International Biodeterioration & Biodegradation xxx (2012) 1e7

Contents lists available at SciVerse ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

The role of the copper-binding enzyme e laccase e in the biodegradation

of polyethylene by the actinomycete Rhodococcus ruber
Miriam Santo, Ronen Weitsman, Alex Sivan*
The Department of Biotechnology Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105, Israel

a r t i c l e i n f o a b s t r a c t

Article history: Polyethylene is considered one of the most durable plastic polymers. Virtually, non-biodegradable
Received 15 January 2012 polyethylene accumulates in the environment, thus posing an ecological threat to man and wildlife.
Received in revised form We have previously isolated a strain of the actinomycete Rhodococcus ruber (designated C208; EC
4 March 2012
1.10.3.2.) capable of utilizing and degrading polyethylene. Here, we report the role of the bacterial
Accepted 4 March 2012
copper-binding enzyme, laccase, in the oxidation and degradation of polyethylene by this strain. Copper
Available online xxx
markedly affected the induction and activity of laccase, resulting in polyethylene degradation. mRNA
quantification by RT-PCR, revealed a 13-fold increase in laccase mRNA levels, in copper-treated cultures
Keywords:
Laccase
compared with the untreated control. Addition of copper to C208 cultures containing polyethylene
Polyethylene enhanced the biodegradation of polyethylene by 75%, as compared with the non-amended control.
Biodegradation Furthermore, when an extracellular isoform of laccase collected from the media of copper-induced cells
Copper-binding enzymes was incubated with polyethylene, reductions of 20% and 15% were obtained in the Average Molecular
Weight (Mw) and Average Molecular Number (Mn) with the polymer, respectively. FTIR analysis of
similar polyethylene films incubated with the extracellular laccase exhibited an increase in the carbonyl
peak, indicating that enzymatic oxidation by laccase plays a major role in the biodegradation of
polyethylene.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction 1998). By contrast, experiments comparing the durability of an

Polyethylene films comprise a massive portion of municipal and
industrial waste. Polyethylene is also used in large quantities in
agriculture for soil mulching and green-house construction. Because
of its high durability, polyethylene accumulates in the environment
at an alarming rate. Accordingly, significant efforts to degrade
polyethylene have been undertaken. Long-term studies aimed at the
biodegradation of polyethylene have, however, yielded limited
results. After ten years of incubation of 14C-labeled polyethylene in
soil, less than 0.5% carbon (in terms of CO2) by weight was derived
from a UV-irradiated polyethylene sheet. Non-irradiated poly-
ethylene emitted less than 0.2% carbon dioxide over the same period
(Albertsson and Karlsson, 1990). Biodegradation of thermo-oxidized
polyethylene incubated with Arthrobacter paraffineus for 3.5 years
resulted in oxidation of the polyethylene and formation of organic
acids. Simultaneously, a small increase in the molecular weight of
the polyethylene was recorded, attributed to the consumption of the
lower molecular weight fragments by the bacteria (Albertsson et al.,
* Corresponding author. Tel.: þ972 8 64619; fax: þ972 8 6479035.
E-mail address: sivan@bgu.ac.il (A. Sivan).
oxidized polyethylene with that of non-oxidized counterpart,
showed only a minimal decrease in the molecular weight of both
polyethylene types after a three months incubation with Penicillium
simplicissimum (Yamada-Onodera et al., 2001). Modification and
degradation of polyethylene with oxidative ad enzymes have also
been attempted. Zhao et al. (2004) reported on the modification of
the surface of polyethylene films that were treated with soybean
peroxidase. Biodegradation of nylon and polyethylene membranes
by the laccase-mediator system has also been demonstrated
(Nishida et al., 2001). However, the three-dimensional structure of
the membrane polymer may have been drastically different from
that of standard polyethylene and the high porosity of the
membranes rendered them very fragile. Accordingly similar exper-
iments on nylon fibers realized far more limited results (Nishida
et al., 1998). Previous studies in our laboratory using enrichment
techniques gave rise to the isolation of several unique soil bacteria
able to grow on low-density polyethylene as a sole carbon source,
reducing up to 11% of its gravimetric weight in 30 days (Gilan et al.,
2004; Hadad et al., 2005). Biodegradation of the polyethylene was
obtained with pre-irradiated (to obtain partial photooxidation) or
non-irradiated films. The maximal degrading activity was obtained
with Rhodococcus ruber strain C208 (Gilan et al., 2004) and with the

0964-8305/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibiod.2012.03.001

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
2 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7
thermophilic bacterium Brevibacillus borstelensis strain 707 (Hadad
et al., 2005).
With these observations in mind, we sought to determine
whether oxidative enzymes such as peroxidases, oxygenases and
laccases play a major place in the biodegradation of polyethylene.
Laccases (phenol oxidases) are a part of a larger group of enzymes
designated as multi-copper enzymes. Such enzymes include three
spectroscopically distinct copper ions (designated type I, II and III)
and are classified, therefore, as multi-copper blue enzymes (Suzuki
et al., 2003).
Laccases are widespread in plants, fungi and bacteria; however,
their biological functions are not yet completely understood. They
have been implicated in many diverse processes such as sporula-
tion, pigment production, rhizomorph formation and lignin
degradation (Coll et al., 1993). Laccase has been used for numerous
biotechnological applications, such as drug analysis to distinguish
morphine from codeine, wine clarification, and most importantly,
in the degradation of several recalcitrant pollutants such as tri-
chlorophenol, alkenes, bisphenol A and fluorene as well as herbi-
cides and other persistent and toxic molecules, in addition to
decolorization of synthetic azo dyes (Mayer and Staples, 2002). In
the present study, we describe an extracellular laccase excreted by
the polyethylene-degrading actinomycete R. ruber strain C208,
isolated by Gillan (Orr) et al. (2004).
We have characterized and optimized the activity of this
bacterial laccase and demonstrated the role of copper in the
induction of extracellular laccase and the involvement of the
enzyme in polyethylene degradation.
2. Materials and methods
2.1. Polyethylene
3
Branched low-density (0.92 g cm ) polyethylene (LDPE) film,
with an average molecular weight of 191,000 (IpitenÒ111; Carmel
Olefins, Haifa, Israel) and thickness of 0.2 mm was produced by
Plastopil Hazorea (Hazarded, Israel) and was kindly provided by Mr.
R. Harpaz, Kibbutz.
2.2. Media and culture conditions
Bacterial cultures of the polyethylene-degrading R. ruber strain
C208 were maintained on nutrient broth (NB) or nutrient agar (NA)
media (Difco). Unless otherwise specified, liquid cultures (50 ml)
were incubated in flasks (250 ml) on a rotary shaker
(150 rpm min1) at 30  C. The synthetic medium (SM) used for
assaying the biodegradation of polyethylene and biofilm formation
contained the following elements (in distilled water): 1.0 g l1
NH4NO3, 1.0 g l1 K2HPO4, 0.2 g l1 MgSO4$7H2O, 0.15 g l1 KCl,
0.1 g l1 CaCl2$2H2O and each of the following microelements:
1.0 mg l1 FeSO4$6H2O, 1.0 mg l1 ZnSO4$7H2O and 1.0 mg l1
MnSO4.
To facilitate accurate measurement of residual polyethylene
weight, bacterial biofilms were washed off the polyethylene surface
with 2% (v/v) sodium dodecyl sulfate (SDS) overnight, followed by
rinsing with distilled water (Hadad et al., 2005).
2.3. Polyethylene degradation assays (gravimetric and molecular
weight losses)
Polyethylene films (Carmel Olefins, Haifa, Israel) were added to
SM medium as the sole carbon source. Two ml culture aliquots
were withdrawn, washed by centrifugation, re-suspended in SM
and added to polyethylene-containing SM (final cell density
0.5e1.0  107 cells/ml). At the end of the desired incubation time,
Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
the biofilm was removed and the polyethylene was dried overnight
and weighed gravimetrically. Laccase activity was determined at
37  C, in potassium phosphate buffer (pH 7; modified after
Johannes and Majcherczyk, 2000). Specific activity was defined as
the amount of protein required to oxidize 30 mM of 2,6-
dimethoxyphenol (DMP) by increasing absorbance at 470 nm by
1 m Au during 1 h. Laccase activity tests were carried out in 96-well
plates (Kartell, Noviglio, Italy) using an ELISA reader (EL808, BioTek
Inc., Winooski, VT) set at 470 nm at 10-min intervals. Specific
activity of laccase was expressed as the Delta O.D. (470 nm) h1 mg
protein1.
Laccase activity for rapid screening was also assayed on SM agar
plates supplemented with 0.1% xylan as carbon source and 0.04%
(w/v) of the laccase indicators Ramazol Brilliant Blue R or syrin-
galdazine (Yaver et al., 1996; Kiiskinen et al., 2004).
2.4. Induction of laccase activity
Strain C208 cells were cultured in 250 ml flasks each containing
50 ml SM supplemented with 0.1% mannitol as carbon source on
a rotary shaker (150 rpm) at 30  C for up to 6 days. Copper (5, 10 and
20 mM) was added daily. A cell-free fraction was obtained by
centrifugation at 17,000 g. The supernatant was dialyzed over-
night against 5 l of potassium phosphate buffer (0.2 mM, frozen
at 85  C and lyophilized). Lyophilyzates originating from 50 ml of
dialyzates were redissolved in 1 ml potassium phosphate buffer.
Laccase activity was measured at 5- or 10-min intervals, for up to
110 min.
2.5. Effect of pH on laccase activity
Determination of the pH range that facilitates extracellular
laccase activity was realized using lyophilized supernatants (as
above) dissolved in potassium phosphate buffer (0.2 mM) to attain
the desired pH levels (ranging from 5.8 to 8.0). Laccase activity, at
each pH level was determined using DMP as substrate. To eliminate
the effects of pH on oxidation of DMP pre-set pH solutions sup-
plemented with copper and incubated without bacteria provided
baseline values and served as control.
2.6. Effects of temperature on laccase activity
Crude enzyme-containing lyophilyzates originating from 50 ml
of supernatant were re-suspended in 1 ml of potassium phosphate
buffer (pH 7.0) and maintained for 30 and 120 min at various
temperatures (30, 50, 70 and 100  C) to test enzyme thermosta-
bility. Relative residual activities were calculated proportional to
the activity of enzyme incubated at 30  C. The effect of temperature
on laccase activity was measured at different temperatures
(30e100  C), after a 20-min incubation with DMP.
2.7. Enzymatic degradation of polyethylene films
Fifty ml of bacterial culture containing 1010 cells/ml were pel-
leted by centrifugation. The supernatant was dialyzed and lyophi-
lized as mentioned above to obtain a crude extracellular laccase
preparation. The dried enzyme was concentrated ten-fold upon
dissolution in 5 ml potassium buffer (pH 7.0), filter sterilized and
applied daily to three polyethylene films, previously irradiated by
UV light for 60 h (3 cm  3 cm, approximate weight 100 mg), in
50 ml flasks on a rotary shaker (100 rpm) at 37  C. Sterile potassium
phosphate buffer was added daily to control treatments. Experiments
with Trametes versicolor laccase (Sigma) were similarly using
a culture filtrate with 1.5 U/ml laccase activity with the exception of
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7
the use of acetate buffer (pH 4.5; the preferred acidity for fungal
laccases).
2.8. Analytical measurements of polyethylene
Changes in polyethylene structure following UV irradiation and
the subsequent incubation with bacteria or enzyme were analyzed
by ATR-FTIR (Impact 410, Nicolet, Ettingen, Germany), using the
ATR 350 method with a ZnSe crystal. Enzymatic oxidation of
polyethylene film was expressed as the carbonyl index, AC ¼ O:A
CH2 (i.e. the ratio the absorbance peak of carbonyl at 1712 cm1 to
that of CH2 at 1462-cm1, which served as an internal standard).
Differential Scanning Colorimetry (DSC) Crystallinity and melting
behavior were quantified with a DSC20 (Mettler Toledo, Columbus,
OH), using samples weighing 1e5 mg. The heating and cooling
rates were 10  C/min, with thermo-grams being recorded in heat-
ing from 50  C to 160  C. Crystallinity was calculated using Star-E
software for thermal analysis, version SW 9.01 (Mettler Toledo).
2.9. Dependence of laccase on copper
The specificity and the effect of copper on laccase activity were
further studied using the high-affinity copper chelator e Tetra
ethylene pentamine (TEPA). C208 was cultured for 4 days in SM
containing 20 mM Cu and dialyzed against potassium phosphate
buffer, supplemented with 0.2 mM TEPA and incubated for 30 min at
room temperature (R.T.). The samples were amended (or not) with
20 mM Cu and incubated (R.T.) for additional 30 min. The laccase
activity (2,6-dimethoxyphenol oxidation) was determined after
each of the 30 min incubation (R.T.). SM void of Cu or TAPA served
as control.
2.10. Gel Permeation Chromatography (GPC)
Analysis of the molecular weight of polyethylene samples was
performed at the Technion, Israel Institute of Technology, using an
Alliance GPC-2000 high temperature GPC device (Waters Corp.,
Milford, MA). Data processing was performed using Millennium
Ver. 4.2 software (Waters.).
2.11. Partial sequencing of strain C208 laccase
Total genomic DNA from bacterial cultures grown overnight was
extracted using a MoBio Microbial DNA isolation kit (MoBio Labo-
ratories, Solana Beach, CA). The purified DNA was stored at 20  C
until used. DNA concentrations were determined with an NlaD-
1000 UVeVis spectrophotometer (NanoDrop Technologies, Wil-
mington, DE). DNA amplification was performed in iTGradient
thermocycler (Biometra GmbH, Göttingen, Germany). The PCR
reaction mixtures contained 50 ml Reddy Mix (PCR master mix
containing 1.5 mM MgCl2 and a 0.2 mM concentration of each
deoxynucleoside tripotassium phosphate (ABgene, Surrey, United
Kingdom), 4 pmol each of the forward and reverse primers, (Sigma)
4 ml of the DNA template and water to bring the total volume to
100 ml. A laccase fragment was amplified (using an initial dena-
turing hot start of 4 min at 95  C followed by 30 cycles of the
following incubation pattern: 94  C for 30 s, 50  C for 40 s, and 72  C
for 1.5 min) with the sense primer, 1F (50 CGCAACGACATGGACGGN
30 ) and the anti-sense primer, 1R (50 TAGTCGTTGTGGCAGTGN 30 ).
Degenerate primers were designed and produced based, mainly, on
the homology with the nucleotide sequence around the copper-
binding sites of laccases from Streptomyces lavendulae (AB092576)
and Rhodococcus RHA1YP (702340). An additional fragment was
sequenced using the sense primer, 2F (50 CCGTCCACTCGACCCGN 30 )
and the anti-sense primer, 1R. Sequencing was performed using an
Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
3
ABI PRISM dye terminator cycle sequencing ready reaction kit with
AmpliTaq DNA polymerase FS and ABI model 373A DNA sequencer
(PerkineElmer, Waltham, MA).
2.12. Total RNA extraction
Bacterial cultures were grown on SM supplemented with 0.1%
mannitol, with or without copper entation (20 mM/day). After 2
days, 1 ml (109 cells) aliquot was remo1ved and centrifuged at
16,000 rpm for 1 min. Extraction of total RNA was performed using
of Illustra RNA spin mini kit (GE healthcare, Uppsala, Sweden),
according to the manufacturer’s instructions. RNA samples were
processed immediately after extraction.
Reverse transcriptase and quantitative PCR were performed
using PowerScript Reverse Transcriptase (Clonetech, Mountain
View, CA), according to the manufacturer’s instructions, in a total
reaction volume of 20 ml. Briefly, the cDNA template was diluted
ten-fold and amplified in a thermocycler combined with a fluores-
cence spectrometer (ABI 7000 sequence detection system, Applied
Biosystems, Foster City, CA). For each reaction 10 ml of two-fold
SYBR Advantage qPCR Premix (Clonetech) was mixed with 0.4 ml
of the forward and reverse primers, 0.4 ml ROX dye, 2 ml cDNA
diluted ten-fold and 6.8 ml of double-distilled water. Primers for
amplification of the 220-laccase mRNA segment (220 bp) were:
Forward e TGCTCGGTACCGACCTGAGTN and Reverse e AGAC-
CAGCGCGAAGGTGTGCCCGT1G. Detection of the ‘housekeeping
gene’ 16S rRNA was performed with the universal primers: 8F
GGATCCAGACTTTGAT(C/T)(A/C)TGGCTAG (Weisburg et al. (1991))
and 341R CTGCTGCCTCCCGTAGG (defining a 360 bp segment; Saito
et al. (2006)) The real-time cycle consisted of 2 min at 50  C and
15 s at 95  C, followed by 40 cycles of 15 s at 95  C and 1 min at
60  C. Analysis of relative expression was achieved with ABI Prism
700 SDS software (Applied Biosystems).
3. Results
3.1. pH optimum and thermal stability of laccase
Our working hypothesis was that biodegradation of poly-
ethylene can be affected by oxidative enzymes. We have detected
the secretion of laccase by strain C208 (Accession Number: DSM
45332) upon oxidation of the laccase-specific substrates, syringal-
dazine and Ramazol Brilliant Blue R. Further characterization of the
effects of pH on laccase activity revealed that the optimal pH was 7.
Strain C208 laccase exhibited high level of thermal stability, only
26% and 36% activity were lost during incubation at 100  C for 30
and 120 min, respectively (Table 1). Preliminary tests to determine
laccase stability after long-term incubation revealed that optimal
activity was obtained at 70  C (Fig. 1). However, at that tempera-
ture, a decrease of 40% in laccase activity was obtained after 20 h
incubation with DMP as substrate (Table 1). Therefore, enzymatic
assays with polyethylene were conducted at 37  C. Treatment of
Table 1
Temperature stability of laccase of Rhodococcus ruber.
Residual laccase activity (%)
Temp.  C 30 min 120 min
0 100 100
50 97 88
70 86 78
100 74 64
Crude enzyme was incubated at 30  C or 120 min. Residual activity was calculated
relatively to enzyme activity at 30  C.
4 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7

0.2
2000 Control

(ΔO.D. 490 nm) hr-1(μg protein)-1

20 µM Cu+2
Activity (mAu/min)

20 µM Fe+3
0.16

Laccase specific activity

1500 20 µM Mg+2
20 µM Mn+2

1000 0.12

500 0.08

0 0.04
20 30 40 50 60 70 80 90 100 110
Temperature (ºC)
0
Fig. 1. Temperature dependence of C208 laccase activity. Crude enzyme was incubated
0 10 20 30
in potassium phosphate buffer with DMP for 20 min at various temperatures. Activity
Time (min)
was determined by measuring DMP oxidation at 490 nm after incubation.
Fig. 3. Laccase activity as affected by metal ions.

crude laccase with Proteinase K resulted in complete loss of

oxidative activity (not shown).
A number of additives (such as ethanol and xylan) and growth
conditions were tested as potential inducers of laccase. The best of
which was copper. Extracellular laccase activity, as well as total
protein production and growth were monitored every two days for
up to 6 days. Optimization of laccase production was carried out in
the presence of different concentrations of copper in cultures
grown with 0.1% (w/v) mannitol as carbon source. A daily addition
of copper up to 20 mM after six days of incubation resulted in an
increase in the specific activity of laccase (Fig. 2). While higher
concentrations had no effect on laccase activity (not shown), the
binding specificity of other metal ions revealed that copper
exhibited the highest level of specifity (Fig. 3).
In the absence of an effective laccase inhibitor we have used
a specific copper chaelator. TEPA. The high affinity of Cu to TEPA
resulted in chaelation of copper ions making them unavailable for
the laccase. Consequently, resulting in loss of enzymatic activity.
However, further addition of Cu resulted in full restoration of
450
- cu
400 + 5µM cu
+ 10µM cu
350
+ 20µM cu
Activity (mAu/min)
laccase activity (Fig. 4). Since copper increased the production of
extracellular laccase in strain C208, we proposed that if laccase is
involved in polyolefin biodegradation, addition of copper may
improve biodegradation by strain C208. Fig. 5 shows the effect of
addition of copper on polyethylene biodegradation in cultures of
C208 grown on polyethylene films as the sole carbon source. The
data show that addition of copper enhanced polyethylene biodeg-
radation by ca. 75%, as compared to non-amended cultures. On the
other hand, both biodegradation analyses showed no effect on
polyethylene when tested in a sterile medium amended with
copper (not shown). This result was confirmed by DSC analysis,
which revealed the difference in biodegradation of the amorphous
polyethylene fraction relative to that of the crystalline (Fig. 6). As
expected, amorphous polyethylene is degraded first. Therefore, the
enhancement of biodegradation by copper resulted in an increase
in the relative amount of the crystalline fraction. To verify the
hypothesis that extracellular laccase activity of C208 is involved in
polyethylene biodegradation, a culture of C208 cells was grown in
the presence of copper as described above. After six days with
optimal copper concentrations, crude extracellular enzyme was
collected and applied to polyethylene films. After two weeks of

300

250

200

150

100

50

0
0 2 4 6
Time (days)
Fig. 2. The effect of copper concentration on specific activity of laccase in Rhodococcus
ruber. Bacterial cultures were incubated for up to 6 days in synthetic medium sup- Fig. 4. The effect of stepwise addition of copper and the copper chelator, tetraethylene
plemented with 0.1% mannitol. Varying concentrations of copper were added daily. pentamine (TEPA), on extracellular laccase-specific activity in C208. The specific
Laccase-specific activity was expressed as the change in absorbance (490 nm) obtained activity was determined in void of copper and TEPA (control) free SM. Consecutive
by oxidation of 2,6-dimethoxyphenol (DMP) during 1 h of incubation with 1 mg incubation periods, 30 min each, was carried out with 20 mM of CuSO4, followed by
extracellular protein. addition of 0.2 mM of TEPA and finally with additional 20 mM of CuSO4.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7 5

Table 2
Molecular weight changes of polyethylene after exposure to crude extracellular
laccase from Rhodococcus ruber.

Sample Molecular number (Mn) Molecular weight (Mw) MWD

Control 40,383 116,453 2183
Laccase 34,201 93,646 2738
Change (%) 15 20 5

Polyethylene samples treated with laccase for two weeks were analyzed by Gel
Permeation Chromatography.

organisms, as well as primers for conserved sequences at the

Fig. 5. Enhancement of biodegradation of polyethylene films by copper. Polyethylene
films (3  3 cm) were incubated for 30 days with strain C208 in carbon-free synthetic
medium (SM) amended with 50 mM CuSO4. Sterile SM served as a control.
beginning of the gene. The deduced amino acid sequence consists
of 424 residues (Fig. 7). All four copper-binding sites characteristic
of laccases were found in the deduced amino acid sequence of
strain C208 laccase. Comparative phylogenetic analyses of the
sequencing ClustalW and MEGA sequence alignment programs
revealed that C208 laccase is highly similar to many multi-copper
oxidases (Fig. 8).

incubation with the extracellular fraction containing laccase, the

films were analyzed by FTIR microscopy. The carbonyl peak of the
UV-irradiated films incubated with laccase increased by almost
40%, as compared to the laccase-free control (unpublished). Simi-
larly, the calculated carbonyl index of the polyethylene increased
from 0.154 in the control to 0.214 after the laccase treatment. On
the other hand, T. versicolor laccase had no effect on the FTIR
spectrum of the polyethylene films (data not shown). In order to
establish a relationship between laccase activity and polyethylene
biodegradation, samples of irradiated polyethylene incubated for 2
weeks with extracellular laccase were analyzed by GPC to detect
changes in the average molecular weight (Mw) and average
molecular number (Mn). The results clearly indicated a reduction in
Mw and Mn of approximately 20% and 15%, respectively (Table 2).

3.2. Sequencing of the laccase gene

Partial sequencing (1273 bp) of the laccase gene was obtained

using primers for copper-binding regions of laccases in similar

Fig. 6. Differential Scanning Calorimetry (DSC) analysis of polyethylene biodegrada-

tion with addition of copper. Polyethylene films were incubated for 30 days with C208
in carbon-free synthetic medium (SM) containing 50 mM CuSO4. Sterile SM served as
a control. Fig. 7. Nucleotide sequence and the deduced amino acid of C208 laccase.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
6 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7
Fig. 8. Alignment of putative copper-binding motifs of C208 and of other laccases.
3.3. Induced transcription of laccase mRNA
To determine whether laccase activity was simply enhanced by
copper addition or rather was a result of an induction effect relative
real-time (RT) PCR was used to analyze expression levels of laccase
mRNA with or without copper supplementation (Fig. 9). mRNA
levels of the laccase gene were inspected and normalized to the
amount of a ‘housekeeping gene’, in this case 16S ribosomal RNA. To
test for the specificity of the primers used for amplification of both
genes, a dissociation plot was generated at a temperatures range of
60e95  C. The singularity of the product was confirmed by the
distinct peak obtained from the dissociation plot (not shown). To
verify that the amplified fragment of the laccase gene was correct,
the fragment was sequenced and aligned with the strain C208
laccase sequence. The resulting alignment shows 100% compati-
bility to that region corresponding to the fragment that bound by
the forward and reverse primers designed for the real-time PCR.
Two experiments, each examining expression levels in cultures
grown on SM supplemented with 0.1% mannitol, with or without
addition of copper, were considered. Each culture was subjected to
relative real-time PCR in triplicate. The resulting relative quantifi-
cation was computed using ABI Prism 700 SDS software, with a 95%
confidence level. The relative quantities of laccase mRNA in cells
grown with copper showed an increase of 8e13-fold after 2 days of
induction (Fig. 9).
25
20
Relative Quantities
15
10
5
0 for degradation of polyethylene at high temperatures, facilitating
- cu - cu + cu + cu
Fig. 9. Relative expression levels strain C208 laccase with or without addition of
copper. Cultures were grown on SM supplemented with 0.1% mannitol with or without
addition of copper, for 2 days. Each experiment was subjected to relative real-time PCR
in triplicates. Data in each experiment represent the average of 3 replicates  S.D.
Polyethylene films were incubated for 30 days with C208 in carbon-free synthetic
medium (SM) containing 50 mM CuSO4. Sterile SM served as control.
Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
4. Discussion
This study elucidates the role of a putative bacterial laccase
enzyme in polyethylene biodegradation. To the best of our knowl-
edge, this is the first reported enzyme that degrades polyethylene.
Laccase is best known in lignin-biodegrading fungi, where it
catalyses the oxidation of aromatic compounds. However, there is
evidence that shows activity of laccase on non-aromatic substrates
(Mayer and Staples, 2002). Since laccase is a copper-binding
enzyme with 4 binding sites that may contribute to its oxidizing
activity (Morozova et al., 2007) we have postulated that copper
might affect laccase activity and contribute to the biodegradation of
polyethylene. The specificity of copper in the oxidative activity of
laccase was demonstrated by the use of a highly specific copper
chaelator (TAPA). The data obtained from RT-PCR, showing up to
13-fold increase in laccase mRNA levels, confirmed that copper is
involved in the induction of laccase by strain C208. Similarly, the
addition of 400 mM of copper resulted in an 18-fold increase in the
laccase activity of T. versicolor (Collins and Dobson 1997). Likewise,
Palmieri et al. (2000) reported that addition of CuSO4 increased the
laccase activity of Pleurotus ostreatus by up to 50-fold. Nevertheless,
laccase of T. versicolor did not affect polyethylene (Santo and Sivan,
unpublished). This may have resulted from difference in enzyme
activity and/or due to mediators present in the laccase preparation
of C208. Partial sequencing of C208 laccase has enabled us to
quantify the induction of laccase mRNA. This finding is supported
by the fact that a variety of species of the actinomycete Strepto-
myces also produced elevated levels of laccase in the presence of
copper (Endo et al., 2002). Likewise, Southern blot analysis of lac-
case cDNA produced by the fungi P. ostreatus and Trametes pubes-
cens revealed that copper has an inductive effect on laccase cDNA
production (Palmieri et al., 2000; Galhaup et al., 2002). One of the
main features of the laccase of strain C208 is its high level of
thermal stability, maintaining more than 60% of its original activity
even after 2 h incubation at 100  C. Conversely, incubation of
T. versicolor laccase for 30 min at 100  C resulted in a complete loss
of activity (Santo and Sivan, unpublished). Furthermore, the
optimal laccase activity of C208 was obtained at 70  C. This
temperature is markedly higher than that of thermostable bacterial
laccases of Bacillus subtilis and the actinomycete S. lavendulae and of
the thermophilic fungus Chaetomium thermophillium (Suzuki et al.,
2003). The high thermal stability of the laccase may pave the way
a high kinetic reaction. In contrast, S. lavendulae and T. versicolor
laccases reached their optimum at around 50  C (Suzuki et al.,
2003; Han et al., 2005). In accordance with the stimulation of lac-
case expression, copper enhanced polyolefin biodegradation (as
determined as weight loss) of polyethylene by 75%, thus confirming
the role of laccase in polyolefin biodegradation. FTIR spectra of
polyethylene revealed that more than 40 percent increase in the
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7
carbonyl index (AC¼O:ACH2), indicating that laccase may play a role
in oxidation of the hydrocarbon backbone of polyethylene. One of
the most important indicators of polyethylene biodegradation is
molecular weight reduction. We data demonstrated that cell-free
laccase incubated with polyethylene resulted in a reduction of ca.
20% and 15% in the average molecular weight and average molec-
ular number of the polyethylene, respectively. These results are
consistent with a reduction of 25% in the weight average molecular
weight of identical polyethylene films incubated for 30 days with
the thermophilic bacterium B. borstelensis (Hadad et al., 2005). The
insignificant changes in the molecular dispersity index indicate
that chain breakage occurs at the ends of the molecular chains or
branches rather than at the center of the molecule. Our findings
advocate that copper and copper-binding enzymes may play
a major role in biodegradation of polyethylene and possibly of other
synthetic polymers.
References
Albertsson, A.C., Erlandsson, B., Hakkarainen, M., Karlsson, S., 1998. Molecular
weight changes and polymeric matrix changes correlated with the formation of
degradation products in biodegraded polyethylene. Journal of Environmental
Polymer Degradation 6, 187e195.
Albertsson, A.C., Karlsson, S., 1990. The influence of biotic and abiotic environments
on the degradation of polyethylene. Progress in Polymer Science 15, 177e192.
Coll, P.M., Fernandes-abalos, J.M., Villanueva, J.R., Santamaria, R., Perez, P., 1993.
Purification and characterization of a phenoloxidase (laccase) from the lignin-
degrading basidiomycete PM1. Applied and Environmental Microbiology 59,
2607e2613.
Collins, P.J., Dobson, A.D.W., 1997. Regulation of laccase gene transcription in I
versicolor. Applied and Environmental Microbiology 63, 3444e3450.
Endo, K., Hosono, K., Beppu, T., Ueda, K., 2002. A novel extracytoplasmic phenol
oxidase of Streptomyces: it’s possible involvement in the onset of morphogen-
esis. Microbiology 148, 1767e1778.
Galhaup, C., Goller, S., Peterbauer, C.K., Strauss, J., Haltrich, A., 2002. Characteriza-
tion of the major laccase isoenzymes from Trametes pubescens and regulation of
its synthesis by metal ions. Microbiology 148, 2159e2169.
Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
7
Gilan(Orr), I., Hadar, Y., Sivan, A., 2004. Colonization, biofilm formation and
biodegradation of polyethylene by a strain of Rhodococcus ruber. Applied
Microbiology and Biotechnology 65, 97e104.
Hadad, D., Geresh, S., Sivan, A., 2005. Biodegradation of polyethylene by the ther-
mophilic bacterium Brevibacillus borstelensis. Journal of Applied Microbiology
98, 1093e1100.
Han, M.J., Choi, H.T., Song, H.G., 2005. Purification and characterization of laccase
from the white rot fungus Trametes versicolor. Journal of Microbiology 43,
555e560.
Johannes, C., Majcherczyk, 2000. Laccase activity tests and laccase inhibitors.
Journal of Biotechnology 78, 193e199.
Kiiskinen, L.L., Rato, M., Kruus, K., 2004. Screening for novel laccase producing
microbes. Journal of Applied Microbiology 97, 640e646.
Mayer, A.M., Staples, R.C., 2002. Laccase: new functions for an old enzyme. Phyto-
chemistry 60, 561e565.
Morozova, O.V., Shumakovich, G.P., Shleev, S.V., Yaropolov, Y., Aiuia, I., 2007. Applied
Biochemistry and Microbiology 43, 523e535.
Nishida, T., Deguchi, T., Kakezawa, M., 1998. Nylon biodegradation by lignin-
degrading fungi. Applied and Environmental Microbiology 63, 329e331.
Nishida, T., Fujisawa, M., Hirai, H., 2001. Degradation of polyethylene and Nylon-66
by the laccase-mediator system. Journal of Polymers and the Environment 9,
103e108.
Palmieri, G., Giardinni, P., Bianco, C., Fontanella, B., Sannia, G., 2000. Copper
induction of laccase iso-enzymes in the ligninolytic fungus Pleurotus ostreatus.
Applied and Environmental Microbiology 66, 920e924.
Saito, D., Leonardo, R.T., Rodrigues, J.L., Tsai, S.M., Hofling, J.F., Goncalves, R.B., 2006.
Identification of bacteria in endodontic infections by sequence analysis of 16S
rDNA clone libraries. J Med Microbiol 55, 101e107.
Suzuki, T., Endo, K., Ir o, M., Tsujibo, H., Miyamoto, K., Inamori, Y., 2003.
A thermostable laccase from Streptomyces lavendulae REN-7: purification,
characterization, nucleotide sequence and expression bioscience. Biotechnology
and Biochemistry 6, 2167e2175.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16 ribosomal DNA
amplification for phylogenetic study. J. Bacteriol 173, 697e703.
Yamada-Onodera, K., Mukumoto, H., Katsuyaya, Y., Saiganji, A., Tani, Y., 2001.
Degradation of polyethylene by a fungus, Penicillium simplicissimum YK. Poly-
mer Degradation and Stability 72, 323e327.
Yaver, D.S., Xu, F., Colightly, E.J., Brown, K.M., Brown, S.H., Rey, M.D., Schneider, P.,
Halkie, T., Mondorf, K., Dalboge, H., 1996. Purification, characterization,
molecular cloning and expression of two laccase genes from the white rot
Basidiomycete vilosa. Applied and Environmental Microbiology 62, 834841.
Zhao, J., Zhian, G., Xiaoyan, M., Guozheng, L., Junlong, W., 2004. Novel surface
modification of high-density polyethylene films by using enzymatic catalysis.
Journal of Applied Polymer Science 91, 3673e3678.