Article

Cite This: Anal. Chem. 2018, 90, 1317−1324 pubs.acs.org/ac

Visualizing the Regulation of Hydroxyl Radical Level by Superoxide

Dismutase via a Specific Molecular Probe
Lingyu Zeng,† Tian Xia,§ Wei Hu,† Shiyu Chen,∥ Siyu Chi,† Yidi Lei,† and Zhihong Liu*,†
†
Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular
Sciences, Wuhan University, Wuhan 430072, China
§
College of Life Science, Wuhan University, Wuhan 430072, China
∥
Department of Chemistry, New York University, New York, New York 10003, United States
*
S Supporting Information

ABSTRACT: Hydroxyl radical (·OH), as the most delete-

rious reactive oxygen species, is believed to be the etiological
agent for many diseases and aging. An altered ·OH level has
been confirmed in certain types of superoxide dismutase
(SOD) mutation, but the regulation of ·OH by SOD in situ is
still controversial or unclear because of the lack of effective
tools to detect ·OH in the biological environment. Herein we
report the first two-photon excitable molecular probe (P2) for
·OH, which is able to track the subtle fluctuation of ·OH level
both in vitro and in vivo with high sensitivity and specificity.
The probe was successfully applied to visualize ·OH variations
in a variety of SOD1-involved biological processes, confirming
that the inhibited enzymatic activity and down-regulated
expression of SOD1 both lead to elevated intracellular ·OH
level. This is the first report to visually reveal the relationship between SOD1 and ·OH level with a molecular tool.

fluorescent probes for bioimaging can be constructed from

S uperoxide dismutase (SOD) plays a pivotal role in
balancing the concentration of reactive oxygen species
(ROS) as the first enzymatic defense against superoxide, which
acts as a sink for many other radicals generated intra-
cellularly.1,2 Among them, hydroxyl radicals (·OH) are
considered as the leading cause of oxidative stress damage,
which attacks virtually all types of biomacromolecules and
causes irreparable cellular damage.3 Previous studies have
reported that such a highly toxic species can be accumulated by
the mutation of Cu, Zn−SOD (SOD1).4 Although increasing
explorations have confirmed the coordination between SOD1
and ·OH, some important issues concerning the regulation of ·
OH by SOD1 still remain controversial or unclear.3,5−9 To
gain in-depth understanding on the relationship between the
enzymatic activity and ·OH level, more direct experimental
evidence is required.
It is widely accepted that ·OH detection in living systems is
highly challenging because of its short lifetime, small diffusion
distance, extremely low concentration, and the interference
from other ROS.10−13 Currently, the major method for ·OH
detection in a biosystem is electron paramagnetic resonance
(EPR) method with a spin trapper.8,14,15 Fluorescent probes,
by contrast, have advantages and potential prospect for
monitoring species in situ in the body, such as the relatively
inexpensive equipment and easy operation, high selectivity and
sensitivity, and feasible real-time imaging with good space
resolution by microscopy.16 Basically, the ·OH-specific
organic small molecules, nanomaterials, and metal complexes
(Table S1). Small-molecule probes, known for their favorable
biocompatibility, are mainly based on ·OH-induced hydrox-
ylation of aromatic ring,17−22 hydrogen atom abstraction,23−25
or adduction with a radical trap.10,26−28 Although some efforts
have been made to image ·OH in living cells under
physiological or pathological processes like inflamma-
tion,10,23−27,29 there is still plenty of room for improving the
performance of probes. (e.g., the problems of limited
selectivity, auto-oxidation, photobleaching, etc.13,30)
To circumvent the existing problems for in vivo ·OH
detection and help to elucidate the connection between SOD1
enzyme and intracellular ·OH levels, herein we present a
rationally designed ·OH-specific two-photon fluorescent probe
with high sensitivity and pronounced specificity. The reason to
incorporate a two-photon excitable fluorophore is to achieve
better time/space resolution by two-photon microscopy
(TPM),31 which is particularly favorable for species that are
difficult to investigate in vivo. With the assistance of this
molecular probe, we tracked ·OH levels in vitro and in vivo.
Furthermore, we realized the visualization of ·OH in some
SOD1-involved biological processes for the first time,
Received: October 12, 2017
Accepted: December 14, 2017
Published: December 14, 2017

© 2017 American Chemical Society 1317 DOI: 10.1021/acs.analchem.7b04191

Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
confirming that the inhibited enzyme activity and down-
regulated expression of SOD1 could contribute to escalated
intracellular ·OH level.
■ EXPERIMENTAL SECTION
Chemical Synthesis. Briefly, the probes P1−P4 were
synthesized by Pd-catalyzed C−N cross-coupling reactions.
For P1/P3 (R1 = Me), compound 1 was reacted with
secondary amine catalyzed by RuPhos and Pd(OAc)2 in
anhydrous t-BuOH using CsCO3 for basic condition. For P2/
P4 (R2 = Me), BrettPhos was used instead of RuPhos. Then
the nitro-group was reduced by N2H4·H2O and Pd/C (for P1/
P4) or the Boc-group was deprotected by trifluoroacetic acid
(for P2/P3). The characterization of 1H NMR, 13C NMR,
HRMS spectra, and detailed procedures for each probe are
available in Supporting Information (Figures S15−S34).
Synthesis of 1-(9,9-Dimethyl-7-((4-(methylamino)-
phenyl)amino)-9H-fluoren-2-yl)ethan-1-one (P2). Com-
pound 5 (150 mg, 0.33 mmol) was dissolved in anhydrous
DCM. Under an ice−water bath, 1 mL of trifluoroacetic acid
was added dropwise into the above mixture and reacted at
room temperature for 24 h. Then the reaction was quenched
by water, extracted with DCM, washed with brine, and dried
with anhydrous Na2SO4. The solution was concentrated and
then purified by silica gel column chromatography using PE/
EA (6/1, v/v) and gave a yellow solid. (68 mg, 58% yield) 1H
NMR (400 MHz, DMSO-d6) δ 8.01 (s, 1H), 7.93 (d, J = 17.3
Hz, 2H), 7.67 (dd, J = 20.4, 8.1 Hz, 2H), 7.03−6.91 (m, 3H),
6.79 (d, J = 10.4 Hz, 1H), 6.57 (s, 2H), 5.48 (s, 1H), 2.68 (d, J
= 3.9 Hz, 3H), 2.60 (s, 3H), 1.41 (s, 6H). 13C NMR (100
MHz, DMSO-d6) δ 197.70, 156.96, 152.79, 148.44, 146.47,
144.95, 134.17, 131.05, 128.81, 126.99, 123.59, 122.74, 122.49,
118.42, 113.12, 112.83, 107.60, 46.61, 30.63, 27.43, 27.19.
HRMS (DART): calcd for C24H25ON2 [M + H]+, 357.1961;
found, 357.1961.
General Procedure for In Vitro Imaging Experiment.
HeLa cells and RAW 264.7 macrophage cells were cultured in
Dulbecco’s modified Eagle’s medium (DMEM, Thermo
Scientific) supplemented with 1% penicillin/streptomycin
and 10% fetal bovine serum (FBS) and incubated in an
atmosphere of 5/95 (v/v) of CO2/air at 37 °C. Human
umbilical vein endothelial cells (HUEVCs) were cultured in
RPMI Medium 1640 basic (Gibco), with 1% penicillin/
streptomycin and 10% FBS at the same condition. Before
imaging, the cells were passed and plated into 35 mm glass-
bottomed confocal dish (NEST) and were allowed to grow to
the desired cell density.
TEMPOL, GSH, LPS (lot no. L2880), and PMA were
purchased from Sigma-Aldrich. ATN-244 (Bis(choline)-
tetrathiomolybdate) was gained from MedChem Express.
Interferon-gamma (IFN-γ) was obtained from GenScript (lot
no. Z02916). MitoTracker Red was purchased from Life
Technology.
Before introducing the reagents, the cells were washed once
by warm PBS and replenished by fresh medium containing
certain drugs. Unless otherwise noted, all the probe-loading
steps used 10 μM P2 (medium containing 0.2% DMF) for 30
min incubation under the same condition for cell culture.
Before imaging, the culture medium was removed and the cells
were washed twice by PBS.
The two-photon fluorescence microscopy images for living
cells were obtained by exciting the P2 with 740 nm excitation,
and emission was collected from 430−680 nm range. The
1318
Article
internal PMTs were used to collect the signals in an 8 bit
unsigned 1024 × 1024 pixels at 1.58 μs/pixel scan speed. Cells
were observed under EC Plan-Neofluar 100 × /1.3 oil
objective.
The mean fluorescence density was measured by Image-Pro
Plus (v. 6.0) and calculated via the equation (mean density =
IODsum/areasum), where IOD and area were integral optical
density and area of fluorescent region.
E. coli Infection. E. coli was grown in antibiotic-free Luria
broth (LB) medium at 37 °C for 18 h. Then the bacteria
suspension was divided into several 1.5 mL Eppendorf tubes,
and the number of E. coli was determined by O.D.600 nm (ca. 2
× 109 E. coli/tube). Next the bacteria were harvested by
centrifugation and resuspended in 100 μL of sterile PBS by
rigorous vortex and pipetting, following heat treatment by 90
°C water bath for 1 h. When the RAW 264.7 cells had grown
to 2 × 105 cells/well in the confocal dish, the culture medium
was replaced by 1 mL of fresh medium (DMEM, 1%
penicillin/streptomycin, 10% FBS) containing 1 μL of E. coli
suspension (100 moi as final). After certain time of infection,
the cells were washed twice with PBS and then labeled with P2.
SOD1-Overexpressing Cells. The SOD1 mammalian
expression plasmid was prepared from cDNA clone by
standard molecular biology techniques. HeLa cells were
divided 24 h before experiment to generate 50% confluence
at the time of transfection. The concentration of empty vector
and plasmid were determined by a microplate reader and then
were diluted to 0.2 mg/mL stocking solution. Then 0.4 μg
vector and the constructed plasmids were separately mixed
with 50 μL of Opti-MEM (Gibco) and 3 μL of Lipofectamine
2000 (Invitrogen), resulting in a total volume of 100 μL. The
cell medium was replaced by 500 μL of Opti-MEM, and then
the as-prepared mixture was added dropwise. The culture
medium was replaced with fresh medium (DMEM, 1%
penicillin/streptomycin, 10% FBS) after 6 h. After 24 h, the
two groups of cells were treated with 2 μg/mL PMA for 2 h.
Then the four groups were loaded with P2. After bioimaging,
the RNA in above the samples was extracted by Trizol
(Takara), and then the SOD1 mRNA level was determined by
qRT-PCR.
RNAi Cells. Chemically synthesized siRNA oligo was
designed with minor reversion as literature reported
sequence,32 and manufactured by GenePharma. The siRNA
sequences were as follows, and the scramble control was a
universal negative sequence.
Sense sequence (5′-3′): GGATGAAGAGAGGCATGTTTT
Antisense sequence (5′-3′): AACATGCCTCTCTT-
CATCCTT
Two groups of HUEVCs were divided 24 h prior to
transfection to gain 50% confluence, and then the culture
medium was replaced by 500 μL of Opti-MEM before
experiment. The siRNA oligo (1 OD) was dissolved in 125
μL of DEPC water, and then the cells were transfected by
adding the mixture of 20 μL of siRNA solution, 200 μL of
Opti-MEM, and 16 μL of Lipofectamine 2000. Then the
culture medium was replaced by fresh medium (DMEM, 1%
penicillin/streptomycin, 10% FBS) after 6 h. After 36 h of
transfection, the two groups of cells were loaded with P2. After
bioimaging, the RNA in the above samples was extracted by
Trizol (Takara), and then the SOD1 mRNA level was
determined by qRT-PCR.
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
■ RESULTS AND DISCUSSION
Design and Screening of ·OH-Specific Two-Photon
Fluorescent Probe. To design a reaction-based fluorescent
probe for ·OH, utilizing the susceptibility of the recognition
domain to oxidation is a common strategy. The pioneering
work of Nagano on ·OH probe utilized the oxidative O-
dearylation mechanism,33 in which the aryloxy group was
removed by an ipso-substitution reaction, while other highly
reactive species can cause a response as well (Scheme 1a).13
Scheme 1. (a) Reported Sensing Mechanism of hROS Probe
Based on the Oxidative O-Dearylation Mechanism.33 (b)
Our Design of the Two-Photon Fluorescent Probes for
Specific Detection of ·OH. (c) Proposed Fluorescent
Products after ·OH-Probe Reaction
We thus thought to change the O-linkage to N-linkage, using
an amine-derived fluorophore with electron-rich aromatics as
the recognition group. Moreover, we infer that the released
fluorophore after the probe-target reaction, which has a typical
electronic structure, will possess good two-photon fluorescence
properties.31 Bearing these considerations in mind, we
designed a series of probes P1−P4 (Scheme 1b), using the
p-phenylenediamine derivative as the recognition group and
fluorene moiety as the fluorophore. In order to modulate the
reactivity toward ·OH, we also fabricated different N-methyl
substitution on R1 and R2. The four probes (P1−P4) were
synthesized via palladium-catalyzed C−N cross-coupling
reactions (Scheme S1).
Evaluating the Sensitivity and Specificity of Probe
P1−P4 to ·OH. With the probes P1−P4 in hand, we first
tested their reactivity toward ·OH (generated through the
Fenton reaction between FeSO4 and H2O234−36) in aqueous
solutions. Before the reaction with target, all the probes
exhibited extremely low fluorescence quantum yield in aqueous
buffer (Φ< 0.01, Table S2). After varying amounts of Fenton
reagents (FeSO4/H2O2 = 1/6, molar ratio, regarding [Fe2+]=
[·OH]37) were introduced, enhanced fluorescence was
observed for all probes (Figure 1a). The products displayed
different fluorescence (orange for P1 and P3, yellow for P2
and P4, Figure 1b), implying that two different kinds of
fluorescent substances were generated because of different
substitution on R1 site. To clarify the reactions, we synthesized
the two proposed products (10 and 11 in Scheme 1c) and
compared their fluorescence spectra with the reaction
products. As shown in Figure 1b, the emission spectra of 10
and 11 perfectly match that of the ·OH-probe reaction
products. More evidence was shown in LC-MS analysis by
comparing the retention time of the compounds (Figure S1),
1319
Article
Figure 1. (a) Fluorescence enhancement of 10 μM P1−P4 in the
presence of increasing amount (0.1−10 equiv) of ·OH. (b)
Fluorescence spectra of the ·OH-probe reaction products (with 1
equiv of ·OH), 10, and 11. Inset: the photos of reaction systems
under 365 nm UV lamp. -: probe alone; + : the reaction system of 1
equiv of ·OH and probe. Fluorescence intensity (F) for P1/P3 was
gained from the emission peak at 560 nm under 360 nm excitation,
and F of P2/P4 were obtained from emission at 550 nm under 350
nm excitation.
which further verifies the proposed mechanism depicted in
Scheme S2.
We next examined the specificity of probes P1−P4, judging
by their response toward hypochlorous acid (HClO) because it
often has strong interference to the detection of ·OH. As
shown in Figure S2, P2 and P4 were inert to HClO but P1 and
P3 showed obvious response (∼100-fold fluorescence
enhancement). Then we selected P2 and P3 and traced their
reactions with HClO by LC-MS. It was found that P3 could
react with HClO to produce the fluorescent compound 11
(Figure S1h), while P2 did not react (Figure S1d). We
attributed the HClO-responsibility of P1/P3 to N-chlorination
onto the nitrogen atom linked with R1 (proposed mechanism
shown in Scheme S3). Taking the sensitivity and specificity
into consideration, it is obvious that P2 possesses the best
comprehensive properties. We further checked the pH
dependence of P2 in the range of pH 4.0−8.0. The probe
had very low fluorescence in the whole pH range studied, while
its reaction product with ·OH, compound 10, displayed strong
and stable fluorescence in the physiological pH range (Figure
S3). Finally, P2 was chosen as the ·OH-specific probe for
subsequent studies.
Sensing Performance of P2 toward ·OH. In aqueous
buffer (0.1 M phosphate buffer, pH 7.4, containing 5% DMF),
the fluorescence of P2 was nearly undetectable (Φ = 0.001).
Upon the reaction with varying amounts of ·OH, a
concentration-dependent fluorescence enhancement at 550
nm was detected under excitation at 350 nm (Figure 2a). As
shown in Figure 2b, the titration curve of P2 by ·OH shows a
fast response at low concentrations and then reaches a plateau
at 0.5 equiv of ·OH. The maximal fluorescence enhancement
(F/F0) was up to ca. 200-fold, which stands among the highest
levels of signal-to-background ratio among the reported
fluorescent probes for ·OH. The detection limit was calculated
as 0.04 μM according to the 3sb/m criterion, where m is the
slope for the range of linearity and sb is the standard deviation
of the blank (n = 11). This result shows that probe P2 has
good sensitivity to ·OH, compared with most of the small-
molecule-based ·OH probes. (Table S1) We also tested the
time-dependent response of P2 toward 1 equiv of ·OH, which
shows that the maximal fluorescence enhancement can be
achieved within 20 min (Figure S4).
Next, we evaluated the possibility of using P2 to detect ·OH
under two-photon excitation mode. First, we determined the
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
Figure 2. Response of P2 to ·OH under one-photon excitation mode.
(a) Fluorescence spectra and (b) titration curve of 10 μM P2 in the
presence of increasing amount of ·OH (0, 0.005, 0.01, 0.02, 0.04, 0.06,
0.08, 0.1, 0.15, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 equiv; inset:
response in the range of 0.005−0.1 equiv). Fluorescence intensity (F)
was gained from the emission peak at 550 nm under 350 nm
excitation.
active absorption cross section (the product of absorption
cross section and fluorescence quantum yield, δΦ, which
determines the brightness of two-photon fluorophores) of both
P2 and 10. The maximal δΦ value of 10 in aqueous buffer (0.1
M phosphate buffer, pH 7.4, containing 5% DMF) was
detected to be 83 GM at 740 nm, whereas the δΦ value of P2
was nearly undetectable (Figure 3a). Such a significant
Figure 3. (a) Two-photon active cross section (δΦ) of P2 and 10
under 710−850 nm excitation. (b) Two-photon titration curve of 10
μM P2 by increasing amount of ·OH (0, 0.005, 0.01, 0.02, 0.04, 0.06,
0.08, 0.1, 0.15, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 equiv; inset:
response in the range of 0.005−0.1 equiv). Fluorescence intensity (F)
was gained from the emission peak at 550 nm under 740 nm
excitation.
difference of δΦ would guarantee a sufficient contrast in
bioimaging, presenting an obvious change of brightness before
and after the reaction of probe with ·OH. In a fluorescence
titration experiment under two-photon excitation (740 nm),
the [·OH]-dependent turn-on fluorescence signals were also
obtained (Figure 3b). These results suggest that P2 can be an
effective two-photon excitable fluorescent probe for ·OH
detection.
Subsequently, we investigated the selectivity of P2 over a
variety of potential interfering substances, including common
reactive species in biological system and some agents expected
to react.13,38 We tested the following categories of interfer-
ences: reductive reagents (e−: Fe2+, ascorbic acid), reactive
carbonyl species (malondialdehyde, formaldehyde, acetalde-
hyde, glutaraldehyde, acetylactone), reactive sulfur species
(glutathione, cysteine, homocysteine, Na2S4, Na2S), and highly
reactive oxygen-containing species (NO, NO2−, NO3−,
ONOO−, H2O2, tBuOOH, 1O2, O2·‑, ROO·, tBuO·, ClO−, ·
OH). As Figure 4 shows, all these potential interfering species
(with 1, 5, and 10 equiv) caused negligible change of
fluorescence of P2, but ·OH with 1 equiv can promote nearly
1320
Article
Figure 4. Responses of 10 μM P2 to 1, 5, 10 equiv of interfering
species (shown as dark gray, light gray, and white bar, respectively)
and 1 equiv of ·OH (red bar). (a: P2 only; b: Fe2+; c: ascorbic acid; d:
malondialdehyde; e: formaldehyde; f: acetaldehyde; g: glutaraldehyde;
h: acetylactone; i: glutathione; j: cysteine; k: homocysteine; l: Na2S4;
m: Na2S; n: NO; o: NO2−; p: NO3−; q: ONOO−; r: H2O2; s:
tBuOOH; t: 1O2; u: O2·‑; v: ROO·; w: tBuO·; x: ClO−; y: ·OH)
Fluorescence intensity (F) was gained from the emission peak at 550
nm under 350 nm excitation.
200-fold fluorescence enhancement. These results have
indicated the pronounced selectivity of P2 for ·OH detection,
which lays a solid foundation of using P2 to specifically
monitor ·OH in complicated biological environments.
Two-photon Fluorescence Imaging of Exogenous
and Endogenous ·OH in Biological Systems. Before
using P2 in bioimaging, we checked its cytotoxicity by
recording the survival rate of HeLa cells after 24 h incubation
with P2 using the tetrazolium-based colorimetric assay (MTT
assay), which demonstrated a low cytotoxicity of the probe
(Figure S5). As the first step of evaluating the sensing ability of
P2 in living cells, we introduced exogenous ·OH via in situ
Fenton reaction, which mimics the process in mitochondria to
generate ·OH flux under oxidative stress.39 As shown in Figure
5, upon the addition of catalyst Fe2+, the intracellular
fluorescence intensity was immediately promoted and then
increased quickly. Since the foregoing experiments have
precluded the response of P2 to H2O2 or Fe2+ alone, this
remarkable fluorescence enhancement indicates a sensitive
response of P2 toward ·OH generated in situ. Meanwhile, we
noticed a faint background (Figure 5, P2 only). To figure out
the origin of this weak fluorescence, we pretreated two groups
of HeLa cells with ·OH scavengers, 2,2,6,6-tetramethylpiper-
idine-N-oxyl (TEMPOL) and glutathione (GSH). (The ·OH-
depleting abilities were verified in solution assay, as shown in
Figure S6.) Compared with the control group, the fluorescence
of scavenger-treated groups was obviously weakened (Figure
S7), and a similar phenomenon was also observed in RAW
264.7 cells (Figure S8). These results demonstrate that P2 is
sensitive enough to illuminate basal-level ·OH in living cells.
Next, we proceeded to elucidate the intracellular location of
the fluorescence. Given the close relationship between ROS
and mitochondria, we costained the HeLa cell with
MitoTracker Red and P2. As shown in Figure S9, a broad
fluorescence overlap emitted from mitochondria and basal-
level ·OH can be observed. The calculation for Pearson’s
correlation coefficient (Rr) and overlap coefficient (R) were ca.
0.63 and 0.66, respectively, indicating a certain correlation40
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
Figure 5. Change of intracellular two-photon fluorescence with
adding exogenous Fenton reagent. The HeLa cells were preloaded
with 10 μM P2 for 30 min, followed by sequential treatment with 1
mM H2O2 and 1 mM FeSO4. The images of both two-photon
fluorescence and bright field channel were collected with 2 min
intervals. Scale bar: 10 μm.
between mitochondria and ·OH generation in living cancer
cells. Moreover, we also tested the photostability of fluorescent
product by continuously illuminating compound 10-labeled
cells for 30 min under the above imaging conditions.
Negligible fluorescence change was observed (Figure S10),
which guarantees the long-time observation of ·OH under two-
photon excitation.
Having proven the ability of P2 to recognize ·OH in living
cells, we proceeded to explore its capability of capturing ·OH
generated endogenously in vitro. We thus incubated P2-loaded
RAW 264.7 cells with heat-killed E. coli, serving as a strong
inflammatory stimulus to yield excess ROS including ·OH.41 A
distinct time-dependent intracellular fluorescence enhance-
ment (up to 4-fold) with obvious morphological changes can
be seen, showing the accumulating ·OH generation during the
inflammation process (Figure 6). We then treated RAW 264.7
cells with another moderate immune stimulus, the combina-
tion of lipopolysaccharide (LPS) and interferon-gamma (IFN-
γ), and a 1.6-fold intracellular fluorescence enhancement was
seen (Figure S11). To verify the universality of these findings,
we also tested on HeLa cells using phorbol 12-myristate 13-
acetate (PMA) as stimulus. Again, we observed a time-
dependent fluorescence elevation (maximal 1.7-fold) after 1 h
stimulation (Figure S12). In order to further highlight the
applicability of the probe in bioimaging in vivo, we tried using
P2 to illuminate ·OH in a living body. As known, the detection
of ·OH in vivo is a highly challenging task, and very few
luminescent probes have been reported for this subject.42 We
constructed the swelling ear model on living BALB/cA-nu
1321
Article
Figure 6. Monitoring the ·OH generation within RAW 264.7 cells
surviving the E. coli infection (100 moi) after 0, 3, 6, 18 h. Scale bar:
10 μm. Fluorescence intensity (F) was displayed as yellow bars.
mouse by topical application of PMA, which is a widely used
acute inflammatory model. As shown in Figure S13, much
stronger accumulated fluorescence was detected from the
PMA-treated ear compared with the contralateral control
(more clear profile of endogenous ·OH generation at different
depth are shown in Figure S14 and S15). To summarize, all the
above results have collectively demonstrated that P2 is able to
trace the fluctuation of ·OH endogenously generated upon
different kinds of stimuli both in vitro and in vivo.
Probing the ·OH Alteration Upon Regulation of SOD1
at Activity and Expression Level. The success of visualizing
·OH by P2 in biological environments inspired us to explore
the relationship between the variation of ·OH level and SOD
status. Biological studies have suggested that both the activity
and expression level of SOD may contribute to variation of
ROS level.1,43,44 At first, we tried to modulate the activity of
SOD and determine if P2 can detect the possible change of
intracellular ·OH level. We utilized ATN-244 (choline
tetrathiomolybdate), a preclinical antitumor drug that targets
onto the copper ion and inhibits copper/zinc-dependent
enzyme including SOD1,45,46 as the SOD1 activity inhibitor.
As shown in Figure 7, the intracellular fluorescence increased
by 2.3-fold after 2 h treatment with 100 μM inhibitor and
showed a ca. 3.2-fold enhancement after 18 h treatment. This
result indicates a higher level of ·OH production in the cells
with lowered SOD1 activity, as the catalytic role of copper ion
was blocked by ATN-244. As further support, when the cells
were treated with a lower concentration of ATN-244 (10 μM),
a relatively weaker but also time-dependent fluorescence
enhancement was also observed (Figure S16).
Next, we moved on to manipulate the SOD1 mRNA, trying
to illustrate the relationship between SOD1 gene expression
level and intracellular ·OH content. To this end, we
constructed the SOD1 overexpressing cells by transfecting
the recombinant plasmid, which contains the fragment of
SOD1 gene, into two groups of HeLa cells (entries 2 and 4).
As controls, two more groups were transfected with empty
vector (entries 1 and 3). After 24 h transfection, two groups
(entries 3 and 4) were stimulated with PMA prior to P2
loading. We can see the SOD1 overexpressed cells (entry 2)
exhibited lower fluorescence than the control group (entry 1),
which suggests a decreased basal level of ·OH resulting from
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
Figure 7. Illumination of the ·OH release along the deactivation of
SOD1 by enzyme inhibitor ATN-244. The RAW 264.7 cells were
treated by 100 μM ATN-244 for 0, 2, 6, 18 h, and then incubated with
10 μM P2 for 30 min. Scale bar: 10 μm. Fluorescence intensity (F)
was displayed as yellow bars.
higher expression level of SOD1 (Figure 8). In the groups
treated with empty vector (entries 1 and 3), an obvious
Figure 8. Visualization of the ·OH content in PMA-treated HeLa cells
under different SOD1 gene expression level. The cells in entries 2 and
4 were transfected with SOD1 gene plasmids, and empty vectors were
used for entries 1 and 3 as control. Cells in entries 3 and 4 were
further treated with 2 μg/mL PMA for 2 h. All the groups were finally
incubated with 10 μM P2 for 30 min before imaging. Scale bar: 10
μm. Fluorescence intensity (F) was displayed as yellow bars. The
mRNA level of SOD1 was determined by qRT-PCR, shown as the
relative expression in gray bars.
fluorescence enhancement (ca. 1.7-fold) can be observed in
the PMA-treated cells, which is consistent with the above result
in HeLa cells (Figure S10). However, for the SOD1-
overexpressing cells, the group with PMA stimulation (entry
4) shows only a slightly higher fluorescence than that without
stimulation (entry 2), while it was still weaker than normal
cells (entry 1) producing basal-level ·OH. This means the
overexpressed SOD1 successfully consumes the O2·‑, boosted
1322
Article
by PMA stimulation, thus decreasing ·OH level by the Fenton/
Haber−Weiss mechanism. To further reveal the relationship
between intracellular ·OH and SOD1 expression, we harvested
the above four groups of cells and performed quantitative real
time polymerase chain reaction (qRT-PCR) to determine the
SOD1 mRNA level. As shown with the gray bar graph in
Figure 8, significantly enhanced expression levels of SOD1
gene were determined in the two groups transfected with
recombinant plasmid (entry 2 and 4), in accordance with their
reduced fluorescence intensities. Interestingly, we found a
slightly elevated mRNA expression of SOD1 in HeLa cells
stimulated with PMA (entry 3), which is a recurring result of
previous literature.47 These results confirmed that the
intracellular ·OH content has a close correlation with the
expression level of SOD1, and our probe P2 displayed its
capability to light up the subtle ·OH fluctuation in such a
regulation process.
Finally, we tried applying our probe in a ·OH-participating
pathological process involving SOD1 mutation. As a
preliminary attempt in this regard, we managed to knockdown
the SOD1 gene in human umbilical vein endothelial cells
(HUVECs) by introducing short interfering RNA (siRNA).
Like some of the mutation of SOD1 gene in ALS, such a silent
gene will probably deprive the normal radical-clearance
function of SOD1 and thus result in an elevated ·OH level.
Compared with the control, the cells transfected with siRNA
exhibited moderate increase of intracellular fluorescence after
36 h transfection, and the qRT-PCR result indicated that ca.
55% gene was successfully suppressed (Figure 9). Such results
Figure 9. Images of HUEVC cells separately transfected with
scrambled RNA duplex (control) and SOD1 siRNA (SOD1
knockdown), and finally incubated with 10 μM P2 for 30 min.
Scale bar: 10 μm. Fluorescence intensity (F) was displayed as yellow
bars. The mRNA level of SOD1 was determined by qRT-PCR, shown
as the relative expression in gray bars.
convinced us that the down-regulation of SOD1 gene
contributes to the elevated endogenous ·OH generation. It
also confirms again that the probe P2 could be a useful tool for
uncovering some unsolved puzzles in ·OH and SOD related
events.
■
CONCLUSIONS
In summary, we have developed a two-photon excitable
molecular probe for specific detection of ·OH. Taking
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry
advantage of the N-dearylation reaction mechanism, the probe
P2 shows a highly sensitive response (∼200-fold fluorescence
enhancement to 1 equiv of ·OH) and pronounced selectivity
over a series of biological reactive species. Equipped with the
two-photon fluorophore (with 83 GM active cross-section), P2
is competent in detecting ·OH both in vitro and in vivo. P2
enables the visualization of subtle variation of ·OH in various
SOD-modulated biological events. Our results show that
inhibited enzymatic activity and down-regulated expression of
SOD1 both lead to elevated generation of intracellular ·OH.
This work is the first report to reveal the regulation of
intracellular ·OH level by SOD enzyme with a visuable
molecular tool. The favorable performance of P2 in bioimaging
also suggests that the probe (and further improved analogues)
can be useful tool for elucidating the functions and roles of ·
OH in future studies.
■
*
ASSOCIATED CONTENT
S Supporting Information
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.anal-
chem.7b04191.
Organic synthesis and characterization, spectroscopic
measurements, cytotoxicity assay, cell imaging, mouse
imaging, and additional figures and tables (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail: zhhliu@whu.edu.cn.
ORCID
Zhihong Liu: 0000-0003-1500-9342
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
The authors acknowledge the financial support from the
National Natural Science Foundation of China (nos.
21625503, 21535005), and the support of China Scholarship
Council. We also thank Fang Zhou of the Institute of
Hydrobiology, Chinese Academy of Sciences, for the assistance
of confocal microscopy.
■
REFERENCES
(1) Miao, L.; St. Clair, D. K. Free Radical Biol. Med. 2009, 47, 344−
356.
(2) Hu, J. J.; Wong, N.; Ye, S.; Chen, X.; Lu, M.; Zhao, A. Q.; Guo,
Y.; Ma, A. C.; Leung, A. Y.; Shen, J.; Yang, D. J. Am. Chem. Soc. 2015,
137, 6837−6843.
(3) Sayre, L. M.; Perry, G.; Smith, M. A. Chem. Res. Toxicol. 2008,
21, 172−188.
(4) Hayashi, Y.; Homma, K.; Ichijo, H. Adv. Biol. Regul 2016, 60,
95−104.
(5) Liu, D.; Wen, J.; Liu, J.; Li, L. FASEB J. 1999, 13, 2318−2328.
(6) Sankarapandi, S.; Zweier, J. L. J. Biol. Chem. 1999, 274, 34576−
34583.
(7) Raha, S.; Robinson, B. H. Trends Biochem. Sci. 2000, 25, 502−
508.
(8) Bruijn, L. I.; Miller, T. M.; Cleveland, D. W. Annu. Rev. Neurosci.
2004, 27, 723−749.
(9) Mondola, P.; Damiano, S.; Sasso, A.; Santillo, M. Front. Physiol.
2016, 7, 594−601.
(10) Li, P.; Xie, T.; Duan, X.; Yu, F.; Wang, X.; Tang, B. Chem. - Eur.
J. 2010, 16, 1834−1840.
1323
Article
(11) Fulford, J.; Nikjoo, H.; Goodhead, D. T.; O’Neill, P. Int. J.
Radiat. Biol. 2001, 77, 1053−1066.
(12) William, H. G.; Kang, J. J. Am. Water Works Assoc. 1988, 80,
57−63.
(13) You, Y.; Nam, W. Chem. Sci. 2014, 5, 4123−4135.
(14) Popovic-Bijelic, A.; Mojovic, M.; Stamenkovic, S.; Jovanovic,
M.; Selakovic, V.; Andjus, P.; Bacic, G. Free Radical Biol. Med. 2016,
96, 313−322.
(15) Obata, T. Toxicol. Lett. 2002, 132, 83−93.
(16) Gomes, A.; Fernandes, E.; Lima, J. L. J. Biochem. Biophys.
Methods 2005, 65, 45−80.
(17) Soh, N.; Makihara, K.; Ariyoshi, T.; Seto, D.; Maki, T.;
Nakajima, H.; Nakano, K.; Imato, T. Anal. Sci. 2008, 24, 293−296.
(18) Page, S. E.; Wilke, K. T.; Pierre, V. C. Chem. Commun. 2010,
46, 2423−2425.
(19) Cui, G.; Ye, Z.; Chen, J.; Wang, G.; Yuan, J. Talanta 2011, 84,
971−976.
(20) Ganea, G. M.; Kolic, P. E.; El-Zahab, B.; Warner, I. M. Anal.
Chem. 2011, 83, 2576−2581.
(21) Perry, C. C.; Tang, V. J.; Konigsfeld, K. M.; Aguilera, J. A.;
Milligan, J. R. J. Phys. Chem. B 2011, 115, 9889−9897.
(22) Zhuang, M.; Ding, C.; Zhu, A.; Tian, Y. Anal. Chem. 2014, 86,
1829−1836.
(23) Yuan, L.; Lin, W.; Song, J. Chem. Commun. 2010, 46, 7930−
7932.
(24) Kim, M.; Ko, S. K.; Kim, H.; Shin, I.; Tae, J. Chem. Commun.
2013, 49, 7959−7961.
(25) Asano, M.; Doi, M.; Baba, K.; Taniguchi, M.; Shibano, M.;
Tanaka, S.; Sakaguchi, M.; Takaoka, M.; Hirata, M.; Yanagihara, R.;
Nakahara, R.; Hayashi, Y.; Yamaguchi, T.; Matsumura, H.; Fujita, Y. J.
Biosci. Bioeng. 2014, 118, 98−100.
(26) Yapici, N.; Jockusch, S.; Moscatelli, A.; Mandalapu, S. R.;
Itagaki, Y.; Bates, D. K.; Wiseman, S.; Gibson, K. M.; Turro, N. J.; Bi,
L. Org. Lett. 2012, 14, 50−53.
(27) Cao, L.; Wu, Q.; Li, Q.; Shao, S.; Guo, Y. J. Fluoresc. 2014, 24,
313−318.
(28) Zhou, W.; Cao, Y.; Sui, D.; Lu, C. Angew. Chem., Int. Ed. 2016,
55, 4236−4241.
(29) Meng, L.; Wu, Y.; Yi, T. Chem. Commun. 2014, 50, 4843.
(30) Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M. T. D.; Mazur,
M.; Telser, J. Int. J. Biochem. Cell Biol. 2007, 39, 44.
(31) Kim, H. M.; Cho, B. R. Chem. Rev. 2015, 115, 5014−5055.
(32) Lowndes, S. A.; Sheldon, H. V.; Cai, S.; Taylor, J. M.; Harris, A.
L. Microvasc. Res. 2009, 77, 314−326.
(33) Setsukinai, K.; Urano, Y.; Kakinuma, K.; Majima, H. J.; Nagano,
T. J. Biol. Chem. 2003, 278, 3170−3175.
(34) Minero, C.; Lucchiari, M.; Maurino, V.; Vione, D. RSC Adv.
2013, 3, 26443−26450.
(35) Vermilyea, A. W.; Voelker, B. M. Environ. Sci. Technol. 2009,
43, 6927−6933.
(36) Kang, Y. W.; Hwang, K. Water Res. 2000, 34, 2786−2790.
(37) Halliwell, B.; Gutteridge, J. M. C. Arch. Biochem. Biophys. 1986,
246, 501−514.
(38) Wardman, P. Free Radical Biol. Med. 2007, 43, 995−1022.
(39) Thomas, C.; Mackey, M. M.; Diaz, A. A.; Cox, D. P. Redox Rep.
2009, 14, 102−108.
(40) Zinchuk, V.; Zinchuk, O. Curr. Protoc. Cell. Biol. 2008, 4.19.1−
4.19.6.
(41) Streit, W. J.; Kincaid-Colton, C. A. Sci. Am. 1995, 273, 54−61.
(42) Li, Z.; Liang, T.; Lv, S.; Zhuang, Q.; Liu, Z. J. Am. Chem. Soc.
2015, 137, 11179−11185.
(43) Winterbourn, C. C. Toxicol. Lett. 1995, 82, 969−974.
(44) Jomova, K.; Valko, M. Toxicology 2011, 283, 65−87.
(45) Lin, J.; Zahurak, M.; Beer, T. M.; Ryan, C. J.; Wilding, G.;
Mathew, P.; Morris, M.; Callahan, J. A.; Gordon, G.; Reich, S. D.;
Carducci, M. A.; Antonarakis, E. S. Urol. Oncol.: Semin. Orig. Invest
2013, 31, 581−588.
DOI: 10.1021/acs.analchem.7b04191
Anal. Chem. 2018, 90, 1317−1324
Analytical Chemistry Article

(46) Lee, K.; Briehl, M. M.; Mazar, A. P.; Batinic-Haberle, I.;

Reboucas, J. S.; Glinsmann-Gibson, B.; Rimsza, L. M.; Tome, M. E.
Free Radical Biol. Med. 2013, 60, 157−167.
(47) Minc, E.; de Coppet, P.; Masson, P.; Thiery, L.; Dutertre, S.;
Amor-Gueret, M.; Jaulin, C. J. Biol. Chem. 1999, 274, 503−509.

1324 DOI: 10.1021/acs.analchem.7b04191

Anal. Chem. 2018, 90, 1317−1324