Molecular Microbiology (2014) 91(1), 39–56 ■ doi:10.1111/mmi.

12440
First published online 15 November 2013

Replication of the Escherichia coli chromosome in

RNase HI-deficient cells: multiple initiation regions
and fork dynamics

Nkabuije Z. Maduike,1 Ashley K. Tehranchi,2† Introduction

Jue D. Wang2 and Kenneth N. Kreuzer1*
1
Department of Biochemistry, Duke University Medical The normal cycle of DNA replication in Escherichia coli is
Center, Durham, North Carolina, USA. a highly coordinated process that begins with the DnaA-
2
Department of Bacteriology, University of Wisconsin mediated opening of the DNA duplex at the chromosomal
Madison, Madison, Wisconsin, USA. origin site oriC (for a review, see Mott and Berger, 2007).
Following the assembly of replication machinery at the
site, replication proceeds bidirectionally around the circu-
Summary lar chromosome until the two replication forks meet in the
terminus region, generally within the fork trap between
DNA replication in Escherichia coli is normally initi-
TerA and TerC (Duggin and Bell, 2009).
ated at a single origin, oriC, dependent on initiation
As the key bacterial initiation protein, DnaA is generally
protein DnaA. However, replication can be initiated
essential for cell viability. However, E. coli cells can utilize
elsewhere on the chromosome at multiple ectopic oriK
an alternative mode of DNA replication, constitutive stable
sites. Genetic evidence indicates that initiation from
DNA replication (cSDR), that is independent of DnaA or
oriK depends on RNA-DNA hybrids (R-loops), which
concomitant protein synthesis (Kogoma, 1997). cSDR can
are normally removed by enzymes such as RNase HI to
drive chromosomal DNA replication in knockout mutants of
prevent oriK from misfiring during normal growth.
the rnhA and recG genes, which encode RNase HI and
Initiation from oriK sites occurs in RNase HI-deficient
RecG respectively (Ogawa et al., 1984; Hong et al., 1995).
mutants, and possibly in wild-type cells under certain
These two proteins are involved in the removal of RNA
unusual conditions. Despite previous work, the loca-
from R-loops (RNA-DNA hybrids in otherwise duplex DNA)
tions of oriK and their impact on genome stability
that form on the chromosome. While cSDR is normally
remain unclear. We combined 2D gel electrophoresis
repressed under physiological conditions, it may be acti-
and whole genome approaches to map genome-wide
vated and play an important role even in wild-type cells
oriK locations. The DNA copy number profiles of
under unusual conditions such as entry into stationary
various RNase HI-deficient strains contained multiple
phase or replication after DNA damage (Hong et al., 1996;
peaks, often in consistent locations, identifying candi-
Camps and Loeb, 2005; also see below).
date oriK sites. Removal of RNase HI protein also leads
Based on these and other observations, the late Tokio
to global alterations of replication fork migration
Kogoma and colleagues proposed that replication initiation
patterns, often opposite to normal replication direc-
via cSDR involves specific chromosomal sites called oriK,
tions, and presumably eukaryote-like replication fork
where R-loops form by invasion of duplex DNA with a
merging. Our results have implications for genome
homologous RNA transcript (von Meyenburg et al., 1987;
stability, offering a new understanding of how RNase
Kogoma, 1997). In this model, the invading RNA strand
HI deficiency results in R-loop-mediated transcription-
acts as a primer for replication initiation and the displaced
replication conflict, as well as inappropriate replica-
DNA strand serves as an assembly site for the replicative
tion stalling or blockage at Ter sites outside of the
helicase. While oriK sites have never been precisely iden-
terminus trap region and at ribosomal operons.
tified, Kogoma’s group attempted to map them using an
imprecise chromosomal marker frequency approach that
utilized 21 hybridization probes around the chromosome
(de Massy et al., 1984a; see Masters and Broda, 1971, for
Accepted 23 October, 2013. *For correspondence. E-mail kenneth the first use of copy number analysis in analysing E. coli
.kreuzer@duke.edu; Tel. 919 684 6466; Fax 919 684 6525. †Present
address: Department of Biology, Stanford University, Palo Alto, Cali- replication). Based on the ratio of copy number of these
fornia, USA. probes in exponentially growing versus resting rnhA− ΔoriC

© 2013 John Wiley & Sons Ltd

40 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
cells, they argued for the existence of four or five oriK
sites in the chromosome, mapped to broad (150–200 kb)
regions (de Massy et al., 1984a). Each oriK site was
argued to be quite weak in replication activity relative to
that of oriC. Interestingly, the terminus region of the chro-
mosome showed the highest copy number in rnhA− ΔoriC
cells, which led the authors to conclude that at least two
oriK sites exist in this region. Kogoma’s group made great
progress towards understanding the protein requirements
for cSDR, which include DnaB, DnaC, DnaG, PriA, DNA
polymerases I and III, and RecA (but no other recombina-
tion protein) (see Kogoma, 1997 for review). However, the
true nature of oriK sites, proposed to be transcription units
prone to R-loop formation, is still unknown.
A better understanding of cSDR may illuminate impor-
tant aspects of chromosomal replication, its connection to
chromosome segregation and the cell cycle, and genome
stability. Assuming that multiple weak oriK sites exist
around the chromosome, rnhA− cells, even when they have
a functional oriC, should have replication forks running in
the wrong direction relative to normal replication, an unco-
ordinated replication cycle, and opposing replication forks
meeting in unusual places around the chromosome.
Notably, E. coli strains with a reduced capacity to remove
R-loops are unhealthy, as evidenced by the SOS-
constitutive phenotypes of rnhA− and recG− mutants, as
well as the inviability of rnhA recG double mutants (Hong
et al., 1995). Intriguing hotspots for homologous recombi-
nation (Hot sites), mostly in the chromosomal terminus
region, are also activated in rnhA− E. coli cells (Nishitani
et al., 1993; Horiuchi et al., 1994). A subset of these Hot
sites are adjacent to Ter sites flanking the terminus region,
and the induced recombination was shown to be depend-
ent on the Tus protein (Horiuchi et al., 1994). These results
led to a model in which aberrant replication initiates from
R-loops, the resulting forks stall at the Ter sites for abnor-
mally long times, and breakage at the stalled forks triggers
RecA/RecBCD-dependent homologous recombination
(later results suggested that a second fork from the same
direction could collide with the blocked fork to generate the
broken end; Bidnenko et al., 2002).
In a more general sense, replication disturbances are
responsible for genome instability caused by R-loops
(see Discussion) (French, 1992; Rudolph et al., 2009;
2010; Boubakri et al., 2010; Srivatsan et al., 2010; Gan
et al., 2011; De Septenville et al., 2012; Wimberly et al.,
2013). Indeed, R-loops have been linked to DNA
rearrangements, double-strand break (DSB) formation,
and transcriptional elongation defects in species ranging
from yeast to humans (Aguilera and Garcia-Muse,
2012). Wimberly et al. (2013) recently provided evidence
that R-loop-triggered replication in starving phase (wild-
type) E. coli leads to DNA breaks when the fork encoun-
ters nicks in the template, resulting in stress-induced
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
mutation and amplification. This study not only highlights
the importance of R-loops in genome instability but
also provides evidence for R-loop-dependent replication
in wild-type (non-growing) cells. Recent work has also
begun to reveal a connection between genomic instabil-
ity and the formation of RNA-DNA hybrids in cancer cells
(Potenski and Klein, 2011). Our study of the cSDR
system in E. coli is aimed at improving our understand-
ing of the mechanisms underlying the propagation of
R-loop structures in the cell, and their effects on chro-
mosomal integrity.
Our goals in these studies were to better understand
both the initiation of replication from R-loops at oriK sites
in the chromosome and the consequences of the aberrant
replication that is thereby induced. The prior studies on
cSDR and Hot sites focused our attention on the terminus
region in our search for oriK sites. First, two of the major
oriK sites identified by Kogoma were apparently located
within this region, although their positions were only
crudely defined. Second, Tus-dependent Hot fragments
were argued to result from the activity of nearby oriK
sites, and Tus-independent Hot fragments in the terminus
region could conceivably be dependent on oriK sites
within (or, again, close to) the Hot fragment (Horiuchi
et al., 1994). Third, focusing on the terminus region pro-
vides an additional tool that can be used to assess oriK
activity: the accumulation of blocked forks at Ter sites
during replication termination.
By employing the technique of two-dimensional agarose
gel electrophoresis (Friedman and Brewer, 1995), we were
able to visualize and quantify stalled replication forks on
the non-permissive side of Ter sites in RNase HI-deficient
cells. We attempted to localize oriK sites by inserting
artificial Ter sites at specific locations within the terminus
region and observing the effects on the proportion of forks
stalled at the natural TerB site downstream. We then went
on to use next-generation sequencing (NGS) analyses of
the genomes of various rnhA− strains to identify regions of
origin activity and to analyse the replication dynamics
when forks are initiated at sites other than oriC. The use of
NGS with deep read coverage provides a high level of
accuracy in determining copy number around the E. coli
chromosome – for example, pinpointing the location of oriC
in dnaA+ cells to within a few kb of its known location. The
NGS results show a dramatic reversal in apparent replica-
tion directions in an rnhA− dnaA− double mutant, with most
forks apparently initiating in the general vicinity of the
terminus region and replication often terminating in the
general vicinity of oriC. We also found dramatic disconti-
nuities in DNA copy number, implying replication fork stall-
ing or blockage, at Ter sites outside of the terminus trap
region and at ribosomal operons. Finally, the NGS profiles
under several conditions strongly suggest that the E. coli
chromosome contains multiple oriK sites, with some

specific candidate locations evident from small peaks in
the profiles.
Results
Blocked forks at Ter sites accumulate at greater levels
in rnhA− strains
Previous work implicated the terminus region of the E. coli
chromosome as a likely site of oriK elements (see Intro-
duction). We therefore began our analysis of DNA replica-
tion in rnhA knockout E. coli by measuring the blocked
forks at Ter sites. The termination events of replication in
E. coli generally take place in an area known as the repli-
cation trap, a 267 kb region delimited by the innermost Ter
sites, TerA and TerC. The ten known Ter sites, shown in
Fig. 1, are sequences to which the termination protein Tus
binds in a polar manner, blocking the progression of incom-
ing replication forks from one direction but not the other.
In the trap region, clockwise-moving forks stall first at
TerC, while counter-clockwise forks do so at TerA. In order
to visualize these stalled forks, we made use of two-
dimensional (2D) gel electrophoresis, a technique that
allows digested DNA fragments to be separated by shape
as well as size, thus making it possible to distinguish
between different kinds of replication intermediates. The
collection of Y-shaped replication intermediates resulting
from the movement of a replication fork through a restric-
Fig. 1. Map of Ter sites and rrn operons in the E. coli
chromosome. Ter sites C, B, F, G, and J are oriented to block
clockwise replication forks from oriC, whereas A, D, E, I, and H
block counter-clockwise forks. The replication fork trap is the
267 kb region between TerC and TerA. The positions of the seven
rrn operons are shown (genome coordinate reflects 5′ end of rrs
gene sequence in each). The oriC site is located at position
3923.9 kb. All listed genome positions are in kb.
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 41
tion fragment produces a ‘Y arc’ on 2D gels, and stalling of
forks at a specific location such as a Ter site results in a
discrete spot on the Y arc, which can subsequently be
quantified (relative to the linear restriction fragment; see
Fig. 2A). This approach was previously used to visualize
and quantify Tus-Ter-blocked forks in wild-type E. coli, and
as expected, the highest fraction of blocked forks was
found at the innermost TerA and TerC sites (0.19% and
0.85%, compared with the linear restriction fragment
respectively; see Duggin and Bell, 2009).
As a result of the added oriK replication origin activity in
rnhA− cells, a greater fraction of blocked replication forks
are expected to be found at Ter sites in these cells than in
the wild-type, presumably dependent on the location of
oriK sites around the chromosome. For all experiments in
this study, we grew cells in LB broth because rnhA− mutants
express higher levels of SOS in LB than in minimal media,
consistent with a higher level of cSDR activity (Kogoma
et al., 1993; also see Usongo et al., 2013). We compared
replication fork intermediates at the TerB and TerC sites
of a wild-type and an rnhA− derivative of E. coli strain
MG1655. These two sites were chosen because previous
studies had suggested that the TerB-TerC region contains
oriK site(s) (see Introduction), which could be particularly
evident from an accumulation of blocked forks at TerB (the
upstream TerC should block most forks originating from
outside this region; see Fig. 1).
Growing cells were harvested and lysed in low melting
point agarose plugs to extract their large genomic DNAs
without shearing, and restriction digestions were per-
formed in the plugs prior to 2D gel electrophoresis and
Southern blotting with an appropriate probe. Each blot
clearly revealed an accumulation of replication intermedi-
ates as a discrete spot at the appropriate location on the Y
arc, indicative of stalled forks at the Ter site (Fig. 2B). The
fraction of blocked forks was quantified (in repeated experi-
ments) by dividing the signal of the blocked forks by the
sum total of the blocked forks and linear spot (Fig. 2C).
Quantification of blocked forks in the wild-type gave
values modestly higher than those of Duggin and Bell
(2009), perhaps due to differences in growth conditions
(they also used MG1655 as the wild-type, arguing against
a strain difference). We found that the fraction of forks
blocked at the TerB and TerC sites was dramatically higher
in the rnhA− mutant (11-fold and sevenfold respectively;
Fig. 2C). Fully 15% of the TerC restriction fragment signal
consisted of blocked forks, indicating that a clockwise fork
often arrives at TerC well before a counter-clockwise fork –
that is, a strong asymmetry in replication. A sizable fraction
(5.7%) of blocked forks was also detected in the TerB
restriction fragment; these forks must have originated from
oriK site(s) within the TerB-TerC region and/or forks that
originated upstream of TerC but somehow leaked through
it.
42 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■

Fig. 2. Blocked forks at TerB and TerC.

A. The Y-arc represents the series of Y-shaped replication intermediates that are formed by the movement of a single replication fork through
a segment of digested DNA. The Linear DNA spot (also known as the monomer or 1n spot) is the collection of non-replicating restriction
fragments from the digest. The EcoRI fragments containing TerC and TerB are also diagrammed.
B. Genomic DNA was extracted from wild-type MG1655 and its rnhA− derivative (AQ12251) and digested with EcoRI. Restriction fragments
were run on a 2D gel and probed for the TerB and TerC regions by Southern blotting.
C. The concentrations of blocked replication forks at TerB and TerC in wild-type and rnhA− strains were quantified from 2D gel blots of the
regions (such as the ones shown in Panel B). The concentrations are represented as percentages of the total DNA per blot, and the error
bars represent standard deviations.

In an attempt to distinguish between these two alterna-
tives, we inserted additional co-oriented Ter sites within
non-essential genes between TerB and TerC in the rnhA−
background. We used a recombineering technique (Baba
et al., 2006) to construct four different rnhA− strains con-
taining a 23 bp TerA site insertion in place of the non-
essential genes yneK, flxA, ynfL, or ydgH (see Fig. 3A).
The rationale is that an additional Ter site should sub-
stantially reduce the number of clockwise forks that leak
through TerC and subsequently arrive at TerB, but should
not reduce blocked forks at TerB that originated from oriK
site(s) between TerB and the inserted site. We confirmed
that every inserted Ter site did accumulate blocked forks
(i.e. was functional; data not shown), but we focused our
quantitative analysis on the forks at the TerB site.
The insertion of a Ter site at yneK, flxA or ynfL reduced
the percentage of blocked forks at TerB by about threefold,
to values around 2%, with somewhat different averages
but overlapping error bars (Fig. 3B). However, insertion of
a Ter site at ydgH caused a more dramatic decrease, down
nearly 10-fold (to 0.59%; Fig. 3B). We also tested double
Ter site insertions, one pair at the upstream flxA and yneK
sites and the other pair at ydgH and ynfL, closer to TerB
(see Fig. 3A). The percentage of blocked forks at TerB
averaged 1.4% with the pair of upstream Ter sites, but less
than 0.4% with the pair of Ter sites inserted closer to TerB
(Fig. 3B). All of these results are consistent with the pres-
ence of one or more oriK sites in the 8.8 kb ydgH-ynfL
interval, forks from which can only be blocked by the
leftmost (ydgH) Ter site insertion. However, an important

© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56

caveat remains, since the efficiency of the various inserted
Ter sites may not be equal to each other. Further experi-
ments are needed to definitively test for the presence of the
proposed oriK site(s) in this interval and the rest of the
terminus region.
Deep sequencing analysis reveals excess replicated
DNA in the TerA-TerC region of rnhA− cells
We next pursued a more global approach to analyse the
chromosomal replication pattern of rnhA− strains, using
next generation sequencing (NGS) in an approach similar
to those used in recent studies (Muller and Nieduszynski,
2012; Rudolph et al., 2013). Several prior global studies
using either microarrays or NGS have documented the
highest copy numbers for wild-type E. coli in the region
centred at oriC and the lowest copy numbers in the ter-
minus region, as expected for bidirectional replication
from oriC (Simmons et al., 2004; Breier et al., 2005;
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 43
Fig. 3. Blocked forks at TerB in strains with
artificial Ter insertions in the TerB-TerC region.
A. Artificial TerA sites were introduced by
recombineering into specific gene loci within
the TerB-C region of rnhA− strains, as
described in Experimental procedures. Two
‘double-insertion’ strains were made by
inserting an additional TerA site into pre-
existing single-insertion strains. All strains were
derivatives of rnhA− strain AQ12251.
B. The concentrations of blocked replication
forks at TerB were quantified from 2D gel blots
of the four single-insertion and two double-
insertion rnhA− strains and compared with that
of the parent strain AQ12251 (with no insert).
Kouzminova and Kuzminov, 2008; Sangurdekar et al.,
2010; Skovgaard et al., 2011; Kuong and Kuzminov, 2012;
Rudolph et al., 2013).
The analysis is illustrated first with wild-type MG1655
(Fig. 4). Samples were prepared from both growing
and chloramphenicol-treated cells, sequence reads were
aligned to the reference MG1655 genome, and the
numbers of sequence reads within 100 bp windows were
tabulated. Prior to tabulation, we eliminated all sequence
bins that included repetitive DNA segments (e.g. rRNA
operons, IS elements, REP elements) which cannot be
aligned correctly. The tabulation generates a much more
robust genome copy number profile than that from the
prior hybridization analysis for oriK sites, which measured
only 21 loci (de Massy et al., 1984a).
The read count profile for chloramphenicol-treated
MG1655 (oriC inactive) was, as expected, fairly uniform
across the genome with no obvious trend (Fig. 4B; note
that all NGS data are presented using Log2 scales).
44 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
Spikes and outliers were observed above and below the
mainstream, often in the same location in the two datasets
(plus and minus chloramphenicol). These spikes and a
component of the data scatter might be caused by read
count artefacts (PCR or sequencing variations based on
local sequence characteristics). We therefore calculated
the ratio of the read counts in the growing cell sample to
those in the chloramphenicol-treated sample for each bin
(and also divided by the overall ratio of all aligned read
counts in the two samples to standardize between
curves). This resulted in a significant smoothing of the
data, with few spikes remaining (Fig. 4C). We also gen-
erated a LOESS curve (locally weighted polynomial
regression; red line) which engages the 1000 adjacent
data points in each direction to approximate the overall
copy number pattern.
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Fig. 4. NGS profile of MG1655.
Genomic DNA from cultures of
MG1655 without (A) and with (B)
chloramphenicol were prepared for
NGS as described in Experimental
procedures, with repetitive DNA
regions removed from the analysis.
The absolute read counts of 100 bp
bins (Log2) are shown in Panels A and
B (sum of read counts from each of
the 100 positions within the bin); the
relative level (Log2) of the read counts
for replicating cell DNA (sample) over
reference DNA (MG1655+CAM in
Panel B) is plotted in Panel C. The red
line is the LOESS regression curve
(see Experimental procedures).
The overall shape of the adjusted MG1655 genome
profile was similar to those from the above-cited past
studies, with a dominant peak near oriC and the lowest
copy numbers in the terminus region (Fig. 4C). The peak of
the LOESS curve is at 3916.2 kb, less than 8 kb from the
actual location of oriC (3923.9 kb), and the lowest value
was at position 1602.5 kb, very close to TerC (1607.2 kb).
As discussed above, TerC is the Ter site with the highest
frequency of blocked forks in the wild-type, consistent with
most replication termination events occurring in the vicinity
of TerC. The profile displayed a heightened slope for about
300 kb on each side of oriC. This result suggests that
replication forks travel slower over this interval, or perhaps
that there was some unusual perturbation of replication
initiation under our conditions; further experiments are
needed to clarify this point. All the subsequent experiments

below will utilize the same manipulations to generate cor-
rected datasets (always relative to the chloramphenicol-
treated MG1655 data in Fig. 4B).
Turning to the analysis of rnhA− E. coli, we found that the
oriC peak was poorly defined and that the copy numbers
were more evenly distributed across most of the chromo-
some (Fig. 5A). Indeed, the main peak is no longer even
centred at oriC, but rather covers a broad region from about
3900 kb to 4300 kb (Fig. 5A; see Discussion). The data
also revealed the presence of a secondary peak in the
replication fork trap/terminus region, which appears to be
bounded by the TerA site on the left and TerC on the right
(with a more subtle discontinuity at TerB; see blow-up of
this region in Fig. 5B). This strain contains a functional oriC
but is also active for oriK sites, which have previously been
linked to the terminus region (see above). The peak in the
fork trap region is consistent with the presence of one or
more oriK sites in this region. Another possible interpreta-
tion, not mutually exclusive, is that oriK sites exist in both
halves of the chromosome but fire in an uncoordinated
manner. Assume that in some chromosomes, leftward
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 45
Fig. 5. NGS profiles of rnhA− strains.
Genomic DNA from cultures of rnhA−
cells (strain NZ8; Panels A and B) or
rnhA− rzpR::Ter cells (derivative of NZ8;
Panel C) was prepared for NGS as
described in Experimental procedures.
Log2 of the ratio of read counts (per
100 bp bin) for sample DNA to
reference DNA (chloramphenicol-
treated MG1655) are plotted against
genome position. Panels B and C
present expanded views of the
1200–1800 kb region (the full profile for
the rnhA− rzpR::Ter strain is in Fig. S2).
Locations of the cryptic prophage origin
oriJ and the artificial Ter insertion at
the rzpR locus are also indicated in
Panel C.
(counter-clockwise) forks are blocked for prolonged
periods at TerA, while in other chromosomes, rightward
(clockwise) forks are blocked for prolonged periods at
TerC, then each of these two classes of chromosomes
would have two copies of replication fork trap DNA, two
copies of DNA on the oriK-proximal side of the trap, but only
one copy of the DNA distal to the fork trap region (2:2:1 and
1:2:2 for leftwards: trap: rightwards). Summing up all chro-
mosomes in an equal mix of chromosomes would give a
peak in the TerA-TerC interval (3:4:3) even if no single
chromosomes have replicated only that region. For both
MG1655 and the rnhA− single mutant, similar (though less
well-defined) patterns were also seen using a microarray
approach to measuring genome copy number profiles
(Fig. S1).
The replication origin of a cryptic prophage within the
TerA-TerC region, called oriJ, has previously been shown
to induce autonomous plasmid replication in cells lacking
the remainder of the prophage (Diaz and Pritchard, 1978;
Diaz et al., 1979). We wondered whether oriJ might be
responsible for replication from the terminus region in
46 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
rnhA− cells, contributing to the strong peak in the terminus
region. To test this possibility, we inserted an ectopic Ter
site in the rzpR locus at position 1421.5 kb, upstream of
both oriJ and TerA, and in the same orientation as TerA
(see Fig. 5C). If oriJ is generating much of the excess DNA
just to the right of TerA, the peak should be maintained,
while if oriK sites to the right of rzpR are responsible, we
should see the overall terminus region peak contract.
Indeed, the inserted Ter site at rzpR now became the
border of the high-copy terminus region, and no disconti-
nuity was evident at TerA (Fig. 5C; Fig. S2). We conclude
that the peak in the terminus region is not caused by a
strong oriK in the TerA-rzpR interval, which includes oriJ,
and this experiment also provides direct confirmation that
the Ter sites are necessary for the striking discontinuities in
the peak shape.
Next, analysis of DNA from an rnhA− dnaA− double
mutant revealed a striking profile (Fig. 6A). The terminus
region provided the peak, this time bordered by disconti-
nuities at TerA and TerB (Figs 6B and S1; see Discus-
sion). A novel discontinuity was also evident at TerE, well
to the left of the normal terminus region (Fig. 6B). TerE is
oriented to trap leftward-moving forks, suggesting that
forks trapped at this site were initiated at oriK site(s)
between TerE and TerD (1081–1279 kb). Also, the region
with the lowest read counts was not far from oriC, with a
notable increase in read counts in the region to the right of
oriC (see below). A striking discontinuity in read counts
was also evident very near or at the TerG site (2375 kb;
Fig. S3). TerG is oriented to trap rightward-moving forks,
suggesting that many forks trapped at this site were initi-
ated at oriK site(s) to the left of TerG, likely between TerB
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Fig. 6. NGS profile of rnhA− dnaA−
strain. Genomic DNA from a culture of
rnhA− dnaA− cells (strain AQ12257)
was prepared for NGS as described in
Experimental procedures. Log2 of the
ratio of read counts (per 100 bp bin)
for sample DNA to reference DNA
(chloramphenicol-treated MG1655) are
plotted against genome position (Panel
A). Panel B presents an expanded
view of the 1000–1800 kb region.
and TerG (1682–2375 kb). No discontinuity was evident
at TerF (2315.7 kb), about 60 kb upstream of TerG (with
respect to clockwise-moving forks; Fig. S3). TerF is known
to be a weak Ter site (Sharma and Hill, 1992; Duggin and
Bell, 2009), perhaps explaining why forks accumulate at
TerG rather than TerF. A similar, though less well-defined,
profile was revealed by microarray analysis of the rnhA−
dnaA− double mutant (Fig. S1C).
An independent way to generate cells that are replicat-
ing only from oriK sites is to treat the rnhA− single mutant
with chloramphenicol, which inhibits replication from oriC
but not oriK sites (Kogoma, 1978; von Meyenburg et al.,
1987). The profile of DNA from this condition looked very
similar to the profile of the rnhA− dnaA− double mutant
above (compare Figs 7A and 6A; also see Fig. S4 for the
profile of the rzpR::Ter insertion strain treated with chlo-
ramphenicol). The peaks in the terminus region were very
similar, and both profiles showed the lowest region to the
left of oriC (roughly from 3500 kb to 4000 kb). A closer
look at the regions at each edge of this trough is revealing
(Fig. 7B; see also Fig. S5). The rrnD operon (3426.8 kb) is
at or very near a copy number discontinuity on the left,
and the rrnE operon (4206.2 kb) is at a discontinuity on
the right (Fig. 7B; Fig. S5). There also appear to be less
dramatic discontinuities at or near rrnB and rrnA. Several
past studies have shown that replication forks have par-
ticular difficulty travelling through oppositely oriented,
actively transcribing rrn operons (see Discussion). All of
these rrn operons are oriented in the same direction as
replication in the wild-type E. coli, but would be oriented in
the opposite direction for replication forks that emanate
from an oriK element in or near the terminus region.

Replication fork pausing or blockage at the rrn operons
therefore provides a likely explanation for the discontinui-
ties highlighted in Figs 7B and S5. We also note that the
profile in this region is not strictly defined by discontinui-
ties at rrn operons – this is particularly noticeable around
rrnD, where gene copy number is changing in a progres-
sive way on both flanks. Nearby oriK sites and/or fork
stalling at sites surrounding rrnD presumably contribute to
this aspect of the profiles.
Replication profiles of rnhA− strains in the absence of
Tus-mediated fork blockage
Several of the read count discontinuities above occur
very near or at Ter sites, and the introduction of a Ter
site at rzpR created a new discontinuity as well. These
results already show that fork blockage by Tus-Ter com-
plexes plays a major role in the shapes of the profiles. In
addition to the local effects on read counts caused by
fork blockage at a particular Ter site, Tus-mediated fork
blockage would likely have more global effects on the
profile – for example, by extending the expanse of the
chromosome replicated by a fork from a given oriK when
its partner fork is blocked at a Ter site. This effect could
be complex considering that multiple oriK elements are
likely spread around the chromosome, presumably dif-
fering in strength from one another. To approach this
issue, we constructed rnhA− and rnhA− dnaA− derivatives
with a deletion of the tus gene and analysed their
genomic profiles.
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 47
Fig. 7. NGS profile of rnhA− cells
treated with chloramphenicol. A culture
of rnhA− cells (strain NZ8) was treated
for 90 min with chloramphenicol
(150 μg ml−1), and genomic DNA was
prepared for NGS as described in
Experimental procedures. Log2 of the
ratio of read counts (per 100 bp bin)
for sample DNA to reference DNA
(chloramphenicol-treated MG1655) are
plotted against genome position (Panel
A). Panel B presents an expanded
view of the 3200–4400 kb region, with
locations of the rrn operons also
shown. Note that bins containing rrn
operons were removed due to the
repetitive nature of rrn sequences,
resulting in the paucity of data points
at those locations.
As expected, introduction of the tus mutation into both
rnhA− strains led to a flattening of the terminus region peak
and the disappearance of the discontinuities at Ter sites
(Fig. 8A and B). The overall profile of the rnhA− tus− strain
was somewhat flatter than the rnhA− single mutant
(compare Figs 8A and 5A). This general flattening could
result from the global effect mentioned in the paragraph
above.
The overall shape of the rnhA− dnaA− tus− profile was
similar to that of the double rnhA− dnaA− mutant, absent
the discontinuities and peaks in the regions of Ter sites
(compare Figs 8B and 6A). However, the change in profile
caused by the tus mutation in the terminus region was
informative – instead of a single strong peak in the
TerA-TerB region, the two regions flanking TerA-TerB had
noticeable peaks (LOESS maxima at 1099.8, 1278.3
and 1766.5 kb). This result implies that the dramatic peak
covering the TerA-TerB region in rnhA− dnaA− tus+ cells is
NOT caused primarily by one or more strong oriK site(s)
within that region. The region still might contain one or
more oriK(s), but they are not strong enough to cause this
peak. Reflecting back on the differential hybridization
analysis of de Massy et al. (1984a), these data also
negate the evidence for strong oriK site(s) in the TerA-TerB
interval.
So what does the data indicate about the location of oriK
sites in the chromosome? Several features of the two tus−
profiles perhaps provide clues. First, the highest LOESS
value in the rnhA− tus− profile occurs not at oriC but at
position 4273 kb, more than 300 kb clockwise from oriC
48 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
(Fig. 8A). This peak could reflect the presence of oriK
site(s) in this region and/or replication fork blockage at rrn
and other operons (see Discussion). Second, in the rnhA−
dnaA− tus− triple mutant, where oriC is non-functional, the
peak region of the entire genome is broadly in the region
of 700 to 1600 kb, with the maximum LOESS value at
1278 kb (Fig. 8B). This peak region is not very sharply
defined, consistent with the presence of two or more oriK
sites. As in the tus+ strain, the genome pattern in this
mutant is basically opposite the normal, with the oriC
region being the lowest copy number. Third, several dis-
crete ‘bumps’ on the LOESS curves coincide in the two
different tus− profiles; the most obvious is near 1760 kb,
with the exact peak values being within 10 kb of each other
in the two profiles (Fig. 8A and B; also see Discussion).
Hydroxyurea treatment amplifies origin peaks in the
genome profile
Hydroxyurea (HU) inhibits the enzyme ribonucleotide
reductase, leading to depletion of deoxyribonucleotides
(dNTPs) in the cell and inhibition of replication. Kuzminov
and colleagues recently showed a dramatic sharpening of
the oriC peak with prolonged HU treatment, as measured
by microarray analysis of genome copy number (Kuong
and Kuzminov, 2012). Apparently, oriC initiation can con-
tinue in the presence of HU but the forks so initiated
become stalled or move very slowly as they attempt to
traverse the chromosome. This seemed like an excellent
tool to try to define the location of oriK sites more precisely.
We began by treating wild-type MG1655 with HU for 4 h
and analysing the genome profile. In agreement with the
Kuzminov study, we found a very dramatic and sharp
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Fig. 8. NGS profiles of rnhA− tus−
strains. Genomic DNA from cultures of
rnhA− tus− cells (derivative of strain
AQ12251; Panel A) and rnhA− dnaA−
tus− cells (derivative of strain
AQ12257; Panel B) were prepared for
NGS as described in Experimental
procedures. Log2 of the ratio of
read counts (per 100 bp bin) for
sample DNA to reference DNA
(chloramphenicol-treated MG1655) are
plotted against genome position.
profile centred on oriC (with significantly less scatter than
in the microarray data of Kuong & Kuzminov, 2012)
(Fig. 9A). The LOESS-averaged intensity at the oriC
peak was about fourfold higher than the intensity near the
bottom of the peak (about 500 kb in either direction) and
8.6-fold higher than the lowest intensity near position
1591 kb. The highest LOESS value was at position
3925.8 kb, less than 2 kb from the known position of oriC,
attesting to the high precision of the data. The median
distance travelled by forks from oriC should be roughly the
distance where the copy number drops in half, which
corresponds to about 250 kb in either direction (261 kb
clockwise and 245 kb counter-clockwise).
A prominent oriC peak is also evident in the profile of
the rnhA− strain treated with HU, as would be expected
(Fig. 9B). Again, the highest LOESS value in this peak
(position 3922.4 kb) was within 2 kb of the known posi-
tion of oriC. Also similar to the MG1655 profile, the oriC
peak in the rnhA− curve drops by half at about 250 kb in
either direction from oriC (250 kb clockwise and 241 kb
counter-clockwise).
The terminus region of the rnhA− strain treated with HU
(Fig. 9B) shows a modest peak which is essentially elimi-
nated in the rnhA− tus− strain treated with HU (Fig. S6).
The shapes of these two profiles imply that oriK sites
distant from oriC are active. First, the small peak in the
terminus region of the rnhA− single mutant seems to
reflect some oriK activity in the region to the right of TerA,
since the copy number is higher on that side. Second, the
entire oriC-distal region of this profile is not as depressed
as in the MG1655 profile, with a ratio between the copy
number at oriC compared with the lowest point (near
position 1228 kb) being only about 4.8-fold (compared

with 8.6-fold in MG1655; see above). Third, since the
terminus peak is dependent on the presence of Tus, the
peak presumably consists of Tus-blocked forks that were
triggered by origins that are relatively nearby (since forks
travel only about 250 kb on average in the presence of
HU). These results support the conclusion that multiple
weak oriK sites exist in the general region of the terminus
(e.g. within a few hundred kb of the replication fork trap).
The copy number profile of the rnhA− dnaA− strain
treated with HU argues that oriK activity is occurring
throughout the genome, with the greatest activity in the
region between about 1200 and 2400 kb (which have
the highest average copy numbers from throughout the
genome; Fig. 9C). Rather than a few discrete peaks
shaped like the oriC peak (only smaller), the profile is
quite complex, with multiple peaks and slope changes.
Small but noticeable peaks do occur with high LOESS
values at about 1483 kb; 1908 kb; 2592 kb; 2832 kb;
3234 kb; and 4397 kb. It seems likely that some or all of
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 49
Fig. 9. NGS profiles of hydroxyurea-
treated cells. Cultures of wild-type cells
(strain MG1655; Panel A), rnhA− cells
(strain AQ12251; Panel B), and rnhA−
dnaA− cells (strain AQ12257; Panel C)
were treated with hydroxyurea
(80 mM) for 4 h, and genomic DNA
was then prepared for NGS as
described in Experimental procedures.
Log2 of the ratio of read counts (per
100 bp bin) for sample DNA to
reference DNA
(chloramphenicol-treated MG1655) are
plotted against genome position. The
scales of the y-axis in this figure are
very different from the previous figures
due to the more extreme variation in
copy number across the genome. Also
note that the DNA from this
experiment was initially sequenced
with 100 base reads, but we truncated
these reads to 50 bases prior to data
analysis so that this data would be
directly comparable to all the other
NGS data in this study. In the
HU-treated profiles, we noted with
interest a set of four 100 bp bins with
very high copy number (this figure and
Fig. S6). These bins are centred at
about position 1019.1 kb at the 5′ end
of the ompA gene. We believe that this
copy number peak is some kind of
PCR artefact, because the excess
reads are all from the same DNA
strand and because no peak was
observed in an analysis of the same
chromosomal DNA sample by a
PacBio direct sequencing protocol that
does not involve PCR (data not
shown). We do not understand why
this peak is seen only in the
HU-treated samples.
these peaks reflect the activity of specific oriK sites, but
stronger evidence is needed to confirm this inference. It is
also likely that both Tus-Ter complexes and rrn operons
have some effects on the overall profile. Based on both
the rnhA− and rnhA− dnaA− profiles, we infer that multiple
oriK elements are spread around the chromosome and
each initiates replication at a much lower frequency than
does oriC.
Discussion
Global replication profiles in rnhA− E. coli
In this study, we analysed the replication profiles of wild-
type and various rnhA− mutants of E. coli using a precise
NGS approach, backed up by 2D gel and microarray
approaches. Our studies revealed a dramatic increase in
the levels of blocked forks at Ter sites in the terminus
region when the rnhA gene is disrupted (Fig. 2), implying
50 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
poorly coordinated replication in the rnhA− mutant (i.e. the
two oppositely oriented replication forks arrive at these
Ter sites at very different times). NGS and microarray
analyses confirmed the unusual replication behaviour of
rnhA− and particularly rnhA− dnaA− mutants. Wild-type
cells show little or no excess of DNA in the replication fork
trap interval (TerA-TerC), consistent with well-coordinated
replication (Duggin and Bell, 2009; also see Figs 4C and
S1A). However, both of the rnhA− strains show a promi-
nent peak in this region (Figs 5, 6, S1B and C), which
could be caused by oriK sites in the trap interval and/or
uncoordinated replication (with some chromosomes
having TerA-trapped clockwise forks and others having
TerC-trapped counter-clockwise forks). The sharp peak
delineated by TerA and TerC, however, was essentially
abolished in tus− derivatives of the two rnhA− strains
(Fig. 8). In the rnhA− dnaA− tus− triple mutant, peaks
appeared in the regions flanking TerA-TerB rather than
within that region. This argues that blockage of forks from
outside the TerA-TerB interval plays a major role in the
formation of the terminus peak in Tus-containing cells.
Additional results from the NGS analysis clearly reveal
fork blockage by Tus-Ter complexes in rnhA− strains. The
discontinuity at TerA in the rnhA− single mutant is abol-
ished and replaced by a similar discontinuity at an artificial
Ter site at the upstream rzpR locus (compare Fig. 5B and
C). In addition, new and very striking discontinuities are
evident at TerE, TerB, and TerG in the rnhA− dnaA− double
mutant (Fig. 6; Fig. S3).
The tus− strains provide an informative view by elimi-
nating the effects of Ter sites. The rnhA− dnaA− tus− strain
shows a peak of copy number at 1278 kb, in the region
nearly opposite oriC, and the lowest copy number at
3883 kb, only about 40 kb from oriC (Fig. 8B; note that all
comparisons of copy number in this Discussion are based
on the LOESS regression values). This result implies that
much of the DNA replication in this strain is opposite in
direction to that of wild-type strains. The oriC-competent
rnhA− tus− mutant shows the flattest genomic profile of
any of the tested strains, with only a 1.29-fold difference
between the most and least represented sequences
(Fig. 8A). This is not surprising, since the rnhA− dnaA− tus−
triple mutant shows nearly the reverse pattern from wild-
type but the rnhA− tus− double mutant should have an
active oriC.
The NGS analysis presented here also contributes to
our understanding of the replication-transcription conflict.
The seven ribosomal RNA operons (rrn) of E. coli are
co-oriented with the direction of DNA replication to mini-
mize head-on collisions between the fork and active tran-
scription complexes in rrn operons (for reviews, see
Brewer, 1988; Rudolph et al., 2007; Merrikh et al., 2012).
French (1992) first showed that replication rate is reduced
during a head-on collision, and studies with a plasmid-
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
based in vivo system showed fork blockage upon encoun-
ter with an oppositely oriented transcription complex
(Mirkin and Mirkin, 2005). In addition, Pomerantz and
O’Donnell (2010) showed that E. coli replisomes have
great difficulty replicating through oppositely oriented
transcribing RNA polymerases in vitro. The ability of the
bacterial replisome to traverse protein-bound DNA in vivo
and in vitro was shown to be dependent on the helicases
Rep and UvrD (Guy et al., 2009). Furthermore, Boubakri
et al. (2010) showed that the helicases DinG, Rep and
UvrD play overlapping roles in allowing replication fork
progression through oppositely oriented, transcribing rrn
operons in E. coli. Finally, replication fork progression in
Bacillus subtilis was slowed by about 30% in wild-type
cells when a segment of DNA was replicated in the
unnatural direction, and this slowing was shown to be
dependent on oppositely oriented transcription (Wang
et al., 2007; also see Srivatsan et al., 2010).
We found the most obvious effect of rrn operons on
replication profiles in the rnhA− strain when oriC function
was inhibited by chloramphenicol (Fig. 7B; Fig. S4). The
profiles showed some abrupt but fairly subtle discontinui-
ties right at rrnA and rrnE, suggesting direct blockage of the
replisome by the transcribing RNA polymerase. In each of
these cases, copy number decreased in the direction
expected for oppositely oriented replication forks (since
forks are likely travelling in both directions in the rnhA−
strains). However, there was a more dramatic decrease in
copy number surrounding the rrn operons, apparently in
both directions. For example, gradual declines are evident
for about 100 kb before and 50 kb after rrnD (considering a
rightward-moving fork in Fig. 7B). Additional experiments
are needed to test whether these gradual declines are
caused by rrn operon transcription – for example, by a
mechanism involving transcription-driven supercoiling.
Where does replication initiate in the chromosomes of
rnhA− E. coli?
One goal of this study was to localize the origin sequences
responsible for constitutive stable DNA replication (cSDR)
in E. coli, the so-called oriK sites. We first focused attention
on the terminus region of the chromosome for reasons
outlined in the Introduction. 2D gel analyses of the rnhA−
mutant strain showed elevated levels of blocked replication
forks at both TerB and TerC (Fig. 2). We were particularly
struck by the level of blocked forks at TerB, since the TerC
site, 75 kb upstream, would be expected to block most
incoming clockwise forks that originated outside this region
(see map in Fig. 1). This suggested that the TerB-TerC
region itself might contain one or more oriK sites. Results
with strains containing one or two additional co-oriented
Ter sites inserted within this region were consistent with a
possible oriK site in the 8.8 kb ydgH-ynfL interval, although

Table 1. Some detectable peaks in rnhA− cells (LOESS curve maxima).
Strain, condition
rnhA 1473.6
rnhA dnaA 789.5 1479.3
rnhA, + CAM 847.2 1522.6
rnhA tus 1757.6
rnhA dnaA tus 1766.5
rnhA rzpR::Ter 1508.9
rnhA rzpR::Ter, + CAM 846.0 1524.2
rnhA, + HU 1486.1
rnhA dnaA, + HU 1483.0
rnhA tus, + HU 1757.5
All numbers in genome coordinates (kb). Bold entries are particularly strong peaks. This list is not exhaustive, but highlights peaks seen in multiple
profiles. The oriC peaks, when present, are not included in this table but are mentioned directly in the text.
this inference depends on the assumption that all inserted
artificial Ter sites are about equally efficient. We attempted
to confirm the existence of an oriK site in this region by
flanking this region on both sides with oppositely facing Ter
sites to create a replication ‘bubble trap’. While each of the
two new Ter sites successfully blocked forks as shown by
the accumulation of Y-form DNA in 2D gels, we did not
detect any bubble molecules in restriction fragments that
contained the two Ter sites and intervening DNA (Maduike,
2012). This result argues against an oriK in this small
interval, unless some unknown problem prevents forma-
tion or detection of the expected bubbles.
Our global analysis using NGS and microarrays
changed our perspective on oriK sites in the terminus
region. The prominent peak in the TerA-TerC replication
trap region of rnhA− strains (Figs 5, 6, 7A, and Figs S1, S2
and S4) was essentially abolished in the rnhA− tus− double
mutant and very much broadened (with local peak posi-
tions outside of TerA-TerC) in the rnhA− dnaA− tus− triple
mutant (Fig. 8). These results argue that the peak within
TerA-TerC does not primarily result from DNA molecules
that have undergone bidirectional replication from an oriK
within the TerA-TerC region, but rather an accumulation of
some molecules with clockwise forks blocked at TerC and
other molecules with counter-clockwise forks blocked at
TerA. These results likewise argue against the prior iden-
tification of two oriK sites in the terminus region (de Massy
et al., 1984a) and the putative oriX site in this same region
(de Massy et al., 1984b); both studies relied on relative
copy number measurements but with many fewer data
points, and both sets of measurements would have been
similarly impacted by Tus-mediated fork blockage. We
also obtained evidence that the cryptic phage replication
origin oriJ does not function as an oriK element in rnhA−
cells (Fig. 5; also see Maduike, 2012, for negative results
with an oriJ bubble trap experiment).
A surprising finding from this study is that the overall
copy number of the three rnhA− strains peaked about
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 51
Identified peaks
4255.8
1867.8 3227.0 4536.6
1840.2 3234.8 4388.0 4541.2
2667.3 4273.1
4327.2
1835.5 2598.5 2849.3 3227.7 4341.0
1902.2 2621.9 2905.7
1907.5 2591.7 2831.8 3233.7 4396.8
1893.6 2594.0 2904.1
350 kb clockwise from oriC (Table 1, positions near
4300 kb). This result raises the possibility that an oriK site,
stronger than oriC, is localized in this region. A different
interpretation is that this region contains multiple ele-
ments that can block forks travelling in either direction,
with a resulting accumulation of clockwise forks that origi-
nated from oriC, and counter-clockwise forks that origi-
nated from oriK sites distal to this region. If the replicated
regions in the two sets of molecules overlap, a peak could
be generated (much like the peak in the terminus region in
Tus-proficient rnhA− cells). This region contains multiple
rrn operons, which can impede replication from the
counter-clockwise direction (see above). Furthermore,
Gan et al. (2011) recently showed that an R-loop that is
co-directional with a replication fork in a ColE1-based
plasmid can stall replication. Thus, in the rnhA− mutant,
fork blockage in either direction (in different chromo-
somes) could be sufficient to explain the unusual peak.
What have we learned about the location of oriK sites
around the chromosome? Their positions should be most
evident in DNA from cells in which the powerful oriC is not
functional – i.e. rnhA− dnaA− double mutants and rnhA−
mutants treated with chloramphenicol. First, the disconti-
nuity at the TerE site suggested the presence of oriK
site(s) between TerE and TerD (1081–1279 kb; see
above). Second, the discontinuity at TerG suggested the
presence of oriK site(s) between TerB and TerG (1682–
2375 kb; see above). Third, the rnhA− dnaA− double
mutant showed a peak in the terminus region bordered by
TerA and TerB, while the peak in the rnhA− single mutant
was bordered by TerA and TerC (compare Figs 6B and
5B). The discontinuity at TerC in the single mutant argues
that TerC is efficient at collecting clockwise forks from
oriC, which suggests that the prominent discontinuity at
TerB in the double mutant results from oriK site(s) in the
TerC-TerB region (1607–1682 kb). 2D gel approaches
also provided evidence, albeit equivocal, for oriK site(s) in
this interval (Figs 2 and 3). Fourth, the overall peak in the
52 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
NGS genome profile of the rnhA− dnaA− tus− cells was
broadly in the region of about 700–1600 kb (Fig. 8B),
suggesting that oriK site(s) exist in this region. Fifth, the
profiles of the rnhA− tus− and rnhA− dnaA− tus− cells, which
have no fork blockage at Ter sites, show several discrete
bumps (maxima in the LOESS curves) that we hypoth-
esize represent oriK sites, the most obvious near position
1760 kb (Fig. 8). Sixth, modest bumps are also seen in
the profiles of rnhA− dnaA− cells and rnhA− cells (with or
without the rzpR::Ter insertion) treated with chlorampheni-
col, including several that show up in all three of these
profiles (positions near 850 kb, 1840 kb and 3230 kb;
TerA-TerC region peak not included since it is likely
created by Tus-mediated fork blockage). Table 1 presents
a summary of locations that repeatedly appeared as
LOESS curve maxima in the various profiles; these are
good candidate regions for oriK sites at diverse locations
around the E. coli chromosome.
Following up on the recent microarray study from
Kuzminov’s group (Kuong and Kuzminov, 2012), we con-
firmed that HU treatment is a powerful tool to use in the
analysis of genome replication. We found that the average
distance travelled by replication forks from oriC in wild-
type cells during a 4 h HU treatment was only about
250 kb, and that approximately 8.6-fold more DNA accu-
mulated at oriC than at distant regions (Fig. 9A). The
rnhA− cells treated with HU showed a prominent peak at
oriC, and their overall NGS profile was consistent with the
existence of multiple oriK sites throughout the chromo-
some (Fig. 9B). Finally, perhaps the most informative
profile was from the rnhA− dnaA− cells treated with HU
(Fig. 9C). As with the profiles from these cells without HU
treatment, the overall peak of the NGS profile was in the
terminus region (1483 kb). This is located in the replica-
tion fork trap area (TerA-TerC), and thus fork blockage at
Ter sites likely contributes. The profile shows five other
maxima (see Table 1) that are consistent with oriK site
activity, two of which are near maxima that were con-
sistently detected in rnhA− dnaA− cells and rnhA− cells
treated with chloramphenicol (maxima at 1907.5 kb and
3233.7 kb). The LOESS curve in the HU-treated rnhA−
dnaA− cells was very bumpy, suggesting additional weak
oriK sites that do not form maxima and likely also fork
blockage at multiple sites such as Ter and rrn operons.
Very recently, Leela et al. (2013) used bisulphite reac-
tivity in an attempt to map R-loops in the chromosomes of
E. coli MG1655 and a nusG derivative. They extracted
chromosomal DNA from the cells and treated with bisul-
phite, which deaminates C residues in single-stranded
regions, converting C to T (or G to A on the opposite
strand after amplification). Surprisingly, they found that
approximately 7% of sequence reads in the wild-type
showed C to T or G to A conversions from bisulphite
treatment, indicative of single-stranded character, and
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
provided supporting evidence that many of these conver-
sions were dependent on R-loop formation. Such a high
level of R-loop formation in wild-type E. coli seems incon-
gruous with the normal physiology of wild-type cells
compared with rnhA− mutants (see below), and this dis-
crepancy remains to be explained. If confirmed, these
candidate R-loop locations provide another clue to the
locations of oriK sites (although it is not clear that all
R-loops would be functional as oriK sites).
Pathology resulting from removal of RNase HI
Mutations that inactivate E. coli RNase HI cause serious
pathology, including an SOS-constitutive phenotype that
presumably reflects spontaneous DNA damage, and syn-
thetic lethality with recG mutations (see Introduction).
These deleterious effects presumably result from aberrant
R-loop formation, but the exact pathways involved in
pathology are still uncertain. Recent studies have high-
lighted the deleterious effects of aberrant R-loop forma-
tion, including replication fork blockage, mutagenesis,
DNA breakage, and DNA rearrangements (Boubakri
et al., 2010; Gan et al., 2011; Helmrich et al., 2011;
Stirling et al., 2012; Wimberly et al., 2013) (for a review,
see Aguilera and Garcia-Muse, 2012).
Our analysis of chromosomal replication in the absence
of RNase HI illuminates some aspects of the RNase
HI-deficient physiology. First, the data directly shows that
rnhA− cells have an altered (and much flatter) profile of
gene copy number around the chromosome compared
with the wild-type (compare Fig. 4C with Fig. 5A; Fig. S1).
Highly expressed genes are concentrated in the early
replicating region of the E. coli chromosome, and their
higher copy numbers in rapidly growing cells augment
their expression (Chandler and Pritchard, 1975; Sousa
et al., 1997; Couturier and Rocha, 2006). The rnhA− cells
may suffer physiological consequences due to alterations
in expression caused by aberrant gene ratios. Second,
2D gel analysis and both microarray and NGS profiles
showed that rnhA− cells have a much higher steady-state
level of replication forks blocked at Ter sites. Fork block-
age at Ter sites can lead to both homologous and illegiti-
mate recombination, both presumably resulting from DNA
breaks (Bierne et al., 1991; 1997; Horiuchi et al., 1994). A
defined pathway of break formation at Tus-blocked forks
involves the arrival of a second replication fork from the
same direction (Sharma and Hill, 1995; Bidnenko et al.,
2002). Third, our NGS analysis showed evidence for fork
stalling or blockage at rrn operons and in their general
vicinity (see above). Aguilera and Garcia-Muse (2012)
discuss in detail the possible pathways of DNA breakage
and genomic instability resulting from fork blockage
during transcription of ribosomal RNA genes. Finally,
the existence of oriK sites throughout the chromosome

implies that oppositely oriented forks will meet at many
locations, presumably in a fashion that is uncoordinated
with the cell division cycle. These aberrant replication
termination events may contribute to the pathology of
rnhA− cells (also see Wimberly et al., 2013 for analysis
of R-loop consequences in non-growing E. coli). With
these considerations, it is perhaps surprising that RNase
HI-deficient cells, and particularly derivatives that cannot
utilize oriC, are even viable.
While this manuscript was under review, another group
published a study on the aberrant replication that occurs
in recG− E. coli cells using genetic and NGS copy number
approaches (Rudolph et al., 2013). RecG-deficient cells
also undergo cSDR, although the mechanism and loca-
tions of cSDR could differ between recG− and rnhA− cells,
and RecG inactivation is not sufficient to suppress the
absence of oriC function (Kogoma, 1997). In general, the
genome profiles of various recG− mutant cells was remi-
niscent of the rnhA− profiles reported here, with a dramatic
peak in the terminus region and a reversed pattern (ter-
minus to oriC) when oriC function was abolished (Rudolph
et al., 2013). However, Rudolph et al. (2013) concluded
that much of the replication in recG− cells occurs by an
aberrant pathway in which colliding replication forks
trigger new rounds of DNA synthesis, a pathway pre-
vented by the normal function of RecG helicase in wild-
type cells. Since all of the RNase HI-deficient cells in our
study have functional RecG, it seems unlikely that repli-
cation fork collisions are triggering replication and con-
tributing to the genome profiles reported here. Further
studies of the unusual mode(s) of replication in RNase HI-
and RecG-deficient cells are clearly warranted.
Experimental procedures
Bacterial strains
All strains used in this study were derivatives of E. coli
MG1655 (F− λ− ilvG− rfb-50 rph-1). Strains AQ12251
(rnhA339::cat) and AQ12257 (rnhA339::cat dnaA850::Tn10)
were kindly provided by Dr Steven Sandler (University of
Massachusetts, Amherst); these strains also contain a dele-
tion of the Eut/CPZ55 prophage. The six strains containing
artificial Ter insertions (Fig. 3A) were all derivatives of rnhA−
strain AQ12251.
Plasmids and primers
Plasmid pKD13 Plus was made by using the QuikChange II
Site-Directed Mutagenesis Kit to insert the 23 bp TerA
sequence (5′-AATTAGTATGTTGTAACTAAAGT-3′) at posi-
tion 1311 on plasmid pKD13 (Baba et al., 2006). PCR primers
used were 5′-GGAACTTCGAACTAATTAGTATGTTGTAAC
TAAAGTGCAGGTCGACGGATCCCCGG-3′ and 5′-CCGGG
GATCCGTCGACCTGCACTTTAGTTACAACATACTAATTAG
TTCGAAGTTCC-3′.
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 53
To prepare the tetracycline-resistant Mini-λ plasmid for the
recombineering experiments, DH10B E. coli cells containing
the plasmid were grown up to exponential phase in 125 ml of
LB at 30°C, and then incubated at 42°C to induce the excision
of the plasmid from the chromosome (see Court et al., 2003).
Plasmid DNA was then extracted from the cells using the
Plasmid Midi kit from Qiagen.
Recombineering
Appropriate primers targeting the gene of interest on the
chromosome were first used to generate a PCR product
containing the artificial TerA site plus the kanamycin resist-
ance gene from the plasmid pKD13 Plus. Primers typically
consisted of a 50 nt 5′ end corresponding to a DNA
sequence flanking the gene of interest in the chromosome
(see Supporting information for Baba et al., 2006), followed
by a 20 nt sequence (either 5′-TGTAGGCTGGAGCTG
CTTCG-3′ for ‘UP’ or 5′-ATTCCGGGGATCCGTCGACC-3′
for ‘DN’) flanking the segment of the pKD13 Plus plasmid
containing the kanamycin resistance gene and the artificial
TerA site.
Cells containing Mini-λ plasmid were grown up to an OD599
of 0.5 with shaking at 32°C. The cell volume was then split
into two, and one half was incubated at 42°C for 15 min to
induce the Mini-λ plasmid, while the other was incubated
at 32°C to serve as a negative control. The two sets were
chilled on ice following their incubations and were used to
prepare electrocompetent cells using ice-cold water or 10%
glycerol. The recombineering PCR product generated above
was then electroporated into both electrocompetent cells,
and kanamycin-resistant transformants were selected on LB
agar plates containing kanamycin. Mock electroporations
were also included for both sets of cells. A successful recom-
bineering experiment produced kanamycin-resistant colonies
from the induced cells but not in the uninduced or mock
controls. Successfully recombineered strains were then
screened by PCR, using primers flanking the original gene in
the chromosome.
Preparation of genomic DNA embedded in
agarose plugs
Escherichia coli cells were grown in LB at 37°C to an OD599
of 0.4. For each agarose plug to be made, 4 ml of cells
were harvested by centrifugation at 6000 g for 10 min (4°C).
Using the Bio-Rad CHEF Bacterial Genomic DNA Plug Kit
(#170–3592), harvested cells were resuspended in Cell
Suspension Buffer (10 mM Tris pH 7.2, 20 mM NaCl,
50 mM EDTA), equilibrated at 50°C, and mixed with a 2%
low melting point agarose solution (also equilibrated at
50°C). The cell/agarose mixture was immediately poured
into a plug mold and allowed to solidify at 4°C for 15 min.
Afterwards, each plug was retrieved and incubated in a
1 mg ml−1 lysozyme solution for 2 h at 37°C, followed by an
overnight incubation in a 1 mg ml−1 Proteinase K solution.
Plugs were then washed four times in Wash Buffer (20 mM
Tris pH 8.0, 50 mM EDTA) and went on to be used for two-
dimensional gel electrophoresis. Extra plugs were stored
stably at 4°C for up to 3 months.
54 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
Digestion of agarose-embedded genomic DNA
Agarose plugs containing genomic DNA were immersed in
1 ml TE buffer (10 mM Tris pH 8.0, 1 mM EDTA) and chilled
on ice for 15–30 min, inverting occasionally. The TE buffer
was then replaced with 300 μl of the appropriate 1× restriction
endonuclease buffer, and chilled on ice again for 15–30 min.
The restriction endonuclease buffer was then replaced with
fresh buffer containing 100 units of the restriction enzyme,
and the plugs were incubated overnight at 37°C.
Two-dimensional agarose gel electrophoresis
Following the overnight digestion, plugs were chilled on ice
and the buffer was carefully removed. Plugs were then equili-
brated in 1 ml of 0.5× TBE running buffer (44.5 mM Tris-HCl,
44.5 mM borate, 1 mM disodium EDTA) on ice for 15–30 min.
Plugs were carefully loaded into the wells of a 12 × 14 cm
0.4% agarose gel and covered with molten 0.5% low melting
point agarose. The wells were allowed to solidify for 15 min at
4°C, and the gel was run in 0.5× TBE buffer at 15 V for 24 h.
Following this first-dimension run, the second dimension gel
was prepared as outlined by Friedman and Brewer (1995).
Briefly, a slice from each lane was carefully cut out from the
first-dimension gel at appropriate positions containing the
targeted restriction fragments and placed at a 90° counter-
clockwise orientation in a 20 × 25 cm gel box. Molten 1%
agarose containing ethidium bromide (0.3 μg ml−1) was then
poured over the gel slices and allowed to solidify. This result-
ing 2D gel was run at 150 V for 15 h in 0.5× TBE buffer
containing ethidium bromide (0.3 μg ml−1). In order to visual-
ize replication intermediates, a Southern blot was performed
on the 2D gel using radioactive DNA probes specific to the
region(s) of interest. Probes were generated by PCR and
were radiolabelled using the Random Primed DNA Labeling
kit from Roche. All blots were visualized using the Storm 820
Phosphorimager (Molecular Dynamics) and quantified with
ImageQuant software (Molecular Dynamics).
Deep sequencing analysis
DNA used for deep sequencing analysis was prepared by
harvesting 4 ml of cells grown in LB to an OD599 of 0.5 and
extracting genomic DNA using the Qiagen Genomic-tip 100/G
kit and Genomic DNA Buffer Set. To prepare chloramphenicol-
treated DNA samples, cells were grown to an OD599 of 0.5
and incubated with chloramphenicol (150 μg ml−1) for 90 min
before harvesting. Hydroxyurea-treated samples were pre-
pared by growing cells at 30°C in M9 CAA medium to an OD599
of 0.2, then adding hydroxyurea to a concentration of 80 mM
and incubating for 4 h. Note that rnhA− dnaA− double mutants,
used in a subset of the genome profile experiments, are
unable to grow on rich media (LB) plates (Torrey et al., 1984).
While our double mutant also failed to grow on LB plates, it
consistently grew in either minimal media or LB broth when
inoculated from colonies on minimal plates. For consistency
with all other experiments, we therefore used rnhA− dnaA−
double mutants grown in LB broth (inoculated from colonies on
minimal media agar plates).
The genomic DNA was sequenced via Illumina HiSeq™
(50 bp or 100 bp single reads) at the Sequencing Facility of the
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Duke Institute for Genome Sciences & Policy (IGSP). The raw
sequence read data (fastq files) have been deposited in the
National Center for Biotechnology Information Sequence
Read Archive (Accession Number SRP026465). The
sequencing reads (approximately 13 to 25 million per sample;
17 million average) were imported into Geneious Pro (Biomat-
ters) and assembled to the reference chromosome MG1655
(GenBank Accession Number 000913.2). The assembly
process was set to medium sensitivity on Geneious, with the
following parameters: 10–15% gaps allowed per read; word
length of 18; index word length of 13; words repeated more
than 12 times ignored; 20% maximum mismatches per read;
and maximum ambiguity of 4. BAM files of the resulting
assembly data were exported to JMP Genomics (SAS), where
read counts were generated for 100 bp bins across the length
of the chromosome by adding the read counts together from
each of the 100 base pair positions (note that every 50-base
oligonucleotide read therefore gets counted 50 times, once
for each base pair position). The deep sequencing data are
located in Datasets S1–S3.
By default, the Geneious software maps sequencing reads
from repeated regions of the chromosome randomly during
assembly, and this would produce inaccurate read counts for
these regions. Bins containing repeated regions were there-
fore removed from the raw read count data for the samples
prior to analysis. First, using the assembly data for our refer-
ence strain, chloramphenicol-treated MG1655 (MG+CAM),
we identified 719 bins (out of 46 397) in the chromosome that
contained repeated regions, along with 223 additional bins
whose read counts were lower than 4 standard deviations
from the mean of the read counts in the set. Second, addi-
tional bins containing annotated RIP and REP elements, rrn
genes, and mobile elements in MG1655 greater than 200 bp
in length were removed. Third, as most of the strains used
contained an rnhA mutation, and some also contained a
deletion of the Eut/CPZ55 prophage (strains AQ12251,
AQ12257, and their derivatives; see Figs 5C, 6, 8, 9B and C),
the bins for the rnhA gene and the prophage were also
included for removal. Collectively, these identified bins (1281
in total) were deleted from the raw read count data for each
sample strain analysed, and are listed in Dataset S5.
Following the removal of the repeat bins above, the raw
read counts for each sample set were divided by the values
from the corresponding bins in the MG+CAM reference strain
dataset. This ratio was then multiplied by the ratio of total
reads in the MG+CAM reference set over total aligned reads
in the relevant sample, to correct for the somewhat different
numbers of aligned reads in the various samples. The Log2
values of the corrected sample/reference ratios were then
calculated and plotted against genomic position to generate
the replication profile charts. A LOESS utility (Peltier Tech;
http://peltiertech.com/WordPress/loess-utility-for-excel) was
used to generate a smoothed curve on the corrected ratios.
LOESS calculates a moving weighted regression across the
data in Microsoft Excel, and we calculated the Log2 values of
the LOESS regression values for plotting in the figures. The
number of points for the moving regression (Npts) in each
case was set to 2000 (corresponding to 200 kb). To compen-
sate for the circular nature of the E. coli chromosome, the first
and last 1000 data points in each dataset were copied to the
end and beginning of the database, respectively, prior to

running the LOESS calculations. The LOESS regression was
then performed on the data as described above, and the
calculated values for the copied data points were removed
before plotting the LOESS values against genomic position,
laid over the replication profile charts.
Acknowledgements
This research was supported in part by NIH grants to KNK
(GM72089) and JDW (GM084003). We are very grateful to
David MacAlpine and Jason Belsky, who provided invaluable
advice on the NGS analyses. The authors declare that they
have no conflicts of interest with regard to this study.
References
Aguilera, A., and Garcia-Muse, T. (2012) R loops: from tran-
scription byproducts to threats to genome stability. Mol Cell
46: 115–124.
Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y.,
Baba, M., et al. (2006) Construction of Escherichia coli
K-12 in-frame, single-gene knockout mutants: the Keio col-
lection. Mol Syst Biol 2: 2006 0008.
Bidnenko, V., Ehrlich, S.D., and Michel, B. (2002) Replication
fork collapse at replication terminator sequences. EMBO J
21: 3898–3907.
Bierne, H., Ehrlich, S.D., and Michel, B. (1991) The replica-
tion termination signal terB of the Escherichia coli chromo-
some is a deletion hot spot. EMBO J 10: 2699–2705.
Bierne, H., Ehrlich, S.D., and Michel, B. (1997) Deletions at
stalled replication forks occur by two different pathways.
EMBO J 16: 3332–3340.
Boubakri, H., de Septenville, A.L., Viguera, E., and Michel, B.
(2010) The helicases DinG, Rep and UvrD cooperate to
promote replication across transcription units in vivo.
EMBO J 29: 145–157.
Breier, A.M., Weier, H.U., and Cozzarelli, N.R. (2005) Inde-
pendence of replisomes in Escherichia coli chromosomal
replication. Proc Natl Acad Sci USA 102: 3942–3947.
Brewer, B.J. (1988) When polymerases collide: replication
and the transcriptional organization of the E. coli chromo-
some. Cell 53: 679–686.
Camps, M., and Loeb, L.A. (2005) Critical role of R-loops in
processing replication blocks. Front Biosci 10: 689–698.
Chandler, M.G., and Pritchard, R.H. (1975) The effect of
gene concentration and relative gene dosage on gene
output in Escherichia coli. Mol Gen Genet 138: 127–141.
Court, D.L., Swaminathan, S., Yu, D., Wilson, H., Baker, T.,
Bubunenko, M., et al. (2003) Mini-lambda: a tractable
system for chromosome and BAC engineering. Gene 315:
63–69.
Couturier, E., and Rocha, E.P. (2006) Replication-associated
gene dosage effects shape the genomes of fast-growing
bacteria but only for transcription and translation genes.
Mol Microbiol 59: 1506–1518.
De Septenville, A.L., Duigou, S., Boubakri, H., and Michel, B.
(2012) Replication fork reversal after replication-
transcription collision. PLoS Genet 8: e1002622.
Diaz, R., and Pritchard, R.H. (1978) Cloning of replication
origins from the E. coli K12 chromosome. Nature 275:
561–564.
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
Replication in RNase HI-deficient Escherichia coli 55
Diaz, R., Barnsley, P., and Pritchard, R.H. (1979) Location
and characterisation of a new replication origin in the E. coli
K12 chromosome. Mol Gen Genet 175: 151–157.
Duggin, I.G., and Bell, S.D. (2009) Termination structures in
the Escherichia coli chromosome replication fork trap. J
Mol Biol 387: 532–539.
French, S. (1992) Consequences of replication fork move-
ment through transcription units in vivo. Science 258:
1362–1365.
Friedman, K.L., and Brewer, B.J. (1995) Analysis of replica-
tion intermediates by two-dimensional agarose gel electro-
phoresis. Methods Enzymol 262: 613–627.
Gan, W., Guan, Z., Liu, J., Gui, T., Shen, K., Manley, J.L., and
Li, X. (2011) R-loop-mediated genomic instability is caused
by impairment of replication fork progression. Genes Dev
25: 2041–2056.
Guy, C.P., Atkinson, J., Gupta, M.K., Mahdi, A.A., Gwynn,
E.J., Rudolph, C.J., et al. (2009) Rep provides a second
motor at the replisome to promote duplication of protein-
bound DNA. Mol Cell 36: 654–666.
Helmrich, A., Ballarino, M., and Tora, L. (2011) Collisions
between replication and transcription complexes cause
common fragile site instability at the longest human genes.
Mol Cell 44: 966–977.
Hong, X., Cadwell, G.W., and Kogoma, T. (1995) Escherichia
coli RecG and RecA proteins in R-loop formation. EMBO J
14: 2385–2392.
Hong, X., Cadwell, G.W., and Kogoma, T. (1996) Activation of
stable DNA replication in rapidly growing Escherichia coli at
the time of entry to stationary phase. Mol Microbiol 21:
953–961.
Horiuchi, T., Fujimura, Y., Nishitani, H., Kobayashi, T., and
Hidaka, M. (1994) The DNA replication fork blocked at the
Ter site may be an entrance for the RecBCD enzyme into
duplex DNA. J Bacteriol 176: 4656–4663.
Kogoma, T. (1978) A novel Escherichia coli mutant capable of
DNA replication in the absence of protein synthesis. J Mol
Biol 121: 55–69.
Kogoma, T. (1997) Stable DNA replication: interplay between
DNA replication, homologous recombination, and tran-
scription. Microbiol Mol Biol Rev 61: 212–238.
Kogoma, T., Hong, X., Cadwell, G.W., Barnard, K.G., and
Asai, T. (1993) Requirement of homologous recombination
functions for viability of the Escherichia coli cell that lacks
RNase HI and exonuclease V activities. Biochimie 75:
89–99.
Kouzminova, E.A., and Kuzminov, A. (2008) Patterns of chro-
mosomal fragmentation due to uracil-DNA incorporation
reveal a novel mechanism of replication-dependent
double-stranded breaks. Mol Microbiol 68: 202–215.
Kuong, K.J., and Kuzminov, A. (2012) Disintegration of
nascent replication bubbles during thymine starvation trig-
gers RecA- and RecBCD-dependent replication origin
destruction. J Biol Chem 287: 23958–23970.
Leela, J.K., Syeda, A.H., Anupama, K., and Gowrishankar, J.
(2013) Rho-dependent transcription termination is essen-
tial to prevent excessive genome-wide R-loops in Escheri-
chia coli. Proc Natl Acad Sci USA 110: 258–263.
Maduike, N.Z. (2012) Native Origins for Constitutive Stable
DNA Replication in Escherichia coli [Dissertation]. Durham,
NC: Duke University.
56 N. Z. Maduike, A. K. Tehranchi, J. D. Wang and K. N. Kreuzer ■
de Massy, B., Fayet, O., and Kogoma, T. (1984a) Multiple
origin usage for DNA replication in sdrA(rnh) mutants of
Escherichia coli K-12. Initiation in the absence of oriC. J
Mol Biol 178: 227–236.
de Massy, B., Patte, J., Louarn, J.M., and Bouche, J.P.
(1984b) oriX: a new replication origin in E. coli. Cell 36:
221–227.
Masters, M., and Broda, P. (1971) Evidence for the bidirec-
tional replications of the Escherichia coli chromosome. Nat
New Biol 232: 137–140.
Merrikh, H., Zhang, Y., Grossman, A.D., and Wang, J.D.
(2012) Replication-transcription conflicts in bacteria. Nat
Rev Microbiol 10: 449–458.
von Meyenburg, K., Boye, E., Skarstad, K., Koppes, L., and
Kogoma, T. (1987) Mode of initiation of constitutive stable
DNA replication in RNase H-defective mutants of Escheri-
chia coli K-12. J Bacteriol 169: 2650–2658.
Mirkin, E.V., and Mirkin, S.M. (2005) Mechanisms of
transcription-replication collisions in bacteria. Mol Cell Biol
25: 888–895.
Mott, M.L., and Berger, J.M. (2007) DNA replication initiation:
mechanisms and regulation in bacteria. Nat Rev Microbiol
5: 343–354.
Muller, C.A., and Nieduszynski, C.A. (2012) Conservation of
replication timing reveals global and local regulation
of replication origin activity. Genome Res 22: 1953–
1962.
Nishitani, H., Hidaka, M., and Horiuchi, T. (1993) Specific
chromosomal sites enhancing homologous recombination
in Escherichia coli mutants defective in RNase H. Mol Gen
Genet 240: 307–314.
Ogawa, T., Pickett, G.G., Kogoma, T., and Kornberg, A.
(1984) RNase H confers specificity in the dnaA-dependent
initiation of replication at the unique origin of the Escheri-
chia coli chromosome in vivo and in vitro. Proc Natl Acad
Sci USA 81: 1040–1044.
Pomerantz, R.T., and O’Donnell, M. (2010) Direct restart of a
replication fork stalled by a head-on RNA polymerase.
Science 327: 590–592.
Potenski, C.J., and Klein, H.L. (2011) R we there yet?
R-loop hazards to finishing the journey. Mol Cell 44: 848–
850.
Rudolph, C.J., Dhillon, P., Moore, T., and Lloyd, R.G. (2007)
Avoiding and resolving conflicts between DNA replication
and transcription. DNA Repair 6: 981–993.
Rudolph, C.J., Upton, A.L., and Lloyd, R.G. (2009) Replica-
tion fork collisions cause pathological chromosomal ampli-
fication in cells lacking RecG DNA translocase. Mol
Microbiol 74: 940–955.
Rudolph, C.J., Upton, A.L., Briggs, G.S., and Lloyd, R.G.
(2010) Is RecG a general guardian of the bacterial
genome? DNA Repair 9: 210–223.
Rudolph, C.J., Upton, A.L., Stockum, A., Nieduszynski, C.A.,
© 2013 John Wiley & Sons Ltd, Molecular Microbiology, 91, 39–56
and Lloyd, R.G. (2013) Avoiding chromosome pathology
when replication forks collide. Nature 500: 608–611.
Sangurdekar, D.P., Hamann, B.L., Smirnov, D., Srienc, F.,
Hanawalt, P.C., and Khodursky, A.B. (2010) Thymineless
death is associated with loss of essential genetic informa-
tion from the replication origin. Mol Microbiol 75: 1455–
1467.
Sharma, B., and Hill, T.M. (1992) TerF, the sixth identified
replication arrest site in Escherichia coli, is located within
the rcsC gene. J Bacteriol 174: 7854–7858.
Sharma, B., and Hill, T.M. (1995) Insertion of inverted Ter
sites into the terminus region of the Escherichia coli chro-
mosome delays completion of DNA replication and disrupts
the cell cycle. Mol Microbiol 18: 45–61.
Simmons, L.A., Breier, A.M., Cozzarelli, N.R., and Kaguni,
J.M. (2004) Hyperinitiation of DNA replication in Escheri-
chia coli leads to replication fork collapse and inviability.
Mol Microbiol 51: 349–358.
Skovgaard, O., Bak, M., Lobner-Olesen, A., and Tommerup,
N. (2011) Genome-wide detection of chromosomal rear-
rangements, indels, and mutations in circular chromosomes
by short read sequencing. Genome Res 21: 1388–1393.
Sousa, C., de Lorenzo, V., and Cebolla, A. (1997) Modulation
of gene expression through chromosomal positioning in
Escherichia coli. Microbiology 143 (Part 6): 2071–2078.
Srivatsan, A., Tehranchi, A., MacAlpine, D.M., and Wang,
J.D. (2010) Co-orientation of replication and transcription
preserves genome integrity. PLoS Genet 6: e1000810.
Stirling, P.C., Chan, Y.A., Minaker, S.W., Aristizabal, M.J.,
Barrett, I., Sipahimalani, P., et al. (2012) R-loop-mediated
genome instability in mRNA cleavage and polyadenylation
mutants. Genes Dev 26: 163–175.
Torrey, T.A., Atlung, T., and Kogoma, T. (1984) dnaA suppres-
sor (dasF) mutants of Escherichia coli are stable DNA
replication (sdrA/rnh) mutants. Mol Gen Genet 196: 350–
355.
Usongo, V., Tanguay, C., Nolent, F., Bessong, J.E., and
Drolet, M. (2013) Interplay between type 1A topoisomer-
ases and gyrase in chromosome segregation in Escheri-
chia coli. J Bacteriol 195: 1758–1768.
Wang, J.D., Berkmen, M.B., and Grossman, A.D. (2007)
Genome-wide coorientation of replication and transcription
reduces adverse effects on replication in Bacillus subtilis.
Proc Natl Acad Sci USA 104: 5608–5613.
Wimberly, H., Shee, C., Thornton, P.C., Sivaramakrishnan,
P., Rosenberg, S.M., and Hastings, P.J. (2013) R-loops and
nicks initiate DNA breakage and genome instability in non-
growing Escherichia coli. Nat Commun 4: 2115.
Supporting information
Additional supporting information may be found in the online
version of this article at the publisher’s web-site.