Journal of Molecular Neuroscience

© Springer Science+Business Media New York 2014

10.1007/s12031-014-0475-4

Citalopram Attenuates Tau

Hyperphosphorylation and Spatial Memory
Deficit Induced by Social Isolation Rearing in
Middle-Aged Rats
Qing-Guo Ren1, 2  , Wei-Gang Gong1, Yan-Juan Wang1, Qi-Da Zhou2 and Zhi-Jun Zhang1

(1)
Department of Neuropsychiatry, Affiliated ZhongDa Hospital, School of Medicine, Southeast University,
Nanjing, China
(2)
Department of Neurology, Wu Xi Branch of Affiliated ZhongDa Hospital, School of Medicine, Southeast
University, Wuxi, China
 

 
Qing-Guo Ren
Email: rqg1976@tom.com

Received: 18 October 2014Accepted: 21 November 2014Published online: 5 December 2014

Abstract
Social isolation (SI) is considered as a chronic stress. Here, middle-aged rats (8 months) were group or isolation reared for 6 weeks.
Following the initial two-week period of rearing, citalopram (10 mg/kg i.p.) was administered for 28 days. Changes in recognition
memory, depression and anxiety-like behavior, and phosphorylated tau were investigated. We found that SI did not lead to obvious
depression/anxiety-like behavior in middle-aged rats. Memory deficits and increased tau hyperphosphorylation at Tau-1, Ser396
episodes could be almost reversed by citalopram. The level of Ser9-phosphorylated GSK-3β (inactive form) was significantly
decreased in the SI group which also could be almost reversed by citalopram, suggesting that the citalopram could prevent GSK-3β
from SI-induced overactivation. The melatonin level was decreased in SI group compared with group housed (GH) group, and
citalopram could partly restore the level of melatonin. We also found that citalopram could increase MT1 and MT2 in mRNA level.
Our results demonstrate that citalopram increases the level of melatonin which negatively regulates GSK-3β and attenuates tau
hyperphosphorylation and spatial memory deficit induced by SI in middle-aged rats. Suggesting that SI might constitute a risk factor
for Alzheimer’s disease (AD), and citalopram may represent a therapeutic strategy for the treatment of AD.
Keywords

 Social isolation Tau Citalopram Alzheimer’s disease

Qing-Guo Ren and Wei-Gang Gong contributed equally to this work.

Introduction
Stress is considered to be associated with the development of neuropsychiatric disorders, including anxiety and major depression.
There are also important memory disturbances in stress-related psychiatric disorders (Bremner and Narayan 1998). Even more
major stressors experienced throughout the lifespan have been hypothesized to contribute to variability in the aging process
(McEwen 2002). Clinical data even suggest that a stressful lifestyle can be a risk factor for AD (Wilson et al. 2005) and stress-
related psychiatric disorders (i.e., major depression) which have been recognized as a risk for developing AD (Ownby et al. 2006).
Social isolation (SI), which is widely used as juvenile stress, is also known risk factors for developing emotional and cognitive
dysfunction (Fone and Porkess 2008; McCormick et al. 2010; Hulshof et al. 2011; Baudin et al. 2012). The results have showed that
adolescent social deprivation leads to increased anxiety-like behaviors (McCormick et al. 2008; Lukkes et al. 2009a, b), decreased
social behaviors (Hol et al. 1999), increased sensitivity to stress (Lukkes et al. 2009a, b; Weintraub et al. 2010), increased
depressive behaviors (Mathews et al. 2008), impaired spatial memory, and reduced hippocampal cell proliferation (McCormick et
al. 2010) in young adult rats. However, some studies reported are inconsistent, if not contradictory (Wongwitdecha and
Marsden 1996; Weiss et al. 2004). It is noteworthy that stress effects are often critically dependent on the age of exposure to the
stressor (Suri et al. 2013). For example, sucrose consumption or preference (a measure of anhedonia) was found to be decreased
after isolation in adulthood (Wallace et al. 2009) or increased in animals isolated as adolescents (Gronli et al. 2006; Brenes and
Fornaguera 2008). Social isolation research has focused mainly on post-weaning animals and therefore little is known about the
neurobiology of middle-aged animals with stress.
Tau is a major microtubule-associated protein. The normal function of tau is to promote microtubule assembly and stabilize the
formed microtubules, and thus to establish cellular polarity and maintain the intracellular transport of neurons (Drewes et al. 1998).
When tau is hyperphosphorylated and accumulated in the cells, it becomes incompetent in executing the above biological functions
and thus leads to disruption of microtubules. Several studies have shown that chronic stress could increase AD-related markers such
as tau phosphorylation and amyloid-β (Aβ) accumulation in mouse or rats (Briones et al. 2012; Zhang et al.2012). Selective
serotonin reuptake inhibitor (SSRI) was a new class of antidepressant that developed from 1980s. It was mainly used in
antidepressive treatment in clinic. Earlier work had established that paroxetine (an antidepressant from the SSRI class) reduced
expression of APP by binding a promoter region in the 50UTR (Tucker et al. 2005). Subsequent evidence suggests that paroxetine
could decrease the number of Aβ and tau positive neurons in the CA1 region of the hippocampus (Nelson et al. 2007). However,
fluoxetine, another antidepressant from the SSRI class, do not have a known direct pharmacology for the generation of Aβ peptide
and tau phosphorylation (Marlatt et al. 2013). At present, whether SSRI antidepressants could ameliorate AD-related markers,
especially tau hyperphosphorylation remains unclear.
The aim of the present study was to investigate the effects of chronic citalopram (an antidepressant from the SSRI class) treatment
on the behavioral phenotype and the tau phosphorylation in isolation-reared middle-aged rats. Firstly, we investigate the effect of
social isolation on tau phosphorylation and spatial memory. Our results show that social isolation can cause tau
hyperphosphorylation and spatial memory deficit without obvious emotional impairment in middle-aged rats. In addition, we
studied the possible effects of pharmacological intervention in social isolation rats with the antidepressant citalopram. We have
demonstrated that citalopram can attenuate tau hyperphosphorylation and spatial memory deficit induced by social isolation rearing
in middle-aged rats. Altogether, the results from the present study support the notion that vulnerability to social isolation might
constitute a risk factor for the development of AD, and that pharmacological treatment with citalopram may represent a therapeutic
strategy for the treatment of stress-related disorders, including AD.
Material and Method
Animals
Sixty adult male Sprague–Dawley rats, weighing 500–550 g, were purchased from Nangjing medical college and were maintained
in our animal facility in a temperature controlled room (22–25 ° C) with a 12-h dark–light cycle. The animals were housed either
individually (isolated; total n = 40) or four per cage [group housed (GH); total n = 20]. All rats were housed in opaque plastic cages
lined with sawdust and fitted with metal grid lids. Isolated rats were housed in cages measuring 38 × 22 × 20 cm, while group
housed rats were maintained in cages measuring 48 × 30 × 20 cm. All animal procedures were reviewed and approved by the
international guidelines for the ethical use of laboratory animals and the National Institutes of Health Guide for the Care and Use of
Laboratory Animals.
Animals were isolated (postnatal month 8) for a total isolation period of 6 weeks. Following the first undisturbed two-week period
of group-housed or isolation-reared conditions, citalopram (10 mg/kg i.p.) or vehicle (water, 1 ml/kg i.p.) was administered to
isolated rats for 4 weeks.

Behavioral Tasks

Sucrose Preference Test

The sucrose preference test was used to test anhedonia which is considered to be a core symptom of human depression. Rats were
tested for preference of a 1 % sucrose solution, using a two-bottle choice procedure. Animals’ preference was evaluated for 12 h.
Briefly, sucrose preference test of all the three groups of rats was carried out after 1 day (24 h) adaptation as the baseline. Then,
animals were housed singly during the test: they had free choice between the sucrose bottle and the bottle of tap water, the bottles
either with 1 % sucrose solution or water changed their position 6 h after beginning. After 12 h, the amount of sucrose and water
consumed was evaluated as grams of liquid consumed, and sucrose preference index was thus calculated: [sucrose (g) / (sucrose (g) 
+ water (g)] × 100 %.

Open Field Test

The open field test was conducted in a 100 × 100 × 50 cm black Plexiglas box with a black floor. The times of standing on the hind
legs (rearing) of rats and total distance traveled were set up with a digital video camera in a 5-min session. The apparatus was
cleaned with a detergent and dried after occupancy by each rat. The observer that was blinded to experimental groups manually
assessed rearing behavior using a computerized system provided in the software.

Morris Water Maze

Morris water maze was used to test the spatial learning and memory of animals. Briefly, the Morris water maze (MWM) consisted
of a black circular tank (160 cm in diameter), filled with water (20 ± 1) °C of 30 cm in depth. The maze was divided into four equal
quadrants, and a transparent escape platform (11 cm in diameter) was placed in a constant position in middle of a quadrant, 2–3 cm
below water surface. The animals received four trials during five daily acquisition sessions. Each trial was started by placing a rat
into the maze, facing the wall of maze. The trial was terminated automatically as soon as the rat reached the platform or when 60 s
had elapsed. The rat was allowed to stay on the platform for 5 s. Rats which did not find the platform within 60 s were guided to the
platform. After each trial, rats were gently dried with a towel and returned to home cage. The latencies and swimming paths for the
rats to search for the platform were monitored by a computerized tracking system. The spatial memory of the rats was tested again
in the same water maze on the 6 days, the same protocol as described above was followed, and besides, a new step was added in
which the platform was removed and animals were allowed to swim freely for 60 s while recording the time and distance in each
quadrant.

Tissue Preparation
Upon completion of final behavioral tests, the animals were decapitated under deep anesthesia and the brain samples were quickly
removed from rats and kept over a glass plate placed on ice and then dissected into hippocampus and cerebral cortex and stored at
−80 °C till further analysis.

Western Blot
The tissues were thawed and homogenized at a ratio of 9.0 ml of buffer/1.0 g tissue in ice-cold buffer containing 50 mM Tris–
HCl (pH 7.0), 1.0 mM EDTA, 0.1 mM phenylmethyl sulfonyl fluoride, 1 mM benzamidine, 0.5 mM isobutylmethylxanthine, and
2.0 μg/ml each of aprotinin, leupeptin, and pepstatin A. Then, the homogenized tissue was centrifuged at 12,500×g for 15 min at
4 °C, and the supernatant was collected. Protein concentration in the supernatants was determined using the pierce bicinchoninic
acid (BCA) Protein Assay Kit (Thermo, USA). Equal amounts of proteins were isolated on 10 % SDS polyacrylamide gel (SDS-
PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Immobilon Transfer Membrane, Millipore, USA). The
membranes were blocked in 5 % (w/v) nonfat milk in TBS T (10 mM Tris–HCl, 150 mM NaCl, 0.02 % (v/v) Tween-20, pH 7.5) and
probed with Tau-1 (1:1000, Millipore) or pS231 (1:1000, Invitrogen) or pS396 (1:1000, Invitrogen) or total GSK-3β (1:1000, CST)
or GSK-3β-Ser9 (1:1000, CST) or GAPDH (1:4000, Sigma) was probed overnight at 4 °C. The blots were developed with
horseradish peroxidase-conjugated secondary antibodies (1:5000, Pierce) and visualized by enhanced chemiluminescent substrate
kit and exposured to CL-XPosure film. The immunore activity of protein bands was quantitatively analyzed by Kodak Digital
Science 1D software (Eastman Kodak Co., New Haven, CT) and expressed as mean optical density. The levels of GAPDH proteins
were expressed as relative level of the mean optical density against control.

Elisa
One hundred milligrams Brian tissue was rinsed with 1× PBS, homogenized in 1 ml of 1× PBS and stored overnight at −20 °C.
After two freeze-thaw cycles were performed to break the cell membranes, the homogenates were centrifuged for 5 min at 5000×g,
2–8 °C. The supernate was removed and assayed immediately. Brain homogenates melatonin concentration was measured using a
commercially available enzyme-linked immunosorbent assay kit for melatonin (manufacturers: CUSABIO Life Science Inc, China).
This assay employs the competitive inhibition enzyme immunoassay technique.

Real-Time PCR
The mRNA expression of melatonin receptor 1 (MT1) and melatonin receptor 2 (MT2) was further assessed by real-time PCR using
a GoTaq® qPCR Master Mix (Promega, USA), with the following forward (F) and reverse (R) primers (5′→3′): MT1 (F)
TTGTGGCGAGTTTAGCTGTG (R) GACACTCAGGCCCATTAGGA (140 bp); MT2 (F) ATTCCTGCACCTTCATCCAG (R)
CCTGGAGCACCAGTATCCAT (126 bp); and GAPDH (F) TTCAACGGCACAGTCAAG (R) TACTCAGCACCAGCATCA was
used as an internal control.

Statistical Analysis
Data were analyzed using SPSS software, version 18.0 (SPSS Inc., Chicago). One-way ANOVA and Bonferroni correction were
used to analyze these data. Values were presented as mean ± standard deviation (S.D.). The results were considered statistically
significant if P < 0.05. Each experiment consisted of at least three replicates per condition.
Result
Effect of Repeated Citalopram Treatment on SI-Induced Behavioral
Characterization
Stressful experiences are believed to be closely associated with the development of psychological alterations. The open field test
was used to test the anxiety/exploration-like levels of the rats. As shown in Fig. 1a, the crossing distance was not different among
the groups reared in different environmental conditions or citalopram treatment groups. The rearing frequency was lower in SI
group compared with GH groups, and citalopram administration could partly improve rearing frequency (Fig. 1b). Spontaneous
open-field activity did not change significantly following different environmental conditions or citalopram treatment (Fig. 1c).
Although not significant, the SI animals showed the shortest and GH rats the longest center distance (Fig. 1c).
Fig. 1
Effect of repeated citalopram treatment on SI-induced behavioral characterization. Adult rats (8 months)
were group housed (GH) or social isolation reared (SI) for 6 weeks. Following the initial two-week period
of rearing, citalopram (10 mg/kg i.p.) was administered for 28 days. The open field test was used to test
the anxiety/exploration-like levels of the rats (a, b, c). The sucrose preference test was used to assess the
reward sensitivity behavior (d). The results are expressed as the mean ± SD (n = 3); *p < 0.05, SI + CI vs
SI,# p < 0.05 GH vs SI
The sucrose preference test was used to assess the reward sensitivity behavior. Insensitivity to rewards is indicative of an anhedonic
state, which is considered to be a major symptom of human depression. Our result revealed that there was no significant difference
among groups in sucrose preference index (Fig. 1d).

Effect of Repeated Citalopram Treatment on SI-Induced Spatial Learning

and Memory Deficits
The impairment of spatial memory is a typical symptom of AD in the early stages. Therefore, we studied the influence of SI on
spatial memory using the Morris water maze. At the same time, we also investigated the effect of repeated administration of
citalopram on maze performance in SI rats. Repeated daily administration of citalopram at a dose of 10 mg/kg was started 2 weeks
after starting the SI until the end of the maze test. We preliminarily checked that SI or citalopram did not affect moving ability
(Fig. 1a). Furthermore, previous paper suggested that SI did not affect swim speed (Song et al. 2006). In addition to results of visible
test in this study, these findings indicate that the changes in performance during the training and probe trials were not because of an
impairment of swimming ability or motivation. On the other hand, there was a significant difference in performance of three
different groups of rat. Compared with GH group, SI significantly prolonged the latency of rats to find the hidden platform (Fig. 2a)
on day 4 and 5. Supplementation of citalopram partially restored the SI-induced impairment in learning memory (Fig. 2a). The GH
rats spent ~35 % of total swimming time (quadrant time percent) in the previous platform-located quadrant, whereas SI rats
significantly decreased this quadrant time (Fig. 2b). The SI-induced decrease in the quadrant time was almost totally abolished by
citalopram treatment (Fig. 2b). When the target crossing time was analyzed as a measure of performance, the same results were
achieved (Fig. 2c).
Fig. 2
Effect of repeated citalopram treatment on SI-induced spatial learning and memory deficits. To acquire
spatial memory, rats were trained for 20 trials (4 trials/day) successively in Morris water maze over a
period of 5 days. The spatial memory of rats was expressed as quadrant time percent (%) and target
crossing time, i.e., the longer the quadrant time or the target crossing time, the better the spatial
memory. a represent the latency of different groups; b and c represent quadrant time percent (%) and
target crossing time of different groups, respectively. The results are expressed as the mean ± SD (N = 
20); *p < 0.05, SI + CI vs SI, # p < 0.05 GH vs SI

Effect of Repeated Citalopram Treatment on SI-Induced Tau

Hyperphosphorylation in Rat Hippocampus
To study the possible mechanisms underlying the improvement of spatial memory retention of the rats by citalopram treatment, we
measured the level of tau phosphorylation. It was shown by Western blotting (Fig. 3a) and quantitative analysis (Fig. 3b–d) that the
immunoreactivity of PS396 (Fig. 3a, b) was enhanced and the immunoreactivity of Tau-1 (Fig. 3a, c) was decreased in SI rats,
suggesting that SI induces tau hyperphosphorylation at Ser396 and Ser199/202 (Tau-1 reacts with non-phosphorylated tau).
Administration of citalopram at 10 mg/kg per day attenuated the SI-induced tau hyperphosphorylation at PS396 and Tau-1 epitopes.
We also tested the phosphorylation level at Thr 231 epitopes, but no significant difference was observed (Fig. 3a, d).
Fig. 3
Effect of repeated citalopram treatment on SI-induced tau hyperphosphorylation in rat hippocampus. The
phosphorylation-dependent antibodies PS396, PT231 (Thr231), and Tau-1 as indicated were used to
measure the alteration of tau in different phosphorylation status. Increased level of phosphorylated tau
was observed in social isolation group which could be reversed by citalopram. The results are expressed
as the mean ± SD (N = 3); *p < 0.05, **p < 0.01, SI + CI vs SI, # p < 0.05, ## p < 0.01, GH vs SI

Effect of Citalopram on SI-Induced Overactivation of GSK-3β in Rat

Hippocampus
GSK-3β is a key kinase to regulate tau phosphorylation. We measured the total level and the activity-dependent Ser9-
phosphorylated level of GSK-3β in the hippocampal extracts. No obvious change was seen in the total level of GSK-3β probed by
pAb against GSK-3β in SI, GH or citalopram treatment rats (Fig. 4a, b). However, the level of Ser9-phosphorylated GSK-3β
(representing the inactivated form of the kinase) was significantly decreased in the SI group, and treatment with citalopram
obviously increased the level of the Ser9-phosphorylated GSK-3β (Fig. 4a, c), suggesting that the citalopram could prevent GSK-3β
from SI-induced overactivation.
Fig. 4
Effect of citalopram on SI-induced overactivation of GSK-3β in rat hippocampus. The alteration of total
level of GSK-3β (a, b) and the ser-9-phosphorylated GSK-3β (inactivated form of the kinase) (a, c) were
measured by Western blotting in different groups. The results are expressed as the mean ± SD (N = 3). *p 
< 0.05, SI + CI vs SI, # p < 0.05 GH vs SI

Effect of Citalopram and SI on Melatonin Homeostasis in Rat

Hippocampus
Serotonin is the precursor of melatonin. It is assumed that SSRIs increases indirectly melatonin production by increasing the
serotonin concentration in tissues and blood (von Bahr et al. 2000; Carvalho et al. 2009). To investigate the effect of SI or
citalopram on melatonin metabolism, we measured the total level and the receptors expression of melatonin in the hippocampal
extracts using Elisa and real-time PCR, respectively. We found that the melatonin level was decreased obviously in SI group
compared with GH group, and citalopram could partly restore the level of melatonin (Fig. 5a). Unexpectedly, we found that SI did
not change the level of melatonin receptor 1 (MT1) and melatonin receptor 2 (MT2) and citalopram could increase MT1 and MT2
in mRNA level (Fig. 5b, c).
Fig. 5
Effect of citalopram and SI on melatonin homeostasis in rat hippocampus. The melatonin level was
detected by Elisa (a), and the mRNA level of MT1 and MT2 was detected by real-time RT-PCR (b, c).
The results are expressed as the mean ± SD (N = 3). *p < 0.05, SI + CI vs SI, # p < 0.05 GH vs SI
Discussion
It has been well recognized that formation of neurofibrillary tangles is a hallmark lesion of AD, and the amount of the tangles is
positively correlated with the deterioration of the memory loss in the patients (Guillozet et al. 2003). Hyperphosphorylated tau is the
major protein subunit of the tangles, and it is believed to be an early pathological event of AD. Recently, several important
prospective studies have demonstrated that depression is a predisposing factor for the development of incident dementia (Wilson et
al. 2005). Isolation rearing which is seen as a chronic stress model has been proved leading to AD-related biomarkers such as
hyperphoshorylated tau and Aβ aggregates (Briones et al. 2012; Zhang et al. 2012). Clinically, increasing evidence has shown the
therapeutic potential of SSRI antidepressants in AD patients (Finkel et al. 2004; Mowla et al. 2007). The neuroprotective effect of
SSRI antidepressant was also shown by preclinical studies (Egashira et al. 2006; Nelson et al. 2007; Lyons et al. 2012). However,
whether SSRI antidepressant can reverse spatial memory deficits caused by isolation rearing and its underlying mechanism is still
unclear. In the present study, we have demonstrated that citalopram can attenuate tau hyperphosphorylation and spatial memory
deficit induced by social isolation rearing in adult rats. And our result strongly indicates that melatonin which negatively
regulates GSK-3 may be involved in this process.
GSK-3 is a crucial kinase not only in tau hyperphosphorylation but also in memory deficits (Sang et al. 2001; Hernandez et
al. 2002). In the attempt to better understand the neuroprotective effects of citalopram in SI, we also investigated the effects of
citalopram on GSK-3β regulation. In our study, we found that the level of Ser9-phosphorylated GSK-3β (representing the
inactivated form of the kinase) was significantly decreased in the SI group, and treatment with citalopram obviously increased the
level of the Ser9-phosphorylated GSK-3β. This is the first report suggesting that citalopram can inhibit GSK-3β and improve SI-
induced tau hyperphosphorylation and spatial memory impairment.
Melatonin, an indoleamine secreted by the pineal, regulates circadian rhythms, clears free radical, improves the immunity, and
generally inhibits the oxidation of biomolecules. Studies demonstrate that the level of melatonin in serum and in cerebrospinal fluid
(CSF) of AD patients is decreased, and the ability of cognition in these patients is improved after melatonin treatment (Uchida et
al. 1996; Asayama et al. 2003). Data from Wang laboratory has also shown that melatonin can attenuate the Alzheimer-like tau
hyperphosphorylation (Wang et al. 2004; Deng et al. 2005; Yang et al. 2011), and inhibiting melatonin biosynthesis induce spatial
memory retention and tau phosphorylation in rats (Zhu et al. 2004). Serotonin is a substrate for melatonin synthesis. Changes in
serotonin catabolism caused by SSRI play a key role in melatonin homeostasis. Although there is still some controversy about
which kind of SSRIs can increase melatonin level (Hartter et al. 2001). Numerous studies have shown that some antidepressants
have an effect of enhancing melatonin (von Bahr et al. 2000; Carvalho et al. 2009). In this study, we found that the melatonin level
was decreased obviously in SI group compared with GH group, and citalopram could partly restore the SI-induced decreased level
of melatonin. In mammals, melatonin exerts some of its functions through two specific high-affinity membrane receptors, MT1 and
MT2. Decreased MT2 immunoreactivity and increased MT1 immunoreactivity have been reported in the hippocampus of AD
patients (Savaskan et al. 2002, 2005). However, we found in our study that SI did not change the level of MT1 and MT2.
Unexpectedly, citalopram could increase MT1 and MT2 in mRNA level, the mechanism still needs further investigation. Altogether,
our result suggests that melatonin may be involved in attenuating SI-induced tau hyperphosphorylation and spatial memory deficit.
Many studies have demonstrated that melatonin can decrease tau phosphorylation (Wang et al. 2004; Deng et al. 2005; Yang et
al. 2011), although the underlying mechanism is not very clear. Study found that melatonin could inhibit tau hyperphosphorylation
induced by inhibiting PI3K pathway (Deng et al. 2005) suggesting that melatonin maybe regulates the PI3K/Akt pathway.
Subsequent studies have also demonstrated that melatonin is involved in regulating PI3K/Akt/GSK3 pathway (Hoppe et al. 2010;
Park et al. 2011; Wang et al. 2012). We found in our study that the level of melatonin changed opposite to activity of GSK-3β,
suggesting that melatonin might act not only against free radicals, but also indirectly as an enzyme modulator (Matsubara et
al. 2003), which is also consistent with previous studies (Hoppe et al. 2010).
In summary, we have found in the present study that citalopram can prevent SI-induced overactivation of GSK-3β and thus improve
spatial memory impairment and tau hyperphosphorylation. And melatonin maybe involved in this process.
Acknowledgments

This work was supported in part by grants from the National Natural Science Foundation of China (30900447 and 91232707).

References

Asayama K, Yamadera H, Ito T, Suzuki H, Kudo Y, Endo S (2003) Double blind study of melatonin effects on the sleep-wake

rhythm, cognitive and non-cognitive functions in Alzheimer type dementia. J Nippon Med Sch 70:334–341CrossRefPubMed

Baudin A, Blot K, Verney C et al (2012) Maternal deprivation induces deficits in temporal memory and cognitive flexibility and

exaggerates synaptic plasticity in the rat medial prefrontal cortex. Neurobiol Learn Mem 98:207–214CrossRefPubMed

Bremner JD, Narayan M (1998) The effects of stress on memory and the hippocampus throughout the life cycle: implications for

childhood development and aging. Dev Psychopathol 10:871–885CrossRefPubMed

Brenes JC, Fornaguera J (2008) Effects of environmental enrichment and social isolation on sucrose consumption and preference:

associations with depressive-like behavior and ventral striatum dopamine. Neurosci Lett 436:278–282CrossRefPubMed

Briones A, Gagno S, Martisova E et al (2012) Stress-induced anhedonia is associated with an increase in Alzheimer’s disease-

related markers. Br J Pharmacol 165:897–907CrossRefPubMedCentralPubMed

Carvalho LA, Gorenstein C, Moreno R, Pariante C, Markus RP (2009) Effect of antidepressants on melatonin metabolite in

depressed patients. J Psychopharmacol 23:315–321CrossRefPubMed

Deng YQ, Xu GG, Duan P, Zhang Q, Wang JZ (2005) Effects of melatonin on wortmannin-induced tau hyperphosphorylation. Acta

Pharmacol Sin 26:519–526CrossRefPubMed

Drewes G, Ebneth A, Mandelkow EM (1998) MAPs, MARKs and microtubule dynamics. Trends Biochem Sci 23:307–

311CrossRefPubMed

Egashira N, Matsumoto Y, Mishima K et al (2006) Low dose citalopram reverses memory impairment and electroconvulsive shock-

induced immobilization. Pharmacol Biochem Behav 83:161–167CrossRefPubMed

Finkel SI, Mintzer JE, Dysken M, Krishnan KR, Burt T, McRae T (2004) A randomized, placebo-controlled study of the efficacy

and safety of sertraline in the treatment of the behavioral manifestations of Alzheimer’s disease in outpatients treated with

donepezil. Int J Geriatr Psychiatr 19:9–18CrossRef

Fone KC, Porkess MV (2008) Behavioural and neurochemical effects of post-weaning social isolation in rodents-relevance to

developmental neuropsychiatric disorders. Neurosci Biobehav Rev 32:1087–1102CrossRefPubMed

Gronli J, Bramham C, Murison R et al (2006) Chronic mild stress inhibits BDNF protein expression and CREB activation in the

dentate gyrus but not in the hippocampus proper. Pharmacol Biochem Behav 85:842–849CrossRefPubMed

Guillozet AL, Weintraub S, Mash DC, Mesulam MM (2003) Neurofibrillary tangles, amyloid, and memory in aging and mild

cognitive impairment. Arch Neurol 60:729–736CrossRefPubMed

Hartter S, Wang X, Weigmann H et al (2001) Differential effects of fluvoxamine and other antidepressants on the biotransformation

of melatonin. J Clin Psychopharmacol 21:167–174CrossRefPubMed

Hernandez F, Borrell J, Guaza C, Avila J, Lucas JJ (2002) Spatial learning deficit in transgenic mice that conditionally over-express

GSK-3beta in the brain but do not form tau filaments. J Neurochem 83:1529–1533CrossRefPubMed

Hol T, Van den Berg CL, Van Ree JM, Spruijt BM (1999) Isolation during the play period in infancy decreases adult social

interactions in rats. Behav Brain Res 100:91–97CrossRefPubMed

Hoppe JB, Frozza RL, Horn AP et al (2010) Amyloid-beta neurotoxicity in organotypic culture is attenuated by melatonin:

involvement of GSK-3beta, tau and neuroinflammation. J Pineal Res 48:230–238CrossRefPubMed

Hulshof HJ, Novati A, Sgoifo A, Luiten PG, den Boer JA, Meerlo P (2011) Maternal separation decreases adult hippocampal cell

proliferation and impairs cognitive performance but has little effect on stress sensitivity and anxiety in adult Wistar rats. Behav

Brain Res 216:552–560CrossRefPubMed

Lukkes JL, Mokin MV, Scholl JL, Forster GL (2009a) Adult rats exposed to early-life social isolation exhibit increased anxiety and

conditioned fear behavior, and altered hormonal stress responses. Horm Behav 55:248–256CrossRefPubMed

Lukkes JL, Summers CH, Scholl JL, Renner KJ, Forster GL (2009b) Early life social isolation alters corticotropin-releasing factor

responses in adult rats. Neuroscience 158:845–855CrossRefPubMedCentralPubMed

Lyons L, ElBeltagy M, Bennett G, Wigmore P (2012) Fluoxetine counteracts the cognitive and cellular effects of 5-fluorouracil in

the rat hippocampus by a mechanism of prevention rather than recovery. PLoS One 7:e30010CrossRefPubMedCentralPubMed
Marlatt MW, Potter MC, Bayer TA, van Praag H, Lucassen PJ (2013) Prolonged running, not fluoxetine treatment, increases

neurogenesis, but does not alter neuropathology, in the 3xTg mouse model of Alzheimer’s disease. Curr Top Behav Neurosci

15:313–340CrossRefPubMed

Mathews IZ, Wilton A, Styles A, McCormick CM (2008) Increased depressive behaviour in females and heightened corticosterone

release in males to swim stress after adolescent social stress in rats. Behav Brain Res 190:33–40CrossRefPubMed

Matsubara E, Shoji M, Murakami T, Kawarabayashi T, Abe K (2003) Alzheimer’s disease and melatonin. Int Congr Ser 1252:395–

398CrossRef

McCormick CM, Smith C, Mathews IZ (2008) Effects of chronic social stress in adolescence on anxiety and neuroendocrine

response to mild stress in male and female rats. Behav Brain Res 187:228–238CrossRefPubMed

McCormick CM, Nixon F, Thomas C, Lowie B, Dyck J (2010) Hippocampal cell proliferation and spatial memory performance

after social instability stress in adolescence in female rats. Behav Brain Res 208:23–29CrossRefPubMed

McEwen BS (2002) Sex, stress and the hippocampus: allostasis, allostatic load and the aging process. Neurobiol Aging 23:921–

939CrossRefPubMed

Mowla A, Mosavinasab M, Haghshenas H, Borhani Haghighi A (2007) Does serotonin augmentation have any effect on cognition

and activities of daily living in Alzheimer’s dementia? A double-blind, placebo-controlled clinical trial. J Clin Psychopharmacol

27:484–487CrossRefPubMed

Nelson RL, Guo Z, Halagappa VM et al (2007) Prophylactic treatment with paroxetine ameliorates behavioral deficits and retards

the development of amyloid and tau pathologies in 3xTgAD mice. Exp Neurol 205:166–176CrossRefPubMedCentralPubMed

Ownby RL, Crocco E, Acevedo A, John V, Loewenstein D (2006) Depression and risk for Alzheimer disease: systematic review,

meta-analysis, and metaregression analysis. Arch Gen Psychiatry 63:530–538CrossRefPubMedCentralPubMed

Park KH, Kang JW, Lee EM et al (2011) Melatonin promotes osteoblastic differentiation through the BMP/ERK/Wnt signaling

pathways. J Pineal Res 51:187–194CrossRefPubMed

Sang H, Lu Z, Li Y, Ru B, Wang W, Chen J (2001) Phosphorylation of tau by glycogen synthase kinase 3beta in intact mammalian

cells influences the stability of microtubules. Neurosci Lett 312:141–144CrossRefPubMed

Savaskan E, Olivieri G, Meier F et al (2002) Increased melatonin 1a-receptor immunoreactivity in the hippocampus of Alzheimer’s

disease patients. J Pineal Res 32:59–62CrossRefPubMed

Savaskan E, Ayoub MA, Ravid R et al (2005) Reduced hippocampal MT2 melatonin receptor expression in Alzheimer’s disease. J

Pineal Res 38:10–16CrossRefPubMed

Song L, Che W, Min-Wei W, Murakami Y, Matsumoto K (2006) Impairment of the spatial learning and memory induced by

learned helplessness and chronic mild stress. Pharmacol Biochem Behav 83:186–193CrossRefPubMed

Suri D, Veenit V, Sarkar A et al (2013) Early stress evokes age-dependent biphasic changes in hippocampal neurogenesis, BDNF

expression, and cognition. Biol Psychiatry 73:658–666CrossRefPubMedCentralPubMed

Tucker S, Ahl M, Bush A, Westaway D, Huang X, Rogers JT (2005) Pilot study of the reducing effect on amyloidosis in vivo by

three FDA pre-approved drugs via the Alzheimer’s APP 5′ untranslated region. Curr Alzheimer Res 2:249–254CrossRefPubMed

Uchida K, Okamoto N, Ohara K, Morita Y (1996) Daily rhythm of serum melatonin in patients with dementia of the degenerate

type. Brain Res 717:154–159CrossRefPubMed

von Bahr C, Ursing C, Yasui N, Tybring G, Bertilsson L, Rojdmark S (2000) Fluvoxamine but not citalopram increases serum

melatonin in healthy subjects—an indication that cytochrome P450 CYP1A2 and CYP2C19 hydroxylate melatonin. Eur J Clin

Pharmacol 56:123–127CrossRef

Wallace DL, Han MH, Graham DL et al (2009) CREB regulation of nucleus accumbens excitability mediates social isolation-

induced behavioral deficits. Nat Neurosci 12:200–209CrossRefPubMedCentralPubMed

Wang DL, Ling ZQ, Cao FY, Zhu LQ, Wang JZ (2004) Melatonin attenuates isoproterenol-induced protein kinase A overactivation

and Tau hyperphosphorylation in rat brain. J Pineal Res 37:11–16CrossRefPubMed

Wang J, Xiao X, Zhang Y et al (2012) Simultaneous modulation of COX-2, p300, Akt, and Apaf-1 signaling by melatonin to inhibit

proliferation and induce apoptosis in breast cancer cells. J Pineal Res 53:77–90CrossRefPubMed

Weintraub A, Singaravelu J, Bhatnagar S (2010) Enduring and sex-specific effects of adolescent social isolation in rats on adult

stress reactivity. Brain Res 1343:83–92CrossRefPubMed

Weiss IC, Pryce CR, Jongen-Relo AL, Nanz-Bahr NI, Feldon J (2004) Effect of social isolation on stress-related behavioural and

neuroendocrine state in the rat. Behav Brain Res 152:279–295CrossRefPubMed

Wilson RS, Barnes LL, Bennett DA et al (2005) Proneness to psychological distress and risk of Alzheimer disease in a biracial

community. Neurology 64:380–382CrossRefPubMed

Wongwitdecha N, Marsden CA (1996) Effects of social isolation rearing on learning in the Morris water maze. Brain Res 715:119–

124CrossRefPubMed

Yang X, Yang Y, Fu Z et al (2011) Melatonin ameliorates Alzheimer-like pathological changes and spatial memory retention

impairment induced by calyculin A. J Psychopharmacol 25:1118–1125CrossRefPubMed

Zhang LF, Shi L, Liu H et al (2012) Increased hippocampal tau phosphorylation and axonal mitochondrial transport in a mouse

model of chronic stress. Int J Neuropsychopharmacol 15:337–348CrossRefPubMed

Zhu LQ, Wang SH, Ling ZQ, Wang DL, Wang JZ (2004) Effect of inhibiting melatonin biosynthesis on spatial memory retention

and tau phosphorylation in rat. J Pineal Res 37:71–77CrossRefPubMed