia beetle research.

5.4 Concluding remarks

Here I conclude that there is still much research to be done on the fungal farming
of ambrosia beetles and many new species of ambrosia fungi await to be discovered,
described and characterised. The combination of culture dependent and culture in-
dependent methods as well as laboratory work in controlled environments will be a
good step in the right direction to shed light on the fungal farming of ambrosia beetles
throughout the world.

94
Appendix A

Supplementary Figures and Tables

A.1 Chapter 2

Figure A.1: Maximum-likelihood analysis of ITS2 for the described isolates of Raf-
faelea ssp. from Australia. Raffaelea spirulatus sp. nov. was chosen as a outgroup.
Please note that the additional undescribed isolate from Austroplatypus incompertus
clusters with the described isolates from this host species.

95
Figure A.2: Maximum-likelihood analysis of the exons of the beta-tubulin gene for
the described isolates of Raffaelea ssp. from Australia. We included also sequences
for isolates for Platypus semigranosus we isolated from Bondi State Forest, but were
lost through a mite infestation.

96
A.2 Chapter 3

Table A.1: Variables measured and tested as influencing factors of the fungal and
bacterial communities

Variables measured Unit

storage temperature °C
diameter of host tree cm
longitude degrees
latitude degrees
altitude m
Purity DNA A260/A280, A260/A230
Total DNA used ng

Figure A.3: Rarefaction curves of bacterial and fungal reads

97
Table A.2: Variation explained by phylogenetic distances computed from the UP-
GMA (unweighted pair group method with arithmetic mean) tree after removing the
outliers sample C22 and D12.

Microbial Associates Variable R2 adjusted R2

Phylogenetic Distance 0.04527 0.00798

Location 0.04518 0.00788
Host 0.05542 0.02613
Bacteria Phylogeny + Location 0.05575 -0.02102
Phylogeny + Host 0.07602 0.00896
Location + Host 0.07497 0.01577
all 0.09191 -0.00647
Phylogenetic Distance 0.06843 0.02261
Location 0.05413 0.01568
Host 0.06898 0.03894
Fungi Phylogeny + Location 0.08285 -0.00337
Phylogeny + Host 0.10487 0.02902
Location + Host 0.08866 0.02791
all 0.12401 0.01643

Table A.3: Analysis of the alpha diversity for the number of fungal ASVs between
different Austroplatypus incompertus populations.

Populations Estimate Standard Error T-Ratio P-Value

Dampier SF - Dorrigo 0.94975239 0.2090979 4.542 0.0002

Dampier SF - Mount Wilson 0.36949167 0.2177855 1.697 0.5362
Dampier SF - Olney SF 0.79105811 0.1655424 4.779 0.0001
Dampier SF - Termeil SF 0.72742258 0.2090979 3.479 0.0085
Dampier SF - Wombeyan Caves 0.17576306 0.1905383 0.922 0.9402
Dorrigo - Mount Wilson -0.58026072 0.2510886 -2.311 0.1962
Dorrigo - Olney SF -0.15869428 0.2074109 -0.765 0.9729
Dorrigo - Termeil SF -0.22232981 0.2435917 -0.913 0.9427
Dorrigo - Wombeyan Caves -0.77398934 0.2278592 -3.397 0.0111
Mount Wilson - Olney SF 0.42156644 0.2161662 1.950 0.3761
Mount Wilson - Termeil SF 0.35793091 0.2510886 1.426 0.7115
Mount Wilson - Wombeyan Caves -0.19372862 0.2358567 -0.821 0.9632
Olney - Termeil SF -0.06363553 0.2074109 -0.307 0.9996
Olney SF - Wombeyan Caves -0.61529506 0.1886853 -3.261 0.0170
Termeil SF - Wombeyan Caves -0.55165952 0.2278592 -2.421 0.1557

98
Table A.4: Analysis of the alpha diversity for the number of bacterial OTUs between
different Austroplatypus incompertus populations.

Populations Estimate Standard Error T-Ratio P-Value

Dampier SF - Dorrigo 0.33333111 0.1779688 1.873 0.4229

Dampier SF - Mount Wilson 0.12046358 0.1853629 0.650 0.9869
Dampier SF - Olney SF 0.09106576 0.1408975 0.646 0.9872
Dampier SF - Termeil SF 0.39492756 0.1779688 2.219 0.2353
Dampier SF - Wombeyan Caves -0.70945182 0.1621721 -4.375 0.0003
Dorrigo - Mount Wilson -0.21286753 0.2137081 -0.996 0.9186
Dorrigo - Olney SF -0.24226535 0.1765329 -1.372 0.7435
Dorrigo - Termeil SF 0.06159644 0.2073273 0.297 0.9997
Dorrigo - Wombeyan Caves -1.04278293 0.1939370 -5.377 <.0001
Mount Wilson - Olney SF -0.02939782 0.1839848 -0.160 1.0000
Mount Wilson - Termeil SF 0.27446398 0.2137081 1.284 0.7932
Mount Wilson - Wombeyan Caves -0.82991540 0.2007438 -4.134 0.0008
Olney SF - Termeil SF 0.30386179 0.1765329 1.721 0.5200
Olney SF - Wombeyan Caves -0.80051758 0.1605951 -4.985 <.0001
Termeil SF - Wombeyan Caves -1.10437938 0.1939370 -5.695 <.0001

99
Figure A.4: Relative abundance of phyla of bacteria of Austroplatypus incompertus
in each population. Bars showing the percentage of bacteria found in the different
beetles per population.

100
Figure A.5: Relative abundance of phyla of fungi of Austroplatypus incompertus
in each population. Bars showing the percentage of bacteria found in the different
beetles per population.

101
Figure A.6: Relative abundance of family of bacteria of Austroplatypus incompertus
in each population. Bars showing the percentage of bacteria found in the different
beetles per population.

102
Figure A.7: Relative abundance of family of fungi of Austroplatypus incompertus in
each population. Bars showing the percentage of funi found in the different beetles
per population.

A.3 Coauthored paper, not part of PhD project

103
Symbiont selection via alcohol benefits fungus farming
by ambrosia beetles
Christopher M. Rangera,b,1,2, Peter H. W. Biedermannc,d,1,2, Vipaporn Phuntumarte, Gayathri U. Beligalae,
Satyaki Ghoshe, Debra E. Palmquistf, Robert Muellerc,g, Jenny Barnetta, Peter B. Schultzh, Michael E. Redinga,b,
and J. Philipp Benzi
a
Horticultural Insects Research Laboratory, US Department of Agriculture–Agricultural Research Service, Wooster, OH 44691; bDepartment of Entomology,
Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH 44691; cDepartment of Biochemistry, Max Planck Institute
for Chemical Ecology, 07745 Jena, Germany; dDepartment of Animal Ecology and Tropical Biology, Biozentrum, Julius Maximilian University Würzburg,
97074 Würzburg, Germany; eDepartment of Biological Sciences, Bowling Green State University, Bowling Green, OH 43403; fUS Department of
Agriculture–Agricultural Research Service Midwest Area, Peoria, IL 61604; gHawkesbury Institute for the Environment, Western Sydney University, Penrith,
NSW 2751, Australia; hHampton Roads Agricultural Research and Extension Center, Virginia Polytechnic Institute and State University, Virginia Beach, VA
23455; and iSchool of Life Sciences Weihenstephan, Technical University of Munich, D-85354 Freising, Germany

Edited by Jerrold Meinwald, Cornell University, Ithaca, NY, and approved March 14, 2018 (received for review September 25, 2017)

Animal–microbe mutualisms are typically maintained by vertical sym-
biont transmission or partner choice. A third mechanism, screening of
high-quality symbionts, has been predicted in theory, but empirical
examples are rare. Here we demonstrate that ambrosia beetles rely
on ethanol within host trees for promoting gardens of their fungal
symbiont and producing offspring. Ethanol has long been known as
the main attractant for many of these fungus-farming beetles as they
the bark beetles (Scolytinae) and once in the pinhole borers (Pla-
typodinae) (Coleoptera: Curculionidae) (5–8). About 3,400 scoly-
tine and 1,400 platypodine species are collectively known as
“ambrosia beetles” for their obligate mutualism with nutritional
fungal symbionts (9). Notably, larvae and adult ambrosia beetles
obtain all their nutrition solely by consuming their symbiont(s),
which is necessary to properly develop and reproduce (10–13).

select host trees in which they excavate tunnels and cultivate fungal
gardens. More than 300 attacks by Xylosandrus germanus and other
species were triggered by baiting trees with ethanol lures, but none
of the foundresses established fungal gardens or produced broods
unless tree tissues contained in vivo ethanol resulting from irrigation
with ethanol solutions. More X. germanus brood were also produced
in a rearing substrate containing ethanol. These benefits are a result
of increased food supply via the positive effects of ethanol on food-
fungus biomass. Selected Ambrosiella and Raffaelea fungal isolates
from ethanol-responsive ambrosia beetles profited directly and in-
directly by (i) a higher biomass on medium containing ethanol, (ii)
strong alcohol dehydrogenase enzymatic activity, and (iii) a compet-
itive advantage over weedy fungal garden competitors (Aspergillus,
Penicillium) that are inhibited by ethanol. As ambrosia fungi both
detoxify and produce ethanol, they may maintain the selectivity of
their alcohol-rich habitat for their own purpose and that of other
ethanol-resistant/producing microbes. This resembles biological
screening of beneficial symbionts and a potentially widespread,
unstudied benefit of alcohol-producing symbionts (e.g., yeasts) in
other microbial symbioses.
|
fungus-farming insects plant–insect–microbe interactions | symbiosis |
|
insect–fungus mutualism host screening
ECOLOGY
Ambrosia beetles vertically transmit their fungal symbionts to
host trees using specialized structures called “mycangia” that
range from simple pits and grooves to comparatively large and
complex pouches (9, 14, 15). Fungal symbionts carried within the
mycangia are mostly of the ascomycete genera Ambrosiella and
Raffaelea and have not been found as free-living species, but
their ancestors were free-living and relied on arthropods for
dispersal (16, 17). A tight coevolutionary pattern and specific
beetle–fungal associations have been documented, particularly
for beetle genera with large, elaborate mycangia (16–19).
As with other ambrosia beetles in the tribe Xyleborini (Scoly-
tinae), male Xylosandrus germanus are flightless, and host selec-
tion is made by female foundresses (20). Adult females tunnel
Significance
Ambrosia beetles are among the true fungus-farming insects
and cultivate fungal gardens on which the larvae and adults
feed. After invading new habitats, some species destructively
attack living or weakened trees growing in managed and un-
managed settings. Ambrosia beetles adapted to weakened trees
tunnel into stem tissues containing ethanol to farm their sym-
biotic fungi, even though ethanol is a potent antimicrobial agent
that inhibits the growth of various fungi, yeasts, and bacteria.
Here we demonstrate that ambrosia beetles rely on ethanol for

H osts evolve to facilitate their beneficial symbionts selectively

(1), while symbionts commonly compete within the host-
provided environment (2). The best-studied mechanisms by which
hosts maintain their association with beneficial symbionts are
partner choice and partner fidelity (i.e., vertical transmission of
symbionts through generations). Competition-based screening is
a third theoretical mechanism that empirically is hardly studied (3,
4). It states that hosts can maintain mutualistic associations with
beneficial symbionts by creating a demanding environment that is
demanding in such a way that the host-preferred symbiont is better
able to endure the demands. To our knowledge, the only examples
come from squid–bacteria, ant–bacteria, and ant–plant mutualisms,
but screening is likely to be much more widespread (3).
Fungus farming as a source of nutrition arose in ants, termites,
and beetles between 40‒100 My before humans began domesti-
cating plants for agriculture (5). Members of these three insect
lineages are true fungus farmers that propagate, cultivate, and
sustainably harvest their fungal gardens (6). This lifestyle evolved
only once in ants and termites but originated more than 10 times in
host tree colonization because it promotes the growth of their
fungal gardens while inhibiting the growth of “weedy” fungal
competitors. We propose that ambrosia beetles use ethanol to
optimize their food production.
Author contributions: C.M.R., P.H.W.B., V.P., G.U.B., S.G., P.B.S., M.E.R., and J.P.B. de-
signed research; C.M.R., P.H.W.B., V.P., G.U.B., S.G., R.M., J.B., P.B.S., M.E.R., and J.P.B.
performed research; C.M.R., P.H.W.B., V.P., and J.P.B. contributed new reagents/analytic
tools; C.M.R., P.H.W.B., V.P., G.U.B., S.G., D.E.P., R.M., J.B., P.B.S., M.E.R., and J.P.B. ana-
lyzed data; and C.M.R., P.H.W.B., and V.P. wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
This open access article is distributed under Creative Commons Attribution-NonCommercial-
NoDerivatives License 4.0 (CC BY-NC-ND).
1
C.M.R. and P.H.W.B. contributed equally to this work.
2
To whom correspondence may be addressed. Email: christopher.ranger@ars.usda.gov or
peter.biedermann@uni-wuerzburg.de.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1716852115/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1716852115 PNAS Latest Articles | 1 of 6

within the sapwood of trees, where they create galleries to farm
their symbionts and rear offspring. Conceivably, this environ-
ment is created in a way that selectively facilitates vertically
transmitted food fungi over parasitic and pathogenic fungi.
Choice of a selective substrate for growing the fungus gardens
may be a potent mechanism to do so. An initial competitive
advantage to the food cultivars is given by the inoculation of host
tunnels with masses of spores overflowing from the mycangium
or present in the feces of the founding female (15). A white
fungal layer of Ambrosiella or Raffaelea conidia or conidiophores
is produced only in the beetles’ presence (10–12). During initial
excavation, host tunnels can become inoculated not only with the
fungal symbionts but also with a variety of microbial competitors
that can hitchhike on the integument of the foundresses. These
“weedy” microbial competitors and pathogens include fungi
(e.g., Aspergillus, Paecilomyces, and Penicillium) and bacteria (11,
12, 21, 22). If unmanaged, these microbes can disrupt the es-
tablishment of the gardens of ambrosia beetles and other fungus-
farming insects (23) and eventually dominate the gallery system
(24, 25). It is therefore important for foundresses to ensure that
their fungal cultivars become established within freshly excavated
tunnels promptly and that they keep dominating other weedy
microorganisms (24, 25). Furthermore, ambrosia beetles begin
ovipositing only after their fungal gardens are established and
flourishing (10–12, 24); otherwise the foundress will die or aban-
don the tunnel, and colonization will be unsuccessful (26).
Most species of ambrosia beetles attack dying or dead trees, but
some exotic species introduced to new habitats destructively at-
tack living trees growing in managed and unmanaged systems (27–
30). Ethanol has long been known to attract many ambrosia
beetles (31), and its emission from living but weakened trees in the
lures attracted beetles and induced attacks on stems, but X.
germanus failed to establish fungal gardens or produce broods
in the absence of in vivo ethanol. Irrigating the roots of trees
with ethanol solutions [0%, 1%, 2.5%, or 5% (vol/vol)] also
attracted beetles and induced attacks on stems, and X. germanus
foundresses established fungal gardens and produced brood in
the presence of in vivo ethanol within these tissues.
Dogwood trees baited with ethanol lures sustained a total of
192 attacks, while trees irrigated with 1%, 2.5%, or 5% ethanol
solutions sustained 84, 206, and 464 total attacks, respectively
(Fig. 1A). There was no difference in cumulative attacks on
ethanol-baited dogwoods compared with trees irrigated with 1%
or 2.5% ethanol solutions (Fig. 1A). Similarly, redbud trees
baited with ethanol lures sustained a total of 111 attacks, while
trees irrigated with 1%, 2.5%, or 5% ethanol solutions sustained
195, 352, and 507 total attacks, respectively (Fig. 1B). There was
no difference in cumulative attacks on ethanol-baited redbud
trees compared with trees irrigated with 1% ethanol (Fig. 1B).
Following dissection of the stems, a comparable number of
living X. germanus foundresses were recovered from ethanol-
baited dogwoods and from trees irrigated with 1% ethanol
(Fig. 1C). A comparable number of X. germanus foundresses
were also recovered from ethanol-baited redbuds and from 1%
ethanol-irrigated trees (Fig. 1D). However, despite 192 and 111
total ambrosia beetle attacks, respectively, no tunnels created in
ethanol-baited dogwoods or redbuds contained living X. germanus
150
Cornus florida
150
Cercis canadensis
A a B
Attacks

100 100 a
early stages of physiological stress is used by some of the more ab
aggressive beetle species to locate new hosts for establishing 50 b b 50 bc
fungal gardens and producing offspring (26, 27). A byproduct of b c
anaerobic respiration, ethanol is a ubiquitous component of the 0 0
sapwood, phloem, and cambium of many living tree species (32, 10 80
C D
Foundresses
Living Xg

8
33). Ethanol is present in some tissues of healthy trees, but in 60
a
6 a a a
weakened trees it increases dramatically due to limited oxygen 4
40
ab
availability resulting from a variety of physiological stressors (32– 2 20 b
b b
34). When given free choice, X. germanus preferentially attacked 0 0
flood-intolerant tree species with elevated ethanol levels over 4 40
Xg Galleries with
Fungal Gardens

a a
flood-tolerant tree species containing little to no ethanol (26). 3 E a 30 F a
When confined without choice to stem tissues, X. germanus ex- 2 a 20
cavated galleries, established fungal gardens, and produced off- 1 10
spring in flood-stressed trees but created only superficial tunnels b
0 0
absent of fungal growth and offspring in nonflooded trees (26). A
70 700
strong preference for host tissues containing ethanol was de- 60
G a a 600
H a
Xg Eggs

cisively demonstrated by Kelsey et al. (35): More than four times 50

40
500
400 a
more ambrosia beetle attacks occurred above ethanol-infused 30 300
sapwood tissues than in the opposite side of the same log that 20 200
10 b 100 b
did not receive ethanol treatment. 0 0
While ethanol is highly attractive to many ambrosia beetles, it is 40 400
a
I a J
Xg Larvae

also a well-known antimicrobial agent that has been used as a 30 300 a

preservative by humans since prehistory (36). Ethanol reduces the
postharvest decay of fruits and extends the shelf-life of food
products by inhibiting various fungi, including Aspergillus spp. and
Penicillium spp. (37). Ambrosia beetles’ specific selection of host
tissues containing a potent antimicrobial agent to cultivate their
fungal gardens would therefore seem counterproductive. Here we
present evidence that X. germanus, and probably many other
ambrosia beetles, rely on the ethanol within tissues of living trees
to optimize the production of their fungal gardens and therefore
successful offspring production. We propose that this is a measure
to achieve improved growth and to create a competitive advantage
for Ambrosiella and Raffaelea fungus cultivars.
Results
Ethanol and Host Tree Colonization Success. Field-based experi-
ments compared the absence or presence of ethanol within stems
of dogwood (Cornus florida) and redbud (Cercis canadensis) trees
with the colonization success of X. germanus. Ethanol sachet
ab
20 200
10 100
0
b b
0
- + 0 1 2.5 5 - + 0 1 2.5 5
Ethanol-Baited Ethanol-Irrigated (%) Ethanol-Baited Ethanol-Irrigated (%)
Fig. 1. (A and B) Cumulative ambrosia beetle attacks per tree on C. florida
(A) and C. canadensis (B) trees that were ethanol-baited or irrigated with
ethanol solutions containing 0%, 1%, 2.5%, or 5% ethanol (vol/vol). (C–J)
Trees were dissected to determine the mean number per tree of X. germa-
nus living foundresses (C and D), tunnels containing living X. germanus
foundresses and fungal gardens (E and F), X. germanus eggs (G and H), and
X. germanus larvae (I and J). Different letters denote significant differences
in mean values using one-way ANOVA and Tukey’s HSD at P < 0.05 (n =
5 and 6 trees per treatment for C. florida and C. canadensis, respectively). (A)
F19 = 22.65; P < 0.0001. (B) F23 = 13.53; P < 0.0001. (C) F19 = 4.11; P = 0.024.
(D) F23 = 8.88; P = 0.0006. (E) F14 = 1.14; P = 0.35. (F) F17 = 6.17; P = 0.011. (G)
F14 = 7.03; P = 0.01. (H) F17 = 8.10; P = 0.0041. (I) F14 = 4.75; P = 0.03. (J) F17 =
6.66; P = 0.009. Error bars represent ± SE.

2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1716852115 Ranger et al.

foundresses with established fungal gardens. In contrast, tun-
nels with foundresses and fungal gardens occurred in dogwoods
(Fig. 1E) and redbuds (Fig. 1F) irrigated with 1%, 2.5%, or 5%
ethanol. No tunnels containing an X. germanus foundress and
oviposited eggs or larvae occurred in ethanol-baited dogwoods
or redbuds (Fig. 1 G–J). In contrast, tunnels/galleries contain-
ing an X. germanus foundress and eggs and larvae were found in
dogwood and redbud trees irrigated with 1%, 2.5%, or 5%
ethanol (Fig. 1 G–J). No species of Scolytinae established
fungal gardens or produced brood in the ethanol-baited dog-
woods or redbuds.
Ethanol and Ambrosia Beetle Offspring Production. Bioassays using
an artificial rearing substrate infused with 0%, 0.1%, 0.5%, 1%,
2.5%, or 5% (vol/vol) ethanol characterized the effects of etha-
nol on fungal garden establishment and offspring production by
X. germanus. The presence of X. germanus’ greyish-white am-
brosial gardens peaked in tubes containing 2.5% ethanol; in
particular, fungus was present in 12.5% of tubes containing 0%
and 0.1% ethanol, in 87.5% of tubes containing 0.5% and 1%
ethanol, in 100% of tubes containing 2.5% ethanol, and in 0% of
tubes containing 5% ethanol. The occurrence of larvae and pu-
pae within the artificial rearing substrate were observed only in
the presence of X. germanus’ greyish-white fungal gardens. Thus,
the number of larvae and pupae per substrate tube also increased
and then decreased in response to increasing amounts of ethanol
from 0 to 5% (Fig. 2 A and B).
Ethanol and Fungal Growth. An agar plate bioassay examined the
effect of ethanol on Ambrosiella grosmanniae, the fungal symbiont
of the ethanol-responsive X. germanus. The dry weight of A. gros-
manniae initially increased and then decreased with increasing
amounts of ethanol in the medium from 0% to 5% (vol/vol) (Fig. 3
A and D and Table S1). The surface area of A. grosmanniae gen-
erally decreased (Fig. 3B) while biomass density increased (Fig. 3C)
with increasing ethanol concentrations from 0% to 5%. The same
procedure was applied to two other fungal symbionts associated
with ethanol-responsive ambrosia beetles, namely, Ambrosiella
roeperi associated with Xylosandrus crassiusculus and Raffaelea
canadensis associated with Xyleborinus saxesenii. The dry weight of
A. roeperi initially increased and then decreased in response to in-
creasing ethanol concentrations (Fig. 4A and Table S1). The growth
of R. canadensis also initially increased and then decreased in re-
sponse to increasing amounts of ethanol (Fig. 4B and Table S1).
Growth was also measured for Ascoidea hylecoeti, the fungal
symbiont of a ship-timber beetle (Elateroides dermestoides,
Lymexylidae) that is also attracted to ethanol (38). The growth of the
Ascoidea sp. steadily decreased with increasing amounts of ethanol
A B
Larvae per Substrate Tube
15
Pupae per Substrate Tube
10
5 2
0 0
0 1 2 3 4 5 0 1 2
Ethanol (%) in Substrate
Fig. 2. (A and B) Relationship between ethanol incorporated into a saw-
dust-based agar substrate at 0%, 0.1%, 0.5%, 1%, 2.5%, or 5% (vol/vol)
and the presence of (A) larvae and (B) pupae of X. germanus, an ethanol-
responsive ambrosia beetle. Data points represent mean values of larvae or
pupae per tube as a function of ethanol percent using a standard weighting
factor of 1/variance (n = 8 per ethanol concentration; see Table S1 for re-
gression equations). (A) r2 = 0.90; F5 = 60.08; P = 0.002. (B) r2 = 0.96; F5 =
168.96; P = 0.0002). (C) White ambrosia garden of A. grosmanniae within the
artificial rearing substrate.
Ranger et al.
A B Ambrosiella grosmanniae C
0.08 0.4
Density (mg/cm2×100)
40
Surface Area (cm2)
Dry Weight (mg)
0.06 30 0.3
0.04 20 0.2
0.02 10 0.1
0.00
0 1 2 3 4 5
0
0 1 2 3 4 5
0.0
0 1 2 3 4 5
Ethanol in Media (%) Ethanol in Media (%) Ethanol in Media (%)
D
0 1 2.5 5
Ethanol in Media (%)
Fig. 3. (A–C) Agar plate bioassays characterized the effects of ethanol in-
corporated into the medium at concentrations of 0%, 1%, 2.5%, or 5% (vol/vol)
on the dry weight (A), surface area (B), and density (C) of A. grosmanniae,
the fungal symbiont of the ethanol-responsive ambrosia beetle X. germanus.
Data points represent mean growth values as a function of ethanol per-
centage using a standard weighting factor of 1/variance (n = 7‒10 per
ethanol concentration; see Table S1 for regression equations). (A) r2 = 0.99;
F4 = 22,685.60; P = 0.00004. (B) r2 = 0.99; F4 = 34,770.7; P = 0.00003. (C) r2 =
0.91; F4 = 31.68; P = 0.031. (D) Representative growth of A. grosmanniae on
ECOLOGY
agar medium infused with ethanol.
from 0% to 5% (Fig. 4C and Table S1). A negative correlation
occurred between ethanol concentration and dry weight of A.
hylecoeti (Pearson correlation coefficient = −0.906; P < 0.0001).
Dry weight of a Penicillium sp., a microbial competitor of am-
brosia beetle fungal cultivars isolated from galleries of X. saxesenii,
rapidly decreased with increasing amounts of ethanol from 0% to
5% (Pearson correlation coefficient = −0.743; P = 0.0002) (Fig.
4D and Table S1). The growth of an Aspergillus sp. generalist
pathogen, also isolated from X. saxesenii galleries, decreased and
was negatively correlated (r = −0.965; P < 0.0001) with increasing
amounts of ethanol from 0% to 5% (Fig. 4E and Table S1).
To further validate the observations, we measured the growth of
liquid cultures in the presence or absence of ethanol and in the
presence or absence of 2% glucose (Fig. S1). While increasing
concentrations of ethanol generally led to prolonged lag phases,
these were considerably shorter for A. grosmanniae and R. cana-
densis (maximum of about 20 h in the presence of 5% or 10%
ethanol) than for a Penicillium competitor isolate (about 48 h) (Fig.
S1). The growth rate was enhanced in most cases by the addition of
2% glucose, but this did not greatly affect the duration of the lag
phase. While A. roeperi displayed extremely low overall growth rates,
this symbiont grew only in the presence of ethanol in this bioassay.
C Alcohol Dehydrogenase Activity. Ethanol is generally toxic and in
all organisms is detoxified to acetaldehyde by alcohol dehydro-
5
genases (ADHs). Enzymatic ADH activity therefore determines
4 ethanol tolerance, which was tested using a standard ADH ac-
3 tivity assay before and after exposure to 2% ethanol on plates
containing A. grosmanniae, A. roeperi, R. canadensis, an Asper-
1 gillus sp., and a Penicillium sp. (Fig. 5). Compared with the un-
treated control cultures, ADH activity was significantly (P <
3 4 5 0.05) higher in the ambrosia beetle cultivar A. grosmanniae after
6 and 93 h of exposure to ethanol (Fig. 5A) and in R. canadensis
after 93 h of exposure (Fig. 5C). While Aspergillus sp. cultures
showed almost no detectable ADH activity in the same condi-
tions (Fig. 5D), activity was slightly induced in A. roeperi (Fig.
5B) and the Penicillium sp. (Fig. 5E).
Discussion
The affinity of ambrosia beetles for host-derived ethanol has been
viewed as a function of this compound acting as a chemical indicator
of weakened, dying, or recently felled trees with compromised
PNAS Latest Articles | 3 of 6
 A B C among other alcohols (53 and 54), which may maintain an alcohol-
30 Ambrosiella roeperi 70 Raffaelea canadensis 20 Ascoidea sp.
Dry Weight (mg)
25 60
20 50 10
15
40
30
10 5
20
5 10
0 0 0 ethanol-resistant yeasts are the dominant symbionts, next to am-
0 1 2 3 4 5 0 1 2 3 4 5 0 1
D E
40 Penicillium commune 30 Aspergillus sp.
30 20
20 10
10 5 species, thus allowing only bioluminescent Vibrio fisheri bacteria to
0 0
0 1 2 3 4 5 0 1 2 3 4
Ethanol in Media (%)
Fig. 4. (A and B) Agar plate bioassays characterized the effects of ethanol
incorporated into the medium at concentrations of 0%, 1%, 2.5%, or 5%
(vol/vol) on the growth of A. roeperi (A) and R. canadensis (B), fungal sym-
bionts of the ethanol-responsive ambrosia beetles X. crassiusculus and X.
saxesenii, respectively. (C–E) Growth of A. hylecoeti, the fungal symbiont of
a ship-timber beetle (C) and fungal competitors of the symbionts including
Penicillium sp. (D) and Aspergillus sp. (E). Data points represent mean
growth values as a function of ethanol percentage using a standard
weighting factor of 1/variance (n = 5 per ethanol concentration for A. roeperi
and A. hylecoeti; n = 9‒10 for R. canadensis; n = 8‒10 for Aspergillus sp.;
see Table S1 for regression equations). (A) r2 = 0.87; F4 = 21.81; P = 0.044. (B)
r2 = 0.99; F4 = 2,773.97; P = 0.0004. (C) r2 = 0.72; F3 = 19.25; P = 0.0482. (D)
r2 = 0.98; F4 = 173.71; P = 0.006. (E) r2 = 0.99; F4 = 12,658.3; P = 0.0001.
defenses that therefore are vulnerable to attack (27, 39). Based on
our results, we propose that ambrosia beetles preferentially select
host tissues containing ethanol because it provides a dual-functional
benefit to their fungiculture: It promotes the growth of their nu-
tritional fungal symbionts and reduces competition with fungal
weeds that get suppressed. Our study shows an advantage for am-
brosia beetles in selecting an ethanol-rich substrate to grow their
coevolved fungal symbionts (i.e., A. grosmanniae, A. roeperi, and R.
canadensis). Ethanol thereby benefits fungal crop production by
ambrosia beetles and adds to other known behavioral or chemical
means by which insects specifically promote their food fungi over
other antagonists (40–43). Notably, attine ants apply fertilizers (44)
and antibiotics (45, 46) to selectively facilitate the growth of food
fungi over weeds and pathogens.
Promptly establishing fungal gardens within newly exca-
vated host tunnels improves the chances of fungal symbionts
outcompeting microbial competitors, including Aspergillus and
Penicillium (24, 47), that can be passively introduced during
tunnel excavation. We suggest that ethanol within host tree tis-
sues facilitates this competitive advantage, as the growth of A.
grosmanniae, A. roeperi, and R. canadensis benefitted from the
presence of low concentrations of ethanol, while the Penicillium
and Aspergillus competitors were inhibited. Ethanol could also
provide a competitive advantage over entomopathogenic fungi
since it inhibits the growth of Trichoderma harzianum (37).
Alcohol-detoxifying enzymes were strongly induced in A. gros-
manniae and R. canadensis after exposure to ethanol, while ADH
activity was low to absent in Penicillium sp. and Aspergillus sp.
Genetic mutations allowing the comparatively fast metabolism of
ethanol might permit the fungal symbionts to consume or at least
rapidly detoxify ethanol present in the host tissues and thereby
achieve improved growth. Bacteria (Acinetobacter spp., Pseudo-
monas aeruginosa) (48, 49), many yeasts (50, 51), and the fungal
tree pathogen Armillaria mellea (52) have also been proposed to
use ethanol as a carbon source. In addition to detoxifying ethanol,
ambrosia beetle fungal symbionts are known to produce ethanol,
4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1716852115
rich gallery environment even after its production by plant cells
has ceased (i.e., because of tree death). Such consumption, pro-
duction, and environmental accumulation of ethanol has been
reported so far from only three lineages of yeasts, in which it has
been shown to be a potent tactic for securing their food resource
against other microbial and possibly also arthropod competitors
(50, 51, 55). Therefore, the presence of ethanol may explain why
2 3 4 5
brosia fungi, in ambrosia beetle galleries (56, 57).
The role of screening by hosts to generate and maintain a
beneficial community of symbionts in animal–microbe mutualisms
is generally understudied. Currently, the clearest case of biological
screening appears in Euprymna scolopes squids, which create a
demanding environment in which bacterial bioluminescence
protects the symbionts against the host’s lethal reactive oxygen
colonize the light organ (3, 58). Fungus-farming insects select and
5 prepare substrates for their nutritional fungi to grow on, so they
should be predisposed for screening. They may choose selective
substrates varying in bioactive compounds (e.g., ethanol in this
study), or they (or their symbionts) may actively incorporate such
compounds into the medium (4, 45, 59). This would add to
mechanisms known to maintain associations with beneficial fungal
cultivars by farming insects, such as partner choice through sig-
naling (fungus-farming termites) and vertical symbiont trans-
mission in the fungus spore-carrying organs of nest-founding
individuals [ambrosia beetles and attine ants (5)].
Since our current study and previous ones (26, 28, 34) dem-
onstrate that X. germanus does not colonize healthy trees, attacks
on living but weakened trees emitting stress-induced ethanol are
arguably a function of maximizing successful fungus farming.
Following their introduction to new habitats, the establishment
and proliferation of ambrosia beetles could benefit from the
combination of a broad host range and the ability to utilize host
tissues containing ethanol. Host tissue chemistry could also reduce
interspecific competition by excluding non–ethanol-responsive
ambrosia beetles (e.g., Xyleborus glabratus and Raffaelea lauricola)
vs. opportunistic species with broad host ranges that have an af-
finity for ethanol and living but weakened trees (X. germanus and
A. grosmanniae). Presumably this effect is not only restricted to
other ambrosia beetles but is also found in other competitors
(e.g., wood-boring beetles) that are not resistant to ethanol.
Likewise, the tolerance toward alcohol produced by certain yeasts
has been shown to determine the relative success of particular
Drosophila spp. (60, 61).
Control 6 hr ethanol exposure 93 hr ethanol exposure
ADH Activity (milliunits/mg)
A B C a D E
b
b
b
a a a a a
a a
a a a a
Ambrosiella Ambrosiella Raffaelea Aspergillus Penicillium
grosmanniae roeperi canadensis sp. sp.
Fig. 5. (A–E) Enzymatic ADH activity of fungal symbionts (A. grosmanniae, A.
roeperi, and R. canadensis) and symbiont competitors (Aspergillus sp., Penicillium
sp.) immediately before (control) and after short-term (6 h) or long-term (93 h)
exposure to 2% ethanol. First and third quartiles enclose the box plots with median
and mean values represented by a bar and an “x” within the boxes, respectively;
top and bottom whiskers represent maximum and minimum values, respectively.
Different letters within a species denote significant differences between control vs.
6-h or 93-h mean values using one-way ANOVA and Dunnett’s test at P < 0.05 (n =
3−4 cultures per species and treatment). (A) F10 = 10.47; P = 0.006. (B) F9 = 1.61; P =
0.27. (C) F11 = 4.53; P = 0.044. (D) F10 = 1.45; P = 0.29. (E) F10 = 2.66; P = 0.13.
Ranger et al.
 The high-level food production of ambrosia beetles suggests the
evolution of horticultural practices used by other insect and hu-
man farmers, including crop fertilization and chemical control of
competitors and pathogens (5). Still, additional facets of ambrosia
beetle fungiculture remain to be elucidated. For instance, the
production of defensive compounds such as antibiotics by symbi-
onts of farming ants and termites to help defend against weedy
competitors (45, 62) has also been described for bacterial symbi-
onts of a bark beetle (41) and a mold-like fungus of an ambrosia
beetle (63). In microbes, such defense reactions are usually in-
duced under stress (64), so it is likely that alcohol-rich environ-
ments not only screen in alcohol-producing microbes but also
induce antibiotic production. Interestingly, many of the ophios-
tomatoid fungal mutualists of ambrosia beetles, including
Ambrosiella and Raffaelea, are resistant to the fungicide cyclo-
heximide (65, 66), which may indicate the presence of microbes
that produce this antibiotic. Again, this would screen in antibiotic-
producing symbionts and screen out nonresistant species.
Taken together, the experimental findings presented here re-
veal that the affinity of X. germanus for ethanol benefits their
fungicultural lifestyle. The failure of ambrosia beetle foundresses
to inoculate a host and establish a fungal garden probably rep-
resents a key weak point in the evolution of this obligate mutu-
alism, because beetles will die or abandon the freshly excavated
tunnels if inoculation is unsuccessful (26). Understanding the
role of host chemistry in promoting and inhibiting the estab-
lishment of ambrosia beetle fungal symbionts could lead to novel
management strategies for these devastating pests of trees in
horticultural, ornamental, and forested settings.
Methods
Ethanol and Host Tree Colonization Success. The influence of ethanol was ex-
amined by comparing attacks, presence of fungal gardens, and X. germanus
offspring production in trees that were either baited or irrigated with aqueous
solutions of ethanol. In particular, the experiment sought to compare coloni-
zation success in stem tissues that were in the vicinity of but lacking in vivo
ethanol (i.e., ethanol-baited trees) vs. trees with tissues containing ethanol
(ethanol-irrigated). Two deciduous species commonly attacked by X. germanus
were selected (28): C. florida was tested during the first field experiment fol-
lowed by C. canadensis. C. florida trees of stems measuring 2.54 cm in diameter
and C. canadensis trees of 3.81-cm caliper were grown in 26.5-L pots containing
a pine bark and peat moss mix amended with lime and micronutrients.
Ethanol-baited trees were prepared by attaching three lures (95% ethanol;
65 mg/d at 30 °C; AgBio, Inc.) using nylon cable ties to a metal rod in parallel
with the main stem. Lures were attached to the metal rod rather than to the
actual stems to avoid potential adsorption of ethanol by the stem tissue. Lures
were positioned about 25.4 cm apart at the base, middle, and upper portions of
C. florida and C. canadensis stems.
Ethanol-irrigated trees were prepared by irrigating the soil of each potted C.
florida and C. canadensis tree with an aqueous solution containing 0%, 1%
(i.e., 7.9 mg/mL), 2.5% (i.e., 19.7 mg/mL), or 5% (39.5 mg/mL) ethanol (vol/vol)
(99.5%; Acros Organics). Each pot received an average of 2.8 L of solution
every 2‒3 d throughout the duration of the two experiments. Ethanol-baited,
nonbaited, and ethanol-irrigated C. florida trees were arranged in five ran-
domized complete blocks within a deciduous woodland in Wayne County,
Ohio (40°45′41.54″N; 81°51′15.92″W) and were deployed under field condi-
tions from 24 April 2017 to 19 May 2017. C. canadensis trees were arranged in
six randomized complete blocks within a deciduous woodland in Wayne
County., Ohio (40°47′4.11″N; 81°50′4.82″W) and were deployed from 15 May
2017 to 12 June 2017. Trees within a block were 2 m apart, and adjacent
blocks were 10 m apart. New ambrosia beetle attacks were recorded every 2‒
3 d. Trees were cut on the last day of field deployment and were transferred to
a refrigerator held at 5 °C. Stems were dissected using pruning shears and were
examined under a stereomicroscope. Specimens of X. germanus foundresses
and offspring (i.e., eggs and larvae) within their respective galleries were
collected and preserved in 70% ethanol.
Ethanol and Ambrosia Beetle Offspring Production. A rearing substrate was
prepared to examine the effects of ethanol on offspring production by X.
germanus. A minimal medium substrate was prepared based on refs. 67 and
68 by dry mixing 75 g of C. canadensis sawdust and 20 g of malt extract agar
followed by 325 mL of distilled water. About 20 mL of substrate was dis-
pensed into 50-mL polystyrene tubes. Substrate tubes were autoclaved for
Ranger et al.
30 min at 120 °C and were allowed to cool slightly in a laminar flow hood;
then ethanol (99.5%; Acros Organics) was pipetted into the substrate to
achieve ethanol concentrations of 0%, 0.1%, 0.5%, 1%, 2.5%, or 5% (vol:wt)
per substrate tube. After pipetting, the substrate within each tube was
immediately stirred using a flame-sterilized spatula for 1.5 min. Tubes were
loosely screw-capped and held in a laminar flow hood under UV light for 4 d.
Live adult female X. germanus were collected (26), transferred to Petri dishes
lined with filter paper, and held overnight at 7 °C. Active beetles were selected
after the Petri dishes were held at room temperature for 3‒4 h, and four
beetles were transferred to each substrate tube. Previous studies recommend
surface-sterilizing beetles with ethanol to minimize contamination by second-
ary microbes passively carried on the cuticle (67, 69), but we intentionally
omitted this sterilization procedure to avoid biasing the competition of A.
grosmanniae with microbial contaminants. Substrate tubes were incubated at
25 °C for 22 d, after which specimens within each tube were quantified.
Ethanol and Fungal Growth. Cultures of A. grosmanniae were grown and
maintained on malt extract agar (MEA) [3% malt extract and 0.5% soya
peptone (wt/vol)]. The effects of ethanol on the dry weight, surface area,
and density of A. grosmanniae were determined using an agar plate
method. Ethanol (99.5%; Pharmco-AAPER) was added to the MEA to achieve
concentrations of 1%, 2.5%, or 5% (vol/vol). Sterile distilled water was used
for the control. The solidified agar was overlaid with a sterile cellophane
membrane (Research Products International Corp.), and a mycelial plug
(3 mm in diameter) of A. grosmanniae was transferred to the center of each
plate. Inoculated plates were photographed every 2 d, and the surface area
was measured using ImageJ v. 1.47 software (NIH). At 6 d after inoculation,
ECOLOGY
the mycelial mat was scraped, and the fresh weight was determined. The
mycelia were then allowed to dry at 37 °C until the weight was constant. The
density of the mycelia was calculated by dividing the dry weight by
the surface area. Using the same approach, the effects of ethanol were exam-
ined on A. roeperi, R. canadensis, A. hylecoeti, Penicillium sp., and Asper-
gillus sp. Cultures were grown under the following conditions: A. roeperi for
4 d at 28 °C; R. canadensis for 10 d at 23 °C; A. hylecoeti for 6 d at 23 °C;
Penicillium sp. for 4 d at 28 °C; and Aspergillus sp. for 4 d at 28 °C. Dry weight
was measured as described above.
The effect of ethanol was further assessed using liquid cultures of A.
grosmanniae, A. roeperi, R. canadensis, Penicillium sp., and Aspergillus sp.
grown in the presence of 0%, 5%, or 10% ethanol. The optical density of the
liquid cultures was measured using a microplate reader to quantify growth
rate (Fig. S1). (See SI Methods for specific methods.)
ADH Activity. The enzymatic activity of ADH and the protein concentration
were measured using A. grosmanniae, A. roeperi, R. canadensis, A. hylecoeti,
Penicillium sp., and Aspergillus sp. cultures grown on yeast extract/mannitol/
agar (YEMA) plates flooded with 0% or 2% ethanol. Proteinaceous super-
natant prepared from each fungal culture was analyzed for ADH activity
using a standard kit (catalog no. MAK053; Sigma-Aldrich). Total protein
concentrations were determined using the Bradford assay (Roti-Quant;
Roth). (See SI Methods for specific methods.)
Ethanol Quantification. Ethanol was quantified within flood-stressed C. florida
trees, ethanol-irrigated C. florida trees, and the sawdust-based substrate to
confirm that biologically relevant levels of ethanol were tested as part of our
study (Fig. S2). Solid-phase microextraction-gas chromatography-mass spec-
trometry (SPME-GC-MS) was used to analyze ethanol concentrations in the
various tissues/substrates (26). (See SI Methods for specific methods.)
Statistics. Weighted regression analyses were conducted on fungal growth
parameters (i.e., surface area, dry weight, and density) and offspring pro-
duction (larvae and pupae) as a function of the percent of ethanol incorporated
into the growth medium. A weighted regression analysis was used on mean
parameter values (e.g., dry weight) as a function of the percent of ethanol using
a standard weighting factor of 1/variance. TableCurve 2D v. 5.01 (Systat
Software Inc., 2002) was used for regression equations, and SYSTAT v.11 was
used to obtain graphs. The Pearson correlation coefficient was used to assess
the correlation between ethanol percentage and fungal growth parameters.
One-way ANOVA and Tukey’s honest significant difference (HSD) or Dunnett’s
multiple comparisons test were used as indicated to separate means.
ACKNOWLEDGMENTS. We thank Emma Trapp (Ohio State University), Betsy
Anderson [US Department of Agriculture–Agricultural Research Service
(USDA-ARS)], Pamela Baumann and Hammad Achmed (Max Planck Institute
for Chemical Ecology), Franziska Ruf (Julius Maximilian University Würzburg),
and Nicole Ganske (Technical University of Munich) for technical
PNAS Latest Articles | 5 of 6
assistance; Rabiu Olatinwo (USDA Forest Service) for sharing the A. roeperi
isolate; the anonymous reviewers for useful comments; and Douglas Yu
(University of East Anglia) for explaining the concept of biological screening
and discussions about our findings. This research was supported by the USDA
Floriculture and Nursery Research Initiative, the Horticultural Research
1. Biedermann PH, Rohlfs M (2017) Evolutionary feedbacks between insect sociality and
microbial management. Curr Opin Insect Sci 22:92–100.
2. Foster KR, Schluter J, Coyte KZ, Rakoff-Nahoum S (2017) The evolution of the host
microbiome as an ecosystem on a leash. Nature 548:43–51.
3. Archetti M, et al. (2011) Economic game theory for mutualism and cooperation. Ecol
Lett 14:1300–1312.
4. Scheuring I, Yu DW (2012) How to assemble a beneficial microbiome in three easy
steps. Ecol Lett 15:1300–1307.
5. Mueller UG, Gerardo N (2002) Fungus-farming insects: Multiple origins and diverse
evolutionary histories. Proc Natl Acad Sci USA 99:15247–15249.
6. Mueller UG, Gerardo NM, Aanen DK, Six DL, Schultz TR (2005) The evolution of ag-
riculture in insects. Annu Rev Ecol Syst 36:563–595.
7. Aanen DK, et al. (2002) The evolution of fungus-growing termites and their mutu-
alistic fungal symbionts. Proc Natl Acad Sci USA 99:14887–14892.
8. Jordal BH, Cognato AI (2012) Molecular phylogeny of bark and ambrosia beetles reveals
multiple origins of fungus farming during periods of global warming. BMC Evol Biol 12:133.
9. Hulcr J, Atkinson TH, Cognato AI, Jordal BH, McKenna DD (2015) Morphology, taxon-
omy, and phylogenetics of bark beetles. Bark Beetles: Biology and Ecology of Native
and Invasive Species, eds Vega FE, Hofstetter RW (Academic, New York), pp 41–84.
10. French JR, Roeper RA (1972) Interactions of the ambrosia beetle, Xyleborus dispar
(Coleoptera: Scolytidae), with its symbiotic fungus Ambrosiella hartigii (Fungi: Im-
perfecti). Can Entomol 104:1635–1641.
11. Weber BC, McPherson JE (1983) Life history of the ambrosia beetle Xylosandrus
germanus (Coleoptera: Scolytidae). Ann Entomol Soc Am 76:455–462.
12. Kajimura H, Hijii N (1992) Dynamics of the fungal symbionts in the gallery system and
the mycangia of the ambrosia beetle, Xylosandrus mutilatus (Blandford) (Coleoptera,
Scolytidae). Ecol Res 7:107–117.
13. Norris DM (1975) Chemical interdependencies among Xyleborus spp. ambrosia bee-
tles and their symbiotic microbes. Mater Org 3:479–788.
14. Francke-Grosmann H (1956) Hautdrüsen als träger der pilzsymbiose bei ambrosiakäfern.
Z Morphol Oekol Tiere 45:275–308.
15. Batra LR (1985) Ambrosia beetles and their associated fungi: Research trends and
techniques. Proc Plant Sci 94:137–148.
16. Mayers CG, et al. (2015) Three genera in the Ceratocystidaceae are the respective
symbionts of three independent lineages of ambrosia beetles with large, complex
mycangia. Fungal Biol 119:1075–1092.
17. Wingfield MJ, et al. (2017) Novel associations between ophiostomatoid fungi, insects
and tree hosts: Current status—Future prospects. Biol Invasions 19:3215–3228.
18. Harrington TC, McNew D, Mayers C, Fraedrich SW, Reed SE (2014) Ambrosiella roeperi
sp. nov. is the mycangial symbiont of the granulate ambrosia beetle, Xylosandrus
crassiusculus. Mycologia 106:835–845.
19. Kostovcik M, et al. (2015) The ambrosia symbiosis is specific in some species and
promiscuous in others: Evidence from community pyrosequencing. ISME J 9:126–138.
20. Kirkendall LR, Biedermann PHW, Jordal BH (2015) Evolution and diversity of bark and
ambrosia beetles. Bark Beetles: Biology and Ecology of Native and Invasive Species,
eds Vega FE, Hofstetter RW (Academic, New York), pp 85–156.
21. Haanstad JO, Norris DM (1985) Microbial symbiotes of the ambrosia beetle Xyloter-
inus politus. Microb Ecol 11:267–276.
22. Aylward FO, et al. (2014) Convergent bacterial microbiotas in the fungal agricultural
systems of insects. MBio 5:e02077.
23. Currie CR, Mueller UG, Malloch D (1999) The agricultural pathology of ant fungus
gardens. Proc Natl Acad Sci USA 96:7998–8002.
24. Biedermann PHW, Taborsky M (2011) Larval helpers and age polyethism in ambrosia
beetles. Proc Natl Acad Sci USA 108:17064–17069.
25. De Fine Licht HH, Biedermann PHW (2012) Patterns of functional enzyme activity in
fungus farming ambrosia beetles. Front Zool 9:13.
26. Ranger CM, Schultz PB, Frank SD, Chong JH, Reding ME (2015) Non-native ambrosia
beetles as opportunistic exploiters of living but weakened trees. PLoS One 10:e0131496.
27. Kühnholz S, Borden JH, Uzunovic A (2001) Secondary ambrosia beetles in apparently
healthy trees: Adaptations, potential causes and suggested research. Integr Pest
Manage Rev 6:209–219.
28. Ranger CM, Tobin PC, Reding ME (2015) Ubiquitous volatile compound facilitates
efficient host location by a non-native ambrosia beetle. Biol Invasions 17:675–686.
29. Hulcr J, Dunn RR (2011) The sudden emergence of pathogenicity in insect-fungus
symbioses threatens naive forest ecosystems. Proc Biol Sci 278:2866–2873.
30. La Spina S, De Canniére C, Dekri A, Grégoire J-C (2013) Frost increases beech sus-
ceptibility to scolytine ambrosia beetles. Agric For Entomol 15:157–167.
31. Graham K (1968) Anaerobic induction of primary chemical attractancy for ambrosia
beetles. Can J Zool 46:905–908.
32. Kimmerer TW, Kozlowski TT (1982) Ethylene, ethane, acetaldehyde, and ethanol
production by plants under stress. Plant Physiol 69:840–847.
33. MacDonald RC, Kimmerer TW (1991) Ethanol in the stems of trees. Physiol Plant 82:582–588.
34. Ranger CM, Reding ME, Schultz P, Oliver J (2013) Influence of flood-stress on am-
brosia beetle (Coleoptera: Curculionidae, Scolytinae) host-selection and implications
for their management in a changing climate. Agric For Entomol 15:56–64.
35. Kelsey RG, Beh MM, Shaw DC, Manter DK (2013) Ethanol attracts scolytid beetles to
Phytophthora ramorum cankers on coast live oak. J Chem Ecol 39:494–506.
6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1716852115
Institute, and USDA-ARS Grant NP304 3607-22000-012-00D. P.H.W.B. is
funded by German Research Foundation Emmy Noether Grant BI 1956/1-1
and Marie Curie Intra-European Fellowship Project 626279. Mention of pro-
prietary products or companies does not imply any endorsement or prefer-
ential treatment by the USDA-ARS.
36. McGovern PE, et al. (2004) Fermented beverages of pre- and proto-historic China.
Proc Natl Acad Sci USA 101:17593–17598.
37. Dao T, Dantigny P (2011) Control of food spoilage fungi by ethanol. Food Control 22:360–368.
38. Klimetzek D, Kohler J, Vite JP, Kohnle U (1986) Dosage response to ethanol mediates
host selection by ‘secondary’ bark beetles. Naturwissenschaften 73:270–272.
39. Wood DL (1982) The role of pheromones, kairomones, and allomones in the host
selection and colonization behavior of bark beetles. Annu Rev Entomol 27:411–446.
40. Cardoza YJ, Klepzig KD, Raffa KF (2006) Bacteria in oral secretions of an endophytic
insect inhibit antagonistic fungi. Ecol Entomol 31:636–645.
41. Scott JJ, et al. (2008) Bacterial protection of beetle-fungus mutualism. Science 322:63.
42. Six DL (2013) The bark beetle holobiont: Why microbes matter. J Chem Ecol 39:989–1002.
43. Flórez LV, Biedermann PH, Engl T, Kaltenpoth M (2015) Defensive symbioses of ani-
mals with prokaryotic and eukaryotic microorganisms. Nat Prod Rep 32:904–936.
44. Martin MM (1970) The biochemical basis of the fungus-attine ant symbiosis. Science 169:16–20.
45. Currie CR, Scott JA, Summerbell RC, Malloch D (1999) Fungus-growing ants use an-
tibiotic-producing bacteria to control garden parasites. Nature 398:701–704.
46. Sen R, et al. (2009) Generalized antifungal activity and 454-screening of Pseudono-
cardia and Amycolatopsis bacteria in nests of fungus-growing ants. Proc Natl Acad Sci
USA 106:17805–17810.
47. Biedermann PHW, Klepzig KD, Taborsky M, Six DL (2013) Abundance and dynamics of
filamentous fungi in the complex ambrosia gardens of the primitively eusocial beetle
Xyleborinus saxesenii Ratzeburg (Coleoptera: Curculionidae, Scolytinae). FEMS Microbiol
Ecol 83:711–723.
48. Smith MG, Des Etages SG, Snyder M (2004) Microbial synergy via an ethanol-triggered
pathway. Mol Cell Biol 24:3874–3884.
49. Chen AI, et al. (2014) Candida albicans ethanol stimulates Pseudomonas aeruginosa
WspR-controlled biofilm formation as part of a cyclic relationship involving phena-
zines. PLoS Pathog 10:e1004480.
50. Thomson JM, et al. (2005) Resurrecting ancestral alcohol dehydrogenases from yeast.
Nat Genet 37:630–635.
51. Dashko S, Zhou N, Compagno C, Piškur J (2014) Why, when, and how did yeast evolve
alcoholic fermentation? FEMS Yeast Res 14:826–832.
52. Weinhold AR, Garraway MO (1966) Nitrogen and carbon nutrition of Armillaria mellea
in relation to growth-promoting effects of ethanol. Phytopathology 56:108–112.
53. Kuhns EH, et al. (2014) Volatiles from the symbiotic fungus Raffaelea lauricola are
synergistic with manuka lures for increased capture of the redbay ambrosia beetle
Xyleborus glabratus. Agric For Entomol 16:87–94.
54. Kandasamy D, Gershenzon J, Hammerbacher A (2016) Volatile organic compounds
emitted by fungal associates of conifer bark beetles and their potential in bark beetle
control. J Chem Ecol 42:952–969.
55. Zhou N, et al. (2017) Coevolution with bacteria drives the evolution of aerobic fer-
mentation in Lachancea kluyveri. PLoS One 12:e0173318.
56. Paine TD, Raffa KF, Harrington TC (1997) Interactions among scolytid bark beetles,
their associated fungi, and live host conifers. Annu Rev Entomol 42:179–206.
57. Davis TS (2015) The ecology of yeasts in the bark beetle holobiont: A century of re-
search revisited. Microb Ecol 69:723–732.
58. Ruby EG, McFall-Ngai MJ (1999) Oxygen-utilizing reactions and symbiotic colonization
of the squid light organ by Vibrio fischeri. Trends Microbiol 7:414–420.
59. Biedermann PH, Kaltenpoth M (2014) New synthesis: The chemistry of partner choice
in insect-microbe mutualisms. J Chem Ecol 40:99.
60. McKenzie JA, Parsons PA (1972) Alcohol tolerance: An ecological parameter in the relative
success of Drosophila melanogaster and Drosophila simulans. Oecologia 10:373–388.
61. Becher PG, et al. (2012) Yeast, not fruit volatiles mediate Drosophila melanogaster
attraction, oviposition and development. Funct Ecol 26:822–828.
62. Matsui T, Tanaka J, Namihira T, Shinzato N (2012) Antibiotics production by an ac-
tinomycete isolated from the termite gut. J Basic Microbiol 52:731–735.
63. Nakashima T, Iizawa T, Ogura K, Maeda M, Tanaka T (1982) Isolation of some mi-
croorganisms associated with five species of ambrosia beetles and two kinds of an-
tibiotics produced by Xv-3 strain in these isolates. J Fac Agric Hokkaido Univ 61:60–72.
64. van der Meij A, Worsley SF, Hutchings MI, van Wezel GP (2017) Chemical ecology of
antibiotic production by actinomycetes. FEMS Microbiol Rev 41:392–416.
65. Harrington TC (1981) Cycloheximide sensitivity as a taxonomic character in Cerato-
cystis. Mycologia 73:1123–1129.
66. Human ZR, Slippers B, de Beer ZW, Wingfield MJ, Venter SN (2017) Antifungal acti-
nomycetes associated with the pine bark beetle, Orthotomicus erosus, in South Af-
rica. S Afr J Sci 113:34–40.
67. Castrillo LA, Griggs MH, Vandenberg JD (2012) Brood production by Xylosandrus
germanus (Coleoptera: Curculionidae) and growth of its fungal symbiont on artificial
diet based on sawdust of different tree species. Environ Entomol 41:822–827.
68. Peer K, Taborsky M (2004) Female ambrosia beetles adjust their offspring sex ratio
according to outbreeding opportunities for their sons. J Evol Biol 17:257–264.
69. Biedermann PH, Klepzig KD, Taborsky M (2009) Fungus cultivation by ambrosia
beetles: Behavior and laboratory breeding success in three xyleborine species. Environ
Entomol 38:1096–1105.
70. Corseuil HX, Moreno FN (2001) Phytoremediation potential of willow trees for
aquifers contaminated with ethanol-blended gasoline. Water Res 35:3013–3017.
Ranger et al.
References

Aanen, D. K. and Boomsma, J. J. (2006). Social-insect fungus farming. Curr. Biol.,

16(24):R1014–6.

Aanen, D. K. and Eggleton, P. (2005). Fungus-growing termites originated in African

rain forest. Curr. Biol., 15(9):851–855.

Aanen, D. K., Eggleton, P., Rouland-Lefevre, C., Guldberg-Froslev, T., Rosendahl,

S., and Boomsma, J. J. (2002). The evolution of fungus-growing termites and their
mutualistic fungal symbionts. Proc. Natl. Acad. Sci. U. S. A., 99(23):14887–14892.

Akman, L., Yamashita, A., Watanabe, H., Oshima, K., Shiba, T., Hattori, M., and
Aksoy, S. (2002). Genome sequence of the endocellular obligate symbiont of tsetse
flies, Wigglesworthia glossinidia. Nat. Genet., 32(3):402–407.

Alfaro, R. I., Humble, L. M., Gonzalez, P., Villaverde, R., and Allegro, G. (2007). The
threat of the ambrosia beetle Megaplatypus mutatus (Chapuis) (=Platypus mutatus
Chapuis) to world poplar resources. Forestry, 80(4):471–479.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic
local alignment search tool. J. Mol. Biol., 215(3):403–410.

Asemaninejad, A., Weerasuriya, N., Gloor, G. B., Lindo, Z., and Thorn, R. G. (2016).
New primers for discovering fungal diversity using nuclear large ribosomal DNA.
PLoS One, 11(7):e0159043.

Ashbolt, N. J. and Inkerman, P. A. (1990). Acetic acid bacterial biota of the pink
sugar cane mealybug, Saccharococcus sacchari, and its environs. Appl. Environ.
Microbiol., 56(3):707–712.

Aylward, F. O., Suen, G., Biedermann, P. H. W., Adams, A. S., Scott, J. J., Malfatti,
S. A., Glavina del Rio, T., Tringe, S. G., Poulsen, M., Raffa, K. F., Klepzig,

110
 K. D., and Currie, C. R. (2014). Convergent bacterial microbiotas in the fungal
agricultural systems of insects. MBio, 5(6).

Baker, J. M. and Kreger-van Rij, N. J. W. (1964). Endomycopsis platypodis sp.n. (as-

comycetes): an auxiliary ambrosia fungus of Platypus cylindrus Fab. (Col. Platy-
podidae). Antonie Van Leeuwenhoek, 30(1):433–441.

Bärlocher, F. (1985). The role of fungi in the nutrition of stream invertebrates. Bot.
J. Linn. Soc., 91(1-2):83–94.

Bateman, C., Huang, Y.-T., Simmons, D. R., Kasson, M. T., Stanley, E. L., and
Hulcr, J. (2017). Ambrosia beetle Premnobius cavipennis (Scolytinae: Ipini) carries
highly divergent ascomycotan ambrosia fungus, Afroraffaelea ambrosiae gen. nov.
et sp. nov. (Ophiostomatales). Fungal Ecol., 25:41–49.

Bateman, C., Kendra, P. E., Rabaglia, R., and Hulcr, J. (2015). Fungal symbionts
in three exotic ambrosia beetles, xylosandrus amputatus, Xyleborinus andrewesi,
and Dryoxylon onoharaense (Coleoptera: Curculionidae: Scolytinae: Xyleborini)
in Florida. Symbiosis, 66(3):141–148.

Batra, L. R. (1963). Contributions to our knowledge of ambrosia fungi. II. Endomy-

copsis fasciculata nom. nov. (ascomycetes). Am. J. Bot., 50(5):481–487.

Batra, L. R. (1966). Ambrosia fungi: extent of specificity to ambrosia beetles. Science,

153(3732):193–195.

Batra, L. R. (1967). Ambrosia fungi: A taxonomic revision, and nutritional studies

of some species. Mycologia, 59(6):976–1017.

Batra, L. R. (1985). Ambrosia beetles and their associated fungi: research trends and
techniques. Proceedings: Plant Sciences, 94(2):137–148.

Beaver, R. A. and Liu, L. Y. (2013). A synopsis of the pin-hole borers of Thailand

(Coleoptera: Curculionidae: Platypodinae). Zootaxa, 3646:447–486.

Beaver, R. A., Wilding, N., Collins, N., Hammond, P., and Webber, J. (1989). Insect-
fungus relationships in the bark and ambrosia beetles. In Insect-fungus interactions.
Edited by Wilding N, Collins NM, Hammond PM, Webber JF. London, Academic
Press. pp. 121–143.

111
Belhoucine, L., Bouhraoua, R. T., Meijer, M., Houbraken, J., Harrak, M. J., Samson,
R. A., Pujade-Villar, J., and Others (2011). Mycobiota associated with Platypus
cylindrus (Coleoptera: Curculionidae, Platypodidae) in cork oak stands of north
west Algeria, Africa. Afr. J. Microbiol. Res., 5(25):4411–4423.

Bellahirech, A., Inácio, M. L., Nóbrega, F., Henriques, J., Bonifácio, L., Sousa, E.,
and Ben Jamâa, M. L. (2016). Can behavioural differences in Platypus cylindrus
(Coleoptera: Platypodinae) from Portugal and Tunisia be explained by genetic and
morphological traits? Bull. Entomol. Res., 106(1):1–8.

Bensch, K., Braun, U., Groenewald, J. Z., and Crous, P. W. (2012). The genus
Cladosporium. Stud. Mycol., 72(1):1–401.

Biedermann, P. H. W., Klepzig, K. D., and Taborsky, M. (2009). Fungus cultivation

by ambrosia beetles: behavior and laboratory breeding success in three xyleborine
species. Environ. Entomol., 38(4):1096–1105.

Biedermann, P. H. W., Klepzig, K. D., Taborsky, M., and Six, D. L. (2013). Abun-
dance and dynamics of filamentous fungi in the complex ambrosia gardens of
the primitively eusocial beetle Xyleborinus saxesenii Ratzeburg (Coleoptera: Cur-
culionidae, Scolytinae). FEMS Microbiol. Ecol., 83(3):711–723.

Biedermann, P. H. W. and Taborsky, M. (2011). Larval helpers and age polyethism

in ambrosia beetles. Proc. Natl. Acad. Sci. U. S. A., 108(41):17064–17069.

Biere, A. and Bennett, A. E. (2013). Threeway interactions between plants, microbes

and insects. Functional Ecology, 27(3):567–573.

Blackwell, M. (1994). Minute mycological mysteries: the influence of arthropods on

the lives of fungi. Mycologia, 86(1):1–17.

Blackwell, M. (2011). The fungi: 1, 2, 3 5.1 million species? Am. J. Bot., 98(3):426–
438.

Bokulich, N. A., Kaehler, B. D., Rideout, J. R., Dillon, M., Bolyen, E., Knight,
R., Huttley, G. A., and Gregory Caporaso, J. (2018). Optimizing taxonomic clas-
sification of marker gene amplicon sequences. Technical Report e3208v2, PeerJ
Preprints.

Borcard, D., Legendre, P., Avois-Jacquet, C., and Tuomisto, H. (2004). Dissecting
the spatial structure of ecological data at multiple scales. Ecology, 85(7):1826–1832.

112
Branton, D., Deamer, D. W., Marziali, A., Bayley, H., Benner, S. A., Butler, T.,
Di Ventra, M., Garaj, S., Hibbs, A., Huang, X., Jovanovich, S. B., Krstic, P. S.,
Lindsay, S., Ling, X. S., Mastrangelo, C. H., Meller, A., Oliver, J. S., Pershin,
Y. V., Ramsey, J. M., Riehn, R., Soni, G. V., Tabard-Cossa, V., Wanunu, M.,
Wiggin, M., and Schloss, J. A. (2008). The potential and challenges of nanopore
sequencing. Nat. Biotechnol., 26(10):1146–1153.

Brinkmann, N., Martens, R., and Tebbe, C. C. (2008). Origin and diversity of
metabolically active gut bacteria from laboratory-bred larvae of Manduca sexta
(Sphingidae, Lepidoptera, Insecta). Appl. Environ. Microbiol., 74(23):7189–7196.

Buchner, P. (1965). Endosymbiosis of Animals with Plant Microorganisms. New York,

Interscience Publishers. Wiley.

Callahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J. A., and
Holmes, S. P. (2016). DADA2: High-resolution sample inference from Illumina
amplicon data. Nat. Methods, 13(7):581–583.

Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D.,
Costello, E. K., Fierer, N., Peña, A. G., Goodrich, J. K., Gordon, J. I., Hutt-
ley, G. A., Kelley, S. T., Knights, D., Koenig, J. E., Ley, R. E., Lozupone, C. A.,
McDonald, D., Muegge, B. D., Pirrung, M., Reeder, J., Sevinsky, J. R., Turnbaugh,
P. J., Walters, W. A., Widmann, J., Yatsunenko, T., Zaneveld, J., and Knight, R.
(2010). QIIME allows analysis of high-throughput community sequencing data.
Nat. Methods, 7(5):335–336.

Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer,
N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J. A.,
Smith, G., and Knight, R. (2012). Ultra-high-throughput microbial community
analysis on the Illumina HiSeq and MiSeq platforms. ISME J., 6(8):1621–1624.

Cardoza, Y. J., Klepzig, K. D., and Raffa, K. F. (2006). Bacteria in oral secretions
of an endophytic insect inhibit antagonistic fungi. Ecol. Entomol., 31(6):636–645.

Cassier, P., Lévieux, J., Morelet, M., and Rougon, D. (1996). The mycangia of Platy-
pus cylindrus Fab. and P. oxyurus Dufour (Coleoptera: Platypodidae). structure
and associated fungi. J. Insect Physiol., 42(2):171–179.

113
Castrillo, L. A., Griggs, M. H., Ranger, C. M., Reding, M. E., and Vandenberg,
J. D. (2011). Virulence of commercial strains of Beauveria bassiana and Metarhiz-
ium brunneum (Ascomycota: Hypocreales) against adult Xylosandrus germanus
(Coleoptera: Curculionidae) and impact on brood. Biol. Control, 58(2):121–126.

Ceriani-Nakamurakare, E., Slodowicz, M., Gonzalez-Audino, P., Dolinko, A., and

Carmarán, C. (2016). Mycobiota associated with the ambrosia beetle Megaplatypus
mutatus : threat to poplar plantations. Forestry, 89(2):191–200.

Chapela, I. H., Rehner, S. A., Schultz, T. R., and Mueller, U. G. (1994). Evolutionary
history of the symbiosis between fungus-growing ants and their fungi. Science,
266(5191):1691–1694.

Cox, C. R. and Gilmore, M. S. (2007). Native microbial colonization of Drosophila

melanogaster and its use as a model of Enterococcus faecalis pathogenesis. Infect.
Immun., 75(4):1565–1576.

Crisp, M. D., Burrows, G. E., Cook, L. G., Thornhill, A. H., and Bowman, D. M. J. S.
(2011). Flammable biomes dominated by eucalypts originated at the Cretaceous-
Palaeogene boundary. Nat. Commun., 2:193.

Crotti, E., Rizzi, A., Chouaia, B., Ricci, I., Favia, G., Alma, A., Sacchi, L., Bourtzis,
K., Mandrioli, M., Cherif, A., Bandi, C., and Daffonchio, D. (2010). Acetic acid bac-
teria, newly emerging symbionts of insects. Appl. Environ. Microbiol., 76(21):6963–
6970.

Currie, C. R. (2001). A community of ants, fungi, and bacteria: a multilateral

approach to studying symbiosis. Annu. Rev. Microbiol., 55:357–380.

Currie, C. R., Mueller, U. G., and Malloch, D. (1999a). The agricultural pathology
of ant fungus gardens. Proc. Natl. Acad. Sci. U. S. A., 96(14):7998–8002.

Currie, C. R., Scott, J. A., Summerbell, R. C., and Malloch, D. (1999b). Fungus-
growing ants use antibiotic-producing bacteria to control garden parasites. Nature,
398(6729):701–704.

Currie, C. R., Wong, B., Stuart, A. E., Schultz, T. R., Rehner, S. A., Mueller,
U. G., Sung, G.-H., Spatafora, J. W., and Straus, N. A. (2003). Ancient tripartite
coevolution in the attine ant-microbe symbiosis. Science, 299(5605):386–388.

114
Damiani, C., Ricci, I., Crotti, E., Rossi, P., Rizzi, A., Scuppa, P., Esposito, F.,
Bandi, C., Daffonchio, D., and Favia, G. (2008). Paternal transmission of symbiotic
bacteria in malaria vectors. Curr. Biol., 18(23):R1087–8.

Davis, T. S. (2015). The ecology of yeasts in the bark beetle holobiont: a century of
research revisited. Microb. Ecol., 69(4):723–732.

de Beer, Z. W., Duong, T. A., Barnes, I., Wingfield, B. D., and Wingfield, M. J.
(2014). Redefining Ceratocystis and allied genera. Stud. Mycol., 79:187–219.

de Beer, Z. W. and Wingfield, M. J. (2013). Emerging lineages in the Ophiostom-

atales. Ophiostomatoid fungi: expanding frontiers. Utrecht, CBS-KNAW Fungal
Biodiversity Centre. CBS Biodiversity Series, 12:21–46.

de Goffau, M. C., Lager, S., Salter, S. J., Wagner, J., Kronbichler, A., Charnock-
Jones, D. S., Peacock, S. J., Smith, G. C. S., and Parkhill, J. (2018). Recognizing
the reagent microbiome. Nat Microbiol, 3(8):851–853.

Desdevises, Y., Legendre, P., Azouzi, L., and Morand, S. (2003). Quantifying phylo-
genetically structured environmental variation. Evolution, 57(11):2647–2652.

Diamond, J. M. and Ordunio, D. (1999). Guns, germs, and steel. New York W. W.
Norton and Company.

DiGuistini, S., Wang, Y., Liao, N. Y., Taylor, G., Tanguay, P., Feau, N., Henrissat,
B., Chan, S. K., Hesse-Orce, U., Alamouti, S. M., Tsui, C. K. M., Docking, R. T.,
Levasseur, A., Haridas, S., Robertson, G., Birol, I., Holt, R. A., Marra, M. A.,
Hamelin, R. C., Hirst, M., Jones, S. J. M., Bohlmann, J., and Breuil, C. (2011).
Genome and transcriptome analyses of the mountain pine beetle-fungal symbiont
Grosmannia clavigera, a lodgepole pine pathogen. Proc. Natl. Acad. Sci. U. S. A.,
108(6):2504–2509.

Donaldson, G. C., Ball, L. A., Axelrood, P. E., and Glass, N. L. (1995). Primer sets
developed to amplify conserved genes from filamentous ascomycetes are useful in
differentiating fusarium species associated with conifers. Appl. Environ. Microbiol.,
61(4):1331–1340.

Dowd, P. F. (1992). Insect fungal symbionts: A promising source of detoxifying

enzymes. J. Ind. Microbiol., 9(3):149–161.

115
Dreaden, T. J., Davis, J. M., de Beer, Z. W., Ploetz, R. C., Soltis, P. S., Wingfield,
M. J., and Smith, J. A. (2014). Phylogeny of ambrosia beetle symbionts in the
genus Raffaelea. Fungal Biol., 118(12):970–978.

Dryden, S. C. and Kaplan, S. (1990). Localization and structural analysis of the ribo-
somal RNA operons of Rhodobacter sphaeroides. Nucleic Acids Res., 18(24):7267–
7277.

Du Toit, W. J. and Pretorius, I. S. (2002). The occurrence, control and esoteric effect
of acetic acid bacteria in winemaking. Ann. Microbiol., 52(2):155–179.

Dusa, A. (2018). venn: Draw venn diagrams.

Ebert, D. (2013). The epidemiology and evolution of symbionts with mixed-mode

transmission. Annu. Rev. Ecol. Evol. Syst., 44(1):623–643.

Eloe-Fadrosh, E. A., Ivanova, N. N., Woyke, T., and Kyrpides, N. C. (2016). Metage-
nomics uncovers gaps in amplicon-based detection of microbial diversity. Nat Mi-
crobiol, 1:15032.

Endoh, R., Suzuki, M., Okada, G., Takeuchi, Y., and Futai, K. (2011). Fungus sym-
bionts colonizing the galleries of the ambrosia beetle Platypus quercivorus. Microb.
Ecol., 62(1):106–120.

Farrell, B. D., Sequeira, A. S., O’Meara, B. C., Normark, B. B., Chung, J. H.,
and Jordal, B. H. (2001). The evolution of agriculture in beetles (Curculionidae:
Scolytinae and Platypodinae). Evolution, 55(10):2011–2027.

Farris, S. H. and Funk, A. (1965). Repositories of symbiotic fungus in the am-

brosia beetle Platypus wilsoni Swaine (Coleoptera: Platypodidae). Can. Entomol.,
97(5):527–532.

Favia, G., Ricci, I., Damiani, C., Raddadi, N., Crotti, E., Marzorati, M., Rizzi, A.,
Urso, R., Brusetti, L., Borin, S., Mora, D., Scuppa, P., Pasqualini, L., Clementi, E.,
Genchi, M., Corona, S., Negri, I., Grandi, G., Alma, A., Kramer, L., Esposito, F.,
Bandi, C., Sacchi, L., and Daffonchio, D. (2007). Bacteria of the genus Asaia stably
associate with Anopheles stephensi, an Asian malarial mosquito vector. Proc. Natl.
Acad. Sci. U. S. A., 104(21):9047–9051.

Feibelman, T., Bayman, P., and Cibula, W. G. (1994). Length variation in the internal
transcribed spacer of ribosomal DNA in chanterelles. Mycol. Res., 98(6):614–618.

116
Feldhaar, H. (2011). Bacterial symbionts as mediators of ecologically important traits
of insect hosts. Ecol. Entomol., 36(5):533–543.

Fichot, E. B. and Norman, R. S. (2013). Microbial phylogenetic profiling with the

Pacific Biosciences sequencing platform. Microbiome, 1(1):10.

Foster, K. R., Schluter, J., Coyte, K. Z., and Rakoff-Nahoum, S. (2017). The evolution
of the host microbiome as an ecosystem on a leash. Nature, 548(7665):43–51.

Fraedrich, S. W., Harrington, T. C., Rabaglia, R. J., Ulyshen, M. D., Mayfield, 3rd,
A. E., Hanula, J. L., Eickwort, J. M., and Miller, D. R. (2008). A fungal symbiont
of the redbay ambrosia beetle causes a lethal wilt in redbay and other Lauraceae
in the Southeastern United States. Plant Dis., 92(2):215–224.

Frago, E., Dicke, M., and Godfray, H. C. J. (2012). Insect symbionts as hidden players
in insect-plant interactions. Trends Ecol. Evol., 27(12):705–711.

Francke-Grosmann, H. (1956). Hautdrüsen als Träger der Pilzsymbiose bei Am-

brosiakäfern. Zeitschrift für Morphologie und Ökologie der Tiere, 45(3):275–308.

Francke-Grosmann, H. (1963). Some new aspects in forest entomology. Annu. Rev.

Entomol., 8(1):415–438.

Francke-Grosmann, H. (1967). CHAPTER 3 - Ectosymbiosis in Wood-Inhabiting

insects. In Henry, S. M., editor, Symbiosis, pages 141–205. Academic Press.

Funes, H., Griffo, R., Zerba, E., and Gonzalez-Audino, P. (2011). Mating disruption
of the ambrosia beetle Megaplatypus mutatus in poplar and hazelnut plantations
using reservoir systems for pheromones. Entomol. Exp. Appl., 139(3):226–234.

Galtier, N., Gouy, M., and Gautier, C. (1996). SEAVIEW and PHYLO WIN: two
graphic tools for sequence alignment and molecular phylogeny. Comput. Appl.
Biosci., 12(6):543–548.

Gibson, C. M. and Hunter, M. S. (2010). Extraordinarily widespread and fantastically

complex: comparative biology of endosymbiotic bacterial and fungal mutualists of
insects. Ecol. Lett., 13(2):223–234.

Giovannoni, S. J., Britschgi, T. B., Moyer, C. L., and Field, K. G. (1990). Genetic
diversity in Sargasso Sea bacterioplankton. Nature, 345(6270):60–63.

117
Glenner, H., Thomsen, P. F., Hebsgaard, M. B., Sørensen, M. V., and Willerslev, E.
(2006). The origin of insects. Science, 314(5807):1883–1884.

Goodwin, S., Gurtowski, J., Ethe-Sayers, S., Deshpande, P., Schatz, M. C., and
McCombie, W. R. (2015). Oxford nanopore sequencing, hybrid error correction,
and de novo assembly of a eukaryotic genome. Genome Res., 25(11):1750–1756.

Gostinčar, C., Lenassi, M., Gunde-Cimerman, N., and Plemenitaš, A. (2011). Chap-
ter 3 - fungal adaptation to extremely high salt concentrations. In Laskin, A. I.,
Sariaslani, S., and Gadd, G. M., editors, Advances in Applied Microbiology, vol-
ume 77, pages 71–96. Academic Press.

Gouy, M., Guindon, S., and Gascuel, O. (2010). SeaView version 4: A multiplatform
graphical user interface for sequence alignment and phylogenetic tree building. Mol.
Biol. Evol., 27(2):221–224.

Graham, K. (1967). Fungal-Insect mutualism in trees and timber. Annu. Rev. Ento-
mol., 12(1):105–126.

Grubbs, K. J., Surup, F., Biedermann, P. H. W., McDonald, B. R., and others (2019).
Cycloheximide-Producing Streptomyces associated with Xyleborinus saxesenii and
Xyleborus affinis Fungus-Farming ambrosia beetles. bioRxiv.

Guerrero, R. T. (1966). Una nueva especie de hongo inperfecto asociado con el

coleoptero Platypus sulcatus Chapius. Rev Investig Agropecu Ser 5 Patol Veg.

Harrington, T. C. (1981). Cycloheximide sensitivity as a taxonomic character in

Ceratocystis. Mycologia, 73(6):1123.

Harrington, T. C., Fraedrich, S., and Aghayeva, D. N. (2008). Raffaelea lauricola,

a new ambrosia beetle symbiont and pathogen on the Lauracea. Mycotaxon 104:
399-404, 104:399–404.

Harrington, T. C., McNew, D., Mayers, C., Fraedrich, S. W., and Reed, S. E. (2014).
Ambrosiella roeperi sp. nov. is the mycangial symbiont of the granulate ambrosia
beetle, Xylosandrus crassiusculus. Mycologia, 106(4):835–845.

Harrington, T. C., Yun, H. Y., Lu, S.-S., Goto, H., Aghayeva, D. N., and Fraedrich,
S. W. (2011). Isolations from the redbay ambrosia beetle, Xyleborus glabratus,
confirm that the laurel wilt pathogen, Raffaelea lauricola, originated in Asia. My-
cologia, 103(5):1028–1036.

118
Henriques, J., Inácio, M. d. L., and Sousa, E. (2009). Fungos associados ao in-
secto Platypus cylindrus Fab.(Coleoptera: Platypodidae) em sobreiro. Revista de
Ciências Agrárias, 32(2):56–66.

Hosokawa, T., Koga, R., Kikuchi, Y., Meng, X.-Y., and Fukatsu, T. (2010). Wolbachia
as a bacteriocyte-associated nutritional mutualist. Proc. Natl. Acad. Sci. U. S. A.,
107(2):769–774.

Huerta-Cepas, J., Dopazo, J., and Gabaldón, T. (2010). ETE: a python environment
for tree exploration. BMC Bioinformatics, 11:24.

Huerta-Cepas, J., Serra, F., and Bork, P. (2016). ETE 3: Reconstruction, analysis,
and visualization of phylogenomic data. Mol. Biol. Evol., 33(6):1635–1638.

Hulcr, J. and Cognato, A. I. (2010). Repeated evolution of crop theft in fungus-

farming ambrosia beetles. Evolution, 64(11):3205–3212.

Hulcr, J. and Dunn, R. R. (2011). The sudden emergence of pathogenicity in insect–

fungus symbioses threatens naive forest ecosystems. Proceedings of the Royal Soci-
ety of London B: Biological Sciences, 278(1720):2866–2873.

Hulcr, J., Kolarik, M., and Kirkendall, L. R. (2007a). A new record of fungus-
beetle symbiosis in Scolytodes bark beetles (Scolytinae, Curculionidae, Coleoptera).
Symbiosis, 43:151–159.

Hulcr, J., Mogia, M., Isua, B., and Novotny, V. (2007b). Host specificity of ambrosia
and bark beetles (Col., Curculionidae: Scolytinae and Platypodinae) in a New
Guinea rainforest. Ecol. Entomol., 32(6):762–772.

Hulcr, J. and Stelinski, L. L. (2017). The ambrosia symbiosis: From evolutionary

ecology to practical management. Annu. Rev. Entomol., 62:285–303.

Ihrmark, K., Bödeker, I. T. M., Cruz-Martinez, K., Friberg, H., Kubartova, A.,
Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., Clemmensen, K. E.,
and Lindahl, B. D. (2012). New primers to amplify the fungal ITS2 region – eval-
uation by 454-sequencing of artificial and natural communities. FEMS Microbiol.
Ecol., 82(3):666–677.

Inácio, M. L., Henriques, J., Lima, A., and Sousa, E. (2008). Fungi of Raffaelea genus
(Ascomycota: Ophiostomatales) associated to Platypus cylindrus (Coleoptera:
Platypodidae) in Portugal. Revista de Ciências Agrárias, 31(2):96–104.

119
Inácio, M. L., Henriques, J., Lima, A., and Sousa, E. (2012). Ophiostomatoid fungi
associated with cork oak mortality in Portugal. IOBC/WPRS Bull., 76:89–92.

Inácio, M. L., Henriques, J., Sousa, E., and Others (2010). Mycobiota associated
with Platypus cylindrus Fab.(Coleoptera: Platypodidae) on cork oak in Portugal.
IOBC/WPRS Bull., 57:87–95.

Ishikawa, H. (2003). Insect symbiosis: an introduction. In: Insect Symbiosis, edited

by Bourtzis K. and Miller T. A., Boca Raton, CRC Press. Vol 1, pages 1-21.

Ito, S., Kubono, T., Sahashi, N., Yamada, T., and Others (1998). Fungi associated
with the mass mortality of oak trees. Journal of the Japanese Forestry Society,
80(3):170–175.

Johnson, A. J., McKenna, D. D., Jordal, B. H., Cognato, A. I., Smith, S. M., Lemmon,
A. R., Lemmon, E. M., and Hulcr, J. (2018). Phylogenomics clarifies repeated evo-
lutionary origins of inbreeding and fungus farming in bark beetles (Curculionidae,
Scolytinae). Mol. Phylogenet. Evol., 127:229–238.

Jordal, B. H. (2015). Molecular phylogeny and biogeography of the weevil subfamily

Platypodinae reveals evolutionarily conserved range patterns. Mol. Phylogenet.
Evol., 92:294–307.

Jordal, B. H. and Cognato, A. I. (2012). Molecular phylogeny of bark and ambrosia

beetles reveals multiple origins of fungus farming during periods of global warming.
BMC Evol. Biol., 12:133.

Jordal, B. H., Sequeira, A. S., and Cognato, A. I. (2011). The age and phylogeny
of wood boring weevils and the origin of subsociality. Mol. Phylogenet. Evol.,
59(3):708–724.

Jordal, B. H., Smith, S. M., and Cognato, A. I. (2014). Classification of weevils as a

data-driven science: leaving opinion behind. Zookeys, (439):1–18.

Joyeux, A., Lafon-Lafourcade, S., and Ribéreau-Gayon, P. (1984). Evolution of acetic

acid bacteria during fermentation and storage of wine. Appl. Environ. Microbiol.,
48(1):153–156.

Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A., and Jermiin,
L. S. (2017). ModelFinder: fast model selection for accurate phylogenetic estimates.
Nat. Methods, 14(6):587–589.

120
Kamata, N., Esaki, K., Kato, K., Igeta, Y., and Wada, K. (2002). Potential impact
of global warming on deciduous oak dieback caused by ambrosia fungus Raffaelea
sp. carried by ambrosia beetle Platypus quercivorus (Coleoptera: Platypodidae) in
Japan. Bull. Entomol. Res., 92(2):119–126.

Karst, S. M., Dueholm, M. S., McIlroy, S. J., Kirkegaard, R. H., Nielsen, P. H., and
Albertsen, M. (2018). Retrieval of a million high-quality, full-length microbial 16S
and 18S rRNA gene sequences without primer bias. Nat. Biotechnol., 36(2):190–
195.

Kasson, M. T., O’Donnell, K., Rooney, A. P., Sink, S., Ploetz, R. C., Ploetz, J. N.,
Konkol, J. L., Carrillo, D., Freeman, S., Mendel, Z., Smith, J. A., Black, A. W.,
Hulcr, J., Bateman, C., Stefkova, K., Campbell, P. R., Geering, A. D. W., Dann,
E. K., Eskalen, A., Mohotti, K., Short, D. P. G., Aoki, T., Fenstermacher, K. A.,
Davis, D. D., and Geiser, D. M. (2013). An inordinate fondness for Fusarium: phy-
logenetic diversity of fusaria cultivated by ambrosia beetles in the genus Euwallacea
on avocado and other plant hosts. Fungal Genet. Biol., 56:147–157.

Kasson, M. T., Wickert, K. L., Stauder, C. M., Macias, A. M., Berger, M. C., Sim-
mons, D. R., Short, D. P. G., DeVallance, D. B., and Hulcr, J. (2016). Mutualism
with aggressive wood-degrading Flavodon ambrosius (Polyporales) facilitates niche
expansion and communal social structure in Ambrosiophilus ambrosia beetles. Fun-
gal Ecol., 23:86–96.

Katoh, K., Rozewicki, J., and Yamada, K. D. (2017). MAFFT online service: multi-
ple sequence alignment, interactive sequence choice and visualization. Brief. Bioin-
form.

Kendra, P. E., Montgomery, W. S., Niogret, J., and Epsky, N. D. (2013). An uncertain
future for American Lauraceae: a lethal threat from redbay ambrosia beetle and
laurel wilt disease (a review). Am. J. Plant Sci., 4(03):727.

Kent, D. S. (2001). Biology of the ambrosia beetle Austroplatypus incompertus. PhD

thesis, The University of Sydney.

Kent, D. S. (2008a). Distribution and host plant records of Austroplatypus incomper-

tus(Scheld)(Coleoptera: Curculionidae: Platypodinae). Australian Entomologist,
The, 35(1):1.

121
Kent, D. S. (2008b). Mycangia of the ambrosia beetle, Austroplatypus incompertus
(Schedl) (Coleoptera: Curculionidae: Platypodinae). Aust. J. Entomol., 47(1):9–
12.

Kent, D. S. (2010). The external morphology of Austroplatypus incompertus (Schedl)

(Coleoptera, Curculionidae, Platypodinae). Zookeys, (56):121–140.

Kent, D. S. and Simpson, J. A. (1992). Eusociality in the beetle Austroplatypus

incompertus (Coleoptera: Curculionidae). Naturwissenschaften, 79(2):86–87.

Kiers, T. E. and West, S. A. (2015). Evolving new organisms via symbiosis. Science,
348(6233):392–394.

Kikuchi, Y., Hosokawa, T., and Fukatsu, T. (2007). Insect-microbe mutualism with-
out vertical transmission: a stinkbug acquires a beneficial gut symbiont from the
environment every generation. Appl. Environ. Microbiol., 73(13):4308–4316.

Kile, G. A. and Hall, M. F. (1988). Assessment of Platypus subgranosus as a vector of

Chalara australis, causal agent of a vascular disease of Nothofagus cunninghamii.
N. Z. J. For. Sci.

Kim, K.-H., Choi, Y.-J., Seo, S.-T., and Shin, H.-D. (2009). Raffaelea quercus-
mongolicae sp. nov. associated with Platypus koryoensis on oak in Korea. Myco-
taxon, 110(1):189–197.

Kinuura, H. (2002). Relative dominance of the mold fungus, Raffaelea sp., in the
mycangium and proventriculus in relation to adult stages of the oak platypodid
beetle, Platypus quercivorus (Coleoptera; Platypodidae). J. Forest Res., 7(1):7–12.

Kirkendall, L. R. (2017). Beetles (Coleoptera) of Peru: A survey of the families.

curculionidae: Platypodinae. Coleopt. Bull., 71(1):99–115.

Kirkendall, L. R., Biedermann, P. H. W., and Jordal, B. H. (2015). Chapter 3 -

evolution and diversity of bark and ambrosia beetles. In Vega, F. E. and Hofstetter,
R. W., editors, Bark Beetles, pages 85–156. Academic Press, San Diego.

Kirkendall, L. R. and Faccoli, M. (2010). Bark beetles and pinhole borers (Curculion-
idae, Scolytinae, Platypodinae) alien to Europe. Zookeys, (56):227–251.

122
Kirkendall, L. R., Kent, D. S., and Raffa, K. F. (1997). Interactions among males,
females and offspring in bark and ambrosia beetles: the significance of living in
tunnels for the evolution of social behavior. The evolution of social behavior in
insects and arachnids, pages 181–215.

Klappenbach, J. A., Saxman, P. R., Cole, J. R., and Schmidt, T. M. (2001). rrndb:
the ribosomal RNA operon copy number database. Nucleic Acids Res., 29(1):181–
184.

Klepzig, K. D. and Six, D. L. (2004). Bark beetle-fungal symbiosis: context depen-

dency in complex associations. Symbiosis, 37:189–205.

Kõljalg, U., Larsson, K.-H., Abarenkov, K., Nilsson, R. H., Alexander, I. J., Eber-
hardt, U., Erland, S., Høiland, K., Kjøller, R., Larsson, E., and Others (2005).
UNITE: a database providing web-based methods for the molecular identification
of ectomycorrhizal fungi. New Phytol., 166(3):1063–1068.

Korb, J. and Aanen, D. K. (2003). The evolution of uniparental transmission of fungal

symbionts in fungus-growing termites (Macrotermitinae). Behav. Ecol. Sociobiol.,
53(2):65–71.

Kostovcik, M., Bateman, C. C., Kolarik, M., Stelinski, L. L., Jordal, B. H., and Hulcr,
J. (2015). The ambrosia symbiosis is specific in some species and promiscuous in
others: evidence from community pyrosequencing. ISME J., 9(1):126–138.

Kozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K., and Schloss, P. D.
(2013). Development of a dual-index sequencing strategy and curation pipeline
for analyzing amplicon sequence data on the MiSeq illumina sequencing platform.
Appl. Environ. Microbiol., 79(17):5112–5120.

Kubono, T. and Ito, S.-I. (2002). Raffaelea quercivora sp. nov. associated with mass
mortality of Japanese oak, and the ambrosia beetle Platypus quercivorus. Myco-
science, 43(3):255–260.

Kusumoto, D., Masuya, H., Hirao, T., Goto, H., Hamaguchi, K., Chou, W.-I., Suasa-
Ard, W., Buranapanichpan, S., Uraichuen, S., Kern-Asa, O., Sanguansub, S., Pan-
mongkol, A., Pham, Q. T., Kahono, S., Sudiana, I. M., and Kamata, N. (2015).
Comparison of sapwood discoloration in Fagaceae trees after inoculation with iso-
lates of Raffaelea quercivora, cause of mass mortality of Japanese oak trees. Plant
Dis., 99(2):225–230.

123
Lauber, C. L., Hamady, M., Knight, R., and Fierer, N. (2009). Pyrosequencing-ased
assessment of soil pH as a predictor of soil bacterial community structure at the
continental scale. Appl. Environ. Microbiol., 75(15):5111–5120.

Li, H., Sosa-Calvo, J., Horn, H. A., Pupo, M. T., Clardy, J., Rabeling, C., Schultz,
T. R., and Currie, C. R. (2018a). Convergent evolution of complex structures for
ant-bacterial defensive symbiosis in fungus-farming ants. Proc. Natl. Acad. Sci. U.
S. A., 115(42):10720–10725.

Li, Y., Huang, Y.-T., Kasson, M. T., Macias, A. M., Skelton, J., Carlson, P. S.,
Yin, M., and Hulcr, J. (2018b). Specific and promiscuous ophiostomatalean fungi
associated with Platypodinae ambrosia beetles in the southeastern United States.
Fungal Ecol., 35:42–50.

Lindahl, B. D., Nilsson, R. H., Tedersoo, L., Abarenkov, K., Carlsen, T., Kjøller, R.,
Kõljalg, U., Pennanen, T., Rosendahl, S., Stenlid, J., and Others (2013). Fungal
community analysis by high-throughput sequencing of amplified markers–a user’s
guide. New Phytol., 199(1):288–299.

Locey, K. J. and Lennon, J. T. (2016). Scaling laws predict global microbial diversity.
Proc. Natl. Acad. Sci. U. S. A., 113(21):5970–5975.

Malacrinò, A., Schena, L., Campolo, O., Laudani, F., Mosca, S., Giunti, G., Strano,
C. P., and Palmeri, V. (2017). A metabarcoding survey on the fungal microbiota
associated to the olive fruit fly. Microb. Ecol., 73(3):677–684.

Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput se-

quencing reads. EMBnet.journal, 17(1):10.

Martin, M. M. (1970). The biochemical basis of the Fungus-Attine ant symbio-

sis: A complex symbiosis is based upon integration of the carbon and nitrogen
metabolisms of the two organisms. Science, 169(3940):16–20.

Martin, M. M. (1983). Cellulose digestion in insects. Comp. Biochem. Physiol. A

Physiol., 75(3):313–324.

Martin, M. M. (1992). The evolution of Insect-Fungus associations: From contact to

stable symbiosis. Integr. Comp. Biol., 32(4):593–605.

124
Massoumi Alamouti, S., Tsui, C. K. M., and Breuil, C. (2009). Multigene phylogeny
of filamentous ambrosia fungi associated with ambrosia and bark beetles. Mycol.
Res., 113(Pt 8):822–835.

Mayers, C. G., McNew, D. L., Harrington, T. C., Roeper, R. A., Fraedrich, S. W.,
Biedermann, P. H. W., Castrillo, L. A., and Reed, S. E. (2015). Three genera in
the Ceratocystidaceae are the respective symbionts of three independent lineages of
ambrosia beetles with large, complex mycangia. Fungal Biol., 119(11):1075–1092.

McKenna, D. D., Sequeira, A. S., Marvaldi, A. E., and Farrell, B. D. (2009). Temporal
lags and overlap in the diversification of weevils and flowering plants. Proc. Natl.
Acad. Sci. U. S. A., 106(17):7083–7088.

McKinney, W. (2010). Data structures for statistical computing in python. In der

Walt, S. v. and Millman, J., editors, Proceedings of the 9th Python in Science
Conference, pages 51–56.

Mikheyev, A. S., Mueller, U. G., and Abbot, P. (2006). Cryptic sex and many-to-one
coevolution in the fungus-growing ant symbiosis. Proc. Natl. Acad. Sci. U. S. A.,
103(28):10702–10706.

Minh, B. Q., Nguyen, M. A. T., and von Haeseler, A. (2013). Ultrafast approximation
for phylogenetic bootstrap. Mol. Biol. Evol., 30(5):1188–1195.

Moran, N. A., McCutcheon, J. P., and Nakabachi, A. (2008). Genomics and evolution
of heritable bacterial symbionts. Annu. Rev. Genet., 42:165–190.

Morrow, J. L., Hall, A. A. G., and Riegler, M. (2017). Symbionts in waiting: the
dynamics of incipient endosymbiont complementation and replacement in minimal
bacterial communities of psyllids. Microbiome, 5(1):58.

Mota-Gutierrez, J., Ferrocino, I., Rantsiou, K., and Cocolin, L. (2019). Metatax-
onomic comparison between internal transcribed spacer and 26S ribosomal large
subunit (LSU) rDNA gene. Int. J. Food Microbiol., 290:132–140.

Mueller, U. G. (2002). Ant versus fungus versus mutualism: ant-cultivar conflict

and the deconstruction of the attine ant-fungus symbiosis. Am. Nat., 160 Suppl
4:S67–98.

Mueller, U. G. and Gerardo, N. (2002). Fungus-farming insects: multiple origins and

diverse evolutionary histories. Proc. Natl. Acad. Sci. U. S. A., 99(24):15247–15249.

125
Mueller, U. G., Gerardo, N. M., Aanen, D. K., Six, D. L., and Schultz, T. R. (2005).
The evolution of agriculture in insects. Annu. Rev. Ecol. Evol. Syst., 36(1):563–595.

Mueller, U. G., Rehner, S. A., and Schultz, T. R. (1998). The evolution of agriculture
in ants. Science, 281(5385):2034–2038.

Mueller, U. G., Schultz, T. R., Currie, C. R., Adams, R. M., and Malloch, D. (2001).
The origin of the attine ant-fungus mutualism. Q. Rev. Biol., 76(2):169–197.

Musvuugwa, T., de Beer, Z. W., Duong, T. A., Dreyer, L. L., Oberlander, K. C., and
Roets, F. (2015). New species of Ophiostomatales from Scolytinae and Platypodi-
nae beetles in the Cape Floristic Region, including the discovery of the sexual state
of Raffaelea. Antonie Van Leeuwenhoek, 108(4):933–950.

Nakashima, T. (1971). Notes on the associated fungi and the mycetangia of the
ambrosia beetle, Crossotarsus niponicus BLANDFOR : Coleoptera : Platypodidae.
Appl. Entomol. Zool., 6(3):131–137.

Nguyen, L.-T., Schmidt, H. A., von Haeseler, A., and Minh, B. Q. (2015). IQ-
TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood
phylogenies. Mol. Biol. Evol., 32(1):268–274.

Nilsson, R. H., Larsson, K.-H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S.,
Schigel, D., Kennedy, P., Picard, K., Glöckner, F. O., Tedersoo, L., Saar, I., Kõljalg,
U., and Abarenkov, K. (2019). The UNITE database for molecular identification
of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids
Res., 47(D1):D259–D264.

Nobre, T. and Aanen, D. K. (2012). Fungiculture or termite husbandry? The rumi-

nant hypothesis. Insects, 3(1):307–323.

Nobre, T., Fernandes, C., Boomsma, J. J., Korb, J., and Aanen, D. K. (2011). Farm-
ing termites determine the genetic population structure of Termitomyces fungal
symbionts. Mol. Ecol., 20(9):2023–2033.

O’Donnell, K. and Cigelnik, E. (1997). Two divergent intragenomic rDNA ITS2 types
within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol.
Phylogenet. Evol., 7(1):103–116.

126
Oksanen, J., Blanchet, F. G., Kindt, R., Legendre, P., Minchin, P. R., O’hara, R. B.,
Simpson, G. L., Solymos, P., Stevens, M. H. H., and Wagner, H. (2011). vegan:
Community ecology package. R package version, pages 117–118.

Padhi, S. and Tayung, K. (2013). Antimicrobial activity and molecular characteriza-

tion of an endophytic fungus, Quambalaria sp. isolated from Ipomoea carnea. Ann.
Microbiol., 63(2):793–800.

Paradis, E., Claude, J., and Strimmer, K. (2004). APE: Analyses of phylogenetics
and evolution in R language. Bioinformatics, 20(2):289–290.

Pascoe, B. (2014). Dark emu black seeds: Agriculture or accident? Magabala Books.

Pennington, M. J., Rothman, J. A., Dudley, S. L., Jones, M. B., McFrederick, Q. S.,
Gan, J., and Trumble, J. T. (2017). Contaminants of emerging concern affect
Trichoplusia ni growth and development on artificial diets and a key host plant.
Proc. Natl. Acad. Sci. U. S. A., 114(46):E9923–E9931.

Ploetz, R. C., Hulcr, J., Wingfield, M. J., and de Beer, Z. W. (2013). Destructive
tree diseases associated with ambrosia and bark beetles: Black swan events in tree
pathology? Plant Dis., 97(7):856–872.

Poulsen, M. and Boomsma, J. J. (2005). Mutualistic fungi control crop diversity in

fungus-growing ants. Science, 307(5710):741–744.

Prosdocimi, E. M., Mapelli, F., Gonella, E., Borin, S., and Crotti, E. (2015). Micro-
bial ecology-based methods to characterize the bacterial communities of non-model
insects. J. Microbiol. Methods, 119:110–125.

Quince, C., Walker, A. W., Simpson, J. T., Loman, N. J., and Segata, N. (2017).
Shotgun metagenomics, from sampling to analysis. Nat. Biotechnol., 35(9):833–
844.

Quinlan, R. J. and Cherrett, J. M. (1979). The role of fungus in the diet of the
leaf-cutting ant Atta cephalotes (L.). Ecol. Entomol., 4(2):151–160.

Ranger, C. M., Biedermann, P. H. W., Phuntumart, V., Beligala, G. U., Ghosh, S.,
Palmquist, D. E., Mueller, R., Barnett, J., Schultz, P. B., Reding, M. E., and
Philipp Benz, J. (2018). Symbiont selection via alcohol benefits fungus farming by
ambrosia beetles. Proc. Natl. Acad. Sci. U. S. A., page 201716852.

127
Réblová, M., Gams, W., and Seifert, K. A. (2011). Monilochaetes and allied genera
of the Glomerellales, and a reconsideration of families in the Microascales. Stud.
Mycol., 68:163–191.

Richerson, P. J. and Boyd, R. (1999). Complex societies. Hum. Nat., 10(3):253–289.

Riddell, R. W. (1950). Permanent stained mycological preparations obtained by slide

culture. Mycologia, 42(2):265.

Rooney, A. P. and Ward, T. J. (2005). Evolution of a large ribosomal RNA multigene

family in filamentous fungi: birth and death of a concerted evolution paradigm.
Proc. Natl. Acad. Sci. U. S. A., 102(14):5084–5089.

Salem, H., Florez, L., Gerardo, N., and Kaltenpoth, M. (2015). An out-of-body
experience: the extracellular dimension for the transmission of mutualistic bacteria
in insects. Proc. Biol. Sci., 282(1804):20142957.

Salter, S. J., Cox, M. J., Turek, E. M., Calus, S. T., Cookson, W. O., Moffatt, M. F.,
Turner, P., Parkhill, J., Loman, N. J., and Walker, A. W. (2014). Reagent and lab-
oratory contamination can critically impact sequence-based microbiome analyses.
BMC Biol., 12:87.

Samways, M. J. (1993). Insects in biodiversity conservation: some perspectives and

directives. Biodiversity & Conservation, 2(3):258–282.

Sauvard, D., Branco, M., Lakatos, F., Faccoli, M., and others (2010). Weevils and
bark beetles (Coleoptera, Curculionoidea). BioRisk, 4(1):219–266.

Schirmer, M., Ijaz, U. Z., D’Amore, R., Hall, N., Sloan, W. T., and Quince, C. (2015).
Insight into biases and sequencing errors for amplicon sequencing with the Illumina
MiSeq platform. Nucleic Acids Res., 43(6):e37.

Schoch, C. L., Robbertse, B., Robert, V., Vu, D., Cardinali, G., Irinyi, L., Meyer, W.,
Nilsson, R. H., Hughes, K., Miller, A. N., Kirk, P. M., Abarenkov, K., Aime, M. C.,
Ariyawansa, H. A., Bidartondo, M., Boekhout, T., Buyck, B., Cai, Q., Chen, J.,
Crespo, A., Crous, P. W., Damm, U., De Beer, Z. W., Dentinger, B. T. M., Divakar,
P. K., Dueñas, M., Feau, N., Fliegerova, K., Garcı́a, M. A., Ge, Z.-W., Griffith,
G. W., Groenewald, J. Z., Groenewald, M., Grube, M., Gryzenhout, M., Gueidan,
C., Guo, L., Hambleton, S., Hamelin, R., Hansen, K., Hofstetter, V., Hong, S.-
B., Houbraken, J., Hyde, K. D., Inderbitzin, P., Johnston, P. R., Karunarathna,

128
 S. C., Kõljalg, U., Kovács, G. M., Kraichak, E., Krizsan, K., Kurtzman, C. P.,
Larsson, K.-H., Leavitt, S., Letcher, P. M., Liimatainen, K., Liu, J.-K., Lodge,
D. J., Luangsa-ard, J. J., Lumbsch, H. T., Maharachchikumbura, S. S. N., Man-
amgoda, D., Martı́n, M. P., Minnis, A. M., Moncalvo, J.-M., Mulè, G., Nakasone,
K. K., Niskanen, T., Olariaga, I., Papp, T., Petkovits, T., Pino-Bodas, R., Pow-
ell, M. J., Raja, H. A., Redecker, D., Sarmiento-Ramirez, J. M., Seifert, K. A.,
Shrestha, B., Stenroos, S., Stielow, B., Suh, S.-O., Tanaka, K., Tedersoo, L., Tel-
leria, M. T., Udayanga, D., Untereiner, W. A., Diéguez Uribeondo, J., Subbarao,
K. V., Vágvölgyi, C., Visagie, C., Voigt, K., Walker, D. M., Weir, B. S., Weiß,
M., Wijayawardene, N. N., Wingfield, M. J., Xu, J. P., Yang, Z. L., Zhang, N.,
Zhuang, W.-Y., and Federhen, S. (2014). Finding needles in haystacks: linking
scientific names, reference specimens and molecular data for fungi. Database, 2014.

Schultz, T. R. and Brady, S. G. (2008). Major evolutionary transitions in ant agri-

culture. Proc. Natl. Acad. Sci. U. S. A., 105(14):5435–5440.

Scott, D. B. and Du Toit, J. W. (1970). Three new Raffaelea species. Trans. Br.
Mycol. Soc., 55(2):181–IN1.

Scott, J. J., Oh, D.-C., Yuceer, M. C., Klepzig, K. D., Clardy, J., and Currie, C. R.
(2008). Bacterial protection of beetle-fungus mutualism. Science, 322(5898):63.

Scully, E. D., Geib, S. M., Carlson, J. E., Tien, M., McKenna, D., and Hoover,
K. (2014). Functional genomics and microbiome profiling of the asian longhorned
beetle (Anoplophora glabripennis) reveal insights into the digestive physiology and
nutritional ecology of wood feeding beetles. BMC Genomics, 15(1):1096.

Seifert, K. A. and Rossman, A. Y. (2010). How to describe a new fungal species. IMA
Fungus, 1(2):109–116.

Senderovich, Y. and Halpern, M. (2012). Bacterial community composition associated

with chironomid egg masses. J. Insect Sci., 12:149.

Shi, W., Syrenne, R., Sun, J.-Z., and Yuan, J. S. (2010). Molecular approaches to
study the insect gut symbiotic microbiota at the ‘omics’ age: Molecular approaches
for insect gut symbiont study. Insect Sci., 17(3):199–219.

Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., and Ishikawa, H. (2000).
Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp.
APS. Nature, 407(6800):81–86.

129
Simmons, D. R., de Beer, Z. W., Huang, Y.-T., Bateman, C., Campbell, A. S.,
Dreaden, T. J., Li, Y., Ploetz, R. C., Black, A., Li, H.-F., Chen, C.-Y., Wingfield,
M. J., and Hulcr, J. (2016). New Raffaelea species (Ophiostomatales) from the
USA and Taiwan associated with ambrosia beetles and plant hosts. IMA Fungus,
7(2):265–273.

Sinclair, L., Osman, O. A., Bertilsson, S., and Eiler, A. (2015). Microbial community
composition and diversity via 16S rRNA gene amplicons: evaluating the illumina
platform. PLoS One, 10(2):e0116955.

Six, D. L., Doug Stone, W., de Beer, Z. W., and Woolfolk, S. W. (2009). Ambrosiella
beaveri, sp. nov., associated with an exotic ambrosia beetle, Xylosandrus mutila-
tus (Coleoptera: Curculionidae, Scolytinae), in Mississippi, USA. Antonie Van
Leeuwenhoek, 96(1):17–29.

Six, D. L. and Paine, T. D. (1998). Effects of mycangial fungi and host tree species on
progeny survival and emergence of Dendroctonus ponderosae (Coleoptera: Scolyti-
dae). Environ. Entomol., 27(6):1393–1401.

Skelton, J., Johnson, A. J., Jusino, M. A., Bateman, C. C., Li, Y., and Hulcr, J.
(2019). A selective fungal transport organ (mycangium) maintains coarse phylo-
genetic congruence between fungus-farming ambrosia beetles and their symbionts.
Proceedings of the Royal Society B, page doi.org/10.1098/rspb.2018.2127.

Smith, S. M. (2013). Spatial and temporal patterns of kin and population genetic
structure of the eusocial beetle, Austroplatypus incompertus. PhD thesis, Macquarie
University.

Smith, S. M., Kent, D. S., Boomsma, J. J., and Stow, A. J. (2018). Monogamous
sperm storage and permanent worker sterility in a long-lived ambrosia beetle. Nat
Ecol Evol, 2(6):1009–1018.

Steinwender, B. M., Krenn, H. W., and Wegensteiner, R. (2010). Different effects

of the insectpathogenic fungus Beauveria bassiana (Deuteromycota) on the bark
beetle Ips sexdentatus (Coleoptera: Curculionidae) and on its predator Thanasimus
formicarius (Coleoptera: Cleridae). J. Plant Dis. Prot., 117(1):33–38.

Stielow, J. B., Lévesque, C. A., Seifert, K. A., Meyer, W., Iriny, L., Smits, D.,
Renfurm, R., Verkley, G. J. M., Groenewald, M., Chaduli, D., Lomascolo, A.,
Welti, S., Lesage-Meessen, L., Favel, A., Al-Hatmi, A. M. S., Damm, U., Yilmaz,

130
 N., Houbraken, J., Lombard, L., Quaedvlieg, W., Binder, M., Vaas, L. A. I., Vu, D.,
Yurkov, A., Begerow, D., Roehl, O., Guerreiro, M., Fonseca, A., Samerpitak, K.,
van Diepeningen, A. D., Dolatabadi, S., Moreno, L. F., Casaregola, S., Mallet, S.,
Jacques, N., Roscini, L., Egidi, E., Bizet, C., Garcia-Hermoso, D., Martı́n, M. P.,
Deng, S., Groenewald, J. Z., Boekhout, T., de Beer, Z. W., Barnes, I., Duong,
T. A., Wingfield, M. J., de Hoog, G. S., Crous, P. W., Lewis, C. T., Hambleton, S.,
Moussa, T. A. A., Al-Zahrani, H. S., Almaghrabi, O. A., Louis-Seize, G., Assabgui,
R., McCormick, W., Omer, G., Dukik, K., Cardinali, G., Eberhardt, U., de Vries,
M., and Robert, V. (2015). One fungus, which genes? development and assessment
of universal primers for potential secondary fungal DNA barcodes. Persoonia,
35:242–263.

Sun, T., Wang, X.-Q., Zhao, Z.-L., Yu, S.-H., Yang, P., and Chen, X.-M. (2018). A
lethal fungus infects the chinese white wax scale insect and causes dramatic changes
in the host microbiota. Sci. Rep., 8(1):5324.

Tarno, H., Septia, E. D., and Aini, L. Q. (2016). Microbial community associated
with ambrosia beetle, Euplatypus parallelus on Sonokembang, Pterocarpus indicus
in Malang. Agrivita, Journal of Agricultural Science, 38(3):312–320.

Taylor, D. L., Walters, W. A., Lennon, N. J., Bochicchio, J., Krohn, A., Caporaso,
J. G., and Pennanen, T. (2016). Accurate estimation of fungal diversity and abun-
dance through improved Lineage-Specific primers optimized for illumina amplicon
sequencing. Appl. Environ. Microbiol., 82(24):7217–7226.

Teeling, H. and Glöckner, F. O. (2012). Current opportunities and challenges in

microbial metagenome analysis–a bioinformatic perspective. Brief. Bioinform.,
13(6):728–742.

Ulyshen, M. D. (2016). Wood decomposition as influenced by invertebrates. Biol.

Rev. Camb. Philos. Soc., 91(1):70–85.

Untereiner, W. A., Straus, N. A., and Malloch, D. (1995). A molecular-

morphotaxonomic approach to the systematics of the Herpotrichiellaceae and allied
black yeasts. Mycol. Res., 99(8):897–913.

van de Peppel, L. J. J., Aanen, D. K., and Biedermann, P. H. W. (2018). Low

intraspecific genetic diversity indicates asexuality and vertical transmission in the
fungal cultivars of ambrosia beetles. Fungal Ecol.

131
Vanderpool, D., Bracewell, R. R., and McCutcheon, J. P. (2017). Know your farmer:
Ancient origins and multiple independent domestications of ambrosia beetle fungal
cultivars. Molecular Ecology, 27(8):2077–2094.

Vega, F. E. and Dowd, P. F. (2005). The role of yeasts as insect endosymbionts. Insect-
Fungal Associations: Ecology and Evolution. Edited by Vega, F. E. and Blackwell
M. . Oxford University Press, New York, pages 211–243.

Vilgalys, R. and Hester, M. (1990). Rapid genetic identification and mapping of en-
zymatically amplified ribosomal DNA from several Cryptococcus species. J. Bac-
teriol., 172(8):4238–4246.

Wang, G. C. and Wang, Y. (1997). Frequency of formation of chimeric molecules

as a consequence of PCR coamplification of 16S rRNA genes from mixed bacterial
genomes. Appl. Environ. Microbiol., 63(12):4645–4650.

Ward, D. M., Weller, R., and Bateson, M. M. (1990). 16S rRNA sequences reveal nu-
merous uncultured microorganisms in a natural community. Nature, 345(6270):63–
65.

Weber, N. A. (1966). Fungus-growing ants. Science, 153(3736):587–604.

Wegensteiner, R. (2000). Laboratory evaluation of Beauveria bassiana (Bals.) Vuill.

and Beauveria brongniartii (Sacc.) petch against the four eyed spruce bark bee-
tle, Polygraphus poligraphus (L.)(Coleoptera, Scolytidae). Bulletin OILB/SROP,
23(2):161–166.

Weinert, L. A., Araujo-Jnr, E. V., Ahmed, M. Z., and Welch, J. J. (2015). The
incidence of bacterial endosymbionts in terrestrial arthropods. Proc. Biol. Sci.,
282(1807):20150249.

White, P. B. (1921). The normal bacterial flora of the bee. J. Pathol., 24(1):64–78.

Yin, M., Duong, T. A., Wingfield, M. J., Zhou, X., and de Beer, Z. W. (2015).
Taxonomy and phylogeny of the leptographium procerum complex, including Lep-
tographium sinense sp. nov. and Leptographium longiconidiophorum sp. nov. An-
tonie Van Leeuwenhoek, 107(2):547–563.

You, L., Simmons, D. R., Bateman, C. C., Short, D. P. G., Kasson, M. T., Rabaglia,
R. J., and Hulcr, J. (2015). New Fungus-Insect Symbiosis: Culturing, molecular,

132
and histological methods determine saprophytic polyporales mutualists of Ambro-
siodmus ambrosia beetles. PLoS One, 10(9):e0137689.

133