Moore Ucd 5090D 10045

Provided by the author(s) and University College Dublin Library in accordance with publisher
policies., Please cite the published version when available.
Title Genetic control of dairy cow reproduction
Authors(s) Moore, Stephen
Publication date 2015
Publisher University College Dublin. School of Agriculture and Food Science
Link to online version http://dissertations.umi.com/ucd:10045
Item record/more information http://hdl.handle.net/10197/6812
Downaloaded 2018-10-07T23:32:27Z
The UCD community has made this article openly available. Please share how this access
benefits you. Your story matters! (@ucd_oa)
Some rights reserved. For more information, please see the item record link above.
Genetic Control of
Dairy Cow Reproduction
A Thesis submitted to the
National University of Ireland for the Degree of Doctor of Philosophy
By
Stephen Gerard Moore (B.Agr.Sc.)
1
Animal and Bioscience Research Department,
Animal and Grassland Research and Innovation Centre,
Teagasc Moorepark, Fermoy, Co. Cork, Ireland
Head of Programme: Dr. Pat Dillon
2
School of Agriculture and Food Science,
College of Agriculture, Food Science and Veterinary Medicine,
University College Dublin, Belfield, Dublin 4, Ireland
Head of School: Professor Alex Evans
Research Supervisors
1 2
Dr. S.T. Butler Dr. T. Fair
September 2014
Statement of Original Authorship
I hereby certify that the submitted work is my own, was completed while
registered as a candidate for the Degree of Doctor of Philosophy with the
National University of Ireland, and I have not obtained a degree elsewhere
on the basis of the research presented in this submitted work.
Stephen Moore
Table of Contents
Acknowledgements ...................................................................... vii
Publications from this Thesis ...................................................... viii
Peer-reviewed journal publications ........................................................................................ viii
Book chapter ........................................................................................................................... viii
Refereed conference publications ........................................................................................... viii
Technical publications ............................................................................................................... x
List of Tables ................................................................................ xi

List of Figures ............................................................................. xiii
Glossary of Terms ....................................................................... xiv
Thesis Abstract ............................................................................. xv
Introduction to this Thesis ............................................................. 1
References ................................................................................................................................. 3
Literature Review ........................................................................... 6

2.1 Importance of Fertility to Irish Dairy Production ............................................................... 7
2.2 Global Trends in Dairy Cow Fertility ................................................................................. 8
2.3 Genetic Selection in Ireland ................................................................................................ 9
2.4 Fertility in the Dairy Cow ................................................................................................. 10
2.4.1 Postpartum Uterine Health and Resumption of Ovarian Cyclicity ............................ 11
2.4.2 The Oestrous Cycle .................................................................................................... 12
2.4.3 Follicular Environment and Oocyte Competence ...................................................... 13
2.4.4 Corpus Luteum Development .................................................................................... 13
2.4.5 Circulating Progesterone Concentrations ................................................................... 14
2.4.6 Uterine Environment and Embryo Development ....................................................... 15
2.4.7 Embryo Loss .............................................................................................................. 16
2.5 Major Animal Factors Controlling the Reproductive Performance of Dairy Cows ......... 16
2.5.1 Metabolic Status......................................................................................................... 17
2.5.2 Body Condition Score ................................................................................................ 18
2.5.3 Genetic influence on Reproductive Performance ...................................................... 19
2.5.3.1 Genetic Influence on Energy Status .................................................................... 20
2.5.3.2 Genetic Influence on Detailed Reproductive Phenotypes ................................... 20
2.5.3.3 Influence of Genomic Regions and Variants on Reproductive Performance ..... 21
2.5.3.4 Influence of Dairy Breeds on Reproductive Performance .................................. 21
2.5.3.5 Influence of Holstein Strain on Reproductive Performance ............................... 22
i
2.5.3.6 Influence of Genetic Merit for Fertility on Reproductive Performance .............. 23
2.6 Rationale for the Studies Undertaken ............................................................................... 24
2.7 References ......................................................................................................................... 26
Genetic merit for fertility traits in Holstein cows: Transition

period, uterine health and resumption of cyclicity ...................... 43
3.1 Preface............................................................................................................................... 43
3.2 Abstract ............................................................................................................................. 44
3.3 Introduction ....................................................................................................................... 46
3.4 Materials and Methods ...................................................................................................... 48
3.4.1 Animal Model ............................................................................................................ 48
3.4.2 Feed and Management System .................................................................................. 48
3.4.3 Animal Measurements ............................................................................................... 49
3.4.4 Hormone and Metabolite Analysis ............................................................................ 52
3.4.5 Data Handling ............................................................................................................ 53
3.4.6 Statistical Analysis ..................................................................................................... 54
3.5 Results ............................................................................................................................... 55
3.5.1 Milk Production ......................................................................................................... 55
3.5.2 Energy Balance, DMI, BCS and BW ......................................................................... 55
3.5.3 Blood Metabolites and Metabolic Hormones ............................................................ 61
3.5.4 Postpartum Uterine Health ......................................................................................... 64
3.5.5 Postpartum Resumption of Cyclicity ......................................................................... 64
3.6 Discussion ......................................................................................................................... 66
3.6.1 DMI and Energy Balance ........................................................................................... 66
3.6.2 Energy Metabolites and Metabolic Hormones ........................................................... 67
3.6.3 Body Condition Score ................................................................................................ 68
3.6.4 Uterine Health ............................................................................................................ 69
3.6.5 Resumption of Cyclicity ............................................................................................ 70
3.7 Conclusions ....................................................................................................................... 70
3.8 References ......................................................................................................................... 71
Genetic merit for fertility traits in Holstein cows: Factors

affecting circulating progesterone concentrations ....................... 77
4.1 Preface............................................................................................................................... 77
4.2 Abstract ............................................................................................................................. 78
4.3 Introduction ....................................................................................................................... 79
4.4 Materials and Methods ...................................................................................................... 81
4.4.1 Animal Model ............................................................................................................ 81
4.4.1 Study 1 ....................................................................................................................... 84
4.4.1.1 Feed and Management System ........................................................................... 84
ii
4.4.1.2 Animal Measurements ........................................................................................ 84
4.4.1.3 Ovulation Synchronisation .................................................................................. 84
4.4.1.4 Blood Sampling................................................................................................... 85
4.4.1.5 Ovarian Ultrasonography .................................................................................... 85
4.4.1.6 P4 Clearance ....................................................................................................... 85
4.4.1.7 RNA Extraction and cDNA Synthesis ................................................................ 86
4.4.1.8 Primer Design and Reference Gene Selection .................................................... 87
4.4.1.9 Real Time-qPCR ................................................................................................. 87
4.4.2 Study 2 ....................................................................................................................... 87
4.4.2.1 Feed and Management System ........................................................................... 87
4.4.2.2 Ovulation Synchronisation .................................................................................. 88
4.4.2.3 Blood Sampling................................................................................................... 88
4.4.2.4 Ovarian Ultrasonography .................................................................................... 88
4.4.2.5 Blood Sample Analysis ....................................................................................... 88
4.4.2.6 Ultrasound Image Analysis ................................................................................. 91
4.4.2.7 Data Handling ..................................................................................................... 92
4.4.2.8 Statistical Analysis .............................................................................................. 92
4.5 Results ............................................................................................................................... 94
4.5.1 Study 1 ....................................................................................................................... 94
4.5.1.1 Milk Production and Animal Characteristics ...................................................... 94
4.5.1.2 Ovarian Characteristics and Reproductive Hormones ........................................ 94
4.5.1.3 P4 Metabolism .................................................................................................... 98
4.5.2 Study 2 ..................................................................................................................... 100
4.5.2.1 Milk Production and Animal Characteristics .................................................... 100
4.5.2.2 Ovarian Characteristics and Reproductive Hormones ...................................... 100
4.6 Discussion ....................................................................................................................... 105
4.6.1 Preovulatory Follicle Characteristics and Circulating E2 Concentrations ............... 105
4.6.2 Circulating P4 Concentrations ................................................................................. 105
4.6.3 Corpus Luteum Characteristics ................................................................................ 107
4.6.4 P4 Clearance ............................................................................................................ 107
4.7 Conclusions ..................................................................................................................... 108
4.8 References ....................................................................................................................... 109
Follicular fluid and serum metabolites in Holstein cows are

predictive of genetic merit for fertility ...................................... 114
5.1 Preface............................................................................................................................. 114
5.2 Abstract ........................................................................................................................... 115
iii
5.3 Introduction ..................................................................................................................... 116
5.4 Materials and Methods .................................................................................................... 118
5.4.1 Animal Model .......................................................................................................... 118
5.4.2 Feed and Management System ................................................................................ 118
5.4.3 Animal Measurements ............................................................................................. 122
5.4.4 Ovulation Synchronisation ....................................................................................... 122
5.4.5 Blood Sampling ....................................................................................................... 122
5.4.6 Ovarian Ultrasonography ......................................................................................... 122
5.4.7 Ultrasound Image Analysis ...................................................................................... 123
5.4.8 Follicular Fluid Sampling ........................................................................................ 123
5.4.9 Reproductive Hormone Analysis ............................................................................. 124
5.4.10 Metabolite Extraction and Data Analysis .............................................................. 124
5.4.11 Statistical Analysis ................................................................................................. 125
5.5 Results ............................................................................................................................. 127
5.5.1 General Characteristics of the Cows and the Largest Follicle ................................. 127
5.5.2 Fatty Acid Profiles ................................................................................................... 129
5.5.2.1 Composition of Follicular Fluid ........................................................................ 129
5.5.2.2 Composition of Serum ...................................................................................... 134
5.5.3 Amino Acid Profiles ................................................................................................ 137
5.5.3.1 Composition of Follicular Fluid ........................................................................ 137
5.5.3.2 Composition of Serum ...................................................................................... 139
5.6 Discussion ....................................................................................................................... 141
5.6.1 Characteristics of Fatty Acid Profiles ...................................................................... 145
5.6.2 Characteristics of Amino Acid Profiles ................................................................... 146
5.6.3 Ability of Metabolites to Predict Fertility Genotype ............................................... 147
5.7 Conclusions ..................................................................................................................... 147
5.8 References ....................................................................................................................... 148
Differentially expressed genes in the endometrium and corpus

luteum of Holstein cows selected for high and low fertility are
enriched for sequence variants associated with fertility ............ 153
6.1 Preface............................................................................................................................. 153
6.2 Abstract ........................................................................................................................... 154
6.3 Introduction ..................................................................................................................... 155
6.4 Materials and Methods .................................................................................................... 157
6.4.1 Lactating Holstein Cow Genetic Model of Fertility ................................................ 157
6.4.2 Ovulation Synchronization ...................................................................................... 159
6.4.3 Tissue Biopsies ........................................................................................................ 159
6.4.4 RNA Extraction ....................................................................................................... 159
iv
6.4.5 cDNA Library Preparation and Sequencing ............................................................ 160
6.4.6 mRNA Sequence Quality and Alignment ................................................................ 161
6.4.7 Differential Analysis of Gene Expression................................................................ 161
6.4.8 Pathway Analysis of DEG ....................................................................................... 162
6.4.9 Genome-Wide Association Studies using High Density Genotypes ....................... 162
6.4.10 Concordance Analysis............................................................................................ 165
6.4.11 Genome-Wide Association using Whole Genome Sequence ................................ 165
6.5 Results ............................................................................................................................. 166
6.5.1 Gene Expression in Endometrium and Corpus Luteum of High and Low Fertility
cows .................................................................................................................................. 166
6.5.2 Concordance of Differentially Expressed Genes in Endometrium and Corpus Luteum
with High-density Genome-wide Association Studies ..................................................... 168
6.5.3 Sequence Variants Genome-wide Association Study for Fertility........................... 194
6.6 Discussion ....................................................................................................................... 196
6.6.1 Concordance between Differentially Expressed Genes and Fertility Genome-wide
Association Studies ........................................................................................................... 196
6.6.2 PGF2α-related QTL Regions Associated with Fertility ........................................... 201
6.6.3 Steroidogenesis-related QTL Regions Associated with Fertility ............................. 201
6.6.4 mRNA Processing-related QTL Regions and Sequence Variants Associated with
Fertility.............................................................................................................................. 202
6.6.5 Immune-related QTL Regions and Sequence Variants Associated with Fertility ... 203
6.6.6 Energy Status-related QTL Region Associated with Fertility ................................. 204
6.7 Conclusions ..................................................................................................................... 205
6.8 References ....................................................................................................................... 206
General Discussion .................................................................... 216

7.1 Summary ......................................................................................................................... 216
7.2 Chapter 2 – Literature Review ........................................................................................ 216
7.3 Chapter 3 - Genetic Merit for Fertility Traits in Holstein cows: Transition Period, Uterine
Health and Resumption of Cyclicity ..................................................................................... 217
7.4 Chapter 4 - Genetic Merit for Fertility Traits in Holstein cows: Factors Affecting
Circulating Progesterone Concentrations.............................................................................. 218
7.5 Chapter 5 - Differences in Follicular Fluid and Serum Metabolites between Holstein
Cows Selected for High and Low Fertility are Predictive of Fertility Genotype .................. 219
7.6 Chapter 6 - Differentially Expressed Genes in the Endometrium and Corpus Luteum of
Holstein cows Selected for High and Low Fertility are Enriched for Sequence Variants
Associated with Fertility ....................................................................................................... 220
7.7 Limitations ...................................................................................................................... 222
7.7.1 Sample Size .............................................................................................................. 222
7.7.2 Endometrial Biopsy.................................................................................................. 222
7.7.3 Association versus Causation................................................................................... 222
7.8 Future Work .................................................................................................................... 222
7.8.1 Validation of Detailed Phenotypes........................................................................... 222
v
7.8.2 Further Characterisation of Fert+ and Fert- cows .................................................... 223
7.8.3 Mechanisms Linking Metabolism with Fertility ...................................................... 223
7.9 Overall Conclusions and Implications ............................................................................ 224
7.10 References ..................................................................................................................... 227
vi
Acknowledgements
I would like to acknowledge the opportunity presented to me by Teagasc to work
on this project at the Animal and Grassland Research and Innovation Centre,
Moorepark. I am grateful to all my colleagues, led by Dr. Pat Dillon, Head of
Centre with whom I have had the privilege to work it. The commitment shown
by all, to improving dairy production has been inspiring.
To Dr. Stephen Butler, my boss, thank you for your knowledge, encouragement,
advice and friendship. You have been a fantastic mentor. It has been a pleasure to
work with you, and the “repro” team of Jonathon, Sean, Ian, Mary, Hazel,
Francis, Shane, and the two visitors, Drs. Matt Lucy (Mizzou) and Paul Fricke
(UW-Madision). I thoroughly enjoyed every step. Also, I greatly appreciate the
contributions to this thesis, and the assistance and advice of Dr. Trudee Fair and
Prof. Pat Lonergan (University College Dublin).
Thanks to Drs. Jennie Pryce and Amanda Chamberlain, you were both incredibly
welcoming during my three months in Melbourne. Along with Drs. Ben Hayes
and Kath Kemper (DEPI), and Dr. Donagh Berry (Teagasc Moorepark), I thank
each of you for excellent explanations of various topics related to Animal
Breeding and Genetics, and for collaborating on this project.
Technical assistance from Jimmy Quinn (Genexcel Irl. Ltd); Dr. John Browne
(University College Dublin); Drs. Matt McCabe and Paul Cormican (Teagasc
Grange), and Dr. Jos Tibbits (DEPI) is greatly appreciated. Thank you also to
John Paul Murphy, Fergal Coughlan and the Moorepark farm staff for your
assistance and good humour throughout.
To my fellow mischief makers/debaters/pals – Will, Vinny, Brian, PJ, Cathal,

and Ian – you, along with Mags, Ellen, Jess, Aine, Elodie and Hazel made the
past few years go by so quickly. The many laughs with Amy, Eugene, the
Grassland lads, Justine, Marion, Mary, Pat, Roberta, Sean and Yris won’t be
forgotten either! To Dee, Thank you for being a huge support and distraction!
Life would be negative craic without each of you!!
This thesis is dedicated to my Family. A huge thank you to Jer and Kate, for
keeping me grounded, and to my parents, Stevie and Catherine, for your love,
guidance and interest, and for encouraging and supporting my education.
vii
Publications from this Thesis
Peer-reviewed journal publications
Moore, S. G., S. Scully, J. A. Browne, T. Fair and S. T. Butler. 2014. Genetic merit for
fertility traits in Holstein cows: V. Factors affecting circulating progesterone
concentrations. J. Dairy Sci. 97:5543-5557
Moore, S. G., T. Fair, P. Lonergan and S. T. Butler. 2014. Genetic merit for fertility
traits in Holstein cows: IV. Transition period, uterine health and resumption of
cyclicity. J. Dairy Sci. 97:2740–2752
McParland, E. Kennedy, E. Lewis, S. G. Moore, B. McCarthy, M. O’Donovan and D. P.
Berry. 2015. Genetic parameters of dairy cow energy intake and body energy
status predicted using mid-infrared spectrometry of milk. J. Dairy Sci.
98:1310-1320
McParland, S., E. Lewis, E. Kennedy, S. G. Moore, S. T. Butler, B. McCarthy, M.
O’Donovan, J. E. Pryce and D. P. Berry. 2014. Mid-infrared spectrometry of
milk as a predictor of feed intake and efficiency in lactating dairy cows. J.
Dairy. Sci. 97:5863-5871
Book chapter
Butler, S. T., S. B. Cummins, M. M. Herlihy, I. A. Hutchinson and S. G. Moore. 2014.

Optimizing productive and reproductive performance in the grazing cow.
Reproduction in Domestic Ruminants VIII, Japan.
Refereed conference publications
Moore, S. G., M. McCabe, P. Cormican, T. Fair, P. Lonergan, A.J. Chamberlain, J.E.

Pryce and S. T. Butler. 2014. Effect of genetic merit for fertility traits on the
transcriptome of the bovine corpus luteum on day 13 of the oestrous cycle.
Reproduction in Domestic Ruminants VIII, Japan
Moore, S. G., P. Lonergan, T. Fair, and S. T. Butler. 2014. Invited talk: Physiology of
cows with divergent genetic merit for fertility traits during the transition
viii
period. Proceedings of the ADSA/ASAS/CSAS Joint Annual Meeting, Kansas
City, Missouri, 20-24 July
Pryce and S. T. Butler. 2014. The effect of genetic merit for fertility traits on
the transcriptome of the bovine endometrium on d 13 of the oestrous cycle.
Proceedings of the International Cow Fertility Conference, Westport, Ireland,
18-21 May
Pryce and S. T. Butler. 2014. The effect of genetic merit for fertility traits on
the transcriptome of the bovine endometrium on d 13 of the oestrous cycle.
Proceedings of the Agricultural Research Forum, Tullamore, Ireland, 10-11
March
Moore, S. G., P. Lonergan, T. Fair, and S.T. Butler. 2013. Physiology of cows with
divergent genetic merit for fertility traits during the transition period.
Proceedings of the 64th Annual Meeting of the European Federation of Animal
Science, Nantes, France, 26-30 August
Moore, S. G., A.C.O. Evans. P. Lonergan, T. Fair, and S. T. Butler. 2013. The effect of
genetic merit for fertility traits on dry matter intake, milk production and
uterine health. Proceedings of the Agricultural Research Forum, Tullamore,
Ireland, 11-12 March
Moore, S. G., A. O’Gorman, L. Brennan, A.C.O. Evans. P. Lonergan, T. Fair, and S. T.
Butler. 2013. The effect of genetic merit for fertility traits on the follicular fluid
metabolome. Proceedings of the Agricultural Research Forum, Tullamore,
Moran, B., S.T. Butler, S.B. Cummins, S.G. Moore, D.E. MacHugh and C.J. Creevey.
2013. Differential gene expression and alternative transcription in endometrial
tissue of a lactating cow model of fertility. Proceedings of the Agricultural
Research Forum, Tullamore, Ireland, 11-12 March
Moore, S. G., Scully, S., Crowe, M.A., Evans. A.C.O., Lonergan, P., Fair, T. and
Butler, S.T. 2012. Factors affecting plasma progesterone concentration in cows
divergent in genetic merit for fertility traits. Proceedings of the 63rd Annual
Meeting of the European Federation of Animal Science, Bratislava, Slovakia,
27-31 August
Moore, S. G., S. Scully, M.A. Crowe, A.C.O. Evans. P. Lonergan, T. Fair, and S. T.
Butler. 2012. Examination of the factors responsible for differences in
ix
circulating progesterone in lactating dairy cows with divergent genetic merit
for fertility traits. Proceedings of the Agricultural Research Forum, Tullamore,
Technical publications
Stephen Moore and Stephen Butler. 2013. Genetic merit for fertility traits affects
uterine health. TResearch Volume 8: Number 4. Winter 2013
Stephen Moore and Stephen Butler. 2013. The effect of genetic merit for fertility traits
on the uterine health in dairy cows. Proceedings of Moorepark ’13 Irish
Dairying – Harvesting the potential. 3 July
x
List of Tables
Table Title Page

2.1 Fertility performance of the Irish national dairy herd in 2014 8
2.2 Global Trends in Dairy Cow Fertility 9
2.3 Structural characteristics of cells of dioestrus bovine corpus 14
luteum
2.4 Physiological mechanisms associated with the superior 23
reproductive performance of New Zealand strain Holstein-
Friesian cows compared with North American strain Holstein-
Friesian cows
2.5 Milk production and fertility differences between Fert+ and 23
Fert- cows during first lactation
3.1 The mean estimated breeding value (and SD) for both 49
genotypes based on their sire, maternal grandsire and maternal
great grand-sire estimated breeding values
3.2 Ingredient and nutrient composition of the transition period diet 51
3.3 The effect of genetic merit for fertility traits on daily milk 56
production variables during the first 35 weeks of lactation
3.4 The effect of genetic merit for fertility traits on mean BCS and 59
BW variables
3.5 The effect of genetic merit for fertility traits on mean vaginal 64
mucus score in Fert+ and Fert- cows until week eight of
lactation
3.6 The effect of genetic merit for fertility traits on mean PMN 65
counts of the uterus and proportion of cows classified with
endometritis on week 3 and 6 postpartum
grand grand-sire estimated breeding values
4.2 Ingredient and nutrient composition of lactating cow diet 89
4.3 Primer sequences used in real time quantitative PCR 90
4.4 The effect of genetic merit for fertility traits on ovarian 96
characteristics and reproductive hormones during Study 1
4.5 The effect of genetic merit for fertility traits on P4 half-life and 98
MCR
4.6 The effect of genetic merit for fertility traits on ovarian 103
characteristics during Study 2
5.2 Ingredient and nutrient composition of non-lactating and 121
lactating cow diet
5.3 The effect of genetic merit for fertility traits on characteristics 128
of the largest follicle on day 7 of the oestrous cycle
5.4 The effect of genetic merit for fertility traits on the fatty acid 132
composition of follicular fluid
5.5 The effect of genetic merit for fertility traits on the fatty acid 135
composition of serum
5.6 The effect of genetic merit for fertility traits on the amino acid 138
composition of follicular fluid
xi
5.7 The effect of genetic merit for fertility traits on the amino acid 140
composition of serum
5.8 Comparison of significant differences in follicular fluid and 142
serum fatty acid concentrations across five studies
5.9 Comparison of significant differences in follicular fluid and 144
serum amino acid concentrations across three studies
6.2 Processing of endometrium and corpus luteum RNA-seq data 164
6.3 Endometrial genes determined to be differentially expressed 172
between Fert+ and Fert- cows on d 13 of the oestrous cycle
6.4 Corpus luteum genes determined to be differentially expressed 173
between Fert+ and Fert- cows on d 13 of the oestrous cycle
6.5 Categories of differentially expressed genes in the corpus 193
luteum between Fert+ and Fert- cows on day 13 of the oestrous
cycle
6.6 Sequence variants associated with fertility in the Australian 195
dairy cattle population
6.7 QTL regions validated by both the Irish GWAS and Australian 198
GWAS previously associated with female fertility traits
xii
List of Figures
Figure Title Page

2.1 Schematic representation of pasture-based seasonal-calving 7
systems of milk production
2.2 Reproductive outcomes in British-Friesian versus Holstein-Friesian 10
cows
2.3 Sequence of reproductive events in the dairy cow 11
2.4 Temporal profile of milk production and metabolic indicators 17
during the transition period
3.1 Mean daily milk yield and milk solids yield profiles of Fert+ and 57
Fert- cows during 35 weeks of lactation
3.2 Mean dry matter intake and calculated energy balance of Fert+ and 58
Fert- cows from weeks -2 to 5 relative to parturition
3.3 Mean body condition score and body weight from weeks -2 to 35 60
relative to parturition
3.4 Mean circulating glucose, NEFA and BHBA concentrations in 62
Fert+ and Fert- cows from week -2 to 8 relative to parturition
3.5 Mean circulating IGF1 and insulin in Fert+ and Fert- cows from 63
week -2 to 8 relative to parturition
4.1 The effect of genetic merit for fertility traits on dry matter intake, 95
body weight and milk yield during the 4 weeks prior to completion
of the study
4.2 The effect of genetic merit for fertility traits on circulating E2 and 97
P4 concentrations during Study 1
4.3 The effect of genetic merit for fertility traits on progesterone (P4) 99
metabolism
4.4 The effect of genetic merit for fertility traits on reproductive 101
hormones, follicle diameter and CL characteristics during Study 2
4.5 Box plots depicting circulating P4 concentrations from Study 2 104
during d 5, 7, 10 and 13 of the oestrous cycle in Fert+ and Fert-
cows
5.1 ROC curves produced using (a) significant follicular fluid fatty 131
acids (b) significant serum fatty acids (c) significant follicular fluid
amino acids and (d) significant serum amino acids
6.1 Gene body plots of RNA-sequenced libraries 167
6.2 Manhattan plots for calving interval in Australian and Irish dairy 171
cattle populations
xiii
Glossary of Terms
AI Artificial Insemination
BCS Body Condition Score
BHBA β-Hydroxybutyrate
BW Body Weight
CI Confidence Interval
CIDR Controlled Internal Drug Release Device
CL Corpus Luteum
DIM Days in Milk
DMI Dry Matter Intake
E2 Oestradiol
Ebal Energy Balance
EBI Economic Breeding Index
EBV Economic Breeding Value
GH Growth Hormone
GnRh Gonadotropin Releasing Hormone
IGF1 Insulin-like Growth Factor-1
LH Luteinising Hormone
mRNA Messenger Ribonucleic acid
MRP Maternal Recognition of Pregnancy
MSD Mating Start Date
MUFA Monounsaturated Fatty Acid
NAHF North American Holstein Friesian
NEFA Non-Esterified Fatty Acid
P4 Progesterone
PGF2α Prostaglandin F2α
PMN Polymorphonuclear Neutrophils
PUFA Polyunsaturated Acid
ROC Receiver Operating Characteristic
RT-qPCR Real-time Quantitative Polymerase Chain Reaction
SFA Saturated Fatty Acid
TMR Total Mixed Ration
UFL Unité Fourragère Lait
xiv
Thesis Abstract
The decline in dairy cow reproductive performance compromised the productivity and
profitability of dairy production worldwide. The phenotypic performance of lactating
cows with similar proportions of Holstein genes, similar genetic merit for milk
production traits, but either good (Fert+) or poor (Fert-) genetic merit for fertility traits
managed in a standardised environment was compared. The objective of this study was
to elucidate the physiological mechanisms contributing to suboptimal reproductive
performance in lactating dairy cows. Fert+ cows had greater dry matter intake during
the first five weeks postpartum, more favourable metabolic status during the transition
period, better uterine health during early lactation, were more likely to have resumed
cyclicity by week six postpartum, and had greater body condition score and milk
production throughout lactation compared with Fert- cows. Preovulatory concentrations
of oestradiol, corpus luteum volume and circulating concentrations of progesterone
were greater in Fert+ cows compared with Fert- cows during the oestrous cycle. The
metabolic clearance rate of progesterone was similar in both genotypes and differences
in the hepatic mRNA abundance of genes responsible for progesterone metabolism were
minor. Small differences in the abundance of fatty acids and amino acids were detected
between genotypes on day seven of the oestrous cycle. Greater abundance of n-6 and
total polyunsaturated fatty acids and lesser abundance of saturated fatty acids was
observed in the serum of Fert+ cow compared with Fert- cows on day seven of the
oestrous cycle. Fatty acid differences in follicular fluid and serum and amino acid
differences in follicular fluid were highly predictive of fertility genotype. Combination
of transcriptome analysis of the endometrium and corpus luteum on day 13 of the
oestrous cycle with genome-wide association studies and whole genome sequence data
identified quantitative trait loci regions and putative causal mutations associated with
genetic variation in dairy cow fertility. The endometrial expression profile suggested
prolonged uterine inflammation, greater prostaglandin F2α synthesis and secretion, and
compromised energy status in Fert- cows. The luteal expression profile suggested
reduced prostaglandin F2α response, greater steroidogenesis and mRNA processing in
Fert+ cows. Collectively, the results highlight the importance of the uterine environment
and ovarian activity for the phenotypic fertility differences between genotypes. The
study has identified physiological mechanisms controlled by genetic merit for fertility
traits that may support reproductive performance without antagonising milk production.
This novel lactating cow genetic model of fertility represents a robust and valuable
resource for on-going fertility research.
xv
Chapter One
Introduction to this Thesis

The success of dairy production in pasture based systems is centred on achieving high
milk solids production per cow and per hectare from a predominantly pasture-based
diet. A compact calving season in spring is critical to maximising farm productivity and
profitability (Shalloo, 2009). Fertility data indicates that reproductive performance has
been suboptimal for many years but that substantial variation exists between herds
(http://www.icbf.com/wp/wp-content/uploads/2013/07/Dairy-Calving-Stats-2014.pdf).
Intensive international research has concluded that the causes of suboptimal
reproductive performance in dairy herds are multifactorial (Lucy, 2001, Walsh et al.,
2011), with genotype (Butler, 2013, Berry et al., 2014, Khatkar et al., 2014), nutritional
status (Roche et al., 2011, Butler, 2014) and reproductive management (McDougall,
2006, Bisinotto et al., 2014), all contributing factors.
In Ireland, greater milk production of the national herd was facilitated by the use
of a selection index focused solely on the genetic improvement of milk production traits
(Relative Breeding Index). Introgression of North American Holstein genetics into a
primarily British Friesian population resulted in the proportion of Holstein genes in the
dairy herd increasing from 8% in 1990 to 63% by 2001, a period that coincided with the
decline in calving rate to first service from 55% to 44% (Evans et al., 2006). Since
2001, a more holistic approach has developed using a multi-trait selection index to
identify the most profitable sires for Irish dairy production systems (Berry, 2007). This
index is called the Economic Breeding Index (EBI), and weightings are currently placed
on milk production (32.9%), fertility (34.9%), calving (9.2%), beef (8.6%), maintenance
(7.2%), management (4.0%) and health (3.6%) (www.icbf.com).
The sequence of biological processes that must successfully occur in a timely

manner from calving to the establishment of pregnancy, are the recovery of uterine
health; resumption of ovarian cyclicity; oestrous behaviour and ovulation of a
competent oocyte; fertilisation; corpus luteum development and progesterone secretion;
embryo development; maternal recognition of pregnancy; and implantation (Lucy,
1
2001, Hansen, 2002). It has been well established that alterations to the metabolic
environment in response to lactation influence these biological events (Garnsworthy et
al., 2008, Wathes, 2012, Butler, 2014). Elucidating the specific mechanisms involved
has received intense interest (Velazquez et al., 2008, Thatcher et al., 2010, Wathes et al.,
2012, Butler, 2014, Lucy et al., 2014). Previous studies comparing animal models of
high and low fertility have attempted to determine these interactions by manipulation of
the diet (Sangsritavong et al., 2002, Cerri et al., 2009, Fouladi-Nashta et al., 2009);
comparing lactation status (Bender et al., 2010, Maillo et al., 2012); varying genetic
merit for milk production (high genetic merit vs. low genetic merit; (Snijders et al.,
2000, Kennedy et al., 2003, Pollott and Coffey, 2008)); and varying Holstein ancestry
(New Zealand Holstein-Friesian vs. North American Holstein-Friesian cows (Horan et
al., 2005, Lucy et al., 2009, Walker et al., 2012, Meier et al., 2014). These studies
greatly increased our understanding of interactions of metabolic status, nutritional status
and genotype with dairy cow fertility, but were confounded by effects of diet, genetic
merit for milk production, phenotypic milk production, and lactation status.
To minimise the variation that may have existed in those studies, a unique
lactating cow genetic model of fertility was established by Teagasc Moorepark. The
herd consisted of two groups of Holstein cows with similar genetic merit for milk
production traits, but with either good (Fert+) or poor (Fert-) genetic merit for calving
interval. Confounding factors known to affect reproductive performance were similar
for both genotypes. Large differences in phenotypic fertility performance between the
genotypes were detected with practically similar milk production (Cummins et al.,
2012a), indicating that a robust and valuable resource had been established to determine
the physiological mechanisms responsible for suboptimal reproductive performance in
lactating dairy cows. Subsequent studies (Cummins et al., 2012b, c) determined that the
primary differences between genotypes were (i) greater BCS; (ii) greater circulating
insulin and IGF1; (iii) stronger oestrus expression; (iv) fewer silent heats; (v) less
ovulation failure after oestrus; and (vi) greater circulating P4 concentrations in Fert+
cows compared with Fert- cows.
2
References
Bender, K., S. Walsh, A. C. O. Evans, T. Fair, and L. Brennan. 2010. Metabolite

concentrations in follicular fluid may explain differences in fertility between
heifers and lactating cows. Reproduction 139(6):1047-1055.
Berry, D. P., Laurence Shalloo, Andrew Cromie, Victor Olori, Roel Veerkamp, Pat
Dollin, Peter Amer, Ross Evans, Francis Kearney, Brian Wickham. 2007. The
economic breeding index: a generation on. www.icbf.com.
Berry, D. P., E. Wall, and J. E. Pryce. 2014. Genetics and genomics of reproductive
performance in dairy and beef cattle. animal 8(Supplements1):105-121.
Bisinotto, R. S., E. S. Ribeiro, and J. E. P. Santos. 2014. Synchronisation of ovulation
for management of reproduction in dairy cows. animal 8(Supplements1):151-
159.
Butler, S. T. 2013. Genetic control of reproduction in dairy cows. Reproduction,
Fertility and Development 26(1):1-11.
Butler, S. T. 2014. Nutritional management to optimize fertility of dairy cows in
pasture-based systems. animal 8(Supplements1):15-26.
Cerri, R. L. A., S. O. Juchem, R. C. Chebel, H. M. Rutigliano, R. G. S. Bruno, K. N.
Galvao, W. W. Thatcher, and J. E. P. Santos. 2009. Effect of fat source differing
in fatty acid profile on metabolic parameters, fertilization, and embryo quality in
high-producing dairy cows. Journal of Dairy Science 92(4):1520-1531.
Cummins, S. B., P. Lonergan, A. C. O. Evans, D. P. Berry, R. D. Evans, and S. T.
Butler. 2012a. Genetic merit for fertility traits in Holstein cows: I. Production
characteristics and reproductive efficiency in a pasture-based system. Journal of
Dairy Science 95(3):1310-1322.
Cummins, S. B., P. Lonergan, A. C. O. Evans, and S. T. Butler. 2012b. Genetic merit
for fertility traits in Holstein cows: II. Ovarian follicular and corpus luteum
dynamics, reproductive hormones, and estrus behavior. Journal of Dairy Science
95(7):3698-3710.
Cummins, S. B., S. M. Waters, A. C. O. Evans, P. Lonergan, and S. T. Butler. 2012c.
Genetic merit for fertility traits in Holstein cows: III. Hepatic expression of
somatotropic axis genes during pregnancy and lactation. Journal of Dairy
Science 95(7):3711-3721.
Evans, R. D., P. Dillon, F. Buckley, D. P. Berry, M. Wallace, V. Ducrocq, and D. J.
Garrick. 2006. Trends in milk production, calving rate and survival of cows in
14 Irish dairy herds as a result of the introgression of Holstein-Friesian genes.
Animal Science 82(04):423-433.
Fouladi-Nashta, A. A., K. E. Wonnacott, C. G. Gutierrez, J. G. Gong, K. D. Sinclair, P.
C. Garnsworthy, and R. Webb. 2009. Oocyte quality in lactating dairy cows fed
on high levels of n-3 and n-6 fatty acids. Reproduction 138(5):771-781.
Garnsworthy, P., K. Sinclair, and R. Webb. 2008. Integration of Physiological
Mechanisms That Influence Fertility in Dairy Cows. animal 2:1144 - 1152.
Hansen, P. J. 2002. Embryonic mortality in cattle from the embryo's perspective.
Journal of Animal Science 80(E-Suppl_2):E33-44.
Horan, B., J. F. Mee, P. O’Connor, M. Rath, and P. Dillon. 2005. The effect of strain of
Holstein-Friesian cow and feeding system on postpartum ovarian function,
animal production and conception rate to first service. Theriogenology
63(3):950-971.
Kennedy, J., P. Dillon, K. O'Sullivan, F. Buckley, and M. Rath. 2003. The effect of
genetic merit for milk production and concentrate feeding level on the
reproductive performance of Holstein-Friesian cows in a grass-based system.
Animal Science 76:297-308.
3
Khatkar, M. S., I. A. S. Randhawa, and H. W. Raadsma. 2014. Meta-assembly of
genomic regions and variants associated with female reproductive efficiency in
cattle. Livestock Science 166(0):144-157.
Lucy, M. C. 2001. Reproductive Loss in High-Producing Dairy Cattle: Where Will It
End? Journal of Dairy Science 84(6):1277-1293.
Lucy, M. C., S. T. Butler, and H. A. Garverick. 2014. Endocrine and metabolic
mechanisms linking postpartum glucose with early embryonic and foetal
development in dairy cows. animal 8(Supplements1):82-90.
Lucy, M. C., G. A. Verkerk, B. E. Whyte, K. A. Macdonald, L. Burton, R. T. Cursons,
J. R. Roche, and C. W. Holmes. 2009. Somatotropic axis components and
nutrient partitioning in genetically diverse dairy cows managed under different
feed allowances in a pasture system. Journal of Dairy Science 92(2):526-539.
Maillo, V., D. Rizos, U. Besenfelder, V. Havlicek, A. K. Kelly, M. Garrett, and P.
Lonergan. 2012. Influence of lactation on metabolic characteristics and embryo
development in postpartum Holstein dairy cows. Journal of Dairy Science
95(7):3865-3876.
McDougall, S. 2006. Reproduction performance and management of dairy cattle.
Journal of Reproduction and Development 52(1):185-194.
Meier, S., M. D. Mitchell, C. G. Walker, J. R. Roche, and G. A. Verkerk. 2014. Amino
acid concentrations in uterine fluid during early pregnancy differ in fertile and
subfertile dairy cow strains. Journal of Dairy Science 97(3):1364-1376.
Pollott, G. E. and M. P. Coffey. 2008. The Effect of Genetic Merit and Production
System on Dairy Cow Fertility, Measured Using Progesterone Profiles and On-
Farm Recording. Journal of Dairy Science 91(9):3649-3660.
Roche, J. R., C. R. Burke, S. Meier, and C. G. Walker. 2011. Nutrition × reproduction
interaction in pasture-based systems: is nutrition a factor in reproductive failure?
Animal Production Science 51(12):1045-1066.
Sangsritavong, S., D. K. Combs, R. Sartori, L. E. Armentano, and M. C. Wiltbank.
2002. High Feed Intake Increases Liver Blood Flow and Metabolism of
Progesterone and Estradiol-17Î² in Dairy Cattle. Journal of Dairy Science
85(11):2831-2842.
Shalloo, L. 2009. Pushing the barriers on milk costs/ outputs. Proceedings on the
National Dairy Conference:19-38.
Snijders, S. E. M., P. Dillon, D. O'Callaghan, and M. P. Boland. 2000. Effect of genetic
merit, milk yield, body condition and lactation number on in vitro oocyte
development in dairy cows. Theriogenology 53(4):981-989.
Thatcher, W., J. Santos, F. Silvestre, I. Kim, and C. Staples. 2010. Perspective on
Physiological/Endocrine and Nutritional Factors Influencing Fertility in Post-
partum Dairy Cows. Reproduction in Domestic Animals 45:2-14.
Velazquez, M. A., L. J. Spicer, and D. C. Wathes. 2008. The role of endocrine insulin-
like growth factor-I (IGF-I) in female bovine reproduction. Domestic Animal
Endocrinology 35(4):325-342.
Walker, C. G., M. D. Littlejohn, M. D. Mitchell, J. R. Roche, and S. Meier. 2012.
Endometrial gene expression during early pregnancy differs between fertile and
subfertile dairy cow strains. Physiological Genomics 44(1):47-58.
Walsh, S. W., E. J. Williams, and A. C. O. Evans. 2011. A review of the causes of poor
fertility in high milk producing dairy cows. Animal Reproduction Science
123(3–4):127-138.
Wathes, D. C. 2012. Mechanisms Linking Metabolic Status and Disease with
Reproductive Outcome in the Dairy Cow. Reproduction in Domestic Animals
47:304-312.
4
Wathes, D. C., A. M. Clempson, and G. E. Pollott. 2012. Associations between lipid
metabolism and fertility in the dairy cow. Reproduction, Fertility and
Development 25(1):48-61.
5
Chapter 2
Literature Review
6
2.1 Importance of Fertility to Irish Dairy Production
With the abolition of European Union milk quotas in 2015, a 50% increase in national
milk production by 2020 is anticipated (Department of Agriculture, 2010). This will be
achieved by increasing the size of the national dairy cow herd and increasing milk
production per cow. Dairy production in pasture based systems is centred on achieving
high milk solids production per cow and per hectare from a predominantly pasture-
based diet and supplementation with concentrate and/or conserved forages during
pasture deficits. Due to the seasonal nature of grass growth, the herd calves during the
three months of late winter/early spring, is bred during the three months of late
spring/early summer and is dried-off in late lactation during mid-winter (Figure 2.1).
Figure 2.1. Schematic representation of pasture-based seasonal-calving systems of milk

production. Top panel: temporal patterns of pasture growth and herd feed demand. The
objective is to match the timing of peak herd feed demand with peak pasture growth
rates. Bottom panel: Seasonal pattern of calving, breeding and drying off. A compact
calving pattern results in: (i) peak herd feed demand coinciding with peak pasture
growth rate; (ii) most cows calved ≥ 42 days at mating start date; (iii) rapid pregnancy
establishment at the start of the breeding period; (iv) most cows having a long lactation
on a primarily pasture-based diet; (v) most cows having a dry period of eight to ten
weeks. Figure courtesy of B. Horan, Teagasc Moorepark and adapted from Holmes et
al. (2002).
7
A compact calving season, defined as 90% of the herd calving in a six week
period (Butler, 2014), is critical to the success of pasture-based dairy production. It
facilitates high levels of pasture utilisation and low levels of supplementary feeding
through the use of highly fertile cows capable of high milk solids production (Shalloo,
2009). The mean calving date in Ireland is currently mid-March; however, improvement
to mid-February (the optimal mean calving date) would result in economic gains for
dairy producers (Shalloo et al., 2014) and processors (Geary et al., 2012). Achieving the
six-week calving rate of 90% requires high fertility performance from replacement
heifers and the lactating herd. The most recent fertility data for the national dairy herd
indicates that a large improvement is required to achieve this target fertility
performance, as demonstrated by the top 5% of herds (Table 2.1). Improving the current
six week calving rate of 76% in heifers (Berry et al., 2013) and 56% in cows by 1%
would increase net farm profitability by €3.51 per heifer and €9.26 per cow (Shalloo et
al., 2014).
Table 2.1. Fertility performance of the Irish national dairy herd in 2014
Key Performance Indicators Mean Target Top 5% Bottom 5%
Calving interval (days) 396 365 364 456
Six-week calving rate (%) 56 90 85 19
Calves per cow per year 0.89 1 1.02 0.66
http://www.icbf.com/wp/wp-content/uploads/2013/07/Dairy-Calving-Stats-2014.pdf
2.2 Global Trends in Dairy Cow Fertility

Dairy cow fertility is defined as the ability to establish a successful pregnancy if
submitted for breeding at the correct time relative to ovulation (Darwash et al., 1997).
Declines in fertility performance have been evident in both pasture-based and
confinement production systems (Table 2.2), coincident with large increases in milk
production and genetic selection solely for milk production traits. A recent survey of
fertility trends in Holstein-Friesian cows from 16 countries suggests that the rate of
fertility decline has eased since the previous decade (2000-2007), and may have begun
to improve (Pryce et al., 2014). Genetic correlations among milk, protein and fat yield
with most fertility traits demonstrate a strong antagonistic relationship (Berry et al.,
2014), yet, understanding the interaction between production and fertility has been
difficult. Studies of phenotypic data have reported negative associations (Nebel and
McGilliard, 1993), no association (Patton et al., 2007), or a positive association between
milk production and fertility (Buckley et al., 2003), reflecting the importance of herd
8
management and animal health in understanding the interactions (Leblanc, 2010, Bello
et al., 2012).
Table 2.2. Global Trends in Dairy Cow Fertility

Period Fertility trait Change Location
1951 to 1996 CRFS (%) 66 to 40 New York state1
1970s to 2000s CRFS (%) 65 to 55 New Zealand2
1984 to 2004 Calving interval (days) 379 to 389 Ireland3
1985 to 2005 Calving interval (months) 12.5 to 12.5 Norway4
1990 to 2001 CRFS (%) 55 to 44 Ireland5
1997 to 2006 CRFS (%) 54 to 45 United States6
1997 to 2009 CRFS (%) 63 to 50 Australia7
CRFS = Conception rate to first service
1
=Butler (1998)
2
=Burke and Fowler (2007)
3
=Berry et al. (2014)
4
=Refsdal (2007)
5
=Evans et al. (2006)
6
=Norman et al. (2009)
7
=Macmillan (2012)
2.3 Genetic Selection in Ireland

The genetic composition of Irish dairy cattle has progressed from Dairy Shorthorn in the
1960s to dual-purpose British Friesian in the 1980s to the North American Holstein-
Friesian (NAHF), which is presently the predominant dairy breed (Evans et al., 2006).
In Ireland, use of NAHF genetics grew from < 10% in 1977 to ~ 80% in 1995 (Simm,
1998). The introgression of Holstein genetics resulted in the proportion of Holstein
genetics in the dairy herd increasing from 8% in 1990 to 63% by 2001 (Evans et al.,
2006). Similar trends were reported in New Zealand (Harris and Kolver, 2001). Exports
of NAHF semen from the US increased from 13% in 1981 to 30% in 2006 (Funk,
2006). In Ireland, selection indices for dairy cattle have evolved in recent decades.
Initially, a selection index focused solely on the genetic improvement of milk
production traits (Relative Breeding Index) was utilised. During this time, sires
generated for confinement TMR-based milk production systems were utilised to
improve the genetic merit for milk production of the national dairy herd. This selection
policy resulted in dairy cows that mobilised excessive amounts of adipose tissue in early
lactation, and had suboptimal reproductive performance when managed in Irish pasture-
based production systems (Buckley et al., 2000, Kennedy et al., 2003, Horan et al.,
2004, Horan et al., 2005a, b, Dillon et al., 2006, McCarthy et al., 2007a, b). Diskin et al.
(2011) attributed greater occurrence of early embryo loss as the primary contributor to
the decline in reproductive performance (Figure 2.2).
9
In 2001, a more holistic approach was developed using a multi-trait selection index to
identify the most profitable sires for Irish dairy production systems. This was termed the
Economic Breeding Index (EBI), which currently includes 6 traits (weighting in
parenthesis); milk production (32.9%), fertility (34.9%), calving (9.2%), beef (8.6%),
maintenance (7.2%), management (4.0%) and health (3.6%) (http://www.icbf.com).
Figure 2.2. Reproductive outcomes in British-Friesian versus Holstein-Friesian cows

(Diskin et al., 2011).
2.4 Fertility in the Dairy Cow

The sequence of events for optimal reproductive performance of dairy cows is presented
in Figure 2.3 and are discussed in this section.
10
Figure 2.3. Sequence of reproductive events in the dairy cow. Each event depends on the
success of the preceding events. Numbers indicate optimum range (days after calving) to
achieve an average calving interval of 365 days. Major temporal factors that influence
success are: energy balance (EBal), which should start to increase early in lactation; insulin,
which stimulates resumption of oestrous cycles, but may reduce oocyte quality; P4, which
is low during anoestrus, high during luteal phases of cycles, and low during follicular
phases of cycles; and PGF2α which stimulates uterine involution and corpus luteum
regression, but has to be suppressed for successful implantation and maintenance of
pregnancy. Adapted from Garnsworthy et al. (2008).
2.4.1 Postpartum Uterine Health and Resumption of Ovarian Cyclicity

At calving, the uterus is invaded by bacteria in the environment, many of which are
uniquely associated with either a metritic, endometritic or healthy uterine status (Santos
and Bicalho, 2012). The presence of pathogenic bacteria induces an inflammatory
response, characterised by the infiltration of neutrophils and macrophages, and the
accumulation of uterine pus (Sheldon et al., 2014). This is a normal physiological
response. Subsequent development of uterine disease depends on the type of bacteria
involved and on the immune response of the cow, and is associated with reduced
subsequent fertility. 20-30% of dairy cows are classified as having endometritis by
weeks four to six postpartum, with unfavourable consequences for fertility (Williams et
al., 2005, McDougall et al., 2011). Reduced fertility could arise via mechanisms
affecting the ovary (Williams et al., 2007, Williams et al., 2008), follicular environment
(Green et al., 2011), endometrium and embryo (Hoelker et al., 2012, Ledgard et al.,
2013).
Coincident with the recovery of uterine health, resumption of ovarian cyclicity

must also occur in a timely manner. After calving, follicles resume their wave-like
growth pattern in response to increasing follicle stimulating hormone (FSH)
concentration within the first week (Savio et al., 1990), but ovulation of a dominant
follicle does not occur until luteinizing hormone (LH) secretion from the anterior
pituitary reaches a frequency of one pulse per hour (Crowe, 2008). The first ovulation
after calving is frequently not associated with oestrous behaviour, and is usually
followed by a short oestrous cycle, oestrous behaviour and ovulation (Crowe, 2008).
Factors associated with the resumption of cyclicity include the size of the dominant
follicle (Austin et al., 1999) and insulin-like growth factor-1 (IGF1) bioavailability
11
(Canty et al., 2006). Nyman et al. (2014) reported that the interval from calving to
commencement of luteal activity ranged from 27 to 34 days based on milk progesterone
(P4) data. An earlier resumption of ovarian cyclicity is usually associated with greater
fertility (Santos et al., 2009, Galvão et al., 2010), although Horan et al. (2005b) reported
a negative association. In seasonal calving herds, problem cows with uterine infection
and anoestrus are most common in the late calving cohort.
2.4.2 The Oestrous Cycle

Cattle are non-seasonal, polyoestrous animals that experience oestrous cycles consisting
of two to three waves of follicular growth during a period of 18 to 24 days (Forde et al.,
2011b). Pregnancy rates tend to be greater in cows experiencing three versus two
follicular waves (Townson et al., 2002). Each wave consists of three stages: selection,
dominance and either atresia or ovulation. Selection involves the recruitment of a cohort
of follicles following a surge in FSH that declines within four days of wave emergence.
From this cohort of follicles, a single follicle achieves dominance by growing more
quickly, achieves greater oestrogen synthetic capacity than other recruited follicles,
acquires LH receptors and inhibits the growth of competitor follicles (Thatcher et al.,
1996, Adams et al., 2008). In the absence of FSH, LH is essential for maintenance of
dominant follicle steroidogenesis (Thatcher et al., 1996, Bao and Garverick, 1998,
Roche et al., 1998). During periods of elevated circulating P4 concentrations, the
dominant follicle is unable to ovulate and so undergoes atresia. Following removal of
the source oestradiol (E2) and inhibin another FSH surge occurs, preceding the
emergence of a new follicular wave. Regression of the corpus luteum (CL) occurs on
either day 16 or 19 of a two wave or three wave oestrous cycle, respectively (Adams et
al., 2008), and is instigated by increased pulsatility and amplitude of uterine
prostaglandin F2α (PGF2α) release. Once the threshold for E2 is reached, activation of
oestrogen receptors in the brain induces oestrous behaviour. With circulating P4
concentrations at basal levels and peak circulating E2 concentrations, the surge centre of
the hypothalamus is activated to release gonadotropin releasing hormone (GnRH),
thereby facilitating a surge release of LH from the pituitary and ovulation of the
dominant follicle (Senger, 1997). Synchronisation between oestrous behaviour and
ovulation is regulated by oestrogen receptor-dependent transcription of GnRH and
GnRH receptor genes (Woelders et al., 2014). At ovulation, the dominant follicle
ruptures to release the oocyte in response to a surge release of LH. If insemination
12
occurs, subsequent pregnancy success is associated with ovulatory follicle size (Geary
et al., 2013).
2.4.3 Follicular Environment and Oocyte Competence

Competent oocytes are capable of: (i) resuming meiosis; (ii) cleaving following
fertilisation; (iii) developing to the blastocyst stage; and (iv) maintaining pregnancy to
term in good health (Sirard et al., 2006). Even though fertilisation rates of up to 100%
have been reported (Sartori et al., 2002b), a significant proportion of embryos
degenerate before the blastocyst stage (reviewed by Sartori et al. (2010)). Compromised
oocytes have been implicated as a contributor to low pregnancy rates in cattle, because
greater fertility has been achieved following embryo transfer compared with AI
(Vasconcelos et al., 2006, Demetrio et al., 2007). Bovine oocytes have a considerable
lipid component and metabolise glucose, lactate, pyruvate, triglyceride and amino acids
(Sturmey et al., 2009). Dramatic alterations in circulating metabolites that occur as the
dairy cow progresses through the early lactation period are reflected in follicular fluid
(Leroy et al., 2004).
It has been hypothesized that the oocytes that ovulate during the breeding season
have been exposed to the early lactation period of metabolic stress during follicle
development, with negative consequences for fertility. Specifically, greater
concentrations of non-esterified fatty acids (NEFA) and β-hydroxybutyrate (BHBA)
have been implicated in compromised follicle steroidogenesis, oocyte development and
embryo quality (Leroy et al., 2005, Vanholder et al., 2006, Van Hoeck et al., 2011);
however, caution should be taken when interpreting in vitro studies. While dietary fat
manipulation is reflected in the follicular environment, alterations to the lipid content of
oocytes have not been detected in vivo (Sturmey et al., 2009). At the animal level, the
major determinants of oocyte competence are puberty, parity status, genetic merit for
milk production, BCS, dietary protein and heat stress (Hansen, 2002).
2.4.4 Corpus Luteum Development

After ovulation, the theca interna undergoes both hypertrophy and hyperplasia,
progresses to the antral space and becomes dispersed amongst granulosa cells. Luteal
tissue is composed of 4 cell types; large luteal cells (LLC) that develop from granulosa
13
cells, small luteal cells (SLC) that develop from theca cells, endothelial cells and
fibroblast cells (Table 2.3).
Table 2.3. Structural characteristics of cells of dioestrus bovine

corpus luteum (adapted from Wiltbank (1994)).
LLC (%) SLC (%) EC (%) FC (%)
Tissue volume 40 28 13 6
Cell number 3.5 27 52 10
LLC = large luteal cells
SLC = small luteal cells
EC = endothelial cells
FC = fibroblast cells
Luteinizing hormone is the primary hormone responsible for CL maintenance and P4

synthesis. Luteinizing hormone receptors are present on both LLC and SLC, although
LLC’s, which are responsible for 80% of the P4 synthesised (Niswender et al., 1994),
eventually become unresponsive to LH. In SLC’s, LH stimulates P4 production via
increased cholesterol esterase activity and cholesterol transport from the cytoplasm
across the inner mitochondrial membrane, the major rate-limiting step in P4
steroidogenesis. As the CL develops, mRNA abundance and activity of enzymes
(P450scc, 3β-HSD, cholesterol esterase) and receptors (LH and FSH) involved in P4
steroidogenesis increase in support of cholesterol transport (Niswender et al., 1994).
Progesterone production is determined primarily by the volume of luteal tissue and the
rate of blood flow, but their importance is dependent on the stage of the oestrous cycle
(Juengel and Niswender, 1999). Reports on the relative importance of CL tissue volume
and blood flow are currently conflicting. Mann (2009) reported no correlation between
CL volume and circulating P4 concentrations once the CL had matured. Conversely,
correlation analysis between ultrasound images and circulating P4 concentrations
indicated that CL volume is the primary determinant (Bollwein et al., 2012).
2.4.5 Circulating Progesterone Concentrations

Progesterone is the essential hormone of pregnancy and has been implicated in the
control of most reproductive events during the oestrous cycle (Lonergan, 2011,
Wiltbank et al., 2014). Greater circulating P4 concentrations during growth of the
preovulatory follicle (Xu et al., 1997, Herlihy et al., 2011, Colazo et al., 2013) and post
ovulation (Stronge et al., 2005, McNeill et al., 2006, Larson et al., 2007) are associated
with fertility improvements. Persistent follicles develop in low circulating P4
concentrations; these follicles ovulate ooctyes that have undergone premature
14
maturation and subsequent embryo development is compromised (Austin et al., 1999,
Mihm et al., 1999). Conversely, high circulating P4 concentrations at the time of AI due
to incomplete luteolysis are associated with compromised fertility (Martins et al., 2011).
Insufficient P4 synthesis by the CL and greater metabolic clearance rate (MCR)

by the liver are the principal mechanisms responsible for reduced circulating P4
concentrations during the luteal phase (Sangsritavong et al., 2002, Sartori et al., 2002a).
The necessity for greater dry matter intake to meet the demands of rapidly increasing
milk production is the primary reason for increased MCR by the liver (Sangsritavong et
al., 2002, Reynolds et al., 2003, Rhinehart et al., 2009).
2.4.6 Uterine Environment and Embryo Development

In vitro culture of embryos to the blastocyst stage is possible, but genomic and
phenotypic differences between in vivo versus in vitro derived embryos indicate
compromised development (Rizos et al., 2002), even when pregnancies develop to term
(Lazzari et al., 2002). Therefore it can be concluded that the uterine environment is
more favourable than the in vitro environment. Transport proteins, ions, mitogens,
cytokines, lymphokines, enzymes, hormones, growth factors, proteases and protease
inhibitors, amino acids, glucose, fructose, and vitamins are the key components of
histotroph essential for successful embryo development (Bazer et al., 2011). The stages
involved in early embryo development include embryonic genome activation, morula
development, hatching of the blastocyst and trophoblast elongation (Hansen, 2002,
Peippo et al., 2011).
The events leading to maternal recognition of pregnancy on days 15 to 18 after

ovulation involve a complex communication process between the rapidly elongating
embryo, CL and endometrium. These include: (i) reduced expression of the P4 receptor
in the endometrium following exposure to P4; (ii) embryo production of interferon-τ to
prevent the endometrial expression of oestrogen and oxytocin receptors, thereby
preventing oxytocin-induced synthesis and release of PGF2α from the endometrium; and
(iii) CL maintenance and continued P4 production (Senger, 1997). The uterine
environment anticipates establishing a pregnancy until at least the period of maternal
recognition of pregnancy (Lonergan and Forde, 2014). Prior to maternal recognition of
pregnancy, the primary factors influencing the endometrial transciptome are the stage of
the oestrous cycle and circulating P4 concentrations (Forde et al., 2011a). Greater
15
postovulatory circulating P4 concentrations are associated with superior embryo
development (Carter et al., 2008), presumably via alterations to the endometrial
transcriptome and protein secretions (Forde et al., 2013).
Alterations to the uterine environment imposed by lactation status or infection

may influence fertility in dairy cows. Rizos et al. (2010) reported greater embryo
recovery and greater blastocyst development when in vitro fertilised oocytes were
cultured from day two to seven of the oestrous cycle in nulliparous heifers compared
with lactating dairy cows. The expression profile of endometrial immune cells was
reported to be anti-inflammatory in anticipation of pregnancy establishment (Oliveira et
al., 2013) but the presence of neutrophils in the uterus may alter this expression profile,
with possible consequences for pregnancy establishment (Hoelker et al., 2012).
2.4.7 Embryo Loss

Based on fertilisation rates of 90% and calving rates of 55%, Sreenan and Diskin (1986)
calculated embryo loss to be about 40%. Since reported fertilisation rates seem to have
remained reasonably static in recent decades (Sartori et al., 2010; Sreenan and Diskin,
1986), fertilisation problems do not appear to be a primary factor in the declining
fertility, at least in temperate climates. In regions where dairy cows experience heat
stress, fertilisation rates of only 55% have been reported during summer (Sartori et al.,
2002). The period before maternal recognition of pregnancy is responsible for the
majority of conceptus loss (Diskin and Sreenan, 1980; Dunne et al., 2000; Horan et al.,
2004; López-Gatius et al., 2004; Silke et al., 2002). Embryo loss does occur prior to day
8 after artificial insemination, particularly in very high milk production cows when
compared with heifers (Sartori et al., 2002), but the majority of embryo loss occurs
between days 8 to 16 after artificial insemination.
2.5 Major Animal Factors Controlling the Reproductive Performance of Dairy

Cows
The causes of subfertility in dairy cow are multifactorial (Lucy, 2001, Walsh et al.,
2011), with nutritional status (Roche et al., 2011, Butler, 2014), reproductive
management (McDougall, 2006, Bisinotto et al., 2014) and genotype (Berry et al., 2014,
Khatkar et al., 2014) all identified as contributing factors. The impact of improved
reproductive management and increased selection intensity for fertility are now
beginning to materialise. The decline in female fertility in the Holstein-Friesian breed
16
has either plateaued or in some populations begun to improve (Pryce et al., 2014).
Major animal factors that affect the sequence of reproductive events presented in Figure
2.2 are discussed in this section.
2.5.1 Metabolic Status

The transition period in cattle is described as the period from three weeks prepartum to
three weeks postpartum, and is associated with the potential occurrence of multiple
diseases that affect production, fertility, and health (Drackley, 1999). With the onset of
lactation, the dairy cow experiences a marked shift in metabolism due to the uncoupling
of the somatotropic axis. In early lactation, available glucose is prioritised in support of
mammary milk synthesis by increasing hepatic gluconeogenesis and limiting
lipogenesis in adipose tissue (Lucy, 2008). During this period, a hypoinsulinaemic
environment prevails; hepatic expression of GHR mRNA is suppressed, preventing
binding of GH to its receptor, thereby avoiding the negative feedback mechanism that
controls its synthesis (Lucy, 2008). Typically, the dairy cow enters a period of negative
energy balance a few days before calving, reaches a nadir two weeks later, and returns
to positive EBal by week ten postpartum (Butler, 2003). During negative EBal, adipose
tissue is mobilised in support of milk production and BCS declines.
The metabolic status during the postpartum period is characterised by alterations

to DMI, milk production, hepatic mRNA abundance of growth hormone receptor 1A
(GHR 1A), and circulating concentrations of GH, insulin, IGF1, glucose, NEFA and
BHBA (Figure 2.4).
Figure 2.4. Temporal profile of milk production and metabolic indicators during the
transition period. Adapted from Lucy et al. (2001)
17
The primary metabolites and metabolic hormones associated with superior
fertility are insulin, IGF1 and glucose. Greater insulin concentrations support earlier
recoupling of the somatotropic axis and up-regulation of hepatic mRNA abundance of
hepatic expression of GHR 1A and IGF1 (Butler et al., 2003). Insulin was greater in
cows that ovulated the first wave dominant follicle (Butler et al., 2006). Numerous
studies have reported positive associations between IGF1 and fertility (Taylor et al.,
2004, Patton et al., 2007, Wathes, 2012). IGF1 acts on the ovary by promoting
ovulation of the first postpartum dominant follicle, increases the mRNA abundance of
LH and FSH receptors (Lucy, 2000), amplifies FSH-stimulated E2 production (Bao and
Garverick, 1998), and promotes P4 production in small luteal cells (Niswender et al.,
1994).
Energy balance during the first three weeks postpartum is correlated with the
interval to ovulation (Canfield and Butler, 1990, Reist et al., 2003). Dry matter intake,
the primary source of variation in EBal, is greater in cows that ovulate the first
postpartum dominant follicle (Butler et al., 2006). Glucose is also a key metabolic
regulator of fertility. Garverick et al. (2013) reported greater circulating glucose
concentrations during the first week postpartum in cows that subsequently became
pregnant to first service. Glucose may also be a key component of the early postpartum
immune response to pathogenic bacteria as it is an important energy substrate for
immune cells (Ingvartsen and Moyes, 2013). Glucose is also the principal metabolic
fuel of the ovary (Rabiee et al., 1999).
Circulating NEFA and BHBA concentrations during the transition period may
not be suitable predictors of reproductive performance. While circulating NEFA
concentrations were greater during the first two weeks postpartum in cows not pregnant
to first service (Garverick et al., 2013), Burke et al. (2010) reported no differences in
cows classified with or without endometritis and Chapinal et al. (2012) reported no
differences between cows pregnant or not pregnant to first service.
2.5.2 Body Condition Score

Positive effects of BCS on fertility have been reported in pasture and confinement dairy
systems. Body condition score is a subjective assessment of adipose tissue reserves, and
is evaluated on a scale of 1 to 5 in Ireland (Edmonson et al., 1989). Mobilisation of
adipose tissue reserves results in a decline in BCS until about 50 to 100 days in milk
18
(Berry et al., 2006), which is then replenished during the remainder of lactation and the
subsequent dry period. Low BCS at calving prolongs the post-partum anoestrous
interval through delayed ovarian activity, infrequent LH pulses and development of
gonadotropin-unresponsive follicles (Diskin et al., 2003). In a study involving over
6,000 cows in 74 Irish spring-calving herds, Buckley et al. (2003) reported positive
associations between BCS at 60 and 100 days postpartum and 21-day submission rate
and 6-week pregnancy rate, and between BCS at nadir and pregnancy rate to 1 st service.
Roche et al. (2007) evaluated 2,600 lactation records from 900 New Zealand dairy
cows, and reported a positive effect of BCS on resumption of cyclicity prior to mating
start date and a negative effect of BCS loss from calving to nadir on 21-day submission
rate. Santos et al. (2009) examined the records of 6,400 Holstein dairy cows from 4
dairy farms in a confinement production system. The proportion of animals that were
cycling by 65 days postpartum and pregnancy rates per AI were greatest, intermediate
and least when BCS loss from calving to AI was zero, < 1 unit and > 1 unit,
respectively. Minimising the loss of BCS in early lactation is difficult, regardless of
feeding level; however, greater levels of feeding do improve BCS gain (Roche et al.,
2009).
2.5.3 Genetic influence on Reproductive Performance

The potential to improve fertility through genetic selection has been accepted
internationally. This has been implemented through the inclusion of health and fertility
traits in selection indices worldwide (Miglior et al., 2005). The rate of adoption of this
approach, however, varied greatly among countries. The Nordic countries were the
leaders in this regard, and incorporated health and fertility traits in their selection index
since the 1970s. In comparison, Ireland and the USA only began to include non-
production traits in their dairy selection indices in 2001 and 2003, respectively (Berry,
2007; Philipsson and Lindhé, 2003; VanRaden et al., 2004). More recently,
crossbreeding of dairy breeds has been implemented to address declining fertility. A
crossbreeding strategy allows the introduction of favourable genes from another breed
that has been selected more strongly for traits of interest, removes inbreeding
depression, and capitalises on hybrid vigour (Buckley et al., 2014).
19
2.5.3.1 Genetic Influence on Energy Status
The increase in genetic merit for milk production is the primary factor responsible for
increased phenotypic milk production and the decline in reproductive performance.
Genetic correlation between milk production traits and reproductive traits are
antagonistic (Berry et al., 2014). The primary physiological components of this
antagonism are likely explained by alterations in (i) feed intake, (ii) energy balance, and
(iii) circulating concentrations of energy metabolites, metabolic hormones and
reproductive hormones, discussed previously (Veerkamp et al., 2003). This imbalance
may have been widened due to the greater severity of negative EBal, as the genetic
correlation between milk yield and DMI has been reported to be between 0.44 to 0.65
(Veerkamp et al., 2003). In the UK, cows with high genetic merit for milk production
had delayed commencement of luteal activity and reduced oestrous expression
compared with cows that had average genetic merit for milk production (Pollott and
Coffey, 2008). In Ireland, cows with a high genetic merit for milk production had
greater milk yield, reduced BCS, reduced in vitro blastocyst development (Snijders et
al., 2000) and reduced conception rates (Snijders et al., 2001) compared with cows that
had average genetic merit for milk production. Many reproductive traits are under
moderate to strong genetic control (Berry et al., 2014). The lactation profile of BCS is
also under moderate genetic control, with heritability estimates varying from 0.07 to 0.6
(Berry et al., 2008). Studies have indicated that significant variation in BCS exists both
within and between breeds (Horan et al., 2005a, Friggens et al., 2007, Lucy et al., 2009,
Prendiville et al., 2011a, Heins et al., 2012).
2.5.3.2 Genetic Influence on Detailed Reproductive Phenotypes

Additional efforts to increase the rate of genetic gain for female fertility include the
measurement of more detailed reproductive phenotypes (Nyman et al., 2014, Carthy et
al., 2014, Fitzgerald et al., 2014, Walsh et al., 2014) to reduce the unexplained variation
in fertility, thereby improving the heritability estimates of female fertility from the
current range of 0.02 to 0.04 (Berry et al., 2014). Antral follicle count (Walsh et al.,
2014), the interval from calving to commencement of luteal activity (Nyman et al.,
2014) and the interval from calving to the first oestrous activity period (Løvendahl and
Chagunda, 2009) had moderate heritability estimates of 0.31, 0.18, and 0.18,
respectively. Interestingly, antral follicle count and the interval from calving to
commencement of luteal activity had unfavourable genetic relationships with milk
production variables. These deep phenotypes may become useful in genetic evaluations
20
if sufficient records become available. The prospect of automated monitoring of animal
health, ovarian activity and oestrus activity is quickly becoming a reality due to
developments in in-line milk meters (www.delaval.com) and activity monitors
(www.dairymaster.com).
2.5.3.3 Influence of Genomic Regions and Variants on Reproductive Performance

Genomic regions and variants affecting the reproductive performance of dairy cattle
have been identified. A meta-analysis of genome-wide association studies and
quantitative trait loci studies reported strong associations between regions of BTA1, 2,
3, 5, 6, 7, 9, 13, 16 and fertility (Khatkar et al., 2014). Genome-wide association studies
have identified genomic regions associated with a range of fertility traits in dairy cattle
(Pryce et al., 2010, Cole et al., 2011, Berry et al., 2012, Hoglund et al., 2014).
Haplotypes that are embryonic lethal in the homozygous state have been identified on
BTA1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 18, 19, 20, 21, 24, 25, 26, 29 (VanRaden
et al., 2011, Fritz et al., 2013, Sahana et al., 2013, Sonstegard et al., 2013, Daetwyler et
al., 2014, McClure et al., 2014). The frequency of these embryonic lethal haplotypes
may have increased due to greater selection intensity in dairy populations. The increase
in inbreeding depression has had negative consequences for reproductive performance
(VanRaden and Miller, 2006, McParland et al., 2007).
2.5.3.4 Influence of Dairy Breeds on Reproductive Performance

It became evident from the results of a number of breed comparison trials in Ireland and
elsewhere that large variation existed in the reproductive performance of different
breeds. Norwegian Red, F1 Norwegian Red x Holstein-Friesian, Normande, F1
Normande x Holstein-Friesian, Montbeliarde, F1 Montbeliarde x Holstein-Friesian, and
F1 Holstein-Friesian x Jersey cows had greater BCS and superior reproductive
performance compared with Holstein-Friesian cows (Walsh et al., 2008, Begley et al.,
2009, Prendiville et al., 2011b). The superior reproductive performance of Norwegian
Red cows compared with Holstein Friesian cows in Northern Ireland was most recently
validated by Ferris et al. (2014). Over five lactations both breeds had similar milk solids
production, but the Norwegian Red cows had greater CRFS and a greater proportion
survived to the sixth lactation. Across the aforementioned studies, the Holstein-Friesian
cows enrolled were primarily North-American genotypes, indicating their unsuitability
for pasture-based milk production systems. Breed comparison studies in California
21
reported greater CRFS, increased survival, and fewer days open, but reduced milk
production in Montbeliarde x Holstein and Scandinavian Red x Holstein cows
compared with Holstein cows (Heins et al., 2006a, b).
The genetic and physiological mechanisms contributing to the phenotypic

fertility differences between breeds have not been well studied. Differences in BCS
have been reported; however, differences in milk production may also have influenced
the results. The influence of inbreeding and crossbreeding on embryo development has
been evaluated. Lazzari et al. (2011) reported greater in vitro morula development,
blastocyst development and in vivo ovoid embryo development on day six, seven and
twelve of the oestrous cycle, respectively, in crossbred embryos compared with
purebred or inbred embryos, presumably due to reduced levels of inbreeding depression.
2.5.3.5 Influence of Holstein Strain on Reproductive Performance

It became evident from the results of a number of strain comparison farmlet trials in
Ireland and New Zealand that large variation exists in the reproductive performance of
different Holstein strains. Compared with the high production NAHF cows, high
durability NAHF and New Zealand Holstein-Friesian cows had greater CRFS (Horan et
al., 2005b), and were more profitable due to their superior reproductive performance
(McCarthy et al., 2007c). The primary physiological differences between the strains are
outlined in Table 2.4. The results of these studies indicate that cow genotype is critically
important to the productivity and profitability of pasture-based milk production systems.
22
Table 2.4. Physiological mechanisms associated with the superior reproductive
performance of New Zealand strain Holstein-Friesian cows compared with North
American strain Holstein-Friesian cows.
Greater BCS
(Horan et al., 2005a, Roche et al.,
Reduced BCS loss
2006, McCarthy et al., 2007b)
Greater BCS replenishment in late lactation
Similar DMI per metabolic BW Patton et al. (2008)
Similar or earlier commencement of luteal activity Harris and Kolver (2001); Horan et
al. (2005b)
Greater insulin responsiveness Patton et al. (2009)
(Patton et al., 2008, Lucy et al.,
Greater circulating IGF1
2009)
Similar or greater hepatic IGF1 expression Lucy et al. (2009); McCarthy et al.
(2009)
Greater endometrial expression of genes
associated with:
(i) immune tolerance to the embryo
Walker et al. (2012)
(ii) preventing luteolysis
(iii) embryo support and development
2.5.3.6 Influence of Genetic Merit for Fertility on Reproductive Performance

The differences in genotypic and phenotypic milk production, breeding goals and
genetic diversity may have been confounding factors in the findings of the breed
comparison and Holstein strain comparison studies outlined previously. To minimise
the variation that may have existed in those studies, Teagasc Moorepark established a
new herd consisting of two groups of Holstein cows with similar genetic merit for milk
production traits, but with either good (Fert+) or poor (Fert-) genetic merit for calving
interval. Animals were maintained as one herd, thus standardising all environmental
factors that are known to affect reproductive performance. Large differences in
phenotypic fertility performance between the genotypes were detected (Table 2.5) with
practically similar milk production (Cummins et al., 2012a).
Table 2.5. Milk production and fertility differences between Fert+ and Fert- cows
during first lactation
Variable Fert+ Fert-
n 18 18
Milk yield (kg/day) 5947 5703
Milk solids (kg/day) 436 423
Calving to conception interval (days) 86 114
Number of services per cow 1.8 2.8
Number of services per pregnancy 1.4 2.2
Pregnancy rate to first and second service (%) 83 50
Six-week pregnancy rate (%) 72 41
Adapted from Cummins et al. (2012a)
23
Subsequent studies examined the metabolic status and nutrient partitioning during
lactation (Cummins et al., 2012a, c) and the characteristics of the oestrous cycle
(Cummins et al., 2012b) to elucidate some of the physiological mechanisms
contributing to the phenotypic fertility differences. The primary physiological
differences between the genotypes were (i) greater BCS; (ii) greater circulating insulin
and IGF1; (iii) stronger oestrous expression; (iv) fewer silent heats; (v) less ovulation
failure after oestrous; and (vi) greater circulating P4 concentrations in Fert+ cows
compared with Fert- cows. The study highlighted the large effects that genetic merit for
fertility has on the physiological mechanisms influencing reproductive performance,
without antagonising milk production.
2.6 Rationale for the Studies Undertaken

Research was undertaken to continue the characterisation of a lactating cow genetic
model of fertility to elucidate the physiological mechanisms contributing to suboptimal
reproductive performance in lactating dairy cows. Two groups of Holstein cows with
similar genetic merit for milk production traits, but with either good (Fert+) or poor
(Fert-) genetic merit for calving interval were utilised. Animals were maintained as one
herd, thus standardising all environmental factors that are known to affect reproductive
performance (herd management, plane of nutrition, proportion of Holstein genes and
genetic merit for milk production traits).
The objectives of the research reported in this thesis are:

1) To monitor the transition period, uterine health and resumption of ovarian
cyclicity in Fert+ and Fert- cows.
2) To examine the differences between Fert+ and Fert- cows in the factors that
affect circulating progesterone concentrations during the oestrous cycle.
3) To identify potential differences between genotypes in the fatty acid and amino
concentrations of follicular fluid and serum.
4) To compare the transcriptome of the endometrium and corpus luteum on day 13
of the oestrous cycle in Fert+ and Fert- cows and to identify genomic regions
and variants potentially influencing reproductive performance.
5) To describe the results of the study and describe the implications from the work.
24
Chapter Three describes the phenotypic characterisation of the Fert+/Fert- herd during
the transition and early lactation periods, with specific focus on monitoring dry matter
intake, uterine health and resumption of ovarian cyclicity. Chapter Four quantifies
preovulatory follicle and corpus luteum development, circulating steroid hormone
concentrations and metabolic clearance rate of progesterone in Fert+ and Fert- cows.
Chapter Five characterises the fatty and amino acid profiles in follicular fluid and serum
in Fert+ and Fert- cows. Chapter Six compares the transcriptome of the endometrium
and corpus luteum on day 13 of the oestrous cycle between Fert+ and Fert- cows,
examines the concordance between differentially expressed genes and significant single
nucleotide polymorphisms identified in fertility genome-wide association studies, and
identifies genomic variants associated with fertility. Finally, Chapter Seven summarises
the thesis, draws conclusions and implications from the work, describes limitations of
the research, and identifies further areas for research.
25
2.7 References
Adams, G. P., R. Jaiswal, J. Singh, and P. Malhi. 2008. Progress in understanding

ovarian follicular dynamics in cattle. Theriogenology 69(1):72-80.
Austin, E. J., M. Mihm, M. P. Ryan, D. H. Williams, and J. F. Roche. 1999. Effect of
duration of dominance of the ovulatory follicle on onset of estrus and fertility in
heifers. Journal of Animal Science 77(8):2219-2226.
Bao, B. and H. A. Garverick. 1998. Expression of steroidogenic enzyme and
gonadotropin receptor genes in bovine follicles during ovarian follicular waves:
a review. Journal of Animal Science 76(7):1903-1921.
Bazer, F. W., G. Wu, G. A. Johnson, J. Kim, and G. Song. 2011. Uterine Histotroph and
Conceptus Development: Select Nutrients and Secreted Phosphoprotein 1 Affect
MTOR Cell Signaling in Ewes. Biology of Reproduction.
Begley, N., K. Pierce, and F. Buckley. 2009. Milk production, udder health, body
condition score and fertility performance of Holstein-Friesian, Norwegian Red
and Norwegian Red × Holstein-Friesian cows on Irish dairy farms. Pages 191-
198 in Breeding for robustness in cattle.
Bello, N. M., J. S. Stevenson, and R. J. Tempelman. 2012. Invited review: Milk
production and reproductive performance: Modern interdisciplinary insights into
an enduring axiom. Journal of Dairy Science 95(10):5461-5475.
Berry, D. P., J. W. M. Bastiaansen, R. F. Veerkamp, S. Wijga, E. Wall, B. Berglund,
and M. P. L. Calus. 2012. Genome-wide associations for fertility traits in
Holstein–Friesian dairy cows using data from experimental research herds in
four European countries. Animal 6(08):1206-1215.
Berry, D. P., J. F. Kearney, K. Twomey, and R. D. Evans. 2013. Genetics of
reproductive performance in seasonal calving dairy cattle production systems.
Irish Journal of Agricultural and Food Research 52(1):1-16.
Berry, D. P., R. F. Veerkamp, and P. Dillon. 2006. Phenotypic profiles for body weight,
body condition score, energy intake, and energy balance across different parities
and concentrate feeding levels. Livestock Science 104(1–2):1-12.
performance in dairy and beef cattle. Animal 8(Supplements1):105-121.
for management of reproduction in dairy cows. Animal 8(Supplements1):151-
159.
26
Bollwein, H., J. Lüttgenau, and K. Herzog. 2012. Bovine luteal blood flow: basic
mechanism and clinical relevance. Reproduction, Fertility and Development
25(1):71-79.
Buckley, F., P. Dillon, M. Rath, and R. F. Veerkamp. 2000. The Relationship Between
Genetic Merit for Yield and Live Weight, Condition Score, and Energy Balance
of Spring Calving Holstein Friesian Dairy Cows on Grass Based Systems of
Milk Production. Journal of Dairy Science 83(8):1878-1886.
Buckley, F., N. Lopez-Villalobos, and B. J. Heins. 2014. Crossbreeding: implications
for dairy cow fertility and survival. Animal 8(Supplements1):122-133.
Buckley, F., K. O'Sullivan, J. F. Mee, R. D. Evans, and P. Dillon. 2003. Relationships
Among Milk Yield, Body Condition, Cow Weight, and Reproduction in Spring-
Calved Holstein-Friesians. Journal of Dairy Science 86(7):2308-2319.
Burke, C. R. and C. Fowler. 2007. Fertility in New Zealand dairy herds: Industry
situation and a way forward for improving on-farm reproductive performance.
http://side.org.nz/wp-content/uploads/2014/05/Fertility-in-New-Zealand-dairy-
herds.pdf. Date Accessed 18th June 2014.
Burke, C. R., S. Meier, S. McDougall, C. Compton, M. Mitchell, and J. R. Roche. 2010.
Relationships between endometritis and metabolic state during the transition
period in pasture-grazed dairy cows. Journal of Dairy Science 93(11):5363-
5373.
Butler, S., A. Marr, S. Pelton, R. Radcliff, M. Lucy, and W. Butler. 2003. Insulin
restores GH responsiveness during lactation-induced negative energy balance in
dairy cattle: effects on expression of IGF-I and GH receptor 1A. Journal of
pasture-based systems. Animal 8(Supplements1):15-26.
Butler, S. T., S. H. Pelton, and W. R. Butler. 2006. Energy Balance, Metabolic Status,
and the First Postpartum Ovarian Follicle Wave in Cows Administered
Propylene Glycol. Journal of Dairy Science 89(8):2938-2951.
Butler, W. R. 1998. Review: Effect of Protein Nutrition on Ovarian and Uterine
Physiology in Dairy Cattle. Journal of Dairy Science 81(9):2533-2539.
Butler, W. R. 2003. Energy balance relationships with follicular development, ovulation
and fertility in postpartum dairy cows. Livestock Production Science 83(2-
3):211-218.
27
Canfield, R. W. and W. R. Butler. 1990. Energy balance and pulsatile LH secretion in
early postpartum dairy cattle. Domestic Animal Endocrinology 7(3):323-330.
Canty, M. J., M. P. Boland, A. C. O. Evans, and M. A. Crowe. 2006. Alterations in
follicular IGFBP mRNA expression and follicular fluid IGFBP concentrations
during the first follicle wave in beef heifers. Animal Reproduction Science
93(3–4):199-217.
Carter, F., N. Forde, P. Duffy, M. Wade, T. Fair, M. A. Crowe, A. C. O. Evans, D. A.
Kenny, J. F. Roche, and P. Lonergan. 2008. Effect of increasing progesterone
concentration from Day 3 of pregnancy on subsequent embryo survival and
development in beef heifers. Reproduction, Fertility and Development
20(3):368-375.
Carthy, T. R., D. P. Berry, A. Fitzgerald, S. McParland, E. J. Williams, S. T. Butler, A.
R. Cromie, and D. Ryan. 2014. Risk factors associated with detailed
reproductive phenotypes in dairy and beef cows. animal 8(05):695-703.
Chapinal, N., M. E. Carson, S. J. LeBlanc, K. E. Leslie, S. Godden, M. Capel, J. E. P.
Santos, M. W. Overton, and T. F. Duffield. 2012. The association of serum
metabolites in the transition period with milk production and early-lactation
reproductive performance. Journal of Dairy Science 95(3):1301-1309.
Colazo, M. G., A. Dourey, R. Rajamahendran, and D. J. Ambrose. 2013. Progesterone
supplementation before timed AI increased ovulation synchrony and pregnancy
per AI, and supplementation after timed AI reduced pregnancy losses in
lactating dairy cows. Theriogenology 79(5):833-841.
Cole, J., G. Wiggans, L. Ma, T. Sonstegard, T. Lawlor, B. Crooker, C. Van Tassell, J.
Yang, S. Wang, L. Matukumalli, and Y. Da. 2011. Genome-wide association
analysis of thirty one production, health, reproduction and body conformation
traits in contemporary U.S. Holstein cows. BMC Genomics 12(1):408.
Crowe, M. A. 2008. Resumption of Ovarian Cyclicity in Post-partum Beef and Dairy
Cows. Reproduction in Domestic Animals 43:20-28.
28
95(7):3698-3710.
Science 95(7):3711-3721.
Daetwyler, H. D., A. Capitan, H. Pausch, P. Stothard, R. van Binsbergen, R. F.
Brondum, X. Liao, A. Djari, S. C. Rodriguez, C. Grohs, D. Esquerre, O.
Bouchez, M.-N. Rossignol, C. Klopp, D. Rocha, S. Fritz, A. Eggen, P. J.
Bowman, D. Coote, A. J. Chamberlain, C. Anderson, C. P. VanTassell, I.
Hulsegge, M. E. Goddard, B. Guldbrandtsen, M. S. Lund, R. F. Veerkamp, D. A.
Boichard, R. Fries, and B. J. Hayes. 2014. Whole-genome sequencing of 234
bulls facilitates mapping of monogenic and complex traits in cattle. Nature
Genetics 46(8):858-865.
Darwash, A. O., G. E. Lamming, and J. A. Woolliams. 1997. The phenotypic
association between the interval to post-partum ovulation and traditional
measures of fertility in dairy cattle. Animal Science 65:9-16.
Demetrio, D. G. B., R. M. Santos, C. G. B. Demetrio, and J. L. M. Vasconcelos. 2007.
Factors Affecting Conception Rates Following Artificial Insemination or
Embryo Transfer in Lactating Holstein Cows. Journal of Dairy Science
90(11):5073-5082.
Department of Agriculture, Fisheries and Food, 2010. Food Harvest 2020. Retrieved 4
March 2012, from http://agriculture.gov.ie/media/migration/agri-
foodindustry/foodharvest2020/foodharvest2020/2020strategy/2020Foodharvest1
90710.pdf. 2010.
Dillon, P., D. P. Berry, R. D. Evans, F. Buckley, and B. Horan. 2006. Consequences of
genetic selection for increased milk production in European seasonal pasture
based systems of milk production. Livestock Science 99(2-3):141-158.
Diskin, M. G., D. R. Mackey, J. F. Roche, and J. M. Sreenan. 2003. Effects of nutrition
and metabolic status on circulating hormones and ovarian follicle development
in cattle. Animal Reproduction Science 78(3-4):345-370.
Diskin, M. G., M. H. Parr, and D. G. Morris. 2011. Embryo death in cattle: an update.
Reproduction, Fertility and Development 24(1):244-251.
Drackley, J. K. 1999. Biology of Dairy Cows During the Transition Period: the Final
Frontier? Journal of Dairy Science 82(11):2259-2273.
29
Edmonson, A. J., I. J. Lean, L. D. Weaver, T. Farver, and G. Webster. 1989. A Body
Condition Scoring Chart for Holstein Dairy Cows. Journal of Dairy Science
72(1):68-78.
Ferris, C. P., D. C. Patterson, F. J. Gordon, S. Watson, and D. J. Kilpatrick. 2014.
Calving traits, milk production, body condition, fertility, and survival of
Holstein-Friesian and Norwegian Red dairy cattle on commercial dairy farms
over 5 lactations. Journal of Dairy Science 97(8):5206-5218.
Fitzgerald, A. M., D. P. Berry, T. Carthy, A. R. Cromie, and D. P. Ryan. 2014. Risk
factors associated with multiple ovulation and twin birth rate in Irish dairy and
beef cattle. Journal of Animal Science 92(3):966-973.
Forde, N., M. E. Beltman, G. B. Duffy, P. Duffy, J. P. Mehta, P. O'Gaora, J. F. Roche,
P. Lonergan, and M. A. Crowe. 2011a. Changes in the Endometrial
Transcriptome During the Bovine Estrous Cycle: Effect of Low Circulating
Progesterone and Consequences for Conceptus Elongation. Biology of
Reproduction.
Forde, N., M. E. Beltman, P. Lonergan, M. Diskin, J. F. Roche, and M. A. Crowe.
2011b. Oestrous cycles in Bos taurus cattle. Animal Reproduction Science
124(3–4):163-169.
Forde, N., J. Mehta, P. McGettigan, S. Mamo, F. Bazer, T. Spencer, and P. Lonergan.
2013. Alterations in expression of endometrial genes coding for proteins
secreted into the uterine lumen during conceptus elongation in cattle. BMC
Genomics 14(1):321.
Friggens, N. C., P. Berg, P. Theilgaard, I. R. Korsgaard, K. L. Ingvartsen, P. Løvendahl,
and J. Jensen. 2007. Breed and Parity Effects on Energy Balance Profiles
Through Lactation: Evidence of Genetically Driven Body Energy Change.
Journal of Dairy Science 90(11):5291-5305.
Fritz, S., A. Capitan, A. Djari, S. C. Rodriguez, A. Barbat, A. Baur, C. Grohs, B. Weiss,
M. Boussaha, D. Esquerré, C. Klopp, D. Rocha, and D. Boichard. 2013.
Detection of Haplotypes Associated with Prenatal Death in Dairy Cattle and
Identification of Deleterious Mutations in GART, SHBG and SLC37A2. Plos
One 8(6):e65550.
30
Funk, D. A. 2006. Major Advances in Globalization and Consolidation of the Artificial
Insemination Industry. Journal of Dairy Science 89(4):1362-1368.
Galvão, K. N., M. Frajblat, W. R. Butler, S. B. Brittin, C. L. Guard, and R. O. Gilbert.
2010. Effect of Early Postpartum Ovulation on Fertility in Dairy Cows.
Reproduction in Domestic Animals 45(5):e207-e211.
Garnsworthy, P., K. Sinclair, and R. Webb. 2008. Integration of Physiological
Mechanisms That Influence Fertility in Dairy Cows. animal 2:1144 - 1152.
Garverick, H. A., M. N. Harris, R. Vogel-Bluel, J. D. Sampson, J. Bader, W. R.
Lamberson, J. N. Spain, M. C. Lucy, and R. S. Youngquist. 2013.
Concentrations of nonesterified fatty acids and glucose in blood of periparturient
dairy cows are indicative of pregnancy success at first insemination. Journal of
Geary, T. W., M. F. Smith, M. D. MacNeil, M. L. Day, G. A. Bridges, G. A. Perry, F.
M. Abreu, J. A. Atkins, K. G. Pohler, E. M. Jinks, and C. A. Madsen. 2013.
Triennial Reproduction Symposium: Influence of follicular characteristics at
ovulation on early embryonic survival. Journal of Animal Science 91(7):3014-
3021.
Geary, U., N. Lopez-Villalobos, D. J. Garrick, and L. Shalloo. 2012. An analysis of the
implications of a change to the seasonal milk supply profile in the Irish dairy
industry utilizing a seasonal processing sector model. The Journal of
Agricultural Science 150(03):389-407.
Green, M. P., A. M. Ledgard, S. E. Beaumont, M. C. Berg, K. P. McNatty, A. J.
Peterson, and P. J. Back. 2011. Long-term alteration of follicular steroid
concentrations in relation to subclinical endometritis in postpartum dairy cows.
Journal of Animal Science 89(11):3551-3560.
Hansen, P. J. 2002. Embryonic mortality in cattle from the embryo's perspective.
Journalof Animal Science. 80(E-Suppl_2):E33-44.
Hansen, P. J., M. Drost, R. M. Rivera, F. F. Paula-Lopes, Y. M. Al-Katanani, C. E.
Krininger Iii, and C. C. Chase Jr. 2001. Adverse impact of heat stress on embryo
production: causes and strategies for mitigation. Theriogenology 55(1):91-103.
Harris, B. L. and E. S. Kolver. 2001. Review of Holsteinization on Intensive Pastoral
Dairy Farming in New Zealand. Journal of Dairy Science 84:E56-E61.
Heins, B. J., L. B. Hansen, A. R. Hazel, A. J. Seykora, D. G. Johnson, and J. G. Linn.
2012. Short communication: Jersey × Holstein crossbreds compared with pure
31
Holsteins for body weight, body condition score, fertility, and survival during
the first three lactations. Journal of Dairy Science 95(7):4130-4135.
Heins, B. J., L. B. Hansen, and A. J. Seykora. 2006a. Fertility and Survival of Pure
Holsteins Versus Crossbreds of Holstein with Normande, Montbeliarde, and
Scandinavian Red. Journal of Dairy Science 89(12):4944-4951.
Heins, B. J., L. B. Hansen, and A. J. Seykora. 2006b. Production of Pure Holsteins
Versus Crossbreds of Holstein with Normande, Montbeliarde, and Scandinavian
Red. Journal of Dairy Science 89(7):2799-2804.
Herlihy, M. M., D. P. Berry, M. A. Crowe, M. G. Diskin, and S. T. Butler. 2011.
Evaluation of protocols to synchronize estrus and ovulation in seasonal calving
pasture-based dairy production systems. Journal of Dairy Science 94(9):4488-
4501.
Hoelker, M., D. Salilew-Wondim, M. Drillich, G.-B. Christine, N. Ghanem, L. Goetze,
D. Tesfaye, K. Schellander, and W. Heuwieser. 2012. Transcriptional response
of the bovine endometrium and embryo to endometrial polymorphonuclear
neutrophil infiltration as an indicator of subclinical inflammation of the uterine
environment. Reproduction, Fertility and Development 24(6):778-793.
Hoglund, J., G. Sahana, B. Guldbrandtsen, and M. Lund. 2014. Validation of
associations for female fertility traits in Nordic Holstein, Nordic Red and Jersey
dairy cattle. BMC Genetics 15(1):8.
Holmes, C. W., G. F. Wilson, D. D. S. Mackenzie, D. S. Flux, I. M. Brookes, and A. W.
F. Davey. 2002. Milk production from pasture, 3rd edition. Butterworths of New
Zealand, Wellington, New Zealand.
Horan, B., P. Dillon, P. Faverdin, L. Delaby, F. Buckley, and M. Rath. 2005a. The
Interaction of Strain of Holstein-Friesian Cows and Pasture-Based Feed Systems
on Milk Yield, Body Weight, and Body Condition Score. Journal of Dairy
Science 88(3):1231-1243.
Horan, B., J. F. Mee, P. O’Connor, M. Rath, and P. Dillon. 2005b. The effect of strain
of Holstein-Friesian cow and feeding system on postpartum ovarian function,
63(3):950-971.
Horan, B., J. F. Mee, M. Rath, P. O'Connor, and P. Dillon. 2004. The effect of strain of
Holstein-Friesian cow and feeding system on reproductive performance in
seasonal-calving milk production systems. Animal Science 79:453-467.
32
Ingvartsen, K. L. and K. Moyes. 2013. Nutrition, immune function and health of dairy
cattle. animal 7(Supplements1):112-122.
Juengel, J. L. and G. D. Niswender. 1999. Molecular regulation of luteal progesterone
synthesis in domestic ruminants. Journal of Reproduction and Fertility:193-205.
Kennedy, J., P. Dillon, K. O'Sullivan, F. Buckley, and M. Rath. 2003. The effect of
genetic merit for milk production and concentrate feeding level on the
reproductive performance of Holstein-Friesian cows in a grass-based system.
Animal Science 76:297-308.
Larson, S. F., W. R. Butler, and W. B. Currie. 2007. Pregnancy rates in lactating dairy
cattle following supplementation of progesterone after artificial insemination.
Animal Reproduction Science 102(1-2):172-179.
Lazzari, G., S. Colleoni, R. Duchi, A. Galli, F. D. Houghton, and C. Galli. 2011.
Embryonic genotype and inbreeding affect preimplantation development in
cattle. Reproduction 141(5):625-632.
Lazzari, G., C. Wrenzycki, D. Herrmann, R. Duchi, T. Kruip, H. Niemann, and C. Galli.
2002. Cellular and Molecular Deviations in Bovine In Vitro-Produced Embryos
Are Related to the Large Offspring Syndrome. Biology of Reproduction
67(3):767-775.
Leblanc, S. 2010. Assessing the Association of the Level of Milk Production with
Reproductive Performance in Dairy Cattle. Journal of Reproduction and
Development 56(S):S1-S7.
Ledgard, A. M., G. A. Smolenski, H. Henderson, and R. S.-F. Lee. 2013. Influence of
pathogenic bacteria species present in the postpartum bovine uterus on proteome
profiles. Reproduction, Fertility and Development:-.
Leroy, J. L. M. R., T. Vanholder, J. R. Delanghe, G. Opsomer, A. Van Soom, P. E. J.
Bols, J. Dewulf, and A. de Kruif. 2004. Metabolic changes in follicular fluid of
the dominant follicle in high-yielding dairy cows early post partum.
Theriogenology 62(6):1131-1143.
Leroy, J. L. M. R., T. Vanholder, B. Mateusen, A. Christophe, G. Opsomer, A. de Kruif,
G. Genicot, and A. Van Soom. 2005. Non-esterified fatty acids in follicular fluid
of dairy cows and their effect on developmental capacity of bovine oocytes in
vitro. Reproduction 130(4):485-495.
33
Lonergan, P. 2011. Influence of progesterone on oocyte quality and embryo
development in cows. Theriogenology 76(9):1594-1601.
Lonergan, P. and N. Forde. 2014. Maternal-embryo interaction leading up to the
initiation of implantation of pregnancy in cattle. animal 8(Supplements1):64-69.
Løvendahl, P. and M. G. G. Chagunda. 2009. Short communication: Genetic variation
in estrus activity traits. Journal of Dairy Science 92(9):4683-4688.
Lucy, M. C. 2000. Regulation of Ovarian Follicular Growth by Somatotropin and
Insulin-Like Growth Factors in Cattle1. Journal of Dairy Science 83(7):1635-
1647.
Lucy, M. C. 2008. Functional Differences in the Growth Hormone and Insulin-like
Growth Factor Axis in Cattle and Pigs: Implications for Post-partum Nutrition
and Reproduction. Reproduction in Domestic Animals 43:31-39.
Lucy, M. C., H. Jiang, and Y. Kobayashi. 2001. Changes in the Somatotrophic Axis
Associated with the Initiation of Lactation. Journal of Dairy Science 84:E113-
E119.
feed allowances in a pasture system. Journal of Dairy Science 92(2):526-539.
Macmillan, K. L. 2012. The inCalf Project: improving reproductive performance of
cows in Australian dairy herds. Dairy Cow Fertility: Reproductive performance
for efficient pasture-based systems:6-18.
Maillo, V., D. Rizos, U. Besenfelder, V. Havlicek, A. K. Kelly, M. Garrett, and P.
Lonergan. 2012. Influence of lactation on metabolic characteristics and embryo
development in postpartum Holstein dairy cows. Journal of Dairy Science
95(7):3865-3876.
Mann, G. E. 2009. Corpus luteum size and plasma progesterone concentration in cows.
Marei, W. F., D. C. Wathes, and A. A. Fouladi-Nashta. 2012. Differential effects of
linoleic and alpha-linolenic fatty acids on spatial and temporal mitochondrial
distribution and activity in bovine oocytes. Reproduction, Fertility and
Development 24(5):679-690.
34
Martins, J. P. N., R. K. Policelli, L. M. Neuder, W. Raphael, and J. R. Pursley. 2011.
Effects of cloprostenol sodium at final prostaglandin F2α of Ovsynch on
complete luteolysis and pregnancy per artificial insemination in lactating dairy
cows. Journal of Dairy Science 94(6):2815-2824.
McCarthy, S., D. P. Berry, P. Dillon, M. Rath, and B. Horan. 2007a. Effect of strain of
Holstein–Friesian and feed system on calving performance, blood parameters
and overall survival. Livestock Science 111(3):218-229.
McCarthy, S., D. P. Berry, P. Dillon, M. Rath, and B. Horan. 2007b. Influence of
Holstein-Friesian Strain and Feed System on Body Weight and Body Condition
Score Lactation Profiles. Journal of Dairy Science 90(4):1859-1869.
McCarthy, S., B. Horan, P. Dillon, P. O’Connor, M. Rath, and L. Shalloo. 2007c.
Economic Comparison of Divergent Strains of Holstein-Friesian Cows in
Various Pasture-Based Production Systems. Journal of Dairy Science
90(3):1493-1505.
McCarthy, S. D., S. T. Butler, J. Patton, M. Daly, D. G. Morris, D. A. Kenny, and S. M.
Waters. 2009. Differences in the expression of genes involved in the
somatotropic axis in divergent strains of Holstein-Friesian dairy cows during
early and mid lactation. Journal of Dairy Science 92(10):5229-5238.
McClure, M. C., D. Bickhart, D. Null, P. VanRaden, L. Xu, G. Wiggans, G. Liu, S.
Schroeder, J. Glasscock, J. Armstrong, J. B. Cole, C. P. Van Tassell, and T. S.
Sonstegard. 2014. Bovine Exome Sequence Analysis and Targeted SNP
Genotyping of Recessive Fertility Defects BH1, HH2, and HH3 Reveal a
Putative Causative Mutation in SMC2 for HH3. Plos One 9(3):e92769.
McDougall, S. 2006. Reproduction performance and management of dairy cattle.
Journal of Reproduction and Development 52(1):185-194.
McDougall, S., H. Hussein, D. Aberdein, K. Buckle, J. Roche, C. Burke, M. Mitchell,
and S. Meier. 2011. Relationships between cytology, bacteriology and vaginal
discharge scores and reproductive performance in dairy cattle. Theriogenology
76(2):229-240.
McNeill, R. E., M. G. Diskin, J. M. Sreenan, and D. G. Morris. 2006. Associations
between milk progesterone concentration on different days and with embryo
survival during the early luteal phase in dairy cows. Theriogenology 65(7):1435-
1441.
35
McParland, S., J. F. Kearney, M. Rath, and D. P. Berry. 2007. Inbreeding Effects on
Milk Production, Calving Performance, Fertility, and Conformation in Irish
Holstein-Friesians. Journal of Dairy Science 90(9):4411-4419.
Mihm, M., N. Curran, P. Hyttel, P. G. Knight, M. P. Boland, and J. F. Roche. 1999.
Effect of dominant follicle persistence on follicular fluid oestradiol and inhibin
and on oocyte maturation in heifers. Journal of Reprodion and Fertility
116(2):293-304.
Nebel, R. L. and M. L. McGilliard. 1993. Interactions of High Milk Yield and
Reproductive Performance in Dairy Cows. Journal of Dairy Science
76(10):3257-3268.
Niswender, G. D., J. L. Juengel, W. J. McGuire, C. J. Belfiore, and M. C. Wiltbank.
1994. Luteal function: the estrous cycle and early pregnancy. Biology of
Reproduction 50(2):239-247.
Norman, H. D., J. R. Wright, S. M. Hubbard, R. H. Miller, and J. L. Hutchison. 2009.
Reproductive status of Holstein and Jersey cows in the United States. Journal of
Nyman, S., K. Johansson, D. J. de Koning, D. P. Berry, R. F. Veerkamp, E. Wall, and
B. Berglund. 2014. Genetic analysis of atypical progesterone profiles in
Holstein-Friesian cows from experimental research herds. Journal of Dairy
Science 97(11):7230-7239.
Oliveira, L. J., N. Mansourri-Attia, A. G. Fahey, J. Browne, N. Forde, J. F. Roche, P.
Lonergan, and T. Fair. 2013. Characterization of the Th Profile of the Bovine
Endometrium during the Oestrous Cycle and Early Pregnancy. Plos One
8(10):e75571.
Patton, J., D. A. Kenny, S. McNamara, J. F. Mee, F. P. O’Mara, M. G. Diskin, and J. J.
Murphy. 2007. Relationships Among Milk Production, Energy Balance, Plasma
Analytes, and Reproduction in Holstein-Friesian Cows. Journal of Dairy Science
90(2):649-658.
Patton, J., J. J. Murphy, F. P. O Mara, and S. T. Butler. 2009. Responses of North
American and New Zealand strains of Holstein?Friesian dairy cattle to
homeostatic challenges during early and mid-lactation. animal 3(02):251-260.
Patton, J., J. J. Murphy, F. P. O?Mara, and S. T. Butler. 2008. A comparison of energy
balance and metabolic profiles of the New Zealand and North American strains
of Holstein Friesian dairy cow. animal 2(06):969-978.
36
Peippo, J., Z. Machaty, and A. Peter. 2011. Terminologies for the pre-attachment
bovine embryo. Theriogenology 76(8):1373-1379.
Prendiville, R., K. M. Pierce, L. Delaby, and F. Buckley. 2011a. Animal performance
and production efficiencies of Holstein-Friesian, Jersey and Jersey × Holstein-
Friesian cows throughout lactation. Livestock Science 138(1–3):25-33.
Prendiville, R., L. Shalloo, K. M. Pierce, and F. Buckley. 2011b. Comparative
performance and economic appraisal of Holstein-Friesian, Jersey and
Jersey×Holstein-Friesian cows under seasonal pasture-based management. Irish
Journal of Agricultural and Food Research 50(2):123-140.
Pryce, J. E., S. Bolormaa, A. J. Chamberlain, P. J. Bowman, K. Savin, M. E. Goddard,
and B. J. Hayes. 2010. A validated genome-wide association study in 2 dairy
cattle breeds for milk production and fertility traits using variable length
haplotypes. Journal of Dairy Science 93(7):3331-3345.
Pryce, J. E., R. Woolaston, D. P. Berry, E. Wall, M. Winters, R. Butler, and M. Shaffer.
2014. World Trends in Dairy Cow Fertility. Proceedings, 10th World Congress
of Genetics Applied to Livestock Production.
Rabiee, A. R., I. J. Lean, J. M. Gooden, and B. G. Miller. 1999. Relationships Among
Metabolites Influencing Ovarian Function in the Dairy Cow. Journal of Dairy
Science 82(1):39-44.
Refsdal, A. O. 2007. Reproductive performance of Norwegian cattle from 1985 to 2005:
trends and seasonality. Acta Veterinaria Scandinavica 49:5-11.
Reist, M., D. K. Erdin, D. von Euw, K. M. Tschümperlin, H. Leuenberger, H. M.
Hammon, C. Morel, C. Philipona, Y. Zbinden, N. Künzi, and J. W. Blum. 2003.
Postpartum reproductive function: association with energy, metabolic and
endocrine status in high yielding dairy cows. Theriogenology 59(8):1707-1723.
Reynolds, C. K., P. C. Aikman, B. Lupoli, D. J. Humphries, and D. E. Beever. 2003.
Splanchnic Metabolism of Dairy Cows During the Transition From Late
Gestation Through Early Lactation. Journal of Dairy Science 86(4):1201-1217.
Rhinehart, J. D., M. J. Starbuck-Clemmer, J. A. Flores, R. A. Milvae, J. Yao, D. H.
Poole, and E. K. Inskeep. 2009. Low peripheral progesterone and late
embryonic/early fetal loss in suckled beef and lactating dairy cows.
37
Rizos, D., F. Carter, U. Besenfelder, V. Havlicek, and P. Lonergan. 2010. Contribution
of the female reproductive tract to low fertility in postpartum lactating dairy
Rizos, D., F. Ward, P. Duffy, M. P. Boland, and P. Lonergan. 2002. Consequences of
bovine oocyte maturation, fertilization or early embryo development in vitro
versus in vivo: Implications for blastocyst yield and blastocyst quality.
Molecular Reproduction and Development 61(2):234-248.
Roche, J. F., M. Mihm, M. G. Diskin, and J. J. Ireland. 1998. A Review of Regulation
of Follicle Growth in Cattle. Journal of Animal Science 76(suppl 3):16-29.
Roche, J. R., D. P. Berry, and E. S. Kolver. 2006. Holstein-Friesian Strain and Feed
Effects on Milk Production, Body Weight, and Body Condition Score Profiles in
Grazing Dairy Cows. Journal of Dairy Science 89(9):3532-3543.
Roche, J. R., C. R. Burke, S. Meier, and C. G. Walker. 2011. Nutrition × reproduction
interaction in pasture-based systems: is nutrition a factor in reproductive failure?
Animal Production Science 51(12):1045-1066.
Roche, J. R., N. C. Friggens, J. K. Kay, M. W. Fisher, K. J. Stafford, and D. P. Berry.
2009. Invited review: Body condition score and its association with dairy cow
productivity, health, and welfare. Journal of Dairy Science 92(12):5769-5801.
Roche, J. R., K. A. Macdonald, C. R. Burke, J. M. Lee, and D. P. Berry. 2007.
Associations Among Body Condition Score, Body Weight, and Reproductive
Performance in Seasonal-Calving Dairy Cattle. Journal of Dairy Science
90(1):376-391.
Sahana, G., U. S. Nielsen, G. P. Aamand, M. S. Lund, and B. Guldbrandtsen. 2013.
Novel Harmful Recessive Haplotypes Identified for Fertility Traits in Nordic
Holstein Cattle. Plos One 8(12):e82909.
85(11):2831-2842.
Santos, J. E. P., H. M. Rutigliano, and M. F. S. Filho. 2009. Risk factors for resumption
of postpartum estrous cycles and embryonic survival in lactating dairy cows.
Santos, T. M. A. and R. C. Bicalho. 2012. Diversity and Succession of Bacterial
Communities in the Uterine Fluid of Postpartum Metritic, Endometritic and
Healthy Dairy Cows. Plos One 7(12):e53048.
38
Sartori, R., G. J. M. Rosa, and M. C. Wiltbank. 2002a. Ovarian Structures and
Circulating Steroids in Heifers and Lactating Cows in Summer and Lactating
and Dry Cows in Winter. Journal of Dairy Science 85(11):2813-2822.
Sartori, R., R. Sartor-Bergfelt, S. A. Mertens, J. N. Guenther, J. J. Parrish, and M. C.
Wiltbank. 2002b. Fertilization and Early Embryonic Development in Heifers and
Lactating Cows in Summer and Lactating and Dry Cows in Winter. Journal of
Dairy Science 85(11):2803-2812.
Savio, J. D., M. P. Boland, N. Hynes, and J. F. Roche. 1990. Resumption of follicular
activity in the early post-partum period of dairy cows. Journal of Reproduction
and Fertility 88(2):569-579.
Senger, P. L. 1997. Pathways to pregnancy and parturition. Current Conceptions, Inc.,
Pullman, Washington.
Shalloo, L. 2009. Pushing the barriers on milk costs/ outputs. Proceedings on the
National Dairy Conference:19-38.
Shalloo, L., A. Cromie, and N. McHugh. 2014. Effect of fertility on the economics of
pasture-based dairy systems. animal 8(Supplements1):222-231.
Sheldon, I. M., J. G. Cronin, G. D. Healey, C. Gabler, W. Heuwieser, D. Streyl, J. J.
Bromfield, A. Miyamoto, C. Fergani, and H. Dobson. 2014. Innate immunity
and inflammation of the bovine female reproductive tract in health and disease.
Reproduction 148(3):R41-R51.
Sirard, M.-A., F. Richard, P. Blondin, and C. Robert. 2006. Contribution of the oocyte
to embryo quality. Theriogenology 65(1):126-136.
Snijders, S. E. M., P. Dillon, D. O'Callaghan, and M. P. Boland. 2000. Effect of genetic
merit, milk yield, body condition and lactation number on in vitro oocyte
development in dairy cows. Theriogenology 53(4):981-989.
Snijders, S. E. M., P. G. Dillon, K. J. O’Farrell, M. Diskin, A. R. G. Wylie, D.
O’Callaghan, M. Rath, and M. P. Boland. 2001. Genetic merit for milk
production and reproductive success in dairy cows. Animal Reproduction
Science 65(1–2):17-31.
Sonstegard, T. S., J. B. Cole, P. M. VanRaden, C. P. Van Tassell, D. J. Null, S. G.
Schroeder, D. Bickhart, and M. C. McClure. 2013. Identification of a Nonsense
Mutation in CWC15 Associated with Decreased Reproductive Efficiency in
Jersey Cattle. Plos One 8(1):e54872.
39
Stronge, A. J. H., J. M. Sreenan, M. G. Diskin, J. F. Mee, D. A. Kenny, and D. G.
Morris. 2005. Post-insemination milk progesterone concentration and embryo
survival in dairy cows. Theriogenology 64(5):1212-1224.
Sturmey, R. G., A. Reis, H. J. Leese, and T. G. McEvoy. 2009. Role of Fatty Acids in
Energy Provision During Oocyte Maturation and Early Embryo Development.
Reproduction in Domestic Animals 44:50-58.
Taylor, V. J., Z. Cheng, P. G. A. Pushpakumara, D. C. Wathes, and D. E. Beever. 2004.
Relationships between the plasma concentrations of insulin-like growth factor-I
in dairy cows and their fertility and milk yield. Veterinary Record 155(19):583-
588.
Thatcher, W., l. S. R. de, E. Schmitt, T. Diaz, L. Badinga, F. Simmen, C. Staples, and
M. Drost. 1996. Control and management of ovarian follicles in cattle to
optimize fertility. Reproduction, Fertility and Development 8(2):203-217.
Townson, D. H., P. C. Tsang, W. R. Butler, M. Frajblat, L. C. Griel, C. J. Johnson, R.
A. Milvae, G. M. Niksic, and J. L. Pate. 2002. Relationship of fertility to ovarian
follicular waves before breeding in dairy cows. Journal of Animal Science
80(4):1053-1058.
Van Hoeck, V., R. G. Sturmey, P. Bermejo-Alvarez, D. Rizos, A. Gutierrez-Adan, H. J.
Leese, P. E. J. Bols, and J. L. M. R. Leroy. 2011. Elevated Non-Esterified Fatty
Acid Concentrations during Bovine Oocyte Maturation Compromise Early
Embryo Physiology. Plos One 6(8):e23183.
Vanholder, T., J. Lmr Leroy, A. Van Soom, D. Maes, M. Coryn, T. Fiers, A. de Kruif,
and G. Opsomer. 2006. Effect of non-esterified fatty acids on bovine theca cell
steroidogenesis and proliferation in vitro. Animal Reproduction Science 92(1-
2):51-63.
VanRaden, P. M. and R. H. Miller. 2006. Effects of Nonadditive Genetic Interactions,
Inbreeding, and Recessive Defects on Embryo and Fetal Loss by Seventy Days.
VanRaden, P. M., K. M. Olson, D. J. Null, and J. L. Hutchison. 2011. Harmful recessive
effects on fertility detected by absence of homozygous haplotypes. Journal of
Dairy Science 94(12):6153-6161.
Vasconcelos, J. L. M., D. G. B. Demétrio, R. M. Santos, J. R. Chiari, C. A. Rodrigues,
and O. G. S. Filho. 2006. Factors potentially affecting fertility of lactating dairy
cow recipients. Theriogenology 65(1):192-200.
40
Veerkamp, R. F., B. Beerda, and T. van der Lende. 2003. Effects of genetic selection for
milk yield on energy balance, levels of hormones, and metabolites in lactating
cattle, and possible links to reduced fertility. Livestock Production Science 83(2-
3):257-275.
subfertile dairy cow strains. Physiological Genomics 44(1):47-58.
Walsh, S., F. Buckley, K. Pierce, N. Byrne, J. Patton, and P. Dillon. 2008. Effects of
Breed and Feeding System on Milk Production, Body Weight, Body Condition
Score, Reproductive Performance, and Postpartum Ovarian Function. Journal of
Dairy Science 91(11):4401-4413.
Walsh, S. W., F. Mossa, S. T. Butler, D. P. Berry, D. Scheetz, F. Jimenez-Krassel, R. J.
Tempelman, F. Carter, P. Lonergan, A. C. O. Evans, and J. J. Ireland. 2014.
Heritability and impact of environmental effects during pregnancy on antral
follicle count in cattle. Journal of Dairy Science 97(7):4503-4511.
123(3–4):127-138.
47:304-312.
Williams, E. J., D. P. Fischer, D. E. Noakes, G. C. W. England, A. Rycroft, H. Dobson,
and I. M. Sheldon. 2007. The relationship between uterine pathogen growth
density and ovarian function in the postpartum dairy cow. Theriogenology
68(4):549-559.
Williams, E. J., D. P. Fischer, D. U. Pfeiffer, G. C. W. England, D. E. Noakes, H.
Dobson, and I. M. Sheldon. 2005. Clinical evaluation of postpartum vaginal
mucus reflects uterine bacterial infection and the immune response in cattle.
Williams, E. J., K. Sibley, A. N. Miller, E. A. Lane, J. Fishwick, D. M. Nash, S. Herath,
G. C. W. England, H. Dobson, and I. M. Sheldon. 2008. ORIGINAL ARTICLE:
The Effect of Escherichia coli Lipopolysaccharide and Tumour Necrosis Factor
Alpha on Ovarian Function. American Journal Of Reproductive Immunology
60(5):462-473.
41
Wiltbank, M. C. 1994. Cell types and hormonal mechanisms associated with mid-cycle
corpus luteum function. Journal of Animal Science 72(7):1873-1883.
Wiltbank, M. C., A. H. Souza, P. D. Carvalho, A. P. Cunha, J. O. Giordano, P. M.
Fricke, G. M. Baez, and M. G. Diskin. 2014. Physiological and practical effects
of progesterone on reproduction in dairy cattle. animal 8(Supplements1):70-81.
Woelders, H., T. van der Lende, A. Kommadath, M. F. W. te Pas, M. A. Smits, and L.
M. T. E. Kaal. 2014. Central genomic regulation of the expression of oestrous
behaviour in dairy cows: a review. animal 8(05):754-764.
Xu, Z. Z., L. J. Burton, and K. L. Macmillan. 1997. Reproductive performance of
lactating dairy cows following estrus synchronization regimens with PGF2α and
progesterone. Theriogenology 47(3):687-701.
42
Chapter Three
Genetic merit for fertility traits in Holstein cows:

Transition period, uterine health and resumption
of cyclicity
3.1 Preface
At the time of thesis submission this chapter was published in Journal of Dairy Science
(Accepted January 23, 2014; http://dx.doi.org/10.3168/jds.2013-7278). The full
reference is:
Moore, S.G., T. Fair, P. Lonergan, and S.T. Butler. Genetic merit for fertility traits in
Holstein cows: IV. Transition period, uterine health and resumption of cyclicity. J.
Dairy Sci. 2014, 97:2740-2752.
Stephen Moore was the primary author and carried out the experimental work, statistical
analysis and drafted the manuscript. Stephen Moore and Stephen Butler conceived,
designed and coordinated the study. All authors interpreted the data and contributed to
the manuscript.
Formatting and reference style has been edited for consistency throughout the thesis.
Figure and table captions have been assigned with a chapter prefix. Acknowledgements
have been removed. All other aspects are consistent with the published manuscript.
43
3.2 Abstract
The objective of this study was to monitor the dry matter intake (DMI), metabolic
status, uterine health and resumption of cyclicity in cows with similar genetic merit for
milk production traits but with either good (Fert+) or poor genetic merit (Fert-) for
fertility traits. Twenty six cows were enrolled in the study, and data are reported for 15
Fert+ and 10 Fert- cows that completed the study. All cows received a total mixed
ration diet during early lactation and were turned out to pasture in late spring. Dry
matter intake was recorded daily from weeks -2 to 5 relative to parturition. Blood
metabolites and metabolic hormones were measured from weeks -2 to 8 relative to
parturition. Milk production, body condition score and body weight until week 35 of
lactation are reported. To monitor uterine health, vaginal mucus was scored weekly on a
scale of zero (no pus) to three (≥ 50% pus) from parturition to week 8 and uterine
polymorphonuclear neutrophil count was measured at weeks 3 and 6 postpartum.
Prepartum DMI was similar between genotypes, but during the postpartum period, Fert+
cows had significantly greater DMI than Fert- cows (19.7 vs. 16.8 kg DM/d). Energy
balance at week 1 was significantly greater in Fert+ cows than Fert- cows (2.3 vs. -1.1
UFL/d). Fert+ cows had significantly greater daily milk solids production (1.9 vs. 1.7
kg/d) and tended to have greater daily milk yield (24.2 vs. 22.3 kg/d). Fert+ cows had
significantly greater mean circulating insulin-like growth factor-1 (102.6 vs. 56.9
ng/mL) and tended to have greater mean circulating insulin (3.3 vs. 2.6 μIU/mL)
compared with Fert- cows from weeks -2 to 8 relative to parturition. Mean circulating
glucose (3.4 vs. 3.0 mmol/L) concentrations were significantly greater in Fert+ cows
compared with Fert- cows from weeks -2 to 3 relative to parturition. Fert+ cows
maintained significantly greater mean body condition score throughout lactation
compared with Fert- cows (2.98 vs. 2.74 units). Fert+ cows had better uterine health
compared with Fert- cows as evidenced by lower weekly vaginal mucus scores during
weeks 2 to 6 postpartum, and based on uterine cytology a smaller proportion were
classified as having endometritis at week 3 (0.42 vs. 0.78) and 6 (0.25 vs. 0.75). Also, a
significantly greater proportion of Fert+ cows had resumed cyclicity by week 6
postpartum (0.86 vs. 0.20) compared with Fert- cows. Hence we report for the first time
that genetic merit for fertility traits is associated with postpartum uterine health status.
Superior uterine health and earlier resumption of cyclicity may be mediated through
differences in DMI, energy balance, insulin, insulin-like growth factor-1 and body
44
condition score profiles. Importantly, phenotypic improvement in fertility traits was
achieved without antagonising milk production.
45
3.3 Introduction
The transition period in cattle is described as the period from 3 weeks pre-calving to 3
weeks post-calving, and is associated with the potential occurrence of a vast array of
diseases that affect production, fertility and health (Drackley, 1999). During this period,
the energy requirements of the foetus and the mammary gland increase at a greater rate
than energy intake. Typically, dairy cows enter a period of negative energy balance
(EBal) a few days before calving, reach nadir two weeks later and return to positive
energy balance by week 10 (Butler, 2003). Some of the adverse effects of negative
EBAL on fertility are mediated by delays in resumption of cyclicity (Butler et al.,
2006). After parturition, circulating glucose is prioritised for the mammary gland
instead of peripheral tissues and adipose tissue is mobilised, resulting in NEFA and
glycerol release from adipose tissue, and a decline in body condition score (BCS). In the
liver, NEFA can be (i) completely oxidised for energy; (ii) partially oxidised to form
ketones; or (iii) esterified to form triglycerides, resulting in fatty liver (Ingvartsen,
2006). Concurrently, delayed recoupling of the somatotropic axis due to insufficient
circulating insulin (Butler et al., 2003) increases the rate and duration of adipose tissue
mobilisation. Peripartum concentrations of these metabolites have been shown to be
different in cows that do or do not ovulate the follicle from the first postpartum
follicular wave (Butler et al., 2006), and also in cows that do or do not become pregnant
to first AI (Garverick et al., 2013). In addition, circulating concentrations of NEFA,
BHBA and glucose have been incorporated into a model of "physiological imbalance"
that is associated with the risk of disease during early lactation (Moyes et., 2013). Also,
early resumption of ovarian cyclicity following parturition is a key factor in determining
subsequent fertility (Darwash et al., 1997; Galvão et al., 2010).
Positive effects of BCS on fertility have been reported in pasture and

confinement dairy systems (Buckley et al., 2003; Roche et al., 2007; Santos et al.,
2009). Attempts to minimise adipose tissue mobilisation during the early post-partum
period through altered nutritional and management strategies have had limited success
in pasture-based systems (Horan et al., 2005a; Roche et al., 2006). However, it has been
shown that BCS is under strong genetic control and that it differs between breeds and
between different strains within breed (Horan et al., 2005a, Friggens et al., 2007; Lucy
et al., 2009; Prendiville et al., 2009; Cummins et al., 2012a; Heins et al., 2012).
46
It is generally accepted that all cows become exposed to bacteria after calving.
The development of uterine disease depends on the type of bacteria involved and on the
immune response of the cow, and is associated with reduced subsequent fertility
(Sheldon et al., 2009). Clinical disease, lower dry matter intake (DMI), increased
bacterial presence and increased NEFA and BHBA concentrations during the transition
period have been associated with the incidence of endometritis between four and six
weeks postpartum (LeBlanc, 2012).
We have previously validated a lactating Holstein cow genetic model of fertility

(Cummins et al., 2012a), and used this animal model to identify some of the effects of
genetic merit for fertility traits on phenotypic measures of fertility (Cummins et al.,
2012a, b, c). The aim of the current study was to determine the effect of genetic merit
for fertility traits on DMI, energy balance, blood indicators of metabolic status during
late gestation and the early lactation period, postpartum uterine health and the
resumption of ovarian cyclicity.
47
3.4 Materials and Methods
3.4.1 Animal Model

A genetic model of fertility was established in Teagasc Moorepark to elucidate the
mechanisms responsible for poor fertility in lactating Holstein dairy cows (Cummins et
al., 2012a, b, c). Briefly, heifers with >75% Holstein genetics with extreme positive
(i.e., poor fertility; Fert-) or negative (i.e., high fertility; Fert+) EBV for calving interval
were selected from the national dairy cattle database. Within the Irish national herd, the
selected heifers represented the top 25% in genetic merit for milk production. Fert-
heifers represented the bottom 5% in genetic merit for calving interval, whereas Fert+
heifers represented the top 20% in genetic merit for calving interval. In subsequent
years, herd replacements were generated by selecting suitable sires to maintain the
difference in genetic merit for calving interval. The list was restricted to sires with >200
kg PTA for milk production, >0% PTA milk fat and protein concentration and >75%
Holstein genetics. From this group, sires with >5 days PTA for calving interval were
selected for mating with Fert- cows and sires with <-5 days PTA for calving interval
were selected for mating with Fert+ cows. Twenty-six cows were enrolled in the current
study and the EBV of the cows from both genotypes are summarized in Table 3.1. The
parity structure of the Fert+ cows was 3, 4 and 8 cows in second, third and fourth
lactation, respectively. The parity structure of the Fert- cows was 2, 3, and 6 cows in
second, third and fourth lactation, respectively. Fert+ and Fert- cows were represented
by 6 and 9 sires respectively. The maximum and minimum number of daughters from
an individual sire for Fert+ and Fert- cows was 4 and 1; and 2 and 1, respectively.
3.4.2 Feed and Management System

The experimental procedures involving animals on this study were licensed by the
Department of Health, Ireland, in accordance with the Cruelty to Animals Act (Ireland
1876) and the European Community Directive 86/609/EEC. The study was undertaken
at Teagasc Moorepark from January 2012 to December 2012. Cows were housed in a
freestall barn during the dry period until 35 days post-partum. During the days
approaching parturition, cows were moved to a straw-bedded calving shed. Dry matter
intake was recorded daily using the Griffith Elder feeding system (Griffith Elder Ltd,
Bury St Edmunds, Suffolk, UK). A prepartum diet of grass silage, concentrate ration,
straw and dry cow mineral mix was fed ad libitum. Postpartum cows were fed a TMR
48
ad libitum plus 6 kg dairy concentrate per day at the a.m. and p.m. milkings. Feed
refusals were removed every second day. Diet ingredients were sampled weekly and
composited monthly for analysis. The ingredient and nutrient composition of the diets
are outlined in Table 3.2. Cows were turned out to grass on March 26th and managed as
one herd in a rotational grazing system. Cows grazed a predominantly perennial
ryegrass (Lolium perenne L.) sward with fresh pasture allocated daily. The mean daily
herbage allowance was 14.5 ± 1.3 kg DM/cow/day which was supplemented with 3.2 ±
0.2 kg/cow/day of dairy concentrate fed at a.m. and p.m. milking.
Table 3.1. The mean estimated breeding value1 (and SD) for both genotypes based on
their sire, maternal grandsire and maternal great grand-sire estimated breeding values
Genotype2
Item Fert+ Fert-
No. of animals 15 11
Holstein 94 (4.7) 95 (5.5)
Milk (kg) 408 (154.0) 428 (143.4)
Fat (kg) 21.2 (5.2) 18.2 (6.9)
Fat (g/kg) 0.09 (0.08) 0.02 (0.1)
Protein (kg) 17.4 (6.56) 18.0 (6.08)
Protein (g/kg) 0.05 (0.06) 0.05 (0.07)
Survival (%) 3.8 (0.82) -3.4 (1.12)
Calving Interval (d) -6.4 (1.24) 8.2 (2.94)
Sire calving interval (d) -9.3 (2.4) 12.3 (2.4)
Maternal grandsire calving interval (d) -7.9 (3.34) 10.9 (4.5)
1
PTA were obtained from the Autumn 2012 official dairy evaluations published by
the Irish Cattle Breeding Federation and multiplied by 2 to convert to EBV.
Individual cow EBV were determined using the following formula: 0.5*sireEBV +
0.25*MGSireEBV + 0.125*MGGsireEBV
2
Fert+ = good-fertility cows; Fert- = poor-fertility cows
3.4.3 Animal Measurements

Cows were milked twice daily at 0800 and 1600. Milk yield was recorded at each
milking using electronic milk meters (Dairymaster, Causeway, Co. Kerry, Ireland).
Milk composition (fat, protein and lactose) was determined weekly from successive
p.m. and a.m. samples by mid-infrared reflectance spectroscopy (FT6000 Milkscan
instrument, Foss Electric, Hillerød, Denmark). Body weight and body condition score
were recorded weekly from week 2 before calving to week 15 of lactation, and
fortnightly thereafter. Body condition score was assessed using the 1 to 5 scale in 0.25
increments (Edmonson et al., 1989). Mean calving dates were February 11 (SD ± 15.9
d) and February 10 (SD ± 10.6 d) for Fert+ and Fert- cows, respectively. Energy
balance was estimated as the difference between energy intake and the sum of energy
49
for maintenance and milk production, using the French net energy (NE) system (Jarrige,
1989). This system expresses energy units as unite fourragère lait (UFL) which is the
NE content of 1 kg of air-dry standard barley for milk production. The energy required
for maintenance and milk production were calculated using the equations developed by
O' Mara (1997): Energy requirement for maintenance (UFL/day) = 1.4 + 0.6 BW/100;
Energy requirement for milk (UFL/kg of milk) = 0.054 FC + 0.031 PC + 0.028LC -
0.015; where FC = fat concentration (%), PC = protein concentration (%) and LC =
lactose concentration (%).
Blood samples were collected weekly for 2 weeks before expected date of
calving, twice weekly during the first 4 weeks after calving and weekly thereafter until
week 8 postpartum following the a.m. milking. Blood samples were collected via
coccygeal venepuncture into vacutainers (Becton Dickinson, Plymouth, UK) containing
lithium heparin, centrifuged at 2,000 x g for 15 min at 4 °C, plasma decanted and stored
at -20 °C.
Milk samples were collected during the a.m. milking 3 times per week (Monday,
Wednesday and Friday) using electronic milk meters (Dairymaster, Causeway, Co.
Kerry, Ireland). Milk samples were preserved (Lactab MarkIII, Thomson and Capper
Ltd., Cheshire, UK) and stored at 4 °C until progesterone (P4) analysis.
Vaginal mucus was collected weekly after calving following the a.m. milking.
The vulva and perineal area were sanitised with an antiseptic solution and dried with
paper towels. A clean, lubricated, gloved hand was inserted through the vulva, and
mucus was collected from the vagina into a 50 ml conical tube for inspection, and a
character score was determined based on the criteria outlined by Williams et al. (2005):
(0) clear and translucent mucus; (1) mucus containing flecks of white or off-white pus;
(2) <50% white or off-white mucopurulent material.; or (3) ≥50% white or off-white
mucopurulent material.
50
Table 3.2. Ingredient and nutrient composition of the transition period diet
Dry cow diet (g/kg DM)
Grass silage 760
Straw 140
Concentrate 100
Dry cow concentrate ingredients (g/kg as fed)

Barley 250
Soya hulls 150
Rapeseed 150
Palm kernel meal 100
Milk solids 80
Sunflower meal 75
Citrus pulp 60
Dries distillers grain 60
Maize gluten 44
Minerals1 25
Palm oil 6
Lactating cow diet (g/kg DM)

Grass silage 340
Maize silage 310
Soyabean meal 110
Molasses 20
Parlour concentrate 230
Lactating cow concentrate ingredients (g/kg as fed)

Barley 320
Soya hulls 205
Rapeseed 140
Field beans 100
Dried distillers grain 100
Molasses 60
Citrus pulp 50
Minerals2 25
Nutrient composition of concentrate Dry cow Lactating cow

DM (g/kg) 854 872
Net energy (UFL/kg DM) 0.92 1.12
Ash (g/kg DM) 78.4 37
Crude Protein (g/kg DM) 159 142
NDF (g/kg DM) 506 251
Vitamin and mineral mix: 1256 g/kg of Na, 150 g/kg of Mg, 14000 mg/kg of cupric
sulphate pentahydrate, 5556 mg/kg of zinc oxide, 198 mg/kg of cobaltous carbonate
monohydrate, 110 mg/kg of sodium selenite, 1613 mg/kg of manganous oxide, 806 mg/kg
of calcium iodate anhydrous, 275000 IU/kg of vitamin A, 75000 IU/kg of vitamin D, 500
mg/kg of vitamin E and 200 µg/kg of vitamin B12.
2
229 g/kg of Ca, 100 g/kg of Na, 70 g/kg of P, 5 g/kg of Mg, 4500 mg/kg of Zn, 3000
mg/kg of Cu, 1500 mg/kg of Mn, 500 mg/kg of I, 400 mg/kg *Bioplex Cu, 400 mg/kg of
*Bioplex Zn, 99 mg/kg of Co, 37 mg/kg of Se, 375000 IU/kg of vitamin A, 100000 IU/kg
of vitamin D3, 1250 mg/kg of vitamin E and 200 mg/kg of vitamin B12. *Alltech Inc.,
Nicholasville, KY
51
Uterine cytology samples were collected on d 21 (SD ± 1 d) and d 42 (SD ± 2 d)
postpartum. For each cow, uterine cytology samples were collected prior to vaginal
mucus collection when both coincided. The vulva and perineal area were sanitised with
antiseptic solution and dried with paper towels. An AI cannula (53 cm), enclosed by an
embryo transfer (ET) plastic sheath (IMV Technologies, L’Aigle, France), was placed
in a plastic sleeve. The apparatus was guided through the cervix to the common body,
and the plastic sleeve was pierced. The AI gun was removed, leaving the ET plastic
sheath in situ. A sterile cytology brush, attached to copper wire (49 cm), was guided
through the ET plastic sheath to the uterine body. An endometrial cytology sample was
collected by one gentle rotation of the cytobrush against the uterine wall. The cytobrush
was retracted into the ET plastic sheath and both were withdrawn from the uterus. The
AI cannula was placed in disinfectant (Meddis, Medichem International Ltd, Sevenoaks,
England) between uses. The cytobrush was smeared against glass microscope slides, in
duplicate, allowed to air-dry and stained in the laboratory 24 h later. Smears were fixed
to the slides with methanol. Slides were stained with separate eosin and thiazine
reagents (Wescor Inc, South Logan, Utah, USA) by a slide stainer (Wescor Aerospray
Automatic Slide Stainer, Wescor, Inc, South Logan, Utah, USA). The reagents were
rinsed from the slide with an eosin rinse. Each slide was evaluated at 100x
magnification by a single cytologist blind to the cow genotype. One hundred nucleated
cells were counted, from which the percentage that were poylmorphonuclear neutrophils
(PMN) was calculated.
3.4.4 Hormone and Metabolite Analysis

Plasma samples collected at week -2, -1, 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7 and 8
relative to parturition (week 0) were analysed for concentrations of NEFA, BHBA and
glucose by enzymatic colorimetry using an ABX Pentra 400 autoanalyser (ABX Mira,
Montpellier, France; NEFA kit supplied by Wako Chemicals GmBH, Fuggerstraße 12,
D-41468 Neuss, Germany; BHBA kit supplied by Randox Laboratories Limited, 55
Diamond Road, Crumlin, Co. Antrim, BT29 4QY, United Kingdom; Glucose kit
supplied by Horiba ABX, Montpellier, France). Plasma samples collected at weeks -2,
0, 2, 4, 6 and 8 relative to parturition (0) were analysed for concentrations of insulin and
insulin-like growth factor-1 (IGF1). Concentrations of insulin were determined by solid-
125
phase I radioimmunoassay (Coat-A-Count Insulin, Diagnostic Products Corporation,
Los Angeles, CA). Inter- and intra-assay coefficients of variation were 7.8% and 13.5%,
respectively. Concentrations of IGF1 were determined by validated double antibody
52
radioimmunoassay, following ethanol:acetone:acetic acid extraction. Inter- and intra-
assay coefficients of variation were 2.7% and 12.1%, respectively. Both genotypes were
equally represented in each assay and all samples for a cow were completed in a single
assay.
Milk P4 concentrations were measured using a competitive ELISA test

(Ridgeway Science, Gloucester, UK). The inter- and intra-assay coefficients of variation
were 7.8% and 9.7%, respectively and the sensitivity of the assay was 0.5 ng/ml.
3.4.5 Data Handling

All data handling was performed using SAS (SAS Institute, 2006). Twenty-six cows
were enrolled on this study. Records of one Fert- cow were removed from the statistical
analysis due to ill-health. Data collected beyond lactation week 35 were excluded from
the analysis because non-pregnant cows were culled before completing a full lactation.
Daily measurements of milk, fat, protein and lactose yields were collapsed into average
weekly yields. The milk fat to protein ratio was calculated by dividing the milk fat
percent by the milk protein percent. Data were checked for normality. Suitable Box-Cox
transformations were identified to normalise the distribution of lactose, MUN, BHBA,
insulin, IGF1, NEFA and PMN count data. The distribution of somatic cell count data
was normalised by natural logarithm transformation and reported as somatic cell score
(SCS). Dry matter intake and energy balance data were available for 22 cows (12 Fert+
and 10 Fert) during the transition period. These data were analysed as 2 periods;
prepartum (data for the final 3 weeks before calving date) and postpartum (data for the
first 5 weeks after calving date). Linear interpolation was performed to calculate BW
and BCS values for every week of the study. Blood metabolite and metabolic hormone
data were analysed from 2 weeks prepartum to 8 weeks postpartum. In addition, glucose
concentrations were also analysed from 2 weeks prepartum to 3 weeks postpartum.
Cows were classified as having sub-clinical ketosis if BHBA concentrations were ≥ 1.2
and ≤ 2.9 mmol/L at least once during the first 3 weeks of lactation and were classified
with clinical ketosis if BHBA concentrations were > 2.9 mmol/L at least once during
the first 3 weeks of lactation (Oetzel, 2004). The timing of the BCS and BW nadir was
identified as the earliest week during the first 15 weeks postpartum that the lowest value
was recorded. Cows were classified as having endometritis at week 3 if PMN counts
were greater than 18%, and at week 6 if PMN counts were greater than 10% (Sheldon et
al., 2006).
53
3.4.6 Statistical Analysis
All statistical analysis was performed using SAS (SAS Institute, 2006). Mixed model
procedures were used to determine the effect of genotype on variables with repeated
measures such as milk production, BW, BCS, DMI, energy balance, blood metabolite
and metabolic hormone concentrations. A first-order auto regressive covariance
structure was applied and cow nested within genotype was included as a random effect.
Genotype, lactation week and their interaction were included as fixed effects. Parity,
calving date and their interactions with genotype were included initially but removed if
not significant (P > 0.1). The Tukey adjustment was included to correct for multiple
comparison tests. Contrasts were written to compare glucose, insulin and IGF1
concentrations at individual time-points between genotypes. The effect of genotype on
specific BCS variables (i.e., BCS at calving, postpartum BCS nadir, week of BCS nadir,
BCS change from calving to nadir) and weekly vaginal mucus scores were analysed by
one-way nonparametric test.
Logistic regression was carried out using the GENMOD procedure to determine
the effect of genetic merit for fertility traits on binary variables such as the proportion of
animals classified as having endometritis, the proportion of animals to have resumed
postpartum cyclicity and the proportion of animals classified with sub-clinical or
clinical ketosis. Parity and calving date were included in the initial model but removed
if not significant. Data were assumed to be binomially distributed and a logit link
function was used in the model statement. The model tested the probability of a positive
response and predicted probabilities were calculated from model solutions using the
formula PP = (1 + e-(α+ßx)), where α is the predicted intercept of the model, ß is the
predicted regression coefficient(s), and x is the design matrix for the fixed effects. Odds
ratios and confidence intervals were calculated as the exponent of model solutions.
Fert+ cows were set as the reference group. Odds ratios are reported for Fert- cows
relative to Fert+ cows.
The interval from calving to achieving a vaginal mucus score of zero was
determined by survival analysis using the LIFETEST procedure. In the analysis of
postpartum interval to achieve a vaginal mucus score of zero, 2 cows were censored (1
Fert+ and 1 Fert-) at week 1 postpartum because they received intra-uterine antibiotic.
54
3.5 Results
3.5.1 Milk Production

The effect of genetic merit for fertility traits is summarised in Table 3.3. During the first
35 weeks, Fert+ cows tended to have greater mean daily milk yield (+ 1.9 kg/d; P =
0.08) and had greater (P = 0.05) mean daily milk solids production (1.89 ± 0.05 kg/d)
than Fert- cows (1.74 ± 0.06 kg/d; Figure 3.1). Mean milk protein (+ 1.2 g/kg of milk)
and lactose (+ 0.8 g/kg of milk) concentrations tended to be greater (both P = 0.1) in
Fert+ cows compared with Fert- cows. Genotype had no effect on mean milk fat (P
=0.98) or MUN (P = 0.6) concentrations, milk fat to protein ratio or SCS (both P = 0.4).
3.5.2 Energy Balance, DMI, BCS and BW

The effect of genetic merit for fertility traits on DMI and energy balance profiles from
week 2 prepartum to week 5 postpartum are shown in Figure 3.2. Genotype had no
effect on the mean prepartum DMI (14.8 vs. 14.3 kg DM/d for Fert+ and Fert- cows,
respectively; P = 0.63) but Fert+ cows had greater mean postpartum DMI than Fert-
cows (19.7 vs. 16.8 kg DM/d; P = 0.02). Neither prepartum (6.1 vs. 5.5 UFL/d for Fert+
and Fert- cows, respectively; P = 0.45) or postpartum (-0.3 vs. -1.2 UFL/d for Fert+ and
Fert- cows, respectively, P = 0.37) energy balance was affected by genotype. However,
energy balance at week 1 was greater in Fert+ than in Fert- cows (2.3 vs. -1.2 UFL/d, P
= 0.02). Mean BCS and BW profiles from weeks -2 to 35 relative to parturition are
shown in Figure 3.3. Mean BCS (2.98 vs. 2.75 units, P < 0.0001) and BW (578.5 vs.
545.8 kg, P = 0.05) were greater in Fert+ cows than in Fert- during the study period.
Mean BCS at calving and the timing of BCS nadir were similar for both genotypes
(Table 3.4) but the loss of body condition tended to be greater in Fert- cows than in
Fert+ cows (additional 0.13 BCS loss; P = 0.1). At nadir, Fert+ cows had greater mean
BCS than Fert- cows (P = 0.009).
55
Table 3.3. The effect of genetic merit for fertility traits on daily milk production variables during the first 35 weeks of
lactation
Genotype P-value
Variable Fert+ Fert- SEM1 Genotype Genotype x week
Number of animal records 15 10
Milk yield (kg/d) 24.2 22.3 0.88 0.08 0.5
Protein (g/kg of milk) 34.6 33.4 0.05 0.1 0.98
Fat (g/kg of milk) 43.8 43.8 0.11 0.98 0.66
Lactose (g/kg of milk) 46.3 (45.6 – 46.9) 45.5 (44.6 – 46.3) - 0.14 0.85
MUN3 (g/kg of milk) 31.9 (29.7 – 34.3) 31.1 (29.2 – 33.1) - 0.6 0.84
Milk solids2 (kg/d) 1.89 1.74 0.05 0.05 0.99
Fat to protein ratio 1.27 1.3 0.03 0.42 0.53
SCS units3 3.94 (3.50 – 4.39) 4.22 (3.67 – 4.77) - 0.38 0.06
1
= pooled standard error
2
= sum of fat and protein yield
3
Data presented as LSM with 95% CI in parentheses
56
40
35 Fert-
30 Fert+
Milk Yield (kg/d)

25
20
15
10
5
0
3.00
2.50
Milk solids (kg/d)
2.00
1.50
1.00
0.50
0.00
0 5 10 15 20 25 30 35
Week of lactation
Figure 3.1. Mean daily milk yield and milk solids yield profiles of Fert+ and Fert- cows
during 35 weeks of lactation. All values are LSM. Mean daily milk yield tended to be
greater in Fert+ cows than Fert- cows (P = 0.08; SEM = 0.88). Mean daily milk solids
yield (P = 0.05; SEM = 0.06) was greater in Fert+ cows compared with Fert- cows.
57
30
Fert-
25 Fert+
20
DMI (kg/d)
15
10
6
Energy balance (UFL/d)
*
4
-2
-4
-3 -2 -1 0 1 2 3 4 5 6
Week relative to parturition
Figure 3.2. Mean dry matter intake and calculated energy balance of Fert+ and Fert-
cows from weeks -2 to 5 relative to parturition. Prepartum dry matter intake was similar
for both genotypes (P = 0.63; SEM = 0.75), but postpartum dry matter intake was
greater in Fert+ cows compared with Fert- cows (P = 0.02; SEM = 0.79). Mean
prepartum (P = 0.45; SEM = 0.54) and postpartum (P = 0.37; SEM = 0.71) energy
balance were similar for both genotypes. Energy balance at week 1 was greater in Fert+
cows than Fert- cows (P = 0.02). * indicates P ≤ 0.05.
58
Table 3.4. The effect of genetic merit for fertility traits on mean BCS and BW variables
Genotype P-value
Variable Fert+ Fert- SEM1 Genotype Genotype x week
Number of animal records 10 15 - -
Mean BW (kg) 579 546 11 0.05 1
Mean BCS 2.98 2.75 0.02 < 0.001 0.27
BCS at calving 3.12 2.98 - 0.14 -
BCS at nadir 2.75 2.45 - 0.009 -
Week of BCS nadir 6.9 6.89 - 0.98 -
BCS change from calving to nadir -0.35 -0.48 0.06 0.1 -
1
59
4.00
Body condition score (units) 3.80 Fert-
3.60 Fert+
3.40
3.20
3.00
2.80
2.60
2.40
2.20
2.00
750
700
Body weight (kg)
650
600
550
500
450
400
-5 0 5 10 15 20 25 30 35
Figure 3.3. Mean body condition score and body weight from weeks -2 to 35 relative to
parturition. Fert+ cows maintained greater mean body condition score (P < 0.001; SEM
0.02) and body weight (P = 0.05; SEM = 11.09) than Fert- cows from weeks -2 to 35.
60
3.5.3 Blood Metabolites and Metabolic Hormones
The effect of genetic merit for fertility traits on circulating metabolites from two weeks
prepartum to eight weeks postpartum is illustrated in Figure 3.4. Mean circulating
glucose (P = 0.19), NEFA (P= 0.64) and BHBA (P = 0.92) concentrations during the
period were similar in Fert+ and Fert- cows; however, mean circulating glucose
concentrations were greater (P = 0.04) in Fert+ (3.40 mmol/L) cows than in Fert- (3.01
mmol/L) cows from weeks -2 to 3 relative to parturition. Four Fert- and four Fert+ cows
were classified as having sub-clinical ketosis, but there was no effect of genotype (P =
0.49). Of these, one Fert+ and one Fert- cow were classified as having clinical ketosis,
but there was no effect of genotype (P = 0.75). A genotype by week interaction existed
for NEFA (P = 0.02; Figure 3.4). Mean circulating IGF1 and insulin concentrations for
both genotypes are illustrated in Figure 3.5. Fert+ cows had greater mean IGF1
concentrations than Fert- cows (102.6 vs. 56.9 ng/mL, P = 0.001). There was a genotype
by week interaction for mean IGF1 concentrations (P = 0.0009); the difference between
genotypes decreased as time increased. Fert+ tended to have greater mean circulating
insulin concentrations than Fert- cows (3.25 vs. 2.62 µIU/mL, P = 0.08). There was a
tendency for a genotype by week interaction for mean insulin circulating concentrations
(P = 0.04; Figure 3.5).
61
5.0
4.5 * Fert-
4.0 Fert+
Plasma glucose (mmol/L)

* †
3.5
3.0
2.5
2.0 Genotype: P P= =0.19
0.19
1.5 Genotype x week: P = 0.53
1.0 SEM: 0.12mmol/L
0.12 mmol/L
0.5
0.0
1.6
Genotype: PP==0.64
0.64
95% CI: 0.40- -0.60
0.40 0.60(Fert+)
(Fert+)
Plasma NEFA (mmol/L)
1.2
0.36- -0.59
0.36 0.59(Fert-)
(Fert-)
1.0
0.8
0.6
0.4
0.2
0.0
2.0
1.8 Genotype: PP==0.92
0.92
Genotype x week:PP==0.33
0.33
1.6 95% CI: 0.39- -0.60
0.60(Fert+)
(Fert+)
0.39
Plasma BHBA (mmol/L)
1.4 0.41 - 0.58 (Fert-)

0.41 - 0.58 (Fert-)
1.2
1.0
0.8
0.6
0.4
0.2
0.0
-3 -2 -1 0 1 2 3 4 5 6 7 8
Figure 3.4. Mean circulating glucose, NEFA and BHBA concentrations in Fert+ and
Fert- cows from week -2 to 8 relative to parturition. Mean plasma glucose, NEFA and
BHBA were similar in both genotypes. Values for NEFA and BHBA are back-
transformed LSM with 95% CI. * indicates P ≤ 0.05. † indicates P ≤ 0.1.
62
300 Fert- Fert+
250 Genotype: PP == 0.001

0.01
Genotype x week:PP=<0.0009
0.001
Plasma IGF-I (ng/mL)
200 95% CI: 81.70

81.7 - 127.63
- 127.6 (Fert+)
(Fert+)
42.50- -74.9
42.5 74.90 (Fert-)
(Fert-)
150 *
* * *
100
50
10
Genotype: PP == 0.08
0.08
9
Genotype x week: PP==0.04
0.04
8 95% CI: 2.74 -
2.7 3.93.85(Fert+)
(Fert+)
Plasma insulin (uIU/mL)
7 2.16
2.2 - -3.2
3.20 (Fert-)
(Fert-)
6
5 *
4 †
3
2
1
0
-4 -2 0 2 4 6 8
Figure 3.5. Mean circulating IGF1 and insulin in Fert+ and Fert- cows from week -2 to
8 relative to parturition. Plasma IGF1 was greater in Fert+ cows than in Fert- cows
during the sampling period (P = 0.001) and the difference between genotypes decreased
as time increased (P < 0.0009). Plasma insulin tended to be greater in Fert+ cows than
in Fert- cows during the sampling period (P = 0.08) and there was a genotype by time
interaction (P = 0.04). All values are back-transformed LSM with 95% CI. * indicates P
≤ 0.05. † indicates P ≤ 0.1.
63
3.5.4 Postpartum Uterine Health
The effect of genetic merit for fertility traits on postpartum vaginal mucus score is
summarized in Table 3.5. Fert- cows had a greater vaginal mucus score than Fert+ cows
on week 2 and 3 and tended to be greater on week 4 to 6. Survival analysis indicated
that the postpartum interval required to achieve a vaginal mucus score of zero was not
affected by genotype (P = 0.26).
Table 3.5. The effect of genetic merit for fertility traits on mean vaginal mucus score in
Fert+ and Fert- cows until week eight of lactation
Genotype
Week Fert+ (n) Fert- (n) P-value
1 1.9 (15) 2.3 (10) 0.31
2 0.9 (15) 2.5 (10) 0.03
3 1.1 (14) 2.2 (10) 0.04
4 0.4 (14) 1.1 (10) 0.09
5 0.4 (14) 1.2 (10) 0.08
6 0.0 (11) 1.2 (9) 0.06
7 0.0 (8) 0.2 (6) 0.26
8 0.1 (7) 0.0 (1) 0.74
On week 3 postpartum, there was no effect of genotype on the mean PMN counts
(Table 3.6), but there was a tendency for Fert- cows to have increased odds of being
classified as having endometritis (P = 0.09). At week 6 postpartum, Fert- cows had
greater mean PMN counts (P = 0.04), and they had increased odds of being classified as
having endometritis compared with Fert+ cows (P = 0.04).
3.5.5 Postpartum Resumption of Cyclicity

Two of 10 Fert- cows and 12 of 14 Fert+ cows had resumed cyclicity by week 6 after
calving. Fert- cows had reduced odds of having resumed cyclicity by week 6 after
calving compared with Fert+ cows (OR = 0.04; 95% CI = 0.01 – 0.36, P = 0.009).
64
Table 3.6. The effect of genetic merit for fertility traits on mean PMN counts of the uterus and
proportion of cows classified with endometritis on week 3 and 6 postpartum
Genotype PMN count (%) P-value OR (95% CI) PP (SE) P-value
Week 3
Fert- (n = 9) 29.82 (7.87 – 65.87) 0.30 4.9 (0.7, 34.3) 0.78 (0.83) 0.09
Fert+ (n = 12) 13.97 (1.77 – 37.79) 1.0 0.42 (0.64)
Week 6
Fert- (n = 8) 23.73 (8.58 – 46.44) 0.04 9.0 (0.94, 86.52) 0.75 (0.88) 0.04
Fert+ (n = 8) 3.91 (0.00 – 15.36) 1.0 0.25 (0.70)
OR = Odds ratio; PP = Predicted Probability
65
3.6 Discussion
In dairy cattle, genetic selection in past decades focused solely on increasing milk
production without regard to health and fertility traits, resulting in large increases in
milk production and a decline in reproductive performance (Lucy, 2001; Pollott and
Coffey, 2008). The two genotypes of cows enrolled on this study had similar genetic
merit for milk production, but were divergent in genetic merit for fertility traits. Cows
from both genotypes were exposed to the same management and nutrition, allowing the
effect of genetic merit for fertility traits on phenotypic fertility measurements to be
assessed. The results of this study indicate that it is possible to select animals with good
genetic merit for fertility traits without compromising milk production. Fert+ cows had
greater milk yield and milk solids production compared with Fert- cows. This is in
agreement with the results of Cummins et al. (2012a) and validates the robustness of the
animal model. There is disagreement between studies that have examined the
relationship between milk production and reproductive performance. Conclusions have
ranged from a negative association (Nebel and McGilliard, 1993), to no association
(Patton et al., 2007), to a positive association (Buckley et al., 2003). It has also been
suggested that factors such as herd management and animal health should be taken into
account when investigating the interactions between production and fertility (Leblanc,
2010; Bello et al., 2012). In the current study, these concerns were avoided by
managing both groups of cows as a single herd with similar nutrition and similar health
protocols.
3.6.1 DMI and Energy Balance

Dry matter intake and energy balance have previously been shown to be positively
associated with fertility (Butler and Smith, 1989; Patton et al., 2007). In the current
study, however, mean energy balance during the first 5 weeks of lactation was similar in
Fert+ and Fert- cows. This is consistent with Patton et al. (2008), who reported no
difference in early lactation energy balance between strains of Holstein Friesian from
New Zealand (high fertility) and North America (low fertility). However, energy
balance during week 1 of lactation was greater in Fert+ cows than Fert- cows. The
greater DMI during the first 5 weeks of lactation in Fert+ cows compared with Fert-
cows is an important finding from this study. Dry matter intake has been reported to
account for the majority of the variation in energy balance during the early postpartum
66
period (Villa-Godoy et al., 1988; Patton et al., 2007) and is the main limiting factor to
milk production (Roche et al., 2008). Feed allowance and type of feed, management,
day length, weather, genetics, milk production, stage of production cycle and health
status are factors that affect an animal’s voluntary feed intake (Roche et al., 2008;
Sepúlveda-Varas et al., 2012). Lower DMI in the first week postpartum is associated
with increased incidence of sub-clinical ketosis (Goldhawk et al., 2009) and metritis
(Huzzey et al., 2007). In the current study, mean circulating concentrations of NEFA
and BHBA and the incidence of sub-clinical and clinical ketosis were not affected by
genotype. There were, however, clear differences in uterine health between the two
genotypes. Fert- cows had greater mean vaginal mucus scores from weeks 2 to 8, and a
greater proportion were classified as having endometritis at week 6 compared with
Fert+ cows. This suggests that lower postpartum DMI is a factor predisposing Fert-
cows to impaired uterine health. These data suggest an association between DMI and
uterine health in Fert+ and Fert- cows that may support the results of Huzzey et al.
(2007).
3.6.2 Energy Metabolites and Metabolic Hormones

Greater circulating glucose, insulin and IGF1 concentrations during the transition period
indicate that Fert+ cows were in a more favourable metabolic status compared with
Fert- cows. These results imply an earlier recoupling of the somatotropic axis in Fert+
cows, supporting the findings of Cummins et al. (2012a, c) that genetic merit for
fertility traits affects the somatotropic axis. This is possibly due to greater circulating
insulin, which has been reported to up-regulate hepatic expression of GHR 1A and
IGF1 transcripts (Butler et al., 2003). Taylor et al. (2004) and Patton et al. (2007) have
reported a positive association between circulating IGF1 and fertility in dairy cows,
which is mediated through its positive effect on luteinising hormone secretion, follicle
development, histotroph secretion and embryo development (Wathes, 2012). A positive
association between circulating glucose during the early postpartum period and
likelihood of conception at first service has recently been reported (Garverick et al.,
2013). Circulating glucose concentrations during the immediate postpartum period may
be a key indicator of a cow’s adaptive ability to meet the glucose demands of rising
milk production while minimising BCS loss, with longer term consequences for
subsequent reproductive outcomes (i.e., uterine involution, immune function and uterine
health, resumption of cyclicity, likelihood of conception). It is clear from the current
study that genetic selection for fertility traits results in more favourable glucose status in
67
early lactation, and this may represent a key inherent difference between cows with
good or poor genetic merit for fertility traits.
3.6.3 Body Condition Score

With the onset of lactation, the dairy cow experiences a dramatic shift in metabolism
due to the genetically controlled drive to support mammary milk synthesis.
Consequently, a period of negative energy balance and adipose tissue mobilisation
occurs, reflected by increased circulating NEFA concentrations (Drackley, 1999).
Genetic selection for increased milk production potential has amplified the severity of
adipose tissue mobilisation (McCarthy et al., 2007; Lucy et al., 2009). Body condition
score is an assessment of adipose tissue reserves and can be used to detect temporal
changes in energy balance status. Increased severity of adipose tissue mobilisation may
be due to the widening gap between the energy required for greater milk production and
the cow’s voluntary DMI. Veerkamp et al. (2003) reported a genetic correlation of only
0.44-0.65 between milk yield and DMI. In both pasture-based and TMR systems,
however, attempts to minimise adipose tissue mobilisation during the early post-partum
period through altered nutritional and management strategies have been largely
unsuccessful (Horan et al., 2005a; Roche et al., 2006, Maltz et al., 2013), indicating that
there is strong genetic control of the lactation profile of adipose tissue mobilisation.
Berry et al. (2008) reported that heritability estimates for BCS ranged from 0.07
to 0.6. Positive effects of BCS on fertility have been reported in pasture and
confinement dairy systems (Buckley et al., 2003; Roche et al., 2007; Santos et al.,
2009). Similar findings have been reported in strain comparison studies using cows with
New Zealand or North American ancestry (Horan et al., 2005a; Coleman et al., 2009).
Holstein-Friesian cows of North American ancestry have lower BCS but greater milk
yield compared with Holstein-Friesian cows of New Zealand ancestry on a pasture-
based system (McCarthy et al., 2007; Horan et al., 2005a). These strains were divergent
in genetic merit for both milk production traits (greater in North American strain) and
fertility traits (greater in New Zealand strain). The current study reports greater BCS in
Fert+ cows compared with Fert- cows, which have similar genetic merit for milk
production traits but divergent genetic merit for fertility traits. Mean BCS loss from
calving to nadir tended to be greater in Fert- cows than in Fert+ cows, even though milk
production was greater for Fert+ cows and both groups had similar nutritional
management.
68
The results of the current study are supported by the findings of Cummins et al.
(2012a), and indicate that greater genetic merit for fertility traits supports a higher
threshold BCS. Buckley et al. (2003) also reported a positive association between BCS
and milk production. Together, these data suggest that the ability of Fert+ cows to
maintain greater milk production and BCS profiles compared with Fert- cows is linked
to greater postpartum DMI. Earlier recoupling of the somatotropic axis in Fert+ cows
would facilitate the maintenance of greater BCS, while also maintaining greater milk
production compared with Fert- cows (Cummins et al., 2012a, c).
3.6.4 Uterine Health

After calving, the uterus is exposed to microbial pathogens. The development and
severity of uterine infection depends on the species of bacteria involved and their
prevalence, and the immune response of the cow (Sheldon, 2004). Delayed clearance of
uterine infection has serious consequences for reproductive performance (LeBlanc et al.,
2002; Williams et al., 2005; McDougall et al., 2007; McDougall et al., 2011). The
mechanisms responsible may include altered follicle development and function
(Sheldon et al., 2002), delayed resumption of cyclicity (Galvão et al., 2010), altered
follicle steroidogenesis (Green et al., 2011) and development of a smaller corpus luteum
(Williams et al., 2007). Both genotypes were managed as one group in the same
housing, and would theoretically have been exposed to the same bacteria during the
peripartum period. Uterine health was assessed by scoring vaginal mucus weekly, which
reflects the level of bacterial contamination (Williams et al., 2005), and by classifying
cows as having endometritis based on the proportion of PMN in uterine cytology
samples. At week 1, both genotypes had a similar vaginal mucus score. Thereafter, Fert-
cows had greater vaginal mucus scores, indicating a slower clearance of bacterial
contamination compared with Fert+ cows. Neutrophils enter the uterus from blood in
response to chemokines, killing bacteria by phagocytosis (Sheldon, 2004). Fert- cows
tended to have increased odds of being classified with endometritis based on PMN
population at week 3 compared with Fert+ cows. By week 6, a similar proportion of
Fert- cows were classified as having endometritis but Fert+ cows had made a substantial
recovery.
The results of this study clearly indicate that genetic merit for fertility traits
affects postpartum uterine health, which may be a result of differences in the function of
the immune system. Differences in the metabolic status are potential mediators of
69
immune function in dairy cows (Ingvartsen and Moyes, 2013). Hammon et al. (2006)
reported impaired PMN function, lower DMI and greater NEFA and BHBA
concentrations during the peripartum period in cows diagnosed with metritis or
subclinical endometritis compared with healthy cows. Glucose, glutamine, NEFA and
BHBA are major energy sources for immune cells (Ingvartsen and Moyes, 2013). While
circulating NEFA and BHBA were similar between Fert+ and Fert- cows, DMI, energy
balance at week 1 and circulating glucose concentrations were greater in Fert+ cows.
This suggests that Fert+ cows had more glucose available in support of PMN function.
3.6.5 Resumption of Cyclicity

Previous studies examining the resumption of ovarian cyclicity have reported positive
(Galvão et al., 2010) and negative (Horan et al., 2005b) associations with fertility. Our
results show that an early resumption of cyclicity is associated with genetic merit for
good fertility which suggests that it is a positive fertility parameter. The interval from
calving to resumption of cyclicity is dependent on the restitution of frequent luteinising
hormone pulses from the anterior pituitary, which has been reported to be negatively
associated with energy balance (Canfield and Butler, 1990). Greater energy balance at
week 1, combined with greater concentrations of insulin and IGF1 may have supported
earlier ovulation in Fert+ cows (Butler et al., 2006).
3.7 Conclusions
Genetic merit for fertility traits had a significant effect on dry matter intake, metabolic
status, uterine health and the resumption of postpartum cyclicity in cows with similar
genetic merit for milk production and proportion of Holstein genetics that were exposed
to the same management, nutrition and environment. Fert+ cows had greater DMI,
energy balance at week 1, circulating insulin, IGF1 and glucose concentrations,
maintained greater BCS, had superior uterine health and an earlier resumption of
cyclicity, while also achieving greater milk production. These results may explain, at
least in part, the differences in reproductive performance reported in this genetic model.
70
3.8 References
Bello, N. M., J. S. Stevenson, and R. J. Tempelman. 2012. Invited review: Milk

production and reproductive performance: Modern interdisciplinary insights into
an enduring axiom. Journal of Dairy Science 95(10):5461-5475.
Berry, D. P., J. R. Roche, and M. P. Coffey. 2008. Body condition score and fertility -
more than just a feeling. Fertility in dairy cows: Bridging the gaps. M. D. Royal,
N. C. Friggens, and R. F. Smith, ed. British Society of Animal Science,
Cambridge University Press, Cambridge. UK. :107-118.
Buckley, F., K. O'Sullivan, J. F. Mee, R. D. Evans, and P. Dillon. 2003. Relationships
Among Milk Yield, Body Condition, Cow Weight, and Reproduction in Spring-
Calved Holstein-Friesians. Journal of Dairy Science 86(7):2308-2319.
Butler, S. T., A. L. Marr, S. H. Pelton, R. P. Radcliff, M. C. Lucy, and W. R. Butler.
2003. Insulin restores GH responsiveness during lactation-induced negative
energy balance in dairy cattle: effects on expression of IGF1 and GH receptor
1A. Journal of Endocrinology 176(2):205-217.
Butler, S. T., S. H. Pelton, and W. R. Butler. 2006. Energy Balance, Metabolic Status,
and the First Postpartum Ovarian Follicle Wave in Cows Administered
Propylene Glycol. Journal of Dairy Science 89(8):2938-2951.
Butler, W. R. 2003. Energy balance relationships with follicular development, ovulation
and fertility in postpartum dairy cows. Livestock Science 83(2-3):211-218.
Butler, W. R. and R. D. Smith. 1989. Interrelationships Between Energy Balance and
Postpartum Reproductive Function in Dairy Cattle. Journal of Dairy Science
72(3):767-783.
Canfield, R. W. and W. R. Butler. 1990. Energy balance and pulsatile LH secretion in
early postpartum dairy cattle. Domestic Animal Endocrinology 7(3):323-330.
Coleman, J., K. M. Pierce, D. P. Berry, A. Brennan, and B. Horan. 2009. The influence
of genetic selection and feed system on the reproductive performance of spring-
calving dairy cows within future pasture-based production systems. Journal of
Dairy Science 92(10):5258-5269.
71
95(7):3698-3710.
Science 95(7):3711-3721.
Darwash, A. O., G. E. Lamming, and J. A. Woolliams. 1997. The phenotypic
association between the interval to post-partum ovulation and traditional
measures of fertility in dairy cattle. Animal Science 65:9-16.
72(1):68-78.
Friggens, N. C., P. Berg, P. Theilgaard, I. R. Korsgaard, K. L. Ingvartsen, P. Løvendahl,
and J. Jensen. 2007. Breed and Parity Effects on Energy Balance Profiles
Through Lactation: Evidence of Genetically Driven Body Energy Change.
Galvão, K. N., M. Frajblat, W. R. Butler, S. B. Brittin, C. L. Guard, and R. O. Gilbert.
2010. Effect of Early Postpartum Ovulation on Fertility in Dairy Cows. Reprod.
Domest. Anim. 45(5):e207-e211.
Lamberson, J. N. Spain, M. C. Lucy, and R. S. Youngquist. 2013.
Concentrations of nonesterified fatty acids and glucose in blood of periparturient
dairy cows are indicative of pregnancy success at first insemination. Journal of
Goldhawk, C., N. Chapinal, D. M. Veira, D. M. Weary, and M. A. G. von Keyserlingk.
2009. Prepartum feeding behavior is an early indicator of subclinical ketosis.
Green, M. P., A. M. Ledgard, S. E. Beaumont, M. C. Berg, K. P. McNatty, A. J.
Peterson, and P. J. Back. 2011. Long-term alteration of follicular steroid
concentrations in relation to subclinical endometritis in postpartum dairy cows.
Jorunal of Animal Science 89(11):3551-3560.
72
Hammon, D. S., I. M. Evjen, T. R. Dhiman, J. P. Goff, and J. L. Walters. 2006.
Neutrophil function and energy status in Holstein cows with uterine health
disorders. Veterinary Immunology and Immunopathology 113(1–2):21-29.
Heins, B. J., L. B. Hansen, A. R. Hazel, A. J. Seykora, D. G. Johnson, and J. G. Linn.
2012. Short communication: Jersey × Holstein crossbreds compared with pure
Holsteins for body weight, body condition score, fertility, and survival during
the first three lactations. Journal of Dairy Science 95(7):4130-4135.
Horan, B., P. Dillon, P. Faverdin, L. Delaby, F. Buckley, and M. Rath. 2005a. The
interaction of strain of Holstein-Friesian cows and pasture-based feed systems
on milk yield, body weight, and body condition score. Journal of Dairy Science
88(3):1231-1243.
Horan, B., J. F. Mee, P. O’Connor, M. Rath, and P. Dillon. 2005b. The effect of strain
of Holstein-Friesian cow and feeding system on postpartum ovarian function,
63(3):950-971.
Huzzey, J. M., D. M. Veira, D. M. Weary, and M. A. G. von Keyserlingk. 2007.
Prepartum Behavior and Dry Matter Intake Identify Dairy Cows at Risk for
Metritis. Journal of Dairy Science 90(7):3220-3233.
Ingvartsen, K. L. 2006. Feeding- and management-related diseases in the transition
cow: Physiological adaptations around calving and strategies to reduce feeding-
related diseases. Animal Feed Science and Technology 126(3–4):175-213.
Ingvartsen, K. L. and K. Moyes. 2013. Nutrition, immune function and health of dairy
cattle. Animal 7(Supplements1):112-122.
Jarrige, J. 1989. In INRAtion v. 2.7: Microsoft computer program of ration formulation
for ruminant livestock. Edited by J. Agabriel, P. Champciaux & C. Espinasse.
Centre National d'Études et de Ressources en Technologie Advancée, Dijon,
France.
Leblanc, S. 2010. Assessing the Association of the Level of Milk Production with
Reproductive Performance in Dairy Cattle. Journal of Reproduction and
Development 56(S):S1-S7.
LeBlanc, S. J. 2012. Interactions of Metabolism, Inflammation, and Reproductive Tract
Health in the Postpartum Period in Dairy Cattle. Reproduction in Domestic
Animals 47:18-30.
LeBlanc, S. J., T. F. Duffield, K. E. Leslie, K. G. Bateman, G. P. Keefe, J. S. Walton,
and W. H. Johnson. 2002. Defining and Diagnosing Postpartum Clinical
73
Endometritis and its Impact on Reproductive Performance in Dairy Cows.
feed allowances in a pasture system Journal of Dairy Science 92(2):526-539.
Maltz, E., L. F. Barbosa, P. Bueno, L. Scagion, K. Kaniyamattam, L. F. Greco, A. De
Vries, and J. E. P. Santos. 2013. Effect of feeding according to energy balance
on performance, nutrient excretion, and feeding behaviour of early lactation
dairy cows. Journal of Dairy Science 96(8):5249-5266.
McCarthy, S., D. P. Berry, P. Dillon, M. Rath, and B. Horan. 2007. Influence of
Holstein-Friesian Strain and Feed System on Body Weight and Body Condition
Score Lactation Profiles. Journal of Dairy Science 90(4):1859-1869.
McDougall, S., H. Hussein, D. Aberdein, K. Buckle, J. Roche, C. Burke, M. Mitchell,
and S. Meier. 2011. Relationships between cytology, bacteriology and vaginal
discharge scores and reproductive performance in dairy cattle. Theriogenology
76(2):229-240.
McDougall, S., R. Macaulay, and C. Compton. 2007. Association between endometritis
diagnosis using a novel intravaginal device and reproductive performance in
dairy cattle. Animal Reproduction Science 99(1-2):9-23.
Moyes, K. M., T. Larsen, and K. L. Ingvartsen. 2013. Generation of an index for
physiological imbalance and its use as a predictor of primary disease in dairy
cows during early lactation. Journal of Dairy Science 96(4):2161-2170.
Nebel, R. L. and M. L. McGilliard. 1993. Interactions of High Milk Yield and
Reproductive Performance in Dairy Cows. Journal of Dairy Science
76(10):3257-3268.
O' Mara, F. P. 1997. A net energy system for cattle and sheep. Belfield, Dublin 4,
Ireland. Department of Animal Science and Production, Faculty of Agriculture,
Universtity College Dublin.
Oetzel, G. R. 2004. Monitoring and testing dairy herds for metabolic disease. Veterinary
Clinics of North America: Food Animal Practice 20(3):651-674.
Patton, J., D. A. Kenny, S. McNamara, J. F. Mee, F. P. O’Mara, M. G. Diskin, and J. J.
Murphy. 2007. Relationships Among Milk Production, Energy Balance, Plasma
74
Analytes, and Reproduction in Holstein-Friesian Cows. Journal of Dairy Science
90(2):649-658.
Patton, J., J. J. Murphy, F. P. O’ Mara, and S. T. Butler. 2008. A comparison of energy
balance and metabolic profiles of the New Zealand and North American strains
of Holstein Friesian dairy cow. Animal 2(06):969-978.
Prendiville, R., K. M. Pierce, and F. Buckley. 2009. An evaluation of production
efficiencies among lactating Holstein-Friesian, Jersey, and Jersey × Holstein-
Friesian cows at pasture. Journal of Dairy Science 92(12):6176-6185.
Roche, J. R., D. P. Berry, and E. S. Kolver. 2006. Holstein-Friesian Strain and Feed
Effects on Milk Production, Body Weight, and Body Condition Score Profiles in
Grazing Dairy Cows. Journal of Dairy Science 89(9):3532-3543.
Roche, J. R., D. Blache, J. K. Kay, D. R. Miller, A. J. Sheahan, and D. W. Miller. 2008.
Neuroendocrine and physiological regulation of intake with particular reference
to domesticated ruminant animals. Nutrion Research Reviews 21(02):207-234.
Roche, J. R., K. A. Macdonald, C. R. Burke, J. M. Lee, and D. P. Berry. 2007.
Associations Among Body Condition Score, Body Weight, and Reproductive
Performance in Seasonal-Calving Dairy Cattle. Journal of Dairy Science
90(1):376-391.
Santos, J. E. P., H. M. Rutigliano, and M. F. S. Filho. 2009. Risk factors for resumption
of postpartum estrous cycles and embryonic survival in lactating dairy cows.
SAS Institute. 2006. SAS User’s Guide: Statistics. SAS Institute Inc., Cary, NC.
Sepúlveda-Varas, P., J. M. Huzzey, D. M. Weary, and M. A. G. Von Keyserlingk. 2012.
Behaviour of dairy cattle during the periparturient period and its relationship to
illness after calving. Animal Production Science 53:988-999.
Sheldon, I. M. 2004. The postpartum uterus. Veterinary Clinics of North America: Food
Animal Practice 20(3):569-591.
Sheldon, I. M., J. Cronin, L. Goetze, G. Donofrio, and H.-J. Schuberth. 2009. Defining
Postpartum Uterine Disease and the Mechanisms of Infection and Immunity in
the Female Reproductive Tract in Cattle. Biology of Reproduction 81(6):1025-
1032.
75
Sheldon, I. M., G. S. Lewis, S. LeBlanc, and R. O. Gilbert. 2006. Defining postpartum
uterine disease in cattle. Theriogenology 65(8):1516-1530.
Sheldon, I. M., D. E. Noakes, A. N. Rycroft, D. U. Pfeiffer, and H. Dobson. 2002.
Influence of uterine bacterial contamination after parturition on ovarian
dominant follicle selection and follicle growth and function in cattle.
Taylor, V. J., Z. Cheng, P. G. A. Pushpakumara, D. C. Wathes, and D. E. Beever. 2004.
Relationships between the plasma concentrations of insulin-like growth factor-I
in dairy cows and their fertility and milk yield. Veterinary Record 155(19):583-
588.
Veerkamp, R. F., B. Beerda, and T. van der Lende. 2003. Effects of genetic selection for
milk yield on energy balance, levels of hormones, and metabolites in lactating
cattle, and possible links to reduced fertility. Livestock Science 83(2-3):257-
275.
Villa-Godoy, A., T. L. Hughes, R. S. Emery, L. T. Chapin and R. L. Fogwell. 1998.
Association between energy balance and luteal function in lactating dairy cows.
47:304-312.
Williams, E. J., D. P. Fischer, D. E. Noakes, G. C. W. England, A. Rycroft, H. Dobson,
and I. M. Sheldon. 2007. The relationship between uterine pathogen growth
density and ovarian function in the postpartum dairy cow. Theriogenology
68(4):549-559.
76
Chapter Four
Genetic merit for fertility traits in Holstein cows:

Factors affecting circulating progesterone
concentrations
4.1 Preface
At the time of thesis submission this chapter was published in Journal of Dairy Science
(Accepted May 11, 2014; http://dx.doi.org/10.3168/jds.2014-8133). The full reference
is:
Moore, S.G., S. Scully, J.A. Browne, T. Fair, and S.T. Butler. Genetic merit for fertility
traits in Holstein cows: V. Factors affecting circulating progesterone concentrations.
Journal of Dairy Science 2014, 97:5543-5557.
Stephen Moore was the primary author and carried out the experimental work, statistical
analysis and drafted the manuscript. Stephanie Scully carried out the transrectal
ultrasonography with Doppler ultrasound and analysed the images. John Browne
provided training on the techniques for RNA extraction, cDNA synthesis and real time-
qPCR. Trudee Fair and Stephen Butler conceived, designed and coordinated the study.
All authors interpreted the data and contributed to the manuscript.
have been removed. All other aspects are consistent with the published manuscript.
77
4.2 Abstract
This study investigated the factors affecting circulating progesterone (P4)

concentrations in cows with similar genetic merit for milk production traits, but with
extremes of good (Fert+) or poor genetic merit for fertility traits (Fert-). Study 1: 28
cows were enrolled on an ovulation synchronisation protocol at 61±13 (± SD) days
postpartum, and data are presented for 13 Fert+ and 9 Fert- cows that remained on the
study. Progesterone concentrations were determined from d 0 to 9 (d 0 = oestrus), and
on d 7 corpus luteum (CL) volume and blood flow area (BFA) were measured by B-
mode and Doppler ultrasonography, respectively. Cows were administered
prostaglandin F2α (PGF2α) on d 7 p.m. and d 8 a.m. to regress the CL, and 2 CIDRs were
inserted per vaginum on d 8 a.m. Liver biopsies were collected on d 9 and hepatic
mRNA abundance of genes involved in P4 catabolism was determined. On d 10, CIDRs
were removed and frequent blood samples were collected to measure the rate of decline
in circulating P4. Fert+ cows tended to have greater dry matter intake (DMI) compared
with Fert- cows (+0.79 kg DM/d), but similar milk production (29.82 kg/d). After
synchronized ovulation, the rate of increase in circulating P4 concentrations was greater
in Fert+ cows compared with Fert- cows. There was no effect of genotype on CL
volume, but BFA was 42% greater in Fert+ cows compared with Fert- cows. Fert- cows
had greater mRNA abundance of CYP3A compared with Fert+ cows, but mRNA
abundance of AKR1C1, AKR1C3, AKR1C4 and CYP2C were similar. The half-life and
metabolic clearance rate (MCR) of P4 were similar in Fert+ cows and Fert- cows. Study
2: 23 cows were enrolled on an ovulation synchronisation protocol at 55±7 (± SD) days
postpartum, and data are presented for 13 Fert+ and 8 Fert- cows that remained on the
study. On d 4, 7, 10 and 13 (d 0 = oestrus), CL volume and BFA were measured as in
Study 1. Progesterone concentrations were measured from d 1 to 13. Corpus luteum
volume was 41% greater in Fert+ cows compared with Fert- cows but there was no
effect of genotype on BFA. Mean circulating P4 concentrations were 79% greater in
Fert+ cows compared with Fert- cows. Milk yield was similar in both genotypes. The
results indicate that greater circulating P4 concentrations were primarily due to greater
CL P4 synthetic capacity rather than differences in P4 clearance in this lactating cow
genetic model of fertility.
78
4.3 Introduction
Progesterone (P4) is an important regulator of events during the oestrous cycle and is
essential for the maintenance of pregnancy. The well documented decline in fertility in
dairy cows has been attributed to increased occurrence of embryo mortality, particularly
during the period before maternal recognition of pregnancy (MRP; Diskin and Morris,
2008) which has been associated with inadequate circulating P4 concentrations during
dioestrus of the oestrous cycle that preceded insemination and fertilisation (Lonergan,
2011). Indeed, several studies have reported an improvement in fertility performance
when cows were placed on synchronisation protocols with supplemental P4 prior to
ovulation (Xu et al., 1997; Herlihy et al., 2011; Colazo et al., 2013). Reduced
circulating concentrations of P4 during preovulatory follicle development facilitates
increased luteinising hormone pulsatility, greater incidence of multiple ovulations,
lower likelihood of conception after AI and increased likelihood of embryo mortality
between d 30 to 60 after AI (Cunha et al., 2008; Wiltbank et al., 2011). For successful
MRP, the developing embryo must be capable of producing sufficient interferon tau.
This is more likely to occur if there is a rapid increase in circulating P4 concentrations
after fertilisation, which alters the endometrial transcriptome and protein secretions to
promote development of a larger embryo (Forde et al., 2013). In support of this, studies
have reported positive associations between milk P4 concentrations (Stronge et al.,
2005; McNeill et al., 2006) or P4 supplementation (Larson et al., 2007) during the
period prior to blastocyst hatching and subsequent pregnancy success.
Circulating P4 concentrations during the oestrous cycle is a balance between the

P4 synthetic capacity of the CL and the MCR by the liver. Factors affecting P4
secretion include the number of luteal cells, luteal cell steroidogenic capacity and ability
to export P4 (Wiltbank, 1994). Per unit volume, the CL experiences the greatest blood
flow of any endocrine organ, which is central to its function, particularly for the
efficient uptake of cholesterol and for P4 secretion (Wiltbank, 1994). Mann (2009)
reported a strong correlation between CL tissue mass and circulating P4 concentrations
on d 5 of the oestrous cycle (R2 = 0.64), but no correlation on d 8 (R2 = 0.04) or d 16 (R2
= 0.02), suggesting increased importance of luteal cell steroidogenic activity or CL
blood flow as the CL matures. The factors that affect P4 MCR include liver blood flow
and the activity of liver enzymes with P4 catabolic activity. Because liver blood flow is
positively associated with DMI (Sangsritavong et al., 2002; Reynolds et al., 2003),
79
increased liver steroid clearance has been implicated as a potential disruptor of
reproductive events, due to lower circulating concentrations of P4 and oestradiol (E2;
Sangsritavong et al., 2002). In addition, Lemley et al. (2010) demonstrated that the liver
expression of cytochrome P450 3A and 2C and aldo-keto reductase family 1, member C
genes, which are involved in P4 inactivation, can be altered by dietary manipulation.
Therefore, possible causes of low circulating P4 concentrations include inadequate CL
P4 synthesis, increased liver blood flow, and greater liver P4 catabolic enzyme activity.
Previously, we have reported positive effects of genetic merit for fertility traits
on the reproductive performance of dairy cows (Cummins et al., 2012a), a phenotype
associated with greater circulating P4 concentrations during the oestrous cycle
(Cummins et al., 2012b). Therefore, two consecutive studies were carried out to identify
the physiological mechanisms associated with greater circulating P4 concentrations in
dairy cows with high genetic merit for fertility traits.
80
4.4.1 Animal Model

A genetic model of fertility was established in Teagasc Moorepark to elucidate the
mechanisms responsible for poor fertility in lactating Holstein dairy cows (Cummins et
al., 2012a,b,c). In autumn 2007 and 2008, nulliparous spring-calving heifers were
identified from the national dairy cattle database (Irish Cattle Breeding Federation
Bandon, Ireland). This population was limited to animals with EBV for milk production
between +200 kg and +900 kg and >75% Holstein genetics. Within this population,
heifers with extreme positive (i.e., poor fertility; Fert-) or negative (i.e., high fertility;
Fert+) EBV for calving interval were selected. Only Fert- heifers from sires and
maternal grand-sires with positive EBV for calving interval and Fert+ heifers from sires
and maternal grand-sires with negative EBV for calving interval were selected.
Nulliparous Fert- and nulliparous Fert+ heifers that passed the Moorepark Biosecurity
Protocol were purchased and moved to the Moorepark Animal and Grassland Research
and Innovation Centre in Fermoy, Co. Cork, Ireland. Within the Irish national herd,
these heifers were representative of the top 25% in genetic merit for milk production.
The Fert- heifers represented the bottom 5% in genetic merit for calving interval,
whereas the Fert+ heifers represented the top 20% in genetic merit for calving interval.
In subsequent years herd replacements were generated by selecting suitable

sires to maintain the difference in genetic merit for calving interval. The list was
restricted to sires with >200 kg PTA for milk production, >0% PTA milk fat and protein
concentrations and >75% Holstein genetics. From this group, sires with >5 days PTA
for calving interval were selected for mating with the Fert- cows and sires with <-5 days
PTA for calving interval were selected for mating with the Fert+ cows. Twenty-eight
and 23 cows were enrolled on Study 1 and 2, respectively, and the EBV’s of the cows
from both genotypes are summarized in Table 4.1. In Study 1, Fert+ and Fert- cows
were represented by 5 and 11 sires respectively. The parity structure for the Fert+ cows
was 4 and 11 cows in second and third lactation, respectively. The parity structure for
the Fert- cows was 9 and 4 cows in second and third lactation, respectively. In Study 2,
Fert+ and Fert- cows were represented by 6 and 9 sires respectively. Seventeen cows (9
Fert+ and 8 Fert-) were enrolled on both studies. The parity structure for the Fert+ cows
was 3, 4 and 7 cows in second, third and fourth lactation, respectively. The parity
81
structure for the Fert- cows was 1, 3 and 6 cows in second third and fourth lactation,
respectively. The experimental procedures involving animals on both studies were
licensed by the Department of Health, Ireland, in accordance with the Cruelty to
Animals Act (Ireland 1876) and the European Community Directive 86/609/EEC
.
82
Table 4.1. The mean estimated breeding value1 (and SD) for both genotypes based on their sire,
maternal grandsire and maternal grand grand-sire estimated breeding values
Study 1 Study 2
Genotype2
Variable Fert+ Fert- Fert+ Fert-
No. of animals 15 13 13 10
Holstein 90.4 (7.2) 94.9 (7.0) 95 (4.7) 95 (5.8)
Milk (kg) 363 (152) 434 (125) 417 (163) 445 (141)
Fat (kg) 20 (6.2) 17 (5.7) 21 (5.5) 19 (7.1)
Fat (g/kg) 1.0 (0.9) 0.6 (0.9) 0.7 (0.8) 0.2 (1.1)
Protein (kg) 15 (5.7) 16.8 (4.9) 18 (7.0) 19 (5.8)
Protein (g/kg) 0.33 (0.60) 0.35 (0.64) 0.58 (0.59) 0.59 (0.70)
Survival (%) 3.62 (0.94) -2.67 (2.04) 3.64 (0.83) -3.34 (1.17)
Calving Interval (d) -6.02 (1.46) 8.05 (2.67) -6.48 (1.34) 7.98 (2.99)
Sire calving interval (d) -9.9 (1.9) 10.7 (3.7) -9.2 (2.6) 11.9 (3.5)
Maternal grandsire calving interval (d) -6.0 (2.1) 12.7 (5.4) -8.2 (3.5) 11.2 (4.5)
1
PTA values were obtained from the Autumn 2012 official dairy evaluations published by the
Irish Cattle Breeding Federation and multiplied by 2 to convert to EBV. Individual cow EBV
were determined using the following formula: 0.5*sireEBV + 0.25*MGsireEBV +
0.125*MGGsireEBV
2
83
4.4.1 Study 1
4.4.1.1 Feed and Management System
The study was undertaken at Teagasc Moorepark from November 2010 to March 2011.
Mean calving dates were November 2 (SD ± 37.1 d) and November 6 (SD ± 37.9 d) for
the Fert+ and Fert- cows, respectively. Following parturition, cows were housed as one
group in a freestall barn. Starting at d 40 (SD ± 15 d) post-partum, DMI was recorded
daily using the Griffith Elder feeding system (Griffith Elder Ltd, Bury St Edmunds,
Suffolk, UK). Cows were fed a total mixed ration ad libitum plus 5 kg lactating cow
concentrate per day at the a.m. and p.m. milkings. Feed refusals were removed every
second day. Diet ingredients were sampled weekly and composited monthly for
analysis.
4.4.1.2 Animal Measurements

Cows were milked twice daily at 8 a.m. and 4 p.m. Milk yield was recorded at each
a.m. and p.m. samples by mid-infrared reflectance spectroscopy (FT6000 Milkscan
instrument, Foss Electric, Hillerød, Denmark). Body weight (BW) and body condition
score (BCS) were recorded weekly. Body condition score was assessed using the 1 to 5
scale in 0.25 increments (Edmonson et al., 1989).
4.4.1.3 Ovulation Synchronisation

Cows were enrolled on an ovulation synchronisation protocol (CIDR_TAI) as
previously described Herlihy et al., (2012). The mean days postpartum (± SD) when
cows were enrolled in the protocol was 61 ± 15 (range: 37 - 78) and 60 ± 13 (range: 35 -
78) for the Fert+ and Fert- cows, respectively. On d -10, each cow was administered an
i.m. injection of a gonadotropin-releasing hormone (GnRH) agonist containing 10 μg of
buserelin (Receptal; Intervet Ireland, Dublin, Ireland), and a controlled internal drug
release device containing 1.38 g of P4 (CIDR; Pfizer Ireland, Dublin, Ireland) was
inserted per vaginum. On d -3, each cow was administered an i.m. injection of
prostaglandin F2α (PGF2α) containing 25 mg of dinoprost tromethamine (Lutalyse, Pfizer
Ireland). On d -2, the CIDR device was removed and 36 h later, each cow was
administered a second i.m. injection of GnRH agonist.
84
4.4.1.4 Blood Sampling
Blood samples were collected once daily on d -3, -2, -1 (before a.m. milking) and twice
daily on d 0, 1, 2, 3, 4, 5, 6, 7, 8 and 9 at 12 h intervals relative to synchronised oestrus
(d 0) by coccygeal venepuncture into vacutainers containing lithium heparin (Becton
Dickinson, Plymouth, UK), centrifuged at 2,000 x g for 15 min at 4 °C; plasma was
decanted and stored at -20 °C.
4.4.1.5 Ovarian Ultrasonography

Transrectal ultrasound examinations of both ovaries were carried out on d 0 and 7
relative to the synchronised oestrus. On d 0, follicles ≥ 5mm on the ipsilateral and
contralateral ovaries were recorded. The clearest image of the largest follicle was
frozen, and the cross-sectional height and width were measured using the internal
calliper of the ultrasound machine (7.5 MHz transrectal transducer, Aloka SSD-900,
Aloka Ltd., Tokyo, Japan). On d 7, the CL that developed from the ovulatory follicle
was examined using a Voluson i ultrasound machine (GE Healthcare, Austria,
Germany) equipped with a 12 Mhz linear array probe. Initially, CL were visualised in
B-mode, and three images of each CL at its maximum diameter were captured and
stored for further analysis. Ultrasound machine settings were then switched to power
Doppler mode. The entire CL at its maximum size was fitted within a Doppler sample
box and scanned for several seconds. Three images of each CL deemed representative
of maximum blood flow with no flash artefacts were captured and stored for further
analysis.
4.4.1.6 P4 Clearance
Each cow was administered an i.m. injection of PGF2α on d 7 p.m. and d 8 a.m. On d 8
a.m., two CIDRs, each containing 1.38 g of P4 were inserted per vaginum and an
indwelling jugular catheter was inserted to facilitate frequent blood sampling. Cows
were moved to an individual tie-stall barn. On d 9, a liver biopsy was collected from
each cow. The biopsy site on the right flank was clipped, shaved, disinfected with
Videne (Povidone-iodine, 7.5%; Ecolab, Leeds, UK) and methylated spirits and
anaesthetised with Willcain (Procaine hydrochloride, 5.0%, Dechra Ltd, Shrewsbury,
UK). A 1 cm incision was made through the skin between the 11th and 12th ribs and the
biopsy tool was inserted to pierce the intercostal muscle and peritoneum. The liver was
located and a 1 to 1.5 g sample was removed. The sample was washed in saline, blotted
dry, snap frozen in liquid nitrogen and stored at -80 °C. The incision site was sutured
85
and treated topically with Oxytetracycline spray (Duphacycline; Interchem Ireland,
Naas, Ireland). Cows were administered antibiotic as a prophylactic (500 mg Ceftiofur
Hydrochloride; Excenel RTU, Pfizer Animal Health).
On d 10, frequent blood samples were collected via jugular catheter at -60, -45, -30, -15,
0, 15, 30, 45, 60, 90, 120, 180, 240, 300, 360, 420, 540, and 660 min relative to removal
of both CIDRs (0 minutes) to measure the half-life and MCR of P4. Catheter patency
was maintained by flushing with 1 mL of heparinised sterile saline after each sample
collection.
4.4.1.7 RNA Extraction and cDNA Synthesis

Total RNA was extracted from liver tissue using a standard Trizol-based method
(Chomczynski and Sacchi, 1987). The tissue sample was weighed and 100 mg
homogenised in 3 mL TRI Reagent (Sigma-Aldrich, Dublin) for 30 s at 6000 rpm using
a Precellys 24 Dual ‘bead-beater’ with ceramic beads (Bertin Technologies, Montigny-
le-Bretonneux). The homogenate was removed to sterile eppendorf tubes (Eppendorf,
UK) and incubated at room temperature for 5 min.; 300 μL bromo-chloropropane
(Sigma-Aldrich, Dublin) was added, samples were vortexed and incubated at room
temperature for 3 min and then centrifuged at 12,000 x g for 10 min. at 4 °C. The
supernatant was removed to new sterile tubes. Isopropanol was added at 0.6 times the
volume of supernatant and vortexed and centrifuged at 12,000 x g for 10 min. at 4 °C to
pellet the RNA. The supernatant was discarded and the pellet was washed twice in 99%
ethanol (Sigma-Aldrich, Dublin) with centrifugation at 7,500 x g for 5 min. at 4 °C. The
RNA was resuspended in 35μL nuclease-free water (Sigma-Aldrich, Dublin). A kit-
based protocol (RNeasy, Qiagen, UK) was used to clean the total RNA, removing the
fraction below 200 bp as well as any DNA. RNA quality and concentration was
determined using the Nanodrop ND-1000 (Nanodrop, Wilmington, Denver) and the
Bioanalyser 2100 (Agilent Technologies, UK) using the RNA Nano chip. The 260/280
absorbance ratio ranged between 1.92 and 2.18 for all samples. The RNA integrity
number and 28s:18s ratio ranged from 7.1 to 8.8 and 1.1 to 1.5, respectively.
Subsequently, 500 ng of RNA was reverse transcribed to cDNA using the High-
Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster city, CA, USA)
per the manufacturer’s instructions to synthesise cDNA in a 20 µl reaction, diluted to 1
ng/μL of RNA equivalents with water and stored at -20 °C.
86
4.4.1.8 Primer Design and Reference Gene Selection
Primers were designed to span exon-exon junctions where possible (Table 4.3), and
PCR product size was restricted to between 50 and 155 nucleotides, using
NCBI/Primer-Blast; (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). All primers
were manufactured by Eurofins MWG (Ebersberg, Germany). The expression of β-
Actin (ACTB), ribosomal protein L19 (RPL19), peptidylprolyl isomerase A (cyclophilin
A) (PPIA) and mitogen-activated protein kinase 3 (MAPK3) were investigated as
candidate reference genes on a subset of 12 samples that were representative of the two
genotypes and their sires. The geNorm application within the Biogazelle qBaseplus
software program (www.qbaseplus.com; Biogazelle, Ghent, Belgium) determined that
PPIA and RPL19 combined were the most stably expressed reference genes, with an M
value of 0.24. The expected product sizes for all primers were confirmed by gel
electrophoresis.
4.4.1.9 Real Time-qPCR

All RT-qPCR reactions were performed in a 20.0 µL reaction using 5 μL (5 ng) cDNA,
10 μL SYBR MasterMix (Bioline) and 300 nM of forward and reverse primers and) on
clear 96-well plates (FrameStar). All samples were measured in duplicate. Primer
efficiencies for each target were determined using a 1 in 4 serial dilution over 7 points
and were shown to lie between 90% and 110%; non-template controls and minus RT
controls were also included for each target.
All reactions were run on a 7500 Real-Time PCR machine (Applied Biosystems)
with the following cycling conditions: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of
95 °C for 15 sec, 60 °C for 1 min, followed by 95 °C for 15 sec, 60 °C for 1 min and 95
°C for 15 sec to create a dissociation curve, which was examined to ensure
amplification was specific to the target gene. Relative gene expression values (CNRQs)
were determined using the qBase software package.
4.4.2 Study 2
4.4.2.1 Feed and Management System
The objective of this study was to determine the temporal pattern of CL blood flow and
circulating P4 concentrations during the oestrous cycle. The study was undertaken at
Teagasc Moorepark from January 2012 to December 2012. Mean calving dates were
February 17 (SD ± 19.7 d) and February 24 (SD ± 24.7 d) for the Fert+ and Fert- cows,
87
respectively. Following parturition, cows were housed in a freestall barn and were fed a
total mix ration ad libitum plus 6 kg dairy concentrate per day at the a.m. and p.m.
milkings. Diet ingredients were sampled weekly and composited monthly for analysis.
The ingredient and nutrient composition of the diets are outlined in Table 4.2. Cows
were turned out to grass on March 26th and managed as one herd in a rotational grazing
system. Cows grazed a predominantly perennial ryegrass (Lolium perenne L.) sward
with fresh pasture allocated daily. The mean daily herbage allowance was 14.5 ± 1.3 kg
DM/cow day-1, which was supplemented with 3.2 ± 0.2 kg/cow day-1 of lactating cow
concentrate fed at a.m. and p.m. milking. Milk and BCS measurements were collected
as described for Study 1.
4.4.2.2 Ovulation Synchronisation

Cows were enrolled on the same ovulation synchronisation protocol used in Study 1.
The mean days postpartum (± SD) when cows were enrolled on the protocol was 56 ±
5.7 (range: 45-67) and 54 ± 9.1 (range: 34-63) for the Fert+ and Fert- cows,
respectively.
4.4.2.3 Blood Sampling

Blood samples were collected once daily on d -3, -2, -1, 0, 1, 2, 3 (a.m. milking) and
twice daily on d 4, 5, 6, 7, 8, 9, 10, 11, 12 (at 12 h intervals) and 13 (once, after a.m.
milking) relative to synchronised oestrus (d 0) and processed as described in Study 1.
4.4.2.4 Ovarian Ultrasonography

Transrectal ultrasound examinations of both ovaries were carried out on d 0, 4, 7, 10
and 13 using a Voluson i ultrasound machine equipped with a 12 Mhz linear array
probe. Three images of follicles ≥ 15mm on d 0 and of the CL on d 4, 7, 10 and 13 were
captured in B-mode and power Doppler mode as described in Study 1.
4.4.2.5 Blood Sample Analysis

Circulating P4 concentrations were determined in samples collected from d 1 to 9 after
synchronised oestrus and from -60 to 660 min relative to CIDR removal during Study 1,
and in samples collected from d 1 to 13 after synchronised oestrus during Study 2 using
a commercially available solid-phase radioimmunoassay (Coat-A-Count Progesterone,
88
Diagnostic Products Corp., Los Angeles, CA). The inter-and intra-assay CV’s for
Study1 were 17.2% and 11.1%, 10.0% and 8.3% and 9.4% and 6.9% for the low,
Table 4.2. Ingredient and nutrient composition of lactating cow diet

Lactating cow diet (% DM)
Maize silage 36
Grass silage 33
Soyabean meal 9
Lactating cow concentrate ingredients (% fresh)

Wheat 25
Soyabean 15
Rapeseed extract 10
Sunflower seed extract 10
Palm kernel meal 10
Milk solids 5
Maize gluten 5
Citrus pulp 5
Soyabean hulls 5
Palm oil 4
Oat feed 4
Minerals1 2
Nutrient composition of lactating cow concentrate

DM (g/kg) 868
Net energy (UFL/kg DM) 0.92
Ash (g/kg DM)Crude protein (g/kg DM) 74
Crude protein (g/kg DM) 185
NDF (g/kg DM) 330
1
Vitamin and Mineral mix: 229 g/kg of Ca, 100 g/kg of Na, 70 g/kg of P, 5 g/kg of
Mg, 4500 mg/kg of Zn, 3000 mg/kg of Cu, 1500 mg/kg of Mn, 500 mg/kg of I, 400
mg/kg Bioplex* Cu, 400 mg/kg of Bioplex* Zn, 99 mg/kg of Co, 37 mg/kg of Se,
375000 IU/kg of vitamin A, 100000 IU/kg of vitamin D3, 1250 mg/kg of vitamin E
and 200 mg/kg of vitamin B12. *Alltech Inc., Nicholasville, KY
89
Table 4.3. Primer sequences used in real time quantitative PCR
Gene name Primer sequence 5’ – 3’ Product size Accession number
AKR1C1 Forward: CCCAAAAGCACAAGCAGACCCCA 144 NM_001206787.1
Reverse: GCCCTCTGCCCACAGTCTCACT
AKR1C3 Forward: TTCTTGTTGGTGTCGGTCACCCT 99 NM_001038584.1
Reverse: TCACCACCCCACAGAAGTAAAGAGT
AKR1C4 Forward: GCTATTACTGGGTGTTGGTCACCCT 112 NM_181027.2
Reverse: ATCCTCTTCACAGCCCTAGAAGCA
CYP2C19 Forward: TGACCTTGTCCCCAGCAGTATGC 83 NM_001109792.1
Reverse: TGACTGTGCCCTTGGGAATGAGGT
CYP3A5 Forward: GAATTGGCCACTCACCCTGATGTCC 88 NM_001075888.1
Reverse: CATCATAGGTCGGAGGCGCCTTAT
PPIA Forward: TCCATGGCAAATGCTGGCCCC 86 NM_178320.2
Reverse: ACGTGCTTGCCATCCAACCACT
MAPK3 Forward: GACCCAACGGATGAGCCAG 123 NM_001110018.1
Reverse: CACCCCAGGCTGGAAGC
ACTB Forward: CGCCATGGATGATGATATTGC 66 NM_173979.3
Reverse: AAGCCGGCCTTGCACAT
RPL19 Forward: GAAAGGCAGGCATATGGGTA 86 NM_001040516.1
Reverse: TCATCCTCCTCATCCAGGTT
AKR1C1 = aldo-keto reductase family 1, member C1; AKR1C3= aldo-keto reductase family 1, member C3;
AKR1C4 = aldo-keto reductase family 1, member C4; CYP2C19 = cytochrome P450, family 2, subfamily
C, polypeptide 19; CYP3A5 = cytochrome P450, family 3, subfamily A; PPIA = peptidylprolyl isomerase A
(cyclophilin A); MAPK3 = mitogen-activated protein kinase 3; ACTB = β-Actin; RPL19 = ribosomal
protein L19
90
medium and high P4 pools respectively. The inter-and intra-assay CV’s for Study 2
were 12.8% and 11.7%, 9.9% and 7.0% and 5.2% and 6.2% assay for the low, medium
and high pools respectively. Circulating E2 concentrations were determined in samples
collected on d -3, -2, -1 and 0 in the two studies by radioimmunoassay following
extraction using E2 MAIA kits (Bio-Stat Diagnostic Systems Ltd. Stockport, Cheshire,
UK). Peak circulating E2 concentration and day of peak were determined for each cow.
The inter-and intra-assay CV’s were 15.2% and 23.0%, 16.5% and 11.2% and 5.3% and
10.4% assay for the low, medium and high pools respectively. Circulating insulin and
insulin-like growth factor 1 (IGF1) concentrations were determined in samples collected
on d 0, 7 and 9 during Study 1 and d 0 and 13 during Study 2. Insulin concentrations
125
were determined by solid-phase I radioimmunoassay (Coat-A-Count Insulin,
Diagnostic Products Corporation, Los Angeles, CA). Inter- and intra-assay coefficients
of variation were 7.8% and 13.5%, respectively. Concentrations of IGF1 were
determined using a validated double antibody radioimmunoassay, following
ethanol:acetone:acetic acid extraction (Enright et al., 1989). Inter- and intra-assay
coefficients of variation were 2.7% and 12.1%, respectively. Both genotypes were
represented equally in each hormone assay, and all samples for each cow were
completed within one assay.
4.4.2.6 Ultrasound Image Analysis

The diameter of the follicle measured on d 0 in Study 1 was calculated as the mean of
the cross-sectional height and width. The diameter of the follicle and CL scanned with
the Volusan i ultrasound machine were calculated as the mean of 3 cross sectional
diameters measured from each image. Corpus luteum volume was calculated using the
formula: volume = 4/3 x π x (0.5 × diameter)3 and the volume of luteal cavities were
calculated and subtracted if present. Luteal tissue area was calculated using the formula:
area = π x (0.5 × diameter)2 and the area of luteal cavities were calculated and
subtracted if present. Power Doppler images of CL and follicles were analysed using the
computer programme Pixel Flux® (Version 1.0, Chameleon Software, Leipzig,
Germany) to quantify the area in cm2 of coloured pixels within the CL or follicle, and
which is considered a semi-quantitative measure of blood flow. Mean blood flow area
of each structure was calculated using the three images. Corpus luteum relative blood
flow area (relBFA) was calculated as blood flow area/luteal tissue area.
91
4.4.2.7 Data Handling
Cows were deemed to have had a synchronised oestrus if the preovulatory follicle
measured on d 0 resulted in CL formation and circulating P4 concentrations were < 0.7
ng/mL on d 1 and > 1.1 ng/mL on d 7. Twenty-eight cows were enrolled on Study 1.
Records of six cows were not included in the statistical analysis (one Fert+ cow and two
Fert- cows did not respond to the ovulation synchronisation protocol based on P4
profiles and one Fert+ cow and two Fert- cows were diagnosed as having uterine
infection on d 7). Twenty-three cows were enrolled on Study 2. Records of 2 Fert- cows
were not included in the statistical analysis because they did not respond to the
ovulation synchronisation protocol based on P4 profiles. Daily measurements of milk
yield were collapsed into average weekly yields. Milk production, DMI, BW and BCS
data collected during the 4 week period before and during both studies are reported.
Data were checked for normality. In Study 1, suitable Box-Cox transformations were
identified to normalise the distribution of circulating E2 concentrations, P4 half-life and
mRNA abundance of AKR1C1 and AKR1C3. In Study 2, suitable Box-Cox
transformations were identified to normalise the distribution of follicle diameter, BFA,
CL volume, circulating E2 and P4 concentrations.
4.4.2.8 Statistical Analysis

All statistical analysis was performed using SAS (SAS Institute, 2006), with the
exception that R (R Core Team, 2013) was used to generate the box plots. Non-linear
regression was used to calculate the parameter for rate of P4 decay for each cow by
fitting parameter estimates from the first 60 min following removal of 2 CIDRs to the
following equation: f(t) = b * e(c x t)
where
t = time,
b = parameter for starting concentration of P4,
c = parameter for rate of decay.
Finally, P4 half-life and MCR were calculated using the following equations:
Half-life (min) = ln(2)/c;
MCR (%/min) = c x 100.
Mixed model procedures were used to determine the effect of genotype on

variables with repeated measures such as milk production, BW, BCS, DMI,
reproductive hormone concentrations and CL measurements (Study 2). Fixed effects
92
included genotype, time (minute or day or week) and their interactions. Parity, calving
date, block and their interactions with genotype were included initially but removed if
not significant (P > 0.1). Cow nested within genotype was included as a random effect,
time was included as a repeated effect and a first-order auto regressive covariance
structure was applied. Mixed model procedures were used to determine the effect of
genotype on variables without repeated measures. Genotype was included as a fixed
effect. Parity, calving date, block and the interaction of parity with genotype were
included initially but removed if not significant (P > 0.1). Cow nested within genotype
was included as a random effect. The effect of genotype on day of peak circulating E2
concentrations was determined by one-way nonparametric test. Circulating P4
concentration data from d 3 to 7 of the oestrous cycle in both Study 1 and Study 2 were
combined, and the rate of increase in circulating P4 concentrations for each genotype
was determined by regressing circulating P4 concentration against day.
93
4.5 Results
4.5.1 Study 1
4.5.1.1 Milk Production and Animal Characteristics
The effect of genetic merit for fertility traits on DMI, BW and milk yield is illustrated in
Figure 4.1. Dry matter intake tended to be greater in Fert+ cows than Fert- cows (+0.79
kg DM/d, P = 0.06). Milk yield (mean: 29.8 kg/d, P = 0.98), milk solids yield (mean:
2.28 kg/d, P = 0.38), BCS (mean: 2.75 units, P = 0.37), circulating insulin (mean: 3.21
µIU/mL, P = 0.49) and IGF1 concentrations (mean: 116.9 ng/mL, P = 0.13) were
similar in both genotypes.
4.5.1.2 Ovarian Characteristics and Reproductive Hormones

The effect of genetic merit for fertility traits on ovarian characteristics and reproductive
hormones during Study 1 is summarized in Table 4.4. The diameter of the preovulatory
follicle was 9% greater in Fert+ cows than Fert- cows (+1.44 mm, P = 0.04). There was
no effect of genotype on CL volume (P = 0.12). The BFA of the CL was 42% greater in
Fert+ cows compared with Fert- cows (+0.64 cm2, P = 0.03). The relBFA of the CL was
similar in both genotypes (P = 0.7).
The profile of mean circulating E2 and P4 concentrations in Fert+ and Fert-

cows is illustrated in Figure 4.2. A genotype x day interaction for circulating E2
concentrations was observed (P = 0.01), which arose primarily because of a robust
preovulatory increase in circulating E2 concentrations on day -1 in Fert+ cows that was
not evident in Fert- cows. As a result, peak circulating E2 concentration was greater in
Fert+ cows than in Fert- cows (+1.94 pg/mL, P = 0.007). Day of peak circulating E2
concentrations was similar in both genotypes (mean: d -1, P = 0.94). A genotype x day
interaction for circulating P4 concentrations was observed (P = 0.03) because of a more
rapid increase in Fert+ cows compared with Fert- cows.
94
24.0
Fert-
Fert+ †
23.5
23.0
DMI (kg/d) 22.5
22.0
21.5
Genotype: P = 0.06
21.0 Genotype x wk: P = 0.85
SEM: 0.28 kg
20.5
20.0
700
680
660
640
Body weight (kg)
620
600
580
560 Genotype: P = 0.99
540 Genotype x wk: P = 0.70
SEM: 13.82 kg
520
500
34.0
32.0
30.0
Milk yield (kg/d)
28.0
26.0
Genotype: P = 0.98
SEM: 0.77 kg/d
22.0
20.0
-4 -3 -2 -1 0
Week relative to sample week
Figure 4.1. The effect of genetic merit for fertility traits on dry matter intake, body
weight and milk yield during the 4 weeks prior to completion of the study. All values
are LSM. Dry matter intake tended to be greater in Fert+ cows compared with Fert-
cows while body weight and milk yield were similar. † indicates P ≤ 0.1.
95
Table 4.4. The effect of genetic merit for fertility traits on ovarian characteristics and reproductive hormones during Study 1
Genotype
Variable Fert+ Fert- SEM1 Genotype Genotype x day
Preovulatory follicle:
Diameter (mm) 17.23 15.79 0.45 0.04 -
Oestradiol (pg/mL):
Day -3 to 02 1.46 (1.23 – 1.73) 1.40 (1.13 – 1.71) - 0.73 0.01
Peak 4.26 2.32 0.41 0.0007 -
Corpus luteum:
Volume (mm3) 8385.06 6786.77 389.62 0.12 -
BFA (cm2) 2.15 1.51 0.17 0.03 -
relBFA (%) 55.0 52.2 4.7 0.68 -
BFI (cm/s) 0.27 0.26 0.03 0.77 -
Progesterone (ng/mL):
Day 1 to 7.52 0.85 (0.67 – 1.05) 0.73 (0.55 – 0.96) - 0.40 0.03
1
2
= data presented as LSM with 95% CI in parentheses
96
5
4 Fert-
Fert+
Estradiol (pg/mL) 3
4
Progesterone (ng/mL)
0
-4 -3 -2 -1 0 1 2 3 4 5 6 7 8
Day relative to oestrus
Figure 4.2. The effect of genetic merit for fertility traits on circulating E2 and P4
concentrations during Study 1. All values are back-transformed LSM with 95% CI.
Mean circulating E2 concentrations were similar in both genotypes but there was a
genotype x day interaction (P = 0.01) because peak circulating E2 concentration was
greater in Fert+ cows compared with Fert- cows (P = 0.007). Mean circulating P4
concentrations were similar in both genotypes but there was a genotype x day
interaction (P = 0.03) because of a more rapid increase in Fert+ cows compared with
Fert- cows.
97
4.5.1.3 P4 Metabolism
The effect of genotype on hepatic mRNA abundance of genes responsible for P4
catabolism is illustrated in Figure 4.3. The mRNA abundance of CYP3A was greater in
Fert- cows than Fert+ cows, P = 0.05) while the mRNA abundance of AKR1C1,
AKR1C3, AKR1C4 and CYP2C was similar in both genotypes (all P > 0.2). The profile
of circulating P4 concentrations in Fert+ and Fert- cows during the P4 clearance study is
illustrated in Figure 4.3. There was no effect of genotype on the half-life (P = 0.70) and
MCR (P = 0.79) of P4 following removal of the two CIDRs (Table 4.5).
Table 4.5. The effect of genetic merit for fertility traits on P4 half-life and MCR
Genotype
Variable Fert+ Fert- SEM P-value
P4 MCR (%/min) 2.19 2.08 0.2 0.7
P4 half-life (min) 31.37 (26.77 – 38.16) 32.48 (26.92 – 41.37) - 0.79
1
2
98
1.8
Relative mRNA abundance

1.6 Fert- Fert+
1.4
*
(CNRQ) 1.2
1.0
0.8
0.6
0.4
0.2
0.0
AKR1C1 AKR1C3 AKR1C4 CYP2C CYP3A
4
Fert-
Fert+
3
Progesterone (ng/mL)
0
-100 0 100 200 300 400 500 600 700
Time (min) relative to removal of 2 CIDRs
Figure 4.3. The effect of genetic merit for fertility traits on progesterone (P4)
metabolism. Top: the effect of genetic merit for fertility traits on hepatic mRNA
abundance of candidate genes involved in P4 metabolism. The mRNA abundance of
cytochrome P450, family 3, subfamily A (CYP3A) was greater in cows with poor
genetic merit for fertility traits (Fert−) compared with cows with good genetic merit for
fertility traits (Fert+) but the mRNA abundance of aldo-keto reductase family 1,
member C1 (AKR1C1), AKR1C3, AKR1C4, and cytochrome P450, family 2, subfamily
C (CYP2C) was similar. Data are presented as LSM with 95% CI. Bottom: Circulating
P4 concentrations in Fert+ and Fert− cows from −60 min to 660 min relative to removal
of 2 controlled internal drug release (CIDR) devices. CNRQ = calibrated, normalized
relative quantity values.
99
4.5.2 Study 2
4.5.2.1 Milk Production and Animal Characteristics
Milk yield (mean: 31.7 kg/d, P = 0.81), milk solids yield (mean: 2.30 kg/d, P = 0.14),
BW (mean: 540 kg, P = 0.16) and circulating insulin concentrations (3.23 µIU/mL, P =
0.28) were similar in both genotypes. Body condition score (2.88 vs. 2.55 units, P =
0.0002) and circulating IGF1 concentrations (128.3 ± 7.4 vs. 95.6 ± 9.4 ng/mL, P =
0.05) were greater in Fert+ cows compared with Fert- cows.
4.5.2.2 Ovarian Characteristics and Reproductive Hormones

The effect of genetic merit for fertility traits on ovarian characteristics and reproductive
hormones during Study 2 is summarized in Table 4.6. The diameter of the preovulatory
follicle tended to be greater in Fert+ cows compared with Fert- cows (P = 0.09). Mean
circulating E2 concentrations were 54% greater in Fert+ cows than in Fert- cows (+0.48
pg/mL, P = 0.02; Figure 4.4). Peak circulating E2 concentrations were 53% greater in
Fert+ cows than in Fert- cows (+ 1.18 pg/mL, P = 0.01). Day of peak circulating E2
concentrations tended to be earlier in Fert- cows compared with Fert+ cows (P = 0.1).
Corpus luteum volume tended to be 41% greater in Fert+ cows compared with Fert-
cows (+2357.8 mm3, P = 0.06) but there was no effect of genotype on CL BFA (P =
0.45) or relBFA (P = 0.12). Mean circulating P4 concentrations were 79% greater in
Fert+ cows than Fert- cows (+1.67 ng/mL, P < 0.0001; Figure 4.4 and Figure 4.5). A
genotype x day interaction (P = 0.0001) arose because of a more rapid increase in
circulating P4 concentrations in Fert+ cows after d 6. Simple linear regression analysis
indicated that circulating P4 concentrations increased by 0.79 ng/mL day-1 and 0.52
ng/mL day-1 between d 3 and 7 of the oestrous cycle in Fert+ and Fert- cows,
respectively.
Regression equation for Fert+ cows (±SEM): P4 = (0.79±0.03)*day – 2.12±0.18;
R2 = 0.71
Regression equation for Fert- cows (±SEM): P4 = (0.52±0.04)*day – 1.26±0.21;
R2 = 0.54
100
101
Figure 4.4. The effect of genetic merit for fertility traits on reproductive hormones, follicle diameter and CL characteristics during Study 2.
Values are back-transformed LSM with 95% CI. * indicates P ≤ 0.05. † indicates P ≤ 0.1. A: Follicle diameter tended to be greater in Fert+
cows compared with Fert- cows (P = 0.09). Mean circulating E2 concentrations were greater in Fert+ cows compared with Fert- cows (P =
0.02). There was a genotype x day interaction (P = 0.04) because peak circulating E2 concentrations were greater in Fert+ cows compared
with Fert- cows (P = 0.01). B: There was no effect of genotype on CL BFA (P = 0.45). C: Mean circulating P4 concentrations were greater
in Fert+ cows compared with Fert- cows (P < 0.0001) and there was a genotype x day interaction (P = 0.0001) because of a more rapid
increase in Fert+ cows compared with Fert- cows. D: CL volume tended to be greater in Fert+ cows compared with Fert- cows (P = 0.06).
102
Table 4.6. The effect of genetic merit for fertility traits on ovarian characteristics during Study 2
Genotype P-value
Variable Fert+ Fert- SEM1 Genotype Genotype x day
Follicle:
Diameter (mm)2 21.08 (19.40 – 22.90) 18.70 (16.69 – 20.88) - 0.09 -
BFA (cm2) 0.20 (0.14 – 0.27) 0.19 (0.12 – 0.30) - 0.94 -
Oestradiol:
Day -3 to 02 (pg/mL) 1.37 (1.10 – 1.71) 0.89 (0.68 – 1.17) - 0.02 0.04
Peak (pg/mL) 3.39 2.21 0.29 0.01 -
Day of peak -1.15 -1.5 - 0.1 -
Corpus luteum:
Volume (mm3)2 8139.0 (6524.6 – 1001.4) 5781.2 (4211.2 – 7721.0) - 0.06 0.04
BFA (cm2)2 1.37 (1.17 – 1.61) 1.24 (1.01 – 1.53) - 0.45 0.15
relBFA (%) 36.0 40.7 2.2 0.12 0.13
Progesterone:
Day 1 to 132 3.78 (3.38 – 4.18) 2.11 (1.75 – 2.51) - <0.0001 0.0001
1
2
103
Figure 4.5. Box plots depicting circulating P4 concentrations from Study 2 during d 5,
7, 10 and 13 of the oestrous cycle in Fert+ and Fert- cows. Circulating P4
concentrations were significantly greater in Fert+ cows compared with Fert- cows on d
5 (1.98 vs. 1.27 ng/mL, SEM = 0.21, P = 0.03), 7 (4.42 vs. 2.59, SEM = 0.28, P =
0.0002), 10 (7.01 vs. 3.66, SEM = 0.34, P < 0.0001) and 13 (7.96 vs. 4.63, SEM = 0.58,
P = 0.0007) of the oestrous cycle
104
4.6 Discussion
Fert+ cows had greater circulating P4 concentrations and greater CL volume compared
with Fert- cows. The P4 synthetic capacity of the CL was the primary factor affecting
circulating P4 concentrations since there was no effect of genotype on P4 clearance or
on the factors that affect P4 clearance (i.e., milk production, DMI and hepatic mRNA
abundance of P4 catabolic genes). Volume was the primary factor affecting P4 synthetic
capacity of the CL since there was no effect of genotype on CL BFA. Our results imply
that greater preovulatory follicle diameter and greater peak E2 concentrations in Fert+
cows compared with Fert- cows may have been associated with subsequent CL volume
and P4 synthetic capacity.
4.6.1 Preovulatory Follicle Characteristics and Circulating E2 Concentrations

Our results indicate that preovulatory follicle diameter and preovulatory circulating E2
concentrations are important fertility traits. Fert+ cows had greater peak circulating E2
concentrations (d -1) compared with Fert- cows. This may be explained by greater
preovulatory follicle diameter on the day of presumptive oestrus (significantly greater in
Study 1, numerically greater in Study 2). Circulating E2 concentrations must reach the
threshold required by the surge centre of the hypothalamus to release GnRH, thereby
facilitating the surge release of luteinising hormone from the pituitary to initiate the
cascade of events required for ovulation (Senger, 1997). Greater circulating
preovulatory E2 concentrations have been reported in heifers compared with lactating
cows (Sartori et al., 2004), and in dairy cows that subsequently became pregnant
compared with dairy cows that did not (Lopes et al., 2007). Greater preovulatory follicle
diameter has been reported in heifers (Siddiqui et al., 2009) and cows (Lopes et al.,
2007) that subsequently became pregnant compared with those that did not. In addition,
Stevenson et al., (2008) reported a positive correlation between the diameter of the
ovulatory follicle at the time of CIDR removal and PGF2α administration during a timed
AI protocol and circulating P4 concentrations 9 d later in heifers.
4.6.2 Circulating P4 Concentrations

The results of Study 1 and 2, combined with the results of Cummins et al., (2012b)
provide strong evidence that superior genetic merit for fertility traits is associated with
greater circulating P4 concentrations in lactating dairy cows. The P4 profiles from
Study 1 and Study 2 indicate two clear characteristics. First, in keeping with our
105
previous findings (Cummins et al., 2012b), mean circulating P4 concentrations were
greater in Fert+ cows compared with Fert- cows. Second, the interaction between
genotype and time in both studies indicates that Fert+ cows have a more rapid post-
ovulatory increase in circulating P4 concentrations compared with Fert- cows. Simple
linear regression equations indicated that the rate of increase in P4 between days 3 and 7
was 52% greater in Fert+ cows compared with Fert- cows. While the difference was
smaller than in the current study, Walker et al., (2012) reported greater circulating P4
concentrations in cows with New Zealand ancestry (good fertility) compared with cows
with North American ancestry (poor fertility). It is clear that circulating P4
concentrations during the prebreeding and postbreeding periods are important fertility
traits. These findings are supported by data from several studies that indicated
supplemental P4 improved conception rates (Macmillan and Peterson, 1993; Cunha et
al., 2008; Herlihy et al., 2011; Colazo et al., 2013) synchrony of ovulation (Herlihy et
al., 2011; Colazo et al., 2013) and reduced pregnancy loss between d 30 to 60 (Cunha et
al., 2008; Colazo et al., 2013; Herlihy et al., 2013). Consistent with these results,
improved fertility in lactating dairy cows was achieved by the use of a CIDR between d
3.5 to 10 post breeding (Larson et al., 2007) and by human chorionic gonadotropin
(hCG) on d 5 post breeding (Nascimento et al., 2013a). However, other studies have
reported no improvement in pregnancy rates (Lonergan, 2011). The success of P4
supplementation, or administration of GnRH or hCG, may be dependent on the timing
of the treatment and may only be beneficial in cows with low circulating P4
concentrations (Lonergan, 2011) as lower circulating P4 concentrations from d 6 to 8
has been associated with negative pregnancy status following diagnosis on d 29 post AI
(Lopes et al., 2007).
Greater circulating P4 concentrations in nulliparous Holstein heifers compared

with lactating Holstein dairy cows is a likely mediator of superior fertility in heifers
(Sartori et al., 2004; Wolfenson et al., 2004; Rizos et al., 2010). Nascimento et al.,
(2013b) evaluated the effectiveness of CIDR, hCG or CIDR plus hCG treatments from
d 5 post oestrus at raising circulating P4 concentrations in lactating dairy cows. Only
cows receiving the CIDR plus hCG treatment achieved circulating P4 concentrations
similar to those in heifers. Circulating P4 concentrations on d 13 of the oestrous cycle in
Fert+ cows in the current study were similar to cows treated with hCG, whereas Fert-
cows achieved circulating P4 concentrations similar to control cows that received no
treatment in the study reported by Nascimento et al., (2013b). These results indicate the
106
important role of genetic selection for fertility traits in improving circulating P4
concentrations in lactating dairy cows. It would be interesting to examine the
conception rate response if circulating P4 concentrations in Fert- cows was increased to
be similar to Fert+ cows.
4.6.3 Corpus Luteum Characteristics

Progesterone secretion is determined by the volume and blood flow of the CL, the
metabolic rate of the luteal cells and stage of the oestrous cycle. We assessed CL
function based on volume, BFA and relBFA using transrectal ultrasonography. While
several authors reported that positive associations between CL size and circulating P4
concentrations depended on stage of the oestrous cycle (Mann, 2009; Lüttgenau et al.,
2011; Rizos et al., 2012), Herzog et al., (2010) reported that CL BFA was a better
indicator of CL function than size during d 7 to 14 of the oestrous cycle. During this
period, circulating P4 concentrations and BFA doubled while CL area increased only by
25%. However, Lüttgenau et al., (2011) reported no correlation between BFA and
circulating P4 concentrations during the mid-luteal phase in a subsequent study by the
same group. As a result, Lüttgenau et al., (2011) suggested relBFA as a more relevant
assessment of CL function by accounting for CL size. In a review of their studies,
Bollwein et al., (2012) concluded that the correlation between BFA and circulating P4
concentrations reported by Herzog et al., (2010) was due to the fact that both
measurements were closely associated with CL size. In Study 1, based on ultrasound
measurements at a single time point on d 7 of the oestrous cycle, CL volume was
numerically greater and BFA was significantly greater in Fert+ cows compared with
Fert- cows. In Study 2, employing a more thorough assessment, based on ultrasound
measures at 4 time points, mean CL volume tended to be greater in Fert+ cows
compared with Fert- cows but BFA was not affected by genotype. relBFA was not
affected by genotype in either study. Taken together, our results indicate that CL
volume rather than blood flow is the major factor determining CL P4 synthetic capacity
in agreement with Lüttgenau et al., (2011).
4.6.4 P4 Clearance
The removal of P4 from circulation is determined by the rate of blood flow through the
liver and the activity of liver enzymes with P4 catabolic activity. Increased liver blood
flow due to greater DMI (Sangsritavong et al., 2002; Reynolds et al., 2003) and the
107
associated increase in liver steroid clearance has been implicated as a potential disruptor
of reproductive events in high producing dairy cows. Sangsritavong et al., (2002),
Lemley et al., (2010) and Hutchinson et al., (2012) have reported that it is possible to
alter P4 clearance through dietary manipulation. The major genes responsible for P4
catabolism in the liver belong to the cytochrome P450 family (Murray, 1991; Murray,
1992). These are mixed-function monooxygenases that inactivate P4 by hydroxylation
to hydroxyprogesterone. In addition, the aldo-keto reductase family inactivate P4 by
reduction to hydroxyprogesterone (Penning et al., 2000). While there was no effect of
genotype on mRNA abundance of AKR1C1, AKR1C3, AKR1C4 and CYP2C, Fert- cows
had greater mRNA abundance of CYP3A. Down-regulation of CYP3A or reduced
activity of its enzyme in response to elevated circulating insulin has been previously
reported (Lemley et al., 2008, 2009, 2010). There were no differences in circulating
insulin concentrations between Fert+ and Fert- cows at the time of the liver biopsy in
the current study. The lack of an effect of genotype on the MCR and half-life of P4
seems reasonable considering four of the five candidate genes were not differentially
expressed. In addition, milk yield was similar between genotypes in both studies. While
the Fert+ cows tended to have greater DMI compared with the Fert- cows, the
difference equates to only 3.6%, whereas Sangsritavong et al., (2002) maintained a
difference of 200% in DMI between treatment groups in their study.
4.7 Conclusions
Insufficient circulating P4 concentrations have been implicated as a major cause of poor

fertility in lactating dairy cows. The naturally occurring differences in circulating P4
concentrations between Fert+ and Fert- cows provided us with a unique opportunity to
examine the factors that affect circulating P4 concentrations without the need to
artificially manipulate their diet or hormone profiles. The results of our studies indicate:
(i) Fert+ cows had greater circulating P4 concentrations during the oestrous cycle than
Fert- cows; (ii) that these differences were due to greater CL volume rather than
differences in P4 clearance; and (iii) genetic selection for high circulating P4
concentrations is possible without antagonising milk production.
108
4.8 References
mechanism and clinical relevance. Reproduction Fertility and Development
25(1):71-79.
Colazo, M. G., A. Dourey, R. Rajamahendran, and D. J. Ambrose. 2013. Progesterone
supplementation before timed AI increased ovulation synchrony and pregnancy
per AI, and supplementation after timed AI reduced pregnancy losses in lactating
dairy cows. Theriogenology 79(5):833-841.
95(7):3698-3710.
somatotropic axis genes during pregnancy and lactation. Journal of Dairy Science
95(7):3711-3721.
Cunha, A. P., J. G. Guenther, M. J. Maroney, J. O. Giordano, A. B. Nascimento, S. Bas,
H. Ayres, and M. C. Wiltbank. 2008. Effects of high vs. low progesterone
concentrations during Ovsynch on double ovulation rate and pregnancies per AI
in high producing dairy cows. Journal of Dairy Science 91:(Suppl. 1), 246.
[Abstract].
Diskin, M. and D. Morris. 2008. Embryonic and Early Foetal Losses in Cattle and Other
Ruminants. Reproduction in Domestic Animal. 43(Suppl. 2):260-267.
72(1):68-78.
Enright, W. J., L. T. Chapin, W. M. Moseley, S. A. Zinn, M. B. Kamdar, L. F. Krabill,
and H. A. Tucker. 1989. Effects of infusions of various doses of bovine growth
hormone-releasing factor on blood hormones and metabolites in lactating Holstein
cows. Journal of Endocrinology. 122(3):671-679.
109
2013. Alterations in expression of endometrial genes coding for proteins secreted
into the uterine lumen during conceptus elongation in cattle. BMC Genomics
14(1):321.
Herlihy, M. M., D. P. Berry, M. A. Crowe, M. G. Diskin, and S. T. Butler. 2011.
Evaluation of protocols to synchronize estrus and ovulation in seasonal calving
pasture-based dairy production systems. Journal of Dairy Science 94(9):4488-
4501.
Herlihy, M. M., M. A. Crowe, D. P. Berry, M. G. Diskin, and S. T. Butler. 2013.
Factors associated with fertility outcomes in cows treated with protocols to
synchronize estrus and ovulation in seasonal-calving, pasture-based dairy
production systems. Journal of Dairy Science 96(3):1485-1498.
Herlihy, M. M., M. A. Crowe, M. G. Diskin, and S. T. Butler. 2012. Effects of
synchronization treatments on ovarian follicular dynamics, corpus luteum growth,
and circulating steroid hormone concentrations in lactating dairy cows. Journal of
Herzog, K., M. Brockhan-Lüdemann, M. Kaske, N. Beindorff, V. Paul, H. Niemann,
and H. Bollwein. 2010. Luteal blood flow is a more appropriate indicator for
luteal function during the bovine estrous cycle than luteal size. Theriogenology
73(5):691-697.
Hutchinson, I. A., R. J. Dewhurst, A. C. O. Evans, P. Lonergan, and S. T. Butler. 2012.
Effect of grass dry matter intake and fat supplementation on progesterone
metabolism in lactating dairy cows. Theriogenology 78(4):878-886.
Lemley, C. O., S. T. Butler, W. R. Butler, and M. E. Wilson. 2008. Short
Communication: Insulin Alters Hepatic Progesterone Catabolic Enzymes
Cytochrome P450 2C and 3A in Dairy Cows. Journal of Dairy Science 91(2):641-
645.
Lemley, C. O., K. A. Vonnahme, L. R. Tager, K. M. Krause, and M. E. Wilson. 2010.
Diet-induced alterations in hepatic progesterone (P4) catabolic enzyme activity
and P4 clearance rate in lactating dairy cows. Journal of Endocrinology
205(3):233-241.
110
Lemley, C. O., T. A. Wilmoth, L. R. Tager, K. M. Krause, and M. E. Wilson. 2009.
Effect of a high cornstarch diet on hepatic cytochrome P450 2C and 3A activity
and progesterone half-life in dairy cows. Journal of Dairy Science 93(3):1012-
1021.
Lonergan, P. 2011. Influence of progesterone on oocyte quality and embryo
development in cows. Theriogenology 76(9):1594-1601.
Lopes, A. S., S. T. Butler, R. O. Gilbert, and W. R. Butler. 2007. Relationship of pre-
ovulatory follicle size, estradiol concentrations and season to pregnancy outcome
in dairy cows. Animal Reproduction Science 99(1–2):34-43.
Lüttgenau, J., S. E. Ulbrich, N. Beindorff, A. Honnens, K. Herzog, and H. Bollwein.
2011. Plasma progesterone concentrations in the mid-luteal phase are dependent
on luteal size, but independent of luteal blood flow and gene expression in
lactating dairy cows. Animal Reproduction Science 125(1-4):20-29.
Macmillan, K. L. and A. J. Peterson. 1993. A new intravaginal progesterone releasing
device for cattle (CIDR-B) for oestrous synchronisation, increasing pregnancy
rates and the treatment of post-partum anoestrus. Animal Reproduction Science
33(1-4):1-25.
Mann, G. E. 2009. Corpus luteum size and plasma progesterone concentration in cows.
McNeill, R. E., M. G. Diskin, J. M. Sreenan, and D. G. Morris. 2006. Associations
between milk progesterone concentration on different days and with embryo
survival during the early luteal phase in dairy cows. Theriogenology 65(7):1435-
1441.
Murray, M. 1991. Microsomal cytochrome P450-dependent steroid metabolism in male
sheep liver. Quantitative importance of 6β-hydroxylation and evidence for the
involvement of a P450 from the IIIA subfamily in the pathway. Journal of Steroid
Biochemistry and Molelcular Biology. 38(5):611-619.
Murray, M. 1992. Participation of a cytochrome P450 enzyme from the 2C subfamily in
progesterone 21-hydroxylation in sheep liver. Journal of Steroid Biochemistry and
Molelcular Biology. 43(6):591-593.
Nascimento, A. B., R. W. Bender, A. H. Souza, H. Ayres, R. R. Araujo, J. N. Guenther,
R. Sartori, and M. C. Wiltbank. 2013a. Effect of treatment with human chorionic
gonadotropin on day 5 after timed artificial insemination on fertility of lactating
111
Nascimento, A. B., A. H. Souza, J. N. Guenther, F. P. Costa, R. Sartori, and M. C.
Wiltbank. 2013b. Effects of treatment with human chorionic gonadotrophin or
intravaginal progesterone-releasing device after AI on circulating progesterone
concentrations in lactating dairy cows. Reprod. Fertil. Dev. 25(5):818-824.
Penning, T. M., M. E. Burczynski, J. M. Jez, C. F. Hung, H. K. Lin, H. Ma, M. Moore,
N. Palackal, and K. Ratnam. 2000. Human 3alpha-hydroxysteroid dehydrogenase
isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional
plasticity and tissue distribution reveals roles in the inactivation and formation of
male and female sex hormones. Biochemical Journal. 351(1):67-77.
R Core Team (2013). R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria. URL http://www.R-
project.org/.
Reynolds, C. K., P. C. Aikman, B. Lupoli, D. J. Humphries, and D. E. Beever. 2003.
Splanchnic Metabolism of Dairy Cows During the Transition From Late Gestation
Through Early Lactation. Journal of Dairy Science 86(4):1201-1217.
Rizos, D., F. Carter, U. Besenfelder, V. Havlicek, and P. Lonergan. 2010. Contribution
of the female reproductive tract to low fertility in postpartum lactating dairy cows.
Rizos, D., S. Scully, A. K. Kelly, A. D. Ealy, R. Moros, P. Duffy, A. Al Naib, N. Forde,
and P. Lonergan. 2012. Effects of human chorionic gonadotrophin administration
on Day 5 after oestrus on corpus luteum characteristics, circulating progesterone
and conceptus elongation in cattle. Reprod. Fertil. Dev. 24(3):472-481.
85(11):2831-2842.
Sartori, R., J. M. Haughian, R. D. Shaver, G. J. M. Rosa, and M. C. Wiltbank. 2004.
Comparison of Ovarian Function and Circulating Steroids in Estrous Cycles of
Holstein Heifers and Lactating Cows. Journal of Dairy Science 87(4):905-920.
SAS Institute. 2006. SAS User’s Guide: Statistics. SAS Institute Inc., Cary, NC.
Senger, P. L. 1997. Pathways to pregnancy and parturition. Current Conceptions, Inc.,
Pullman, Washington.
Siddiqui, M. A. R., M. Almamun, and O. J. Ginther. 2009. Blood flow in the wall of the
preovulatory follicle and its relationship to pregnancy establishment in heifers.
Animal Reproduction Science 113(1–4):287-292.
112
Stevenson, J. L., J. C. Dalton, J. E. P. Santos, R. Sartori, A. Ahmadzadeh, and R. C.
Chebel. 2008. Effect of Synchronization Protocols on Follicular Development and
Estradiol and Progesterone Concentrations of Dairy Heifers. Journal of Dairy
Science 91(8):3045-3056.
Stronge, A. J. H., J. M. Sreenan, M. G. Diskin, J. F. Mee, D. A. Kenny, and D. G.
Morris. 2005. Post-insemination milk progesterone concentration and embryo
survival in dairy cows. Theriogenology 64(5):1212-1224.
subfertile dairy cow strains. Physiol. Genomics 44(1):47-58.
Wiltbank, M. C. 1994. Cell types and hormonal mechanisms associated with mid-cycle
corpus luteum function. J. Anim. Sci. 72(7):1873-1883.
Wiltbank, M. C., R. Sartori, M. M. Herlihy, J. L. M. Vasconcelos, A. B. Nascimento, A.
H. Souza, H. Ayres, A. P. Cunha, A. Keskin, J. N. Guenther, and A. Gumen.
2011. Managing the dominant follicle in lactating dairy cows. Theriogenology
76(9):1568-1582.
Wolfenson, D., G. Inbar, Z. Roth, M. Kaim, A. Bloch, and R. Braw-Tal. 2004.
Follicular dynamics and concentrations of steroids and gonadotropins in lactating
cows and nulliparous heifers. Theriogenology 62(6):1042-1055.
Xu, Z. Z., L. J. Burton, and K. L. Macmillan. 1997. Reproductive performance of
lactating dairy cows following estrus synchronization regimens with PGF2α and
progesterone. Theriogenology 47(3):687-701.
113
Chapter Five
Follicular fluid and serum metabolites in Holstein

cows are predictive of genetic merit for fertility
5.1 Preface
At the time of thesis submission this chapter is in preparation for submission to a peer-
reviewed journal.
Stephen Moore was the primary author and carried out the animal experiment, statistical
analysis and drafted the manuscript. Aoife O’Gorman and Lorraine Brennan performed
the metabolite analysis and receiver operating characteristic curve analysis. Trudee Fair
and Stephen Butler conceived, designed and coordinated the study. All authors
interpreted the data and contributed to the manuscript.
have been removed.
114
5.2 Abstract
The objectives of this study were: (i) to characterize the fatty acid and amino acid
profile of follicular fluid and serum on day 7 of the oestrous cycle in dairy cows with
similar genetic merit for milk production but with extremes of good (Fert+) or poor
(Fert-) genetic merit for fertility; and (ii) to identify potential biomarkers of fertility in
dairy cows. Twenty-eight lactating dairy cows (15 Fert+, 13 Fert-) and seven non-
lactating dairy cows (3 Fert+, 4 Fert-) were enrolled in an ovulation synchronization
protocol. All cows were fed a total mixed ration diet during the study. On day 7 of the
oestrous cycle (0 = oestrus), follicular fluid from the first wave dominant follicle was
collected by transvaginal follicular aspiration and serum was collected by coccygeal
venepuncture. Day 7 was selected to enable collection of a sufficient volume of
follicular fluid. Metabolites were extracted from follicular fluid and serum, and
analysed by gas chromatography mass spectrometry. Statistical analysis was performed
on the data by mixed model procedures to identify metabolites significantly different
between Fert+ and Fert- cows, and subsequently by receiver operating characteristic
curve analysis to determine the predictive value of these metabolites. The five most
abundant fatty acids in follicular fluid (linoleic acid, stearic acid, oleic acid, palmitic
acid and α-linolenic acid) were not affected by genotype; however, alterations to the
abundance of nine fatty acids (arachidic acid, heneicosanoic acid, myristic acid, behenic
acid, myristoleic acid, heptadecenoic acid, cis-11-eicosanoic acid, nervonic acid and γ-
linolenic acid) that collectively accounted for 2.4% of the total fatty acid content may
reflect small but important differences to the follicular microenvironment. In serum,
greater abundance of total polyunsaturated fatty acids and n-6 polyunsaturated fatty
acids in Fert+ cows, and greater abundance of total saturated fatty acids in Fert- cows
represented the most pronounced effect of genotype in the study. Follicular fluid
concentrations of cysteine, leucine, ornithine, proline and tyrosine and serum
concentrations of asparagine, creatinine, cysteine, methionine, proline and valine were
affected by genotype. Receiver operating characteristic curve analysis indicated that the
follicular fluid and serum fatty acids and follicular fluid amino acids that were
significantly affected by genotype were potential candidates to successfully predict
fertility genotype. The results indicated unique differences in the follicular fluid and
serum metabolite profiles between Fert+ and Fert- cows that were none the less, highly
predictive of fertility genotype.
115
5.3 Introduction
Poor oocyte quality has been implicated as a contributor to low pregnancy rates in dairy
cattle, as greater pregnancy rates have been achieved in lactating dairy cows following
embryo transfer compared with artificial insemination in the animals (Putney et al.,
1989, Ambrose et al., 1999, Vasconcelos et al., 2006). Rates of fertilization failure in
dairy cows are reported to range from 0 - 45% (Sartori et al., 2002). Even when
fertilization is achieved, however, poor oocyte competence is associated with
compromised development of the subsequent embryo (Rahman et al., 2012, Demyda-
Peyrás et al., 2013).
Circulating concentrations of glucose and non-esterified fatty acids (NEFA)

fluctuate during the transition from pregnancy to lactation; however, greater circulating
glucose concentrations and lesser circulating NEFA concentrations during this time are
associated with cows that became pregnant to first insemination (Garverick et al., 2013).
Greater concentrations of NEFA and β-hydroxybutyrate (BHBA) in follicular fluid are
associated with reduced steroidogenesis and proliferation of follicular thecal cells, and
in vitro studies have demonstrated detrimental effects on oocyte quality (Leroy et al.,
2005, Vanholder et al., 2006). In vitro maturation studies have reported that the
predominant circulating NEFAs (oleic, palmitic and stearic acid) had a negative impact
on oocyte meiotic and cytoplasmic maturation, fertilization, blastocyst formation and
embryo quality (Van Hoeck et al., 2011). It is likely that this is due to the high lipid
content (McKeegan and Sturmey, 2011) and high RNA and protein synthetic capacity
of bovine oocytes during maturation (Tomek et al., 2002), which appear to be altered by
exposure to these metabolites (Aardema et al., 2011, Van Hoeck et al., 2013).
The relationship between fertility and amino acid profiles in serum and follicular
fluid has received much less attention than fatty acid profiles. Amino acids are,
however, of interest to dairy cow fertility because they are utilized by oocytes (Gu et al.,
2015) and some, e.g. leucine and methionine, have been reported to affect oocyte
competence (Rooke et al., 2009) and neutrophil function (Osorio et al., 2013), and cause
alterations to the embryo transcriptome (Peñagaricano et al., 2013).
Interestingly, oocyte developmental competence can also be predicted from the

fatty acid and amino acid profiles of bovine follicular fluid (Matoba et al., 2014) or
from the amino acid profile of in vitro maturation media (Hemmings et al., 2012). The
116
objectives of this paper were (i) to characterize the fatty acid and amino acid
composition of follicular fluid and serum collected on d 7 of the oestrous cycle from
dairy cows with similar genetic merit for milk production, but either good (Fert+) or
poor (Fert-) genetic merit for fertility; and (ii) to identify potential biomarkers of
fertility in dairy cows. The hypothesis was that differences in the follicular fluid and
serum metabolite profile between Fert+ and Fert- cows were predictive of fertility
genotype.
117
5.4.1 Animal Model

A lactating cow genetic model of fertility was established in Teagasc Moorepark
to elucidate the mechanisms responsible for poor fertility in lactating Holstein dairy
cows (Cummins et al., 2012). Briefly, heifers with >75% Holstein genetics with either
extreme positive (i.e., poor fertility; Fert-) or negative (i.e., good fertility; Fert+)
estimated breeding values (EBV) for calving interval were selected from the national
dairy cattle database. Within the Irish national herd, the selected heifers were
representative of the top 25% in genetic merit for milk production. Fert- heifers were
representative of the bottom 5% in genetic merit for calving interval, whereas Fert+
heifers were representative of the top 20% in genetic merit for calving interval. Eighteen
Fert+ cows (3 non-lactating and 15 lactating; n = 1, 6, 11 in parity 1, 2 and 3,
respectively and 17 Fert- cows (4 non-lactating and 13 lactating; n = 2, 11 and 3 in
parity 1, 2 and 3, respectively, were enrolled in the study. The EBV’s of the cows from
both genotypes are summarized in Table 1. Fert+ and Fert- cows were represented by 5
and 12 sires, respectively. The maximum and minimum number of daughters from an
individual sire for Fert+ and Fert- cows was 6 and 2, and 2 and 1, respectively. The
experimental procedures involving animals on both studies were licensed by the
Department of Health, Ireland, in accordance with the Cruelty to Animals Act (Ireland
1876) and the European Community Directive 86/609/EEC.
5.4.2 Feed and Management System

The study was undertaken at Teagasc Moorepark from November 2010 to March 2011.
Lactating and non-lactating cows were enrolled in this study. The mean calving dates
were November 2 (SD ± 37.1 days) and November 6 (SD ± 37.9 days) 2010 for the
lactating Fert+ and Fert- cows, respectively. The parity structure for the Fert+ cows was
4 and 11 cows in second and third lactation, respectively. The parity structure for the
Fert- cows was 9 and 4 cows in second and third lactation, respectively. Following
parturition, lactating cows were housed as one group in a freestall barn and fed a total
mixed ration ad libitum plus five kg lactating cow concentrate per day at the a.m. and
p.m. milkings. Non-lactating cows that did not conceive during the previous breeding
season were housed as one group in the same freestall barn and fed a total mixed ration
118
ad libitum. The mean calving dates were February 18 (SD ± 38) and April 5 (SD ± 100)
2009 for the non-lactating Fert+ and Fert- cows, respectively. The parity structure for
the Fert+ cows was 1 and 2 cows in first and second lactation, respectively. The parity
structure for the Fert- cows was 2 and 2 cows in first and second lactation, respectively.
Feed refusals were removed every second day. Diet ingredients were sampled weekly
and composited monthly for analysis (Table 5.2).
119
Table 5.1. The mean estimated breeding value1 (and SD) for both genotypes based on their sire, maternal
grandsire and maternal grand grand-sire estimated breeding values
Genotype2
Fert+ cows Fert- cows
Variable Non-lactating Lactating Non-lactating Lactating
No. of animals 3 15 4 13
Holstein (%) 93.8 (3.2) 90.0 (7.2) 90.6 (9.4) 94.0 (13.5)
Milk (kg) 279 (119) 363 (154) 499.5 (120) 434 (125)
Fat (kg) 15.8 (3.7) 20 (6.2) 16.3 (2.3) 16.3 (6.6)
Fat (g/kg) 1.0 (1.4) 1.0 (0.8) -0.4 (0.6) 0.02 (1.0)
Protein (kg) 12.3 (1.1) 15.1 (5.7) 19.1 (5.6) 16.1 (5.9)
Protein (g/kg) 0.6 (0.6) 0.4 (0.6) 0.4 (1.0) 0.2 (0.8)
Survival (%) 3.78 (0.76) 3.5 (0.96) -3.56 (1.4) -3.1 (1.08)
Calving Interval (d) -6.2 (1.3) -6.0 (1.5) 8.5 (2.04) 8.74 (2.9)
Sire calving interval (d) -8.7 (2.9) -4.95 (1.9) 8.7 (3.9) 10.8 (3.7)
Maternal grandsire calving interval (d) -6.2 (0.5) -6.0 (2.1) 12.5 (3.2) 12.7 (5.4)
1
PTA values were obtained from the Autumn 2012 official dairy evaluations published by the Irish Cattle
Breeding Federation and multiplied by 2 to convert to EBV. Individual cow EBV were determined using
the following formula: 0.5*sireEBV + 0.25*MGsireEBV + 0.125*MGGsireEBV
2
120
Table 5.2. Ingredient and nutrient composition of non-lactating and lactating cow
diet
Non-lactating cow diet (% DM)
Grass silage 76
Straw 14
Concentrate 10
Dry cow concentrate ingredients (% fresh)

Barley 25
Soya hulls 15
Rapeseed 15
Distillers 6
Citrus pulp 6
Minerals 2.5
Sunflower meal 7.5
Palm kernel meal 10
Milk Solids 8
Maize gluten 4.4
Oil 0.6
Lactating cow diet (% DM)

Maize silage 36
Grass silage 33
Soyabean meal 9
Lactating cow concentrate ingredients (% fresh)

Wheat 25
Soyabean 15
Rapeseed extract 10
Sunflower seed extract 10
Palm kernel meal 10
Milk solids 5
Maize gluten 5
Citrus pulp 5
Soyabean hulls 5
Palm oil 4
Oat feed 4
Minerals1 2
Nutrient composition concentrate (DM basis) Non-lactating Lactating

DM (g/kg) 854 868
Net energy (UFL/kg DM) 0.92 0.92
Ash (g/kg DM)Crude protein (g/kg DM) 78.4 74
Crude protein (g/kg DM) 159 185
NDF (g/kg DM) 506 330
1
Vitamin and Mineral mix: 229 g/kg of Ca, 100 g/kg of Na, 70 g/kg of P, 5 g/kg of
Mg, 4500 mg/kg of Zn, 3000 mg/kg of Cu, 1500 mg/kg of Mn, 500 mg/kg of I, 400
mg/kg Bioplex* Cu, 400 mg/kg of Bioplex* Zn, 99 mg/kg of Co, 37 mg/kg of Se,
375000 IU/kg of vitamin A, 100000 IU/kg of vitamin D3, 1250 mg/kg of vitamin E
and 200 mg/kg of vitamin B12. *Alltech Inc., Nicholasville, KY
121
5.4.3 Animal Measurements
Cows were milked twice daily at 0800 and 1600 hours. Milk yield was recorded at each
evening and morning samples by mid-infrared reflectance spectroscopy (FT6000
Milkscan instrument, Foss Electric, Hillerød, Denmark). Body weight and body
condition score were recorded weekly. Body condition score was assessed using the 1 to
5 scale in 0.25 increments (Edmonson et al., 1989).
5.4.4 Ovulation Synchronisation

Cows were enrolled in an ovulation synchronization protocol as described previously
(Herlihy et al., 2012). The mean days postpartum when cows were enrolled in the
protocol was 61 ± 15 and 60 ± 13 for the Fert+ and Fert- lactating cows, respectively,
and 632 ± 38 and 586 ± 100 for the Fert+ and Fert- non-lactating cows, respectively. On
d 0 of the protocol, each cow was administered an intramuscular injection of a GnRH
agonist containing 10 μg of buserelin (Receptal; Intervet Ireland, Dublin, Ireland), and a
controlled internal drug release device containing 1.38 g of progesterone (P4; CIDR,
Pfizer Ireland, Dublin, Ireland) was inserted per vaginum. On day 7, each cow was
administered an intramuscular injection of PGF2α containing 25 mg of dinoprost
tromethamine (Lutalyse, Pfizer Ireland). On day 8, the CIDR device was removed and
36 h later, each cow was administered a second intramuscular injection of GnRH
agonist.
5.4.5 Blood Sampling

Blood samples were collected on day 7 relative to synchronized oestrus (day 0) by
coccygeal venepuncture into serum vacutainers (Becton Dickinson, Plymouth, UK),
kept at room temperature for 30 min and centrifuged at 2000 x g for 10 min at 4 °C;
serum was decanted and stored at -80 °C.
5.4.6 Ovarian Ultrasonography

Transrectal ultrasound examination of both ovaries was carried out on day 7 relative to
the synchronized oestrus. The largest follicle was examined using a Voluson i
ultrasound machine (GE Healthcare, Austria, Germany) equipped with a 12 MHz linear
array probe. Initially, the follicle was visualized in B-mode, and three images at its
122
maximum diameter were captured and stored for further analysis. Ultrasound machine
settings were then switched to power Doppler mode to measure follicle blood flow area.
At its largest apparent size, the entire follicle was fitted within a Doppler sample box
and scanned for several seconds. Three images deemed representative of maximum
blood flow with no flash artefacts were captured and stored for further analysis.
5.4.7 Ultrasound Image Analysis

The diameter of the follicle measured on day 7 was calculated as the mean of three cross
sectional diameters measured from each image. Power Doppler images were analysed
using the computer programme Pixel Flux® (Version 1.0, Chameleon Software, Leipzig,
Germany) to quantify the area in cm2 of coloured pixels within the follicle, which is
considered a semi-quantitative measure of blood flow. Mean blood flow area of each
structure was calculated using the three images.
5.4.8 Follicular Fluid Sampling

After ultrasonography of the largest follicle, follicular fluid was aspirated using an
Esaote Pie medical scanner equipped with a multi-angle ovum pick-up probe (Pie
Medical Equipment B.V., Maastricht, the Netherlands) as described by Bols et al.
(1995). Cows were sedated with an intravenous injection of xylazine (1 mg/100 kg body
weight) and caudal epidural anaesthesia was induced with 4 mL of 2% lidocaine. Faeces
were evacuated from the rectum and the vulva and perineal area were sanitized with
antiseptic solution and dried with paper towels. The probe was inserted into the vagina
so that the transducer face was applied to the vaginal wall. The ovary with the largest
follicle was manipulated against the vaginal wall and over the transducer face so that the
follicle was visible on the monitor. A disposable 19 G hypodermic needle was guided
through the vaginal wall to puncture the follicular wall. The follicular fluid was
aspirated using a foot-operated suction pump at 44 mm Hg into a sterile 50 mL conical
tube (Becton Dickinson, Plymouth, UK). The tube was immediately placed on ice and
transported to the laboratory for processing. The collection tubing was washed with
double-distilled H2O between each cow. In the laboratory, the aspirate was transferred
to sterile 1.5 mL eppendorf tubes (Eppendorf, UK) and centrifuged at 3,500 g x 30 min
at 4 °C. Aliquots of 200 µL were transferred to 1.5 mL eppendorf tubes, snap frozen in
liquid nitrogen and stored at -80 °C.
123
5.4.9 Reproductive Hormone Analysis
Circulating and follicular fluid P4 concentrations were determined in samples collected
from d 1 to 7.5 after synchronized oestrus relative to CIDR removal using a
commercially available solid-phase radioimmunoassay (Coat-A-Count Progesterone,
Diagnostic Products Corp., Los Angeles, CA). The inter-and intra-assay CV’s for
plasma were 17.2% and 11.1%, 10.0% and 8.3% and 9.4% and 6.9% for the low,
medium and high P4 pools, respectively. The intra-assay CV’s for follicular fluid were
10.9% and 6.0% for the low and high P4 pools respectively. Follicular fluid E2
concentrations were determined in samples by radioimmunoassay following extraction
using E2 MAIA kits (Bio-Stat Diagnostic Systems Ltd. Stockport, Cheshire, UK). The
intra-assay CV was 20.0% and 7.8% for the low and high E2 pools respectively.
Follicular fluid cholesterol concentrations were determined by enzymatic colorimetry
using an RX imola clinical biochemistry analyser (Randox Laboratories, Crumlin, UK;
cholesterol kit supplied by Randox Laboratories). Both genotypes were represented
equally in each hormone assay, and all samples for an individual cow were completed
within one assay.
5.4.10 Metabolite Extraction and Data Analysis

Follicular fluid and serum samples were thawed on ice before analysis. For analysis of
organic compounds, 200 µl of follicular fluid or serum was combined with 20 µl of
nonadecanoic acid (C19:0) (1 mg/mL methanol) as an internal standard and extracted
using a 1:2 mixture of chloroform:methanol based on the method of Bligh and Dyer
(1959). Extracts were derived by methylation using methanolic BF3 (BF3/MeOH, 14%
w/v). Derivatives were re-suspended in 200 µL of hexane and 1 µL was injected into the
GC/MS. The GC temperature was initially 70 °C for 2 min, increased by 15 °C/min to
190 °C and held for 9 min, then increased by 5 °C/min to 230 °C and held for 13 min
and finally raised to 320 °C by 20 °C/min and held for 10 min.
Aqueous compounds were isolated using a methanol extraction (Jiye et al.,

2008) following deproteinization with acetonitrile. Briefly, 200 µL of deproteinized
13
sample was combined with 20 µL of C myristic acid (Cambridge Isotopes, Andover,
MA, USA) as an internal standard before extraction with 800 µL methanol. Extracts
were dried and samples were methoximized using 60 µL of methoxamine hydrochloride
(20 mg/mL in pyridine) for 17 hours at room temperature prior to silylation with 60 µL
of N-methyl-N-(trimethylsilyl)trifluoroacetamide with 1% trimethylchlorosilane for 1
124
hour. Samples were diluted with 200 µL of hexane and analysed by gas chromatography
mass spectrometry (GC/MS). The GC/MS system was comprised of an Agilent 7890A
GC coupled with a 5975C MS. The GC temperature was initially 70 °C for 2 min,
increased by 5 °C/min to 260 °C, held for 41 min and finally raised to 320 °C by 30
°C/min and held for 3 min. After a solvent delay of 1 min full scan, mass spectra were
recorded within a scan range of 45-650 atomic mass units (amu) at 2 scans/second.
Calibration was achieved by comparison of peak areas for amino acids and fatty acids
with known reference standards (Amino acid standard A9906 and Supelco 37
component FAME mix, Sigma Aldrich, Ireland) using Agilent Chemstation (MSD
E.02.00.493) and by comparison of their mass spectra with those in the National
Institute of Standards and Technology (NIST) Library 2.0 (2005). For quality control
purposes, one aliquot from a pool of follicular fluid/serum was extracted and analysed
in parallel with each batch of samples.
Automatic peak detection was carried out with Agilent Chemstation MSD. Mass
spectra deconvolution was performed with Automated Mass Spectral Deconvolution
and Identification System (AMDIS, version 2.65). Peaks with a signal-to-noise (S/N)
ratio lower than 30 were rejected, which is an acceptable level to avoid false positives as
reported by Norli et al. (2010). To obtain accurate peak areas for the internal standard
and specific peaks/compounds, one quant mass for each peak was specified as the target
ion and three masses were selected as qualifier ions. Each data file was manually
analysed for false positives/negatives in Agilent Chemstation.
Fatty acids are reported as a percentage of the total fatty acid concentration.
Amino acid concentrations are reported as µmol/mL. Total saturated fatty acid (SFA)
fraction, total monounsaturated fatty acid (MUFA) fraction and total polyunsaturated
fatty acid (PUFA) fraction, indices of desaturase enzyme activity in C16 fatty acids (∆9-
desat (16)) and in C18 fatty acids (∆9-desat (18)), and elongase enzyme activity in chain
lengthening from C16 to C18 fatty acids were calculated using previously published
equations (Malau-Aduli et al., 1998).
5.4.11 Statistical Analysis

All data were statistically analysed using SAS (SAS Institute, 2006). Data were checked
for normality. Appropriate Box-Cox transformations were identified to normalize the
distribution of data where necessary. Mixed model procedures with genotype as a fixed
125
effect and cow nested within genotype as a random effect were used. Parity, calving
date, block, lactation status (lactating or non-lactating), synchronization status (oestrous
cycle synchronized or not synchronized), follicle status (oestrogenic or not oestrogenic;
determined by follicular fluid E2:P4 ratio) and the interaction of parity with genotype
were included as fixed effects initially, but removed if not significant (P > 0.1). Effects
were deemed significant if P ≤ 0.05 and tending to be significant if P ≤ 0.1. The
inclusion of lactating and non-lactating cows in the study allowed the effect of lactation
status to be tested.
Receiver operating characteristic (ROC) curve analysis was performed on the

fatty acid and amino acid data, separately and in combination, using the ROCCET:
ROC Curve Explorer & Tester software (www.roccet.ca). ROC curves are generally
considered the method of choice for evaluating the performance of potential biomarkers
(Xia et al., 2013). The classification performance (sensitivity and specificity) of the
samples was assessed by the area under the curve (AUC) as follows: 0.9-1.0 =
excellent; 0.8-0.9 = good; 0.7-0.8 = fair; 0.6-0.7 = poor; and 0.5-0.6 = fail (Xia et al.,
2013).
126
5.5 Results
5.5.1 General Characteristics of the Cows and the Largest Follicle

There was no effect of genotype on milk yield (mean = 29.8 kg/day; P = 0.9), milk
solids yield (mean = 2.28 kg/day; P = 0.4), body weight (mean = 610 kg; P = 0.9) and
body condition score (mean = 2.75 units; P = 0.4). Follicle diameter was greater in Fert-
cows compared with Fert+ cows (P = 0.03), but there was no effect of genotype on
follicle blood flow area (Table 5.3). Follicular fluid E2 concentrations tended to be
greater in Fert+ cows (P = 0.09) compared with Fert- cows. Follicular fluid P4
concentrations, E2:P4 ratio and cholesterol concentrations were similar in both
genotypes (all P > 0.6). It was not possible to determine the E2, P4 and cholesterol
concentrations in all follicular fluid samples due to the initial volume of follicular fluid
collected.
127
Table 5.3. The effect of genetic merit for fertility on characteristics of the largest follicle on
day 7 of the oestrous cycle
Genotype
Variable Fert+ (n) Fert- (n) SEM1 P-value
Diameter (mm) 13.25 (18) 15.05 (16) 0.7 0.03
Blood flow area (cm2) 0.19 (17) 0.21 (16) 0.03 0.61
Estradiol concentration (pg/mL) 3.83 (13) 2.95 (8) 0.47 0.09
Progesterone concentration (ng/mL) 0.61 (12) 0.64 (6) 0.08 0.87
Estradiol/progesterone ratio 6.80 (12) 6.09 (6) 1.19 0.61
Cholesterol concentration (mmol/L) 1.39 (13) 1.32 (6) 0.11 0.69
1
128
5.5.2 Fatty Acid Profiles
5.5.2.1 Composition of Follicular Fluid
A total of 27 fatty acids were identified in the follicular fluid (Table 5.4). The mean
total fatty acid concentration in follicular fluid samples was 810 µg/mL and was similar
in both genotypes (P = 0.3). Genetic merit for fertility affected four SFA (arachidic acid,
heneicosanoic acid, myristic acid and behenic acid), four MUFA (myristoleic acid,
heptadecenoic acid, cis-11- eicosanoic acid and nervonic acid) and one PUFA (γ-
linolenic acid), all of which were greater in Fert- cows compared with Fert+ cows. The
seven fatty acids significantly affected by genotype accounted for 1.7% of the total fatty
acid content. The five most abundant fatty acids (abundance in parentheses) were
linoleic acid (43%), stearic acid (14%), oleic acid (12%), palmitic acid (11%) and α-
linolenic acid (6%). Collectively, these fatty acids accounted for 86% of the total fatty
acid content, but none were affected by genotype (all P > 0.1). Genetic merit for fertility
had no effect on total SFA, total MUFA and total PUFA.
ROC curve analysis using the fatty acids that were significantly different (P ≤
0.05; Table 5.4) resulted in an AUC of 0.95 (Figure 5.1a) for discriminating between
Fert+ and Fert- cows. This favourable AUC value indicates that these fatty acids had
high predictive ability for fertility genotype.
129
130
Figure 5.1 (a-d): ROC curves produced using (a) significant follicular fluid fatty acids (AUC = 0.95; 95% CI = 0.78 – 1.0) (b) significant
serum fatty acids (AUC = 0.86; 95% CI = 0.61 – 1.0) (c) significant follicular fluid amino acids (AUC = 0.85; 95% CI = 0.65 – 1.0) and (d)
significant serum amino acids (AUC = 0.72; 95% CI = 0.44 – 0.98). ROC: receiver operating characteristic. AUC: area under the curve. CI:
confidence interval
131
Table 5.4. The effect of genetic merit for fertility on the fatty acid composition of follicular fluid.
Values are expressed as percentage of the total fatty acid concentration (%) 1.
Genotype
Variable Fert+ Fert- P-value
n 16 9 -
Myristoleic acid (C14:1) 0.03 (0.03 – 0.05) 0.06 (0.04 – 0.08) 0.005
Myristic acid (C14:0) 0.56 (0.52 – 0.60) 0.62 (0.56 – 0.69) 0.07
Pentadecenoic acid (C15:1) 0.08 (0.07 – 0.10) 0.1 (0.08 – 0.12) NS
Pentadecanoic acid (C15:0) 0.60 (0.56 – 0.65) 0.60 (0.55 – 0.68) NS
Palmitoleic acid (C16:1) 1.85 (1.60 – 2.10) 1.78 (1.45 – 2.13) NS
Palmitic acid (C16:0) 12.09 (11.70 – 12.49) 11.68 (11.21 – 12.15) NS
Heptadecenoic acid (C17:1) 0.53 (0.48 – 0.60) 0.67 (0.59 – 0.75) 0.01
Heptadecanoic acid (C17:0) 0.72 (0.68 – 0.77) 0.76 (0.70 – 0.82) NS
γ-Linolenic acid (C18:3n6) 0.64 (0.52 – 0.76) 1.06 (0.90 – 1.21) 0.0002
Linoleic acid (C18:2n6) 41.81 (40.15 – 43.47) 41.42 (39.46 – 43.38) NS
α-Linolenic acid (C18:3n3) 6.25 (5.76 – 6.74) 6.16 (5.60 – 6.72) NS
Oleic acid (C18:1n9c) 12.13 (11.41 – 12.84) 11.86 (10.78 – 12.94) NS
Stearic acid (C18:0) 14.49 (13.10 – 15.89) 14.34 (13.24 – 15.44) NS
Arachidonic acid (C20:4n6) 2.49 (2.19 – 2.78) 2.55 (2.15 – 2.94) NS
Eicosapentaenoic acid (C20:5n3) 0.97 (0.86 – 1.11) 1.10 (0.93 – 1.33) NS
Dihomo-γ-linolenic acid (C20:3n6) 2.11 (1.90 – 2.29) 2.06 (1.80 – 2.30) NS
cis-Eicosadienoic acid (C20:2) 0.76 (0.69 – 0.86) 0.78 (0.71 – 0.86) NS
cis-11-Eicosanoic acid (C20:1) 0.05 (0.04 – 0.07) 0.13 (0.09 – 0.21) <0.0001
Eicosatrienoic acid (C20:3n3) 0.02 (0.02 – 0.03) 0.01 (0.0007 – 0.03) NS
Arachidic acid (C20:0) 0.06 (0.05 – 0.07) 0.08 (0.07 – 0.09) 0.009
Heneicosanoic acid (C21:0) 0.004 (0.003 – 0.005) 0.008 (0.005 – 0.009) 0.003
Docosahexaenoic acid (C22:6n3) 0.21 (0.16 – 0.30) 0.21 (0.14 – 0.31) NS
Erucic acid (C22:1n9) 0.01 (0.008 – 0.02) 0.02 (0.01 – 0.03) NS
Behenic acid (C22:0) 0.09 (0.07 – 0.1) 0.11 (0.09 – 0.14) 0.09
Tricosanoic acid (C23:0) 0.18 (0.17 – 0.20) 0.17 (0.16 – 0.20) NS
Nervonic acid (C24:1) 0.08 (0.07 – 0.09) 0.11 (0.09 – 0.13) 0.006
Lignoceric acid (24:0) 0.22 (0.17 – 0.26) 0.21 (0.17 – 0.24) NS
132
Genotype
Total SFA 29.03 (27.10 – 30.90) 28.13 (26.43 – 29.83) NS
Total MUFA 14.91 (14.16 – 15.66) 14.89 (13.75 – 16.03) NS
Total PUFA 57.04 (54.79 – 59.29) 56.58 (54.81 – 58.36) NS
(n-3)PUFA 7.21 (6.70 – 7.72) 7.64 (6.96 – 8.32) NS
(n-6)PUFA 47.54 (45.90 – 49.18) 47.50 (45.57 – 49.43) NS
(n-6):(n-3)PUFA ratio 7.10 (6.46 – 7.73) 6.43 (5.58 – 7.28) NS
PUFA:SFA ratio 2.03 (1.85 – 2.22) 2.04 (1.89 – 2.19) NS
9
∆ -desaturase (16) 14.17 (12.31 – 16.03) 14.84 (12.02 – 17.66) NS
∆9-desaturase (18) 49.52 (44.14 – 54.90) 46.64 (43.09 – 50.19) NS
Elongase 66.01 (64.84 – 67.17) 66.25 (64.88 – 67.63) NS
SFA = saturated fatty acid; MUFA = monounsaturated fatty acid; PUFA = Polyunsaturated fatty acid;
(n-3)PUFA = ∑(C18:3n3 + C20:5n3 + C20:3n3 + C22:6n3). (n-6)PUFA = ∑(C18:3n6 + C18:2n6 +
C20:4n6 + C20:3n6)
C16:1
∆9-desaturase (16) = index of desaturase activity in C16 fatty acids 100 × (C16:1+C16:0).
C18:1n9
∆9-desaturase (18) = index of desaturase activity in C18 fatty acids 100 × (C18:1n9+C18:0).
Elongase = index of elongase index activity in chain lengthening of C16-C18 fatty acids 100 ×
C18:1n9+C18:0
((C16:1+C16:0+C18:1n9+C18:0)).
1
133
5.5.2.2 Composition of Serum
A total of 27 fatty acids were identified in serum (Table 5.5). The mean total fatty acid
concentration in follicular fluid samples was 2757 µg/mL and was similar in both
genotypes (P = 0.5). Genetic merit for fertility affected two SFA (palmitic acid and
heneicosanoic acid), three MUFA (pentadecenoic acid, heptadecenoic acid and nervonic
acid) and four PUFA (linoleic acid, γ-linolenic acid, dihomo-γ-linolenic acid and cis-
eicosadienoic acid). The abundance of palmitic acid and nervonic acid was greater in
Fert- cows, but the abundance of the five other fatty acids was greater in Fert+ cows.
The five most abundant fatty acids (abundance in parentheses) were linoleic acid (37%),
oleic acid (21%), stearic acid (12%), palmitic acid (12%) and α-linolenic acid (5%),
which collectively accounted for 89% of the total fatty acid content. The fatty acids that
were significantly affected by genotype accounted for 49% of the total fatty acid
content. The proportion of fatty acids classified as saturated was greater in Fert- cows
compared with Fert+ cows (P = 0.03). The proportion of fatty acids classified as
polyunsaturated was greater in Fert+ cows compared with Fert- cows (P = 0.01); this
was due to a greater proportions of n-6 PUFA (P = 0.04) rather than n-3 PUFA. The
PUFA:SFA ratio (P = 0.02) was greater in Fert+ cows compared with Fert- cows, as
was the ∆9-desaturase activity in C16 fatty acids (P = 0.0005).
ROC curve analysis using the fatty acids that were significantly different (P ≤
0.05; Table 5.5) resulted in an AUC of 0.86 (Figure 5.1b) for discriminating between
Fert+ and Fert- cows. This favourable AUC value indicates that these fatty acids had
high predictive ability for fertility genotype.
134
Table 5.5. The effect of genetic merit for fertility on the fatty acid composition of serum. Values are
expressed as percentage of the total fatty acid concentration (%)1.
Genotype
n 17 17 -
Myristoleic acid (C14:1) 0.14 (0.11 – 0.18) 0.14 (0.11 – 0.18) NS
Myristic acid (C14:0) 1.59 (1.18 – 2.00) 1.87 (1.48 – 2.27) NS
Pentadecenoic acid (C15:1) 0.11 (0.09 – 0.13) 0.08 (0.07 – 0.09) 0.02
Pentadecanoic acid (C15:0) 0.43 (0.34 – 0.56) 0.53 90.41 – 0.71) NS
Palmitoleic acid (C16:1) 1.35 (1.07 – 1.71) 1.17 (0.95 – 1.45) NS
Palmitic acid (C16:0) 9.94 (7.43 – 12.45) 13.84 (11.40 – 16.31) 0.01
Heptadecenoic acid (C17:1) 0.59 (0.48 – 0.70) 0.46 (0.35 – 0.57) 0.09
Heptadecanoic acid (C17:0) 0.89 (0.73 – 1.06) 1.02 (0.86 – 1.19) NS
γ-Linolenic acid (C18:3n6) 0.51 (0.4 – 0.64) 0.25 (0.18 – 0.32) 0.0007
Linoleic acid (C18:2n6) 45.67 (37.44 – 59.77) 37.98 (33.70 – 43.78) 0.03
α- Linolenic acid (C18:3n3) 5.95 (4.57 – 7.70) 4.57 (3.53 – 5.87) NS
Oleic acid (C18:1n9c) 20.12 (17.09 – 23.15) 21.60 (18.57 – 24.63) NS
Stearic acid (C18:0) 9.57 (6.42 – 12.71) 10.57 (7.90 – 13.15) NS
Arachidonic acid (C20:4n6) 2.44 (1.92 – 2.96) 2.85 (2.32 – 3.37) NS
Eicosapentaenoic acid (C20:5n3) 0.7 (0.51 – 0.96) 0.54 (0.39 – 0.75) NS
Dihomo-γ-linolenic acid (C20:3n6) 1.99 (1.52 – 2.62) 1.55 91.22 – 1.96) 0.07
cis-Eicosadienoic acid (C20:2) 0.48 (0.41 – 0.55) 0.39 (0.32 – 0.47) 0.10
cis-11-Eicosanoic acid (C20:1) 0.12 (0.10 – 0.16) 0.12 (0.09 – 0.15) NS
Eicosatrienoic acid (C20:3n3) 0.04 (0.03 – 0.04) 0.04 (0.03 – 0.04) NS
Arachidic acid (C20:0) 0.13 (0.10 – 0.16) 0.13 (0.10 – 0.16) NS
Heneicosanoic acid (C21:0) 0.01 (0.006 – 0.02) 0.005 (0.004 – 0.008) 0.007
Docosahexaenoic acid (C22:6n3) 0.08 (0.06 – 0.09) 0.06 (0.05 – 0.08) NS
Erucic acid (C22:1n9) 0.17 (0.13 – 0.21) 0.19 (0.15 – 0.23) NS
Behenic acid (C22:0) 0.21 (0.17 – 0.27) 0.23 (0.19 – 0.3) NS
Tricosanoic acid (C23:0) 0.23 (0.18 – 0.29) 0.27 (0.22 – 0.32) NS
Nervonic acid (C24:1) 0.09 (0.07 – 0.12) 0.15 (0.12 – 0.19) 0.005
Lignoceric acid (24:0) 0.13 (0.11 – 0.16) 0.14 (0.12 – 0.17) NS
135
Genotype
Total SFA 23.68 (18.95 – 28.41) 29.71 (25.06 – 34.35) 0.03
Total MUFA 17.52 (11.99 – 23.05) 19.69 (15.08 – 24.31) NS
Total PUFA 57.79 (52.02 – 63.57) 51.80 (46.95 – 56.66) 0.01
(n-3)PUFA 6.47 (5.35 – 7.59) 5.25 (4.12 – 6.37) NS
(n-6)PUFA 51.83 (45.28 – 58.37) 46.13 (41.38 – 50.88) 0.04
(n-6):(n-3)PUFA ratio 5.95 (4.81 – 7.55) 6.69 (5.40 – 8.49) NS
PUFA:SFA ratio 3.02 (2.21 – 3.83) 2.19 (1.53 – 2.85) 0.02
∆9-desaturase (16) 12.02 (10.25 – 13.79) 7.90 (6.21 – 9.60) 0.0005
∆9-desaturase (18) 58.95 (53.20 – 64.71) 61.26 (55.74 – 66.78) NS
Elongase 72.20 (68.44 – 75.96) 70.07 (66.32 – 73.83) NS
(n-3)PUFA = ∑(C18:3n3 + C20:5n3 + C20:3n3 + C22:6n3). (n-6)PUFA = ∑(C18:3n6 + C18:2n6 +
C20:4n6 + C20:3n6)
C16:1
∆9-desaturase (16) = index of desaturase activity in C16 fatty acids 100 × (C16:1+C16:0).
C18:1n9
∆9-desaturase (18) = index of desaturase activity in C18 fatty acids 100 × (C18:1n9+C18:0).
Elongase = index of elongase index activity in chain lengthening of C16-C18 fatty acids 100 ×
C18:1n9+C18:0
((C16:1+C16:0+C18:1n9+C18:0)).
1
136
5.5.3 Amino Acid Profiles
5.5.3.1 Composition of Follicular Fluid
A total of 18 amino acids were identified in follicular fluid (Table 5.6). Genetic merit
for fertility affected the concentrations of five amino acids. The concentrations of
cysteine, leucine and ornithine were greater whereas the concentrations of tyrosine were
lower and the concentrations of proline tended to be lower in Fert+ cows compared with
Fert- cows. The five most abundant amino acids (abundance in parentheses) were
alanine (16%), proline (12%), threonine (12%), valine (11%) and glutamine (10%),
which collectively accounted for 61% of the total amino acid content.
ROC curve analysis using the amino acid metabolites that were significantly
different (P ≤ 0.05; Table 5.6) resulted in an AUC of 0.85 (Figure 5.1c) for
discriminating between Fert+ and Fert- cows. This favourable AUC value indicates that
these amino acids had high predictive ability for fertility genotype.
137
Table 5.6. The effect of genetic merit for fertility on the amino acid composition
of follicular fluid.
Genotype
n 13 11 -
Alanine 0.82 (0.71 – 0.91) 0.88 (0.76 – 0.97) NS
Asparagine 0.07 (0.04 – 0.12) 0.06 (0.03 – 0.10) NS
Aspartic acid 0.01 (0.002 – 0.03) 0.03 (0.004 – 0.08) NS
Creatinine 0.05 (0.03 – 0.07) 0.04 (0.02 – 0.06) NS
Cysteine 0.07 (0.05 – 0.09) 0.04 (0.03 – 0.06) 0.03
Glutamine 0.53 (0.37 – 0.68) 0.58 (0.40 – 0.75) NS
Glycine 0.42 (0.38 – 0.51) 0.36 (0.25 – 0.46) NS
Isoleucine 0.33 (0.24 – 0.43) 0.22 (0.11 – 0.33) NS
Leucine 0.53 (0.38 – 0.68) 0.22 (0.06 – 0.39) 0.009
Lysine 0.05 (0.04 – 0.07) 0.07 (0.05 – 0.08) NS
Methionine 0.03 (0.23 – 0.05) 0.04 (0.03 – 0.06) NS
Ornithine 0.08 (0.05 – 0.14) 0.02 (0.01 – 0.04) < 0.0001
Phenylalanine 0.27 (0.20 – 0.38) 0.46 (0.29 – 0.78) NS
Proline 0.57 (0.38 – 0.75) 0.80 (0.60 – 1.00) 0.09
Serine 0.39 (0.22 – 0.57) 0.37 (0.13 – 0.62) NS
Threonine 0.94 (0.74 – 1.14) 0.79 (0.63 – 0.95) NS
Tyrosine 0.01 (0.005 – 0.03) 0.04 (0.03 – 0.05) 0.005
Valine 0.73 (0.22 – 1.92) 0.28 (0.10 – 0.63) NS
1
= data presented as LSM (µmol/mL) with 95% CI in parentheses
138
5.5.3.2 Composition of Serum
A total of 18 amino acids were identified in serum (Table 5.7). Genetic merit for
fertility affected the concentrations of six amino acids: creatinine, cysteine, methionine,
proline and valine were greater in Fert+ cows compared with Fert- cows and the
concentrations of asparagine tended to be greater in Fert- cows compared with Fert+
cows. The five most abundant amino acids (abundance in parentheses) were alanine
(15%), proline (14%), valine (12%), glycine (10%) and leucine (9%), which collectively
accounted for 60% of the total amino acid content.
ROC curve analysis using the amino acid metabolites that were significantly
different (P ≤ 0.05; Table 5.7) resulted in a low AUC value of 0.72 (Figure 5.1d). This
AUC value indicates that these amino acids had poor predictive ability for fertility
genotype.
139
Table 5.7. The effect of genetic merit for fertility on the amino acid
composition of serum. Values are reported as means (µmol/ml)1.
Genotype
n 16 16 -
Alanine 0.64 (0.57 – 0.71) 0.67 (0.58 – 0.76) NS
Asparagine 0.06 (0.04 – 0.09) 0.09 (0.07 – 0.12) 0.08
Aspartic acid 0.07 (0.05 – 0.11) 0.05 (0.04 – 0.08) NS
Creatinine 0.05 (0.04 – 0.07) 0.03 (0.02 – 0.04) 0.02
Cysteine 0.05 (0.04 – 0.06) 0.02 (0.006 – 0.03) 0.003
Glutamine 0.52 (0.28 – 0.91) 0.50 (0.29 – 0.83) NS
Glycine 0.41 (0.33 – 0.52) 0.31 (0.24 – 0.40) NS
Isoleucine 0.35 (0.29 – 0.42) 0.30 (0.24 – 0.37) NS
Leucine 0.38 (0.29 – 0.46) 0.28 (0.17 – 0.38) NS
Lysine 0.05 (0.04 – 0.07) 0.05 (0.03 – 0.07) NS
Methionine 0.05 (0.04 – 0.07) 0.04 (0.03 – 0.05) 0.05
Ornithine 0.02 (0.01 – 0.03) 0.01 (0.009 – 0.02) NS
Phenylalanine 0.12 (0.09 – 0.16) 0.12 (0.09 – 0.15) NS
Proline 0.87 (0.60 – 1.14) 0.65 (0.44 – 0.86) 0.04
Serine 0.31 (0.23 – 0.38) 0.27 (0.17 – 0.36) NS
Threonine 0.37 (0.26 – 0.47) 0.29 (0.16 – 0.43) NS
Tyrosine 0.04 (0.03 – 0.05) 0.03 (0.02 – 0.05) NS
Valine 0.46 (0.39 – 0.54) 0.35 (0.26 – 0.43) 0.01
1
= data presented as LSM (µmol/mL) with 95% CI in parentheses
140
5.6 Discussion
This study reports on the effect of genetic merit for fertility on the fatty acid and amino
acid profile of follicular fluid and serum collected from lactating and non-lactating
Holstein dairy cows on day 7 of a synchronized oestrous cycle. That lactation status did
not affect the variables examined in this study indicates that the metabolite profile of
follicular fluid and serum is not dependent on lactation status. The differences identified
may represent potential biomarkers of fertility.
Follicular fluid proportions of total SFA, total PUFA and total MUFA were not
affected by genotype; however, alterations to seven low-abundance fatty acids may
reflect small but important differences to the follicular microenvironment. In serum,
greater proportions of total PUFA and n-6 PUFA in Fert+ cows and a greater proportion
of total SFA in Fert- cows represented the most pronounced effect of genotype in the
current study. In agreement with the findings of Bender et al. (2010) and Aardema et al.
(2015) the fatty acid and amino acid profiles were unique to follicular fluid and to
serum, suggesting local control of the follicular microenvironment. Of the fatty acids
that were affected by genotype in both follicular fluid and serum, only nervonic acid
had a similar trend in both matrices (i.e., greater in Fert- cows compared with Fert+
cows). Conversely, heptadecenoic acid, γ-linolenic acid and heneicosanoic acid had
opposite trends in follicular fluid and serum (i.e., greater in serum and lesser in
follicular fluid, or vice versa).
Previous studies have identified potential metabolite biomarkers of fertility in

follicular fluid or serum using various models to represent high and low fertility in
cattle or humans (Zeron et al., 2001, Bender et al., 2010, Matoba et al., 2014). It needs
to be acknowledged, however, that differences in the fertility models investigated, the
diets being fed, and seasonal variation make direct comparisons between studies
difficult. While the models used were very diverse, a trend emerges from the
comparison across the studies. Of particular note is the increase in SFA in poorer
fertility models (Tables 5.8 and 5.9). Our study is the first to report on a model where
all animals were exposed to the same environment, with identical management,
nutrition and health protocols. Hence, any differences identified were due solely to
differences in genetic merit for fertility between Fert+ and Fert- cows.
141
Table 5.8. Comparison of significant differences in follicular fluid and serum fatty acid concentrations across five studies
Fatty acid Current study Bender1 Zeron2 Matoba3 O'Gorman4
C14:1 FF 100% ↑ Nd nd nd
‡
C14:0 FF 11% ↑ FF 95% ↑; S 45%↑ Nd S nd S nd
C15:1 S 38% ↓ Nd S nd nd
C16:1 FF 222% ↑ FF 213% ↑; S nd S nd nd
C16:0 S 39% ↑ FF 73% ↑ FF 35% ↑; S nd FF 44% ↑; S na FF 38% ↑; S nd
‡
C17:1 FF 26% ↑; S 28% ↓ Nd S nd nd
C18:3n6 FF 66% ↑; S 104% ↓ FF 130% ↑; S 119% ↑ S nd S nd S nd
C18:2n6 S 20% ↓ FF 359% ↑; S 189% ↑ S nd S nd S nd
C18:3n3 FF 101% ↑; S 67% ↑ S nd FF 77% ↓; S nd S nd
C18:1n9 FF 141% ↑ S nd S nd S nd
C18:0 FF 73% ↑ FF 272% ↓; S nd S nd FF 26% ↓; S nd
C20:4n6 FF 63% ↓; S nd S nd FF 28% ↓; S nd
C20:5n3 FF 350% ↓; S nd S nd S nd
‡
C20:3n6 S 28% ↓ FF 63% ↑; S 92%↑ S nd S nd FF 35% ↓; S nd
‡
C20:2 S 23% ↓ FF 259% ↑; S 30% ↑ S nd S nd S nd
C20:1 FF 160% ↓ FF 136% ↑; S 63% ↑ FF 400% ↓; S nd nd S nd
C20:0 FF 33% ↑ Nd S nd FF 58% ↓; S nd
C21:0 FF 50% ↑; S 50% ↓ Nd nd nd
C22:6n3 FF 138%↑; S 220%↑ FF 350% ↓; S nd S nd FF 96% ↓;S nd
C22:1n9 FF 112% ↑ Nd nd FF 67% ↑; S nd
‡
C22:0 FF 22% ↑ FF 132% ↑ Nd nd S nd
C23:0 FF 140% ↑; S 823% ↑ Nd nd FF 50% ↑; S na
C24:1 FF 38% ↑; S 66% ↑ Nd nd nd
C24:0 Nd nd FF 103% ↑; S nd
142
Fatty acid Current study Bender1 Zeron2 Matoba3 O'Gorman4
Total SFA S 25% ↑ FF74% ↑ Nd FF 42% ↑; S nd FF 19% ↑; S nd
Total MUFA FF 140% ↑ Nd S nd S nd
Total PUFA S 12% ↓ FF215% ↑; S 123%↑ Nd S nd FF 29% ↓; S nd
(n-3)PUFA FF 51% ↑ Nd S nd FF 81% ↓; S nd
(n-6)PUFA S 12% ↓ FF 287% ↑; S 161%↑ Nd S nd S nd
(n-6):(n-3) PUFA ratio FF 139% ↑; S116% ↑ Nd S nd FF 43% ↑; S nd
1
= Current study; Fert- cows relative to Fert+ cows
2
= (Bender et al., 2010); Lactating cows relative to non-lactating heifers
3
= (Zeron et al., 2001); Summer season relative to winter season
4
= (Matoba et al., 2014); Degenerate embryos relative to blastocyst embryos
5
= (O'Gorman et al., 2013); Non-cleaved embryos relative to cleaved embryos
‡
= P ≤ 0.1
(n-3)PUFA = ∑(C18:3n3 + C20:5n3 + C20:3n3 + C22:6n3). (n-6)PUFA = ∑(C18:3n6 + C18:2n6 + C20:4n6 + C20:3n6)
FF = follicular fluid
S = serum
nd = Follicular fluid or serum fatty acid concentrations not determined in study
S nd = Serum fatty acid concentration not determined in study
143
Table 5.9. Comparison of significant differences in follicular fluid and serum
amino acid concentrations across three studies
Amino acid Current study1 Bender2 Matoba3
Alanine FF 75% ↓; S nd FF 54% ↓
Asparagine S 50% ↑ nd nd
Creatinine S 66% ↓ nd nd
Cysteine FF 75% ↓; S 75% ↓ nd S nd
Glycine FF 71% ↑ FF 83% ↓
Glutamate nd FF 73% ↓
Glutamine FF 110% ↑
Leucine FF 141% ↓ nd S nd
Methionine S 20 ↓ nd S nd
Ornithine FF 300% ↓ nd nd
Proline FF 40% ↑; S 34% ↓ nd S nd
Tyrosine FF 2700% ↑ nd S nd
Valine S 31% ↓ nd S nd
1
= Current study; Fert- cows relative to Fert+ cows
2
= (Bender et al., 2010); Lactating cows relative to non-lactating heifers
3
= (Matoba et al., 2014); Degenerate embryos relative to blastocyst embryos
FF = Follicular fluid
nd = Follicular fluid or serum amino acid concentrations not determined in study
S nd = Serum amino acid concentration not determined in study
144
5.6.1 Characteristics of Fatty Acid Profiles
In follicular fluid, the proportion of myristic acid, behenic acid and γ-linolenic acid
were greater or tended to be greater in Fert- cows compared with Fert+ cows. These
fatty acids were previously associated with poor fertility by Bender et al. (2010). cis-11-
eicosanoic acid was greater in Fert+ cows compared with Fert- cows and was greater in
follicular fluid collected in winter compared with summer (Zeron et al., 2001). Greater
follicular fluid proportions of total saturated fatty acid, palmitic acid and palmitoleic
acid have previously been documented in low fertility models (Zeron et al., 2001,
Bender et al., 2010, O'Gorman et al., 2013, Matoba et al., 2014), but these fatty acids
and fatty acid categories were not different in the current study.
Four serum fatty acids or fatty acid categories were significantly associated with
fertility in the current study. These were also previously reported by Bender et al.
(2010) (total PUFA, n-6 PUFA, γ-linolenic acid and linoleic acid) but the direction of
the relationship was completely reversed. This is likely due to: (i) the fundamental
differences in the design of the fertility models; and (ii) the variation in lactation status,
parity, diet and dry matter intake that existed between the lactating cows and non-
lactating heifers reported in Bender et al. (2010). There is some disagreement in the
literature on the effect of supplementary linoleic acid on fertility. Fouladi-Nashta et al.
(2009) reported that changes in dietary intake of fatty acids was reflected in plasma and
milk of lactating dairy cows, but fatty acids in granulosa cells were not affected,
concluding that the ovary has the ability to buffer against major fluctuations in
circulating fatty acids. In response to dietary supplementation of cows with calcium
salts of linoleic and trans-octadecenoic acid, Juchem et al. (2010) reported greater
prostaglandin F2α metabolite concentrations on day one postpartum in primiparous cows
and greater pregnancy rates in primi- and multi-parous cows. Cerri et al. (2009) reported
greater fertilization rates, greater embryo quality and greater numbers of accessory
sperm. Bilby et al. (2006) reported that cows supplemented with calcium salts of palm
and soybean oil enriched with linoleic acid had no effect on oocyte quality but
preovulatory follicle diameter and subsequent corpus luteum volume were greater. In
contrast, Marei et al. (2010) reported negative consequences on oocyte maturation in
vitro.
The serum proportions of pentadecenoic acid, heptadecenoic acid and

heneicosanoic acid were greater in Fert+ cows compared with Fert- cows, but nervonic
145
acid proportions were greater in Fert- cows. These fatty acids are a mixture of SFA and
MUFA. They are lowly-abundant fatty acids in serum, and also lowly abundant in the
diet of grazing or silage-fed cows (Mohammed et al., 2010). The mechanism
responsible for these differences between Fert+ and Fert- cows is unclear, as is their
potential involvement in reproductive function. Serum proportions of palmitic acid and
total SFA were greater in Fert- cows compared with Fert+ cows. Palmitic acid is a
major component of the mobilized NEFA fraction that is associated with compromised
oocyte health in lactating dairy cows (Leroy et al., 2005). In the current study, Fert+
cows tended to have greater dry matter intake compared with Fert- cows (Moore et al.,
2014). Greater palmitic acid concentrations in Fert- cows may be explained by slower
passage rate through the rumen, allowing greater opportunity for biohydrogenation of
palmitoleic acid to palmitic acid (Loften et al., 2014).
5.6.2 Characteristics of Amino Acid Profiles

Follicular fluid concentrations of leucine and cysteine were greater in Fert+ cows
compared with Fert- cows. Positive associations between leucine concentrations and
fertility have been reported in relation to in vitro maturation of oocytes (Hemmings et
al., 2012) and development of embryos cultured in vitro (Rooke et al., 2009). Follicular
fluid concentrations of proline tended to be 40% greater and tyrosine was 300% greater
in Fert- cows compared with Fert+ cows, respectively, but to our knowledge have not
previously been associated with fertility.
Serum concentrations of cysteine and methionine were greater in Fert+ cows

compared with Fert- cows. Positive associations between cysteine and fertility have
been reported in relation to sperm function (Sarıözkan et al., 2009) and development of
embryos cultured in vitro (Lott et al., 2011, Nabenishi et al., 2012). Also, methionine
has been linked with alterations to immune function. Supplementation of dairy cows
with methionine during the transition period increased the phagocytosis capability of
blood neutrophils at day 21 postpartum (Osorio et al., 2013). Supplementation of dairy
cows with methionine from calving until around day 70 postpartum resulted in altered
gene expression in embryos associated with early embryo development and innate and
adaptive immune response (Peñagaricano et al., 2013).
146
5.6.3 Ability of Metabolites to Predict Fertility Genotype
The results of the ROC curve analysis indicated that the follicular fluid fatty acids
achieved the most accurate classification of fertility genotype. Nevertheless, serum fatty
acids also achieved a high AUC, and may be sufficient for determination of fertility
status; serum has the considerable benefit of being easier to obtain than follicular fluid.
Metabolomics-based approaches have previously identified panels of candidate
biomarkers for the authentication of different beef production systems (Osorio et al.,
2012) or prediction of disease occurrence during the transition period of dairy cows
(Hailemariam et al., 2014). The Fert+/Fert- animal model used in this study consisted of
a small number of animals that were representative of extremes in genetic merit for
fertility in the Irish national herd. Additional studies are required to independently
validate the association between these metabolites with dairy cow fertility.
5.7 Conclusions
Alterations to the fatty acid and amino acid metabolome in serum and follicular fluid
reflect the physiological status of dairy cows, with favourable and unfavourable
consequences for their health and fertility. We identified alterations to fatty acids and
amino acids in follicular fluid and serum that may explain, at least in part, the
differences in reproductive performance reported in this genetic model. These
biomarkers were highly predictive of the fertility genotype of the dairy cows used in the
study, but they must be validated in an independent population.
147
5.8 References
Aardema, H., B. M. Gadella, C. H. A. van de Lest, J. F. H. M. Brouwers, T. A. E. Stout,

B. A. J. Roelen, and P. L. A. M. Vos. 2015. Free fatty acid levels in fluid of
dominant follicles at the preferred insemination time in dairy cows are not
affected by early postpartum fatty acid stress. Journal of Dairy Science
98(4):2322-2336.
Aardema, H., P. L. A. M. Vos, F. Lolicato, B. A. J. Roelen, H. M. Knijn, A. B.
Vaandrager, J. B. Helms, and B. M. Gadella. 2011. Oleic Acid Prevents
Detrimental Effects of Saturated Fatty Acids on Bovine Oocyte Developmental
Competence. Biology of Reproduction 85(1):62-69.
Ambrose, J. D., M. Drost, R. L. Monson, J. J. Rutledge, M. L. Leibfried-Rutledge, M. J.
Thatcher, T. Kassa, M. Binelli, P. J. Hansen, P. J. Chenoweth, and W. W.
Thatcher. 1999. Efficacy of Timed Embryo Transfer with Fresh and Frozen In
Vitro Produced Embryos to Increase Pregnancy Rates in Heat-Stressed Dairy
Cattle. Journal of Dairy Science 82(11):2369-2376.
Bender, K., S. Walsh, A. C. O. Evans, T. Fair, and L. Brennan. 2010. Metabolite
concentrations in follicular fluid may explain differences in fertility between
heifers and lactating cows. Reproduction 139(6):1047-1055.
Bilby, T. R., J. Block, B. C. do Amaral, O. Sa Filho, F. T. Silvestre, P. J. Hansen, C. R.
Staples, and W. W. Thatcher. 2006. Effects of Dietary Unsaturated Fatty Acids on
Oocyte Quality and Follicular Development in Lactating Dairy Cows in Summer.
Bligh, E. G. and W. J. Dyer. 1959. A Rapid Method of Total Lipid Extraction and
Purification. Canadian Journal of Biochemistry and Physiology 37(8):911-917.
Bols, P. E. J., J. M. M. Vandenheede, A. Van Soom, and A. de Kruif. 1995.
Transvaginal ovum pick-up (OPU) in the cow: A new disposable needle guidance
system. Theriogenology 43(3):677-687.
Cerri, R. L. A., S. O. Juchem, R. C. Chebel, H. M. Rutigliano, R. G. S. Bruno, K. N.
Galvao, W. W. Thatcher, and J. E. P. Santos. 2009. Effect of fat source differing
in fatty acid profile on metabolic parameters, fertilization, and embryo quality in
high-producing dairy cows. Journal of Dairy Science 92(4):1520-1531.
Butler. 2012. Genetic merit for fertility traits in Holstein cows: I. Production
148
Demyda-Peyrás, S., J. Dorado, M. Hidalgo, J. Anter, L. De Luca, E. Genero, and M.
Moreno-Millán. 2013. Effects of oocyte quality, incubation time and maturation
environment on the number of chromosomal abnormalities in IVF-derived early
bovine embryos. Reproduction, Fertility and Development 25(7):1077-1084.
72(1):68-78.
Fouladi-Nashta, A. A., K. E. Wonnacott, C. G. Gutierrez, J. G. Gong, K. D. Sinclair, P.
C. Garnsworthy, and R. Webb. 2009. Oocyte quality in lactating dairy cows fed
on high levels of n-3 and n-6 fatty acids. Reproduction 138(5):771-781.
Lamberson, J. N. Spain, M. C. Lucy, and R. S. Youngquist. 2013. Concentrations
of nonesterified fatty acids and glucose in blood of periparturient dairy cows are
indicative of pregnancy success at first insemination. Journal of Dairy Science
96(1):181-188.
Gu, L., H. Liu, X. Gu, C. Boots, K. Moley, and Q. Wang. 2015. Metabolic control of
oocyte development: linking maternal nutrition and reproductive outcomes. Cell.
Mol. Life Sci. 72(2):251-271.
Hailemariam, D., R. Mandal, F. Saleem, S. M. Dunn, D. S. Wishart, and B. N. Ametaj.
2014. Identification of predictive biomarkers of disease state in transition dairy
Hemmings, K. E., H. J. Leese, and H. M. Picton. 2012. Amino Acid Turnover by
Bovine Oocytes Provides an Index of Oocyte Developmental Competence In
Vitro. Biology of Reproduction 86(5):165, 161-112.
synchronization treatments on ovarian follicular dynamics, corpus luteum growth,
and circulating steroid hormone concentrations in lactating dairy cows. Journal of
Juchem, S. O., R. L. A. Cerri, M. Villaseñor, K. N. Galvão, R. G. S. Bruno, H. M.
Rutigliano, E. J. DePeters, F. T. Silvestre, W. W. Thatcher, and J. E. P. Santos.
2010. Supplementation with Calcium Salts of Linoleic and trans-Octadecenoic
Acids Improves Fertility of Lactating Dairy Cows. Reproduction in Domestic
Animals 45(1):55-62.
149
Leroy, J. L. M. R., T. Vanholder, B. Mateusen, A. Christophe, G. Opsomer, A. de Kruif,
G. Genicot, and A. Van Soom. 2005. Non-esterified fatty acids in follicular fluid
of dairy cows and their effect on developmental capacity of bovine oocytes in
vitro. Reproduction 130(4):485-495.
Loften, J.R., Linn, J.G., Drackley, J.K., Jenkins, T.C., Soderholm, C.G., and Kertz, A.F.
(2014) Invited review: Palmitic and stearic acid metabolism in lactating dairy
cows. Journal of Dairy Science 97(8), 4661-4674
Lott, W. M., V. M. Anchamparuthy, M. L. McGilliard, I. K. Mullarky, and F. C.
Gwazdauskas. 2011. Influence of Cysteine in Conjunction with Growth Factors
on the Development of In Vitro-Produced Bovine Embryos. Reproduction in
Domestic Animals 46(4):585-594.
Malau-Aduli, A. E., B. D. Siebert, C. D. Bottema, and W. S. Pitchford. 1998. Breed
comparison of the fatty acid composition of muscle phospholipids in Jersey and
Limousin cattle. Journal of Animal Science 76(3):766-773.
Marei, W. F., D. C. Wathes, and A. A. Fouladi-Nashta. 2010. Impact of linoleic acid on
bovine oocyte maturation and embryo development. Reproduction 139(6):979-
988.
Matoba, S., K. Bender, A. G. Fahey, S. Mamo, L. Brennan, P. Lonergan, and T. Fair.
2014. Predictive value of bovine follicular components as markers of oocyte
developmental potential. Reproduction, Fertility and Development 26(2):337-345.
McKeegan, P. J. and R. G. Sturmey. 2011. The role of fatty acids in oocyte and early
embryo development. Reproduction, Fertility and Development 24(1):59-67.
Mohammed, R., J. J. Kennelly, J. K. G. Kramer, K. A. Beauchemin, C. S. Stanton, and
J. J. Murphy. 2010. Effect of grain type and processing method on rumen
fermentation and milk rumenic acid production. Animal 4(08):1425-1444.
Moore, S. G., S. Scully, J. A. Browne, T. Fair, and S. T. Butler. 2014. Genetic merit for
fertility traits in Holstein cows: V. Factors affecting circulating progesterone
concentrations. Journal of Dairy Science 97(9):5543-5557.
Nabenishi, H., H. Ohta, T. Nishimoto, T. Morita, K. Ashizawa, and Y. Tsuzuki. 2012.
The effects of cysteine addition during in vitro maturation on the developmental
competence, ROS, GSH and apoptosis level of bovine oocytes exposed to heat
stress. Zygote 20(03):249-259.
O'Gorman, A., M. Wallace, E. Cottell, M. J. Gibney, F. M. McAuliffe, M. Wingfield,
and L. Brennan. 2013. Metabolic profiling of human follicular fluid identifies
150
potential biomarkers of oocyte developmental competence. Reproduction
146(4):389-395.
Osorio, J. S., P. Ji, J. K. Drackley, D. Luchini, and J. J. Loor. 2013. Supplemental
Smartamine M or MetaSmart during the transition period benefits postpartal cow
performance and blood neutrophil function. Journal of Dairy Science
96(10):6248-6263.
Osorio, M. T., A. P. Moloney, L. Brennan, and F. J. Monahan. 2012. Authentication of
beef production systems using a metabolomic-based approach. animal 6(01):167-
172.
Peñagaricano, F., A. H. Souza, P. D. Carvalho, A. M. Driver, R. Gambra, J. Kropp, K.
S. Hackbart, D. Luchini, R. D. Shaver, M. C. Wiltbank, and H. Khatib. 2013.
Effect of Maternal Methionine Supplementation on the Transcriptome of Bovine
Preimplantation Embryos. Plos One 8(8):e72302.
Putney, D. J., M. Drost, and W. W. Thatcher. 1989. Influence of summer heat stress on
pregnancy rates of lactating dairy cattle following embryo transfer or artificial
insemination. Theriogenology 31(4):765-778.
Rahman, M. B., L. Vandaele, T. Rijsselaere, M. Zhandi, D. Maes, M. Shamsuddin, and
A. Van Soom. 2012. Oocyte quality determines bovine embryo development after
fertilisation with hydrogen peroxide-stressed spermatozoa. Reproduction, Fertility
and Development 24(4):608-618.
Rooke, J. A., A. Ainslie, R. G. Watt, F. M. Alink, T. G. McEvoy, K. D. Sinclair, P. C.
Garnsworthy, and R. Webb. 2009. Dietary carbohydrates and amino acids
influence oocyte quality in dairy heifers. Reproduction, Fertility and Development
21(3):419-427.
Sarıözkan, S., M. N. Bucak, P. B. Tuncer, P. A. Ulutaş, and A. Bilgen. 2009. The
influence of cysteine and taurine on microscopic–oxidative stress parameters and
fertilizing ability of bull semen following cryopreservation. Cryobiology
58(2):134-138.
Sartori, R., R. Sartor-Bergfelt, S. A. Mertens, J. N. Guenther, J. J. Parrish, and M. C.
Wiltbank. 2002. Fertilization and Early Embryonic Development in Heifers and
Lactating Cows in Summer and Lactating and Dry Cows in Winter. Journal of
dairy science 85(11):2803-2812.
Tomek, W., H. Torner, and W. Kanitz. 2002. Comparative Analysis of Protein
Synthesis, Transcription and Cytoplasmic Polyadenylation of mRNA during
151
Maturation of Bovine Oocytes in vitro. Reproduction in Domestic Animals
37(2):86-91.
Van Hoeck, V., J. L. M. R. Leroy, M. Arias Alvarez, D. Rizos, A. Gutierrez-Adan, K.
Schnorbusch, P. E. J. Bols, H. J. Leese, and R. G. Sturmey. 2013. Oocyte
developmental failure in response to elevated nonesterified fatty acid
concentrations: mechanistic insights. Reproduction 145(1):33-44.
Van Hoeck, V., R. G. Sturmey, P. Bermejo-Alvarez, D. Rizos, A. Gutierrez-Adan, H. J.
Leese, P. E. J. Bols, and J. L. M. R. Leroy. 2011. Elevated Non-Esterified Fatty
Acid Concentrations during Bovine Oocyte Maturation Compromise Early
Embryo Physiology. Plos One 6(8):e23183.
Vanholder, T., J. Lmr Leroy, A. Van Soom, D. Maes, M. Coryn, T. Fiers, A. de Kruif,
and G. Opsomer. 2006. Effect of non-esterified fatty acids on bovine theca cell
steroidogenesis and proliferation in vitro. Animal Reproduction Science 92(1-
2):51-63.
Vasconcelos, J. L. M., D. G. B. Demétrio, R. M. Santos, J. R. Chiari, C. A. Rodrigues,
and O. G. S. Filho. 2006. Factors potentially affecting fertility of lactating dairy
cow recipients. Theriogenology 65(1):192-200.
Xia, J., D. I. Broadhurst, M. Wilson, and D. S. Wishart. 2013. Translational biomarker
discovery in clinical metabolomics: an introductory tutorial. Metabolomics
9(2):280-299.
Zeron, Y., A. Ocheretny, O. Kedar, A. Borochov, D. Sklan, and A. Arav. 2001.
Seasonal changes in bovine fertility: relation to developmental competence of
oocytes, membrane properties and fatty acid composition of follicles.
152
Chapter Six
Differentially expressed genes in the

endometrium and corpus luteum of Holstein cows
selected for high and low fertility are enriched for
sequence variants associated with fertility
6.1 Preface
At the time of thesis submission this chapter was in preparation for submission to a
peer-reviewed journal.
Stephen Moore was the primary author and carried out the experimental work,
differential expression analysis, concordance analysis and drafted the manuscript. Matt
McCabe provided training in the techniques for RNA extraction and cDNA library
preparation. Paul Cormican aligned the mRNA sequence data to UMD 3.1 build of the
bovine genome. Donagh Berry performed the fertility genome-wide association study
with the Irish dairy cattle population. Ben Hayes performed the imputation of whole
genome sequence data. Kath Kemper performed the fertility genome-wide association
studies with the Australian dairy cattle population. Stephen Moore, Stephen Butler
Jennie Pryce, Ben Hayes, Amanda Chamberlain, Trudee Fair and Pat Lonergan
conceived, designed and coordinated the study. All authors interpreted the data and
contributed to the manuscript.
153
6.2 Abstract
Despite the importance of fertility in many mammalian species, including humans and
livestock, there has been little success dissecting the genetic basis of this trait, reflecting
a low heritability. In dairy cattle, improved fertility is a key breeding goal and has a
high economic value. The genetic basis of fertility in dairy cattle may also be more
similar to humans than in other model species such as mice, given that both cattle and
humans typically have one, or occasionally two or more, offspring per parturition. In
this study we combine a unique genetic model of fertility (cattle which have been
selected for high and low fertility and show substantial difference in fertility level), with
gene expression data from these cattle, and genome-wide association study results from
imputed whole genome sequence data in more than 20,000 cattle with fertility records,
to identify quantitative trait loci (QTL) regions and sequence variants that are linked to,
and in some cases may be responsible for, genetic variation in fertility. Our hypothesis
was that genes differentially expressed in the endometrium and corpus luteum on day 13
of the oestrous cycle between cows with either good or poor genetic merit for fertility
would be enriched for genetic variants associated with fertility in cattle.
Three hundred and fifty-five QTL regions and 17 sequence variants (P < 10-5)
primarily associated with prostaglandin F2α, steroidogenesis, mRNA-processing and
immune-related processes were identified. Of the 355 QTL regions, 93 were validated
by both Australian and Irish genome-wide association studies using high-density
genotypes, with signals for fertility detected primarily on BTA18, 5, 7, 8 and 29. A
number of plausible causative mutations were identified for follow up studies. These
included one missense variant significantly associated with fertility in EIF4EBP3. The
SIFT value for this variant of 0.01; indicate the amino acid substitution was predicted to
affect its protein function.
The results of this study enhance our understanding of (i) the contribution of the
endometrium and corpus luteum transcriptome to phenotypic fertility differences; and
(ii) the genetic architecture of fertility in a mammalian species with low fecundity. For
dairy cattle, including these variants in predictions of genomic breeding values may
improve the rate of genetic gain for this critical trait.
154
6.3 Introduction
The genetic basis of variation in fertility between individuals is of great interest in
mammals, particularly humans and livestock. While a number of studies have identified
genetic variants affecting male fertility e.g. Kosova et al. (2012), Pausch et al. (2014),
female fertility is more challenging to dissect as the trait has a low heritability and
collection of phenotypes is difficult. One of the first GWAS for human female fertility
was recently published (Aschebrook-Kilfoy et al., 2015).
Dairy cattle are a potential model for dissecting the genetic basis of fertility in
mammals that have one, or occasionally two or more, offspring per parturition, and
gestation times of approximately nine months – fertility phenotypes are routinely
recorded in large volumes in several countries, and whole genome sequence data is
available for the key ancestors of modern dairy cattle populations (Daetwyler et al.,
2014). Dairy cattle fertility also has a high economic value in its own right, and there is
evidence that fertility in dairy cattle has declined significantly in recent decades (Lucy,
2001, Walsh et al., 2011). The causes of this decline are multifactorial (Lucy, 2001,
Walsh et al., 2011), and include negative pleiotropic effects with variants improving
milk production (Kadri et al., 2014). More recently, greater selection intensity for
fertility traits (Berry et al., 2014) and improved reproductive management (Bisinotto et
al., 2014, Butler, 2014) has halted the downward trend in female fertility in the
Holstein-Friesian breed, and in some populations fertility has improved (Pryce et al.,
2014). More rapid improvement is necessary to return the fertility of the Holstein-
Friesian to previous levels, and to improve the economic viability of dairy farming.
The establishment and maintenance of pregnancy involves a complex interplay

between the endometrium, the embryo and the corpus luteum (CL) (Robinson et al.,
2008, Meidan, 2014). The endometrium, a mucosal membrane lining the lumen of the
uterus, promotes embryo development via secretions in the histotroph (Forde et al.,
2013, Forde et al., 2014a,b) and is also involved in the regulation of the oestrous cycle
(Spencer et al., 2008). After ovulation, cellular reorganization and angiogenesis of the
ovulatory follicle is essential to create a highly vascularized CL capable of producing a
rapid rise in progesterone (P4) concentrations (Robinson et al., 2014). The endometrium
and CL are obvious targets for gene expression studies to detect differentially expressed
genes (DEG), for example between high and low fertility cattle (Robinson et al., 2010).
Another method used to identify genomic variation involved in a trait is a genome-wide
155
association study (GWAS). A number of GWAS have been conducted for fertility traits
in cattle (Huang et al., 2010, Pryce et al., 2010, Sahana et al., 2010, Cole et al., 2011,
Berry et al., 2012, Hoglund et al., 2014), and in humans (Aschebrook-Kilfoy et al.,
2015). In cattle, genomic variation associated with fertility traits was detected on BTA1,
5, 13, 16 and 18 (Khatkar et al., 2014), however to date, there has been little agreement
between studies. This is partly due to the complex nature of fertility traits, but also due
to insufficient power, inconsistencies in the fertility traits used and the high significance
threshold required to avoid detecting false-positives (Khatkar et al., 2014). An
alternative approach is to use prior information from candidate gene or functional
pathway studies to focus on specific genomic regions that are likely to harbour variants
directly affecting biological processes. The advantage of this approach is that less
stringent significance thresholds can be applied than with a traditional GWAS, since the
false discovery rate is reduced (Pimentel et al., 2011, Cochran et al., 2013, Raven et al.,
2014).
In this paper, we used global gene expression profiles from endometrium and
CL and GWAS and imputed sequence data to identify variants associated with dairy
cow fertility. Differentially expressed genes in the CL and endometrium that are
important for phenotypic fertility were identified using a unique resource herd of cows
with similar genetic merit for milk production traits, but either good (Fert+) or poor
(Fert-) genetic merit for fertility (Cummins et al., 2012a, Butler, 2013). The results of
this study enhance our understanding of (i) the contribution of the endometrium and CL
transcriptome to phenotypic reproductive performance; (ii) the genetic architecture
affecting fertility in a higher mammal that has a small number of offspring per
parturition, and (iii) genetic variants that could be used to accelerate genomic selection
for improved fertility in dairy cattle.
156
6.4.1 Lactating Holstein Cow Genetic Model of Fertility
A lactating cow genetic model of fertility was established in Teagasc Moorepark,
Ireland to elucidate the mechanisms responsible for sub-optimal fertility in lactating
Holstein dairy cows (Cummins et al., 2012a). Briefly, heifers of >75% Holstein
ancestry with either extreme positive (i.e. poor fertility; Fert-), or negative (i.e. high
fertility; Fert+) estimated breeding value (EBV) for calving interval were selected from
the Irish national dairy cattle database. Genetic evaluations for calving interval are
undertaken 3-times annually in a multi-trait genetic evaluation model that includes the
first five parity records for calving interval and other reproductive traits. Within the
Irish national herd, the selected heifers represented the top 25% in genetic merit for
milk production. Fert- heifers represented the bottom 5% in genetic merit for calving
interval, whereas Fert+ heifers represented the top 20% in genetic merit for calving
interval. In subsequent years, herd replacements were generated by selecting suitable
artificial insemination sires to maintain the difference in genetic merit for calving
interval. The selection criteria for candidate sires were: >200 kg predicted transmitting
ability (PTA) for milk production, positive PTA for milk fat and protein concentration,
and possessed >75% Holstein genetic ancestry. Sires with >5 days (mean = 6.50, SD =
1.54) PTA for calving interval were selected for mating with Fert- cows and sires with
<-5 days (mean = -5.47, SD = 1.12) PTA for calving interval were selected for mating
with Fert+ cows.
Fourteen cows were enrolled in an ovulation synchronization protocol, 8 Fert+

and 6 Fert-. The EBVs of the cows from both genotypes are summarized in Table 6.1.
Fert+ and Fert- cows were sired by 5 and 6 sires, respectively. The experimental
procedures involving animals were licensed by the Department of Health, Ireland, in
accordance with the Cruelty to Animals Act (Ireland 1876) and the European
Community Directive 86/609/EEC. The management of the Fert+ and Fert- cows has
been described in detail elsewhere (Moore et al., 2014a). Mean calving dates were
February 19 (SD ± 22.3 days) and February 20 (SD ± 16.8 days) for the Fert+ and Fert-
cows, respectively.
157
Table 6.1. The mean estimated breeding value1 (and SD) for both genotypes based on
their sire, maternal grandsire and maternal great grand-sire estimated breeding values
Genotype
Variable Fert+ Fert-
No. of animals 8 6
Holstein percentage 95 (4.7) 95 (5.8)
Milk (kg) 438 (176) 482 (158)
Fat (kg) 22 (6.4) 17.2 (8.4)
Fat (g/kg) 0.08 (0.1) -0.02 (0.1)
Protein (kg) 19.2 (7.3) 18.6 (7.2)
Protein (g/kg) 0.08 (0.04) 0.04 (0.08)
Survival (%) 3.4 (1.6) -3.6 (1.2)
Calving Interval (d) -6.4 (1.6) 4.1 (1.4)
Sire calving interval (d) -9.2 (1.6) 11.4 (3.8)
Maternal grandsire calving interval (d) -8.6 (4.2) 11.8 (4.6)
1
PTA values were obtained from the Autumn 2012 official dairy evaluations
published by the Irish Cattle Breeding Federation and multiplied by 2 to convert to
EBV.
Individual cow EBV were determined using the following formula:
0.5*sireEBV + 0.25*MGsireEBV + 0.125*MGGsireEBV
2
158
6.4.2 Ovulation Synchronization
Cows were enrolled in an ovulation synchronization protocol (CIDR_TAI) as described
by Herlihy et al. (2012). Mean days postpartum (± SD) when cows were enrolled in the
protocol was 56 ± 5.4 (range: 47-63) and 56 ± 3.6 (range: 50-61) for the Fert+ and Fert-
cows, respectively. On day -10 of the protocol, each cow was administered an
intramuscular injection of a gonadotropin releasing hormone (GnRH) agonist containing
10 μg of buserelin (Receptal; Intervet Ireland, Dublin, Ireland), and a controlled internal
drug release device containing 1.38 g of P4 (CIDR, Pfizer Ireland, Dublin, Ireland) was
inserted per vaginum. On day -3, each cow was administered an intramuscular injection
of prostaglandin F2α (PGF2α) containing 25 mg of dinoprost tromethamine (Lutalyse,
Pfizer Ireland). On day -2, the CIDR device was removed and 36 hours later, each cow
was administered a second intramuscular injection of GnRH agonist.
6.4.3 Tissue Biopsies

On day 13 of the oestrous cycle, endometrium and CL biopsies were collected from
each cow as described by Chapwanya et al. (2009b) and Kot et al. (1999), respectively.
Briefly, cows were sedated with intravenous xylazine (1 mg/100 kg body weight) and
caudal epidural anaesthesia was induced using 4 mL of 2% lidocaine to prevent
abdominal straining. The vulva and perineal area were sanitized with antiseptic solution
and dried. The luteal biopsy was performed using a tissue biopsy needle (16 gauge, 48
cm, trocar tip. SABD-1648-15-T; US Biopsy, Franklin, Indiana, USA) placed in the
needle guide of an ovum pick-up probe (7.5 MHz convex transducer, Esaote Pie
Medical Equipment B.V., Maastricht, the Netherlands). The endometrial biopsy was
collected from a site in the uterine horn ipsilateral to the CL with an endometrial biopsy
tool (Kruuse, Langeskov, Denmark), approximately 3 cm past the uterine bifurcation.
Tissue samples were rinsed with saline, blotted dry and trimmed of any connective or
myometrial tissue, identified by visual examination. Biopsy samples were immediately
snap frozen in liquid nitrogen and stored at -80 °C.
6.4.4 RNA Extraction

Samples from eight of the thirteen Fert+ cows and six of the ten Fert- cows were
selected; these animals were clinically healthy, responded appropriately to the ovulation
synchronization protocol based on circulating P4 concentrations and were representative
of a suitable mix of sires. Total RNA was extracted from endometrial tissue using a
Trizol-based method (Chomczynski and Sacchi, 1987). The mean (± SD) weight of the
159
endometrial tissue samples was 67 (± 33) mg. Each sample was homogenized in 3 ml
TRI Reagent (Sigma-Aldrich, Dublin) in sterile glass scintillation vials for 30 seconds
using a Polytron PT 10/35 GT homogenizer (Kinematica) at 30,000 rpm until all tissue
was in suspension. Homogenate was incubated at room temperature for 5 min, aliquots
of 1 mL were transferred to sterile Eppendorf tubes (Eppendorf, UK) and 100 μL
Bromo-Chloropropane (Sigma, Dublin) was added. Samples were shaken vigorously for
15 seconds to mix and incubated at room temperature for 2 min.
Next, samples were centrifuged at 12,000 x g for 15 min at 4° C; 500 μL of

aqueous phase (containing RNA) was transferred to new Eppendorf tubes and 300 μL of
isopropanol (Sigma-Aldrich, Dublin) was added. Tubes were inverted 10 times to mix
and centrifuged at 12,000 x g for 10 min at 4° C. The supernatant was removed; the
pellet was washed in 75% ethanol (Sigma-Aldrich, Dublin) and centrifuged at 12,000 x
g for 5 min at 4° C. The supernatant was removed and the pellet allowed to air dry for 5
min. Each RNA pellet was resuspended in 20 μL of RNAse-free water (Sigma-Aldrich,
Dublin) and pooled into one Eppendorf tube.
RNA concentration and quality was evaluated Nanodrop ND-1000 (Nanodrop,

Wilmington, Denver) and the RNA Nano 6000 chip on the Bioanalyser 2100 (Agilent
Technologies, UK), respectively. Total RNA was purified using the RNeasy Plus Mini
kit (Qiagen, Manchester, UK), removing RNAs < 200 nucleotides and any genomic
DNA contamination. The 260/280 absorbance ratio, RNA integrity number and 28s:18s
ratio of clean RNA ranged from 1.85 to 2.29, 7.0 to 9.4 and 1.2 to 2.2, respectively for
endometrium samples. Clean RNA samples were stored at -80° C.
6.4.5 cDNA Library Preparation and Sequencing

mRNA samples were converted to cDNA libraries for sequencing following the
protocol of the Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego,
California). RNAseq libraries were amplified by 11 cycles of PCR. Library
concentration was determined by Qubit (Invitrogen, UK) and quality was determined
using DNA-1000 chips on a Bioanalyser 2100 (Agilent Technologies, UK). A random-
block design was used to reduce the risk of technical bias in the experimental design.
Each sample was sequenced on a single lane over a total of two flow-cells on the
Illumina HiSeq 2500 platform to generate 40 million 75 base paired-end reads, and
FASTQ files were created using CASAVA v1.9 (Illumina Inc).
160
6.4.6 mRNA Sequence Quality and Alignment
FASTQC v0.10.0 was used to perform basic quality control checks on raw sequence
data. Trim Galore (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/)
was used to remove adaptor sequences and low quality bases from the 3’ end of the
sequence reads; reads less than 20 bases in length were then discarded. The remaining
reads were aligned to the bovine genome (UMD3.1 assembly) (Zimin et al., 2009) using
STAR v2.3.0 (Chen et al., 2009) allowing two mismatches to account for sequencing
errors and single nucleotide polymorphisms (SNP). The variation in gene body
coverage by the RNA-Seq reads from 5′ to 3′ ends was assessed using RSeQC (Wang et
al., 2012). Only uniquely mapped reads were retained for downstream analysis.
featureCounts (Liao et al., 2014) was used to assign uniquely aligned reads to Ensembl
(v73) annotated exons. Reads mapping to multiple features or overlapping genes were
discarded. Read counts for all samples were amalgamated into a single matrix for
subsequent differential expression analysis.
6.4.7 Differential Analysis of Gene Expression

Differential expression analysis of the endometrium and CL count data was performed
separately using the Bioconductor software package edgeR (Robinson et al., 2010) with
the R statistical programming language. Genes with <1 count per million in only six
endometrial samples or five CL samples (the lowest level of replication) were removed
from the dataset. Library size was normalized by the Trimmed Mean of M-values. The
edgeR package assumes that RNA-seq data have a negative binomial distribution. A
fixed effects model was fitted to the read counts (expressed as counts per million) for
each gene with genotype (Fert+, Fert-), parity (2, 3, 4) and sample date (n=4) all
included as fixed effects. DEG were identified based on the likelihood ratio test. P-
values were adjusted using the Benjamini and Hochberg (1995) method with a false
discovery rate of 0.05 to correct for multiple testing.
Ensembl Biomart (http://www.ensembl.org/biomart) was used to search the

UMD 3.1 database for descriptions of the DEG. Attempts were made to annotate genes
described as uncharacterized proteins by analyzing their protein coding sequence with
the NCBI Blast tool. A summary of the endometrium and CL RNA-seq data processing
steps is shown in Table 6.2.
161
6.4.8 Pathway Analysis of DEG
Pathway analysis of the DEG was conducted by over-representation analysis using
GOSeq (version 1.16.2) in the R statistical programming language (R Development
Core Team, 2014). GOSeq accounts for gene length bias. The KEGG database (release
71.0) was used to define pathways that contain significantly more DEG than would be
expected by chance given the background set of all genes found expressed in the tissue
(Kanehisa et al., 2014).
6.4.9 Genome-Wide Association Studies using High Density Genotypes

Illumina (http://www.illumina.com) high-density (BovineHD) genotypes (777,962
SNP) were available for 719 Holstein-Friesian AI bulls from Ireland. Illumina Bovine
HD genotypes were available for 1,620 Holstein bulls and cows and 125 Jersey bulls
from Australia. The genotypes were edited using the genotype quality control processes
described by Berry and Kearney (2011) for the Irish genotypes and Erbe et al. (2012)
for the Australian genotypes. Following quality control, 630,337 and 616,350
segregating autosomal SNP remained in the Irish and Australian datasets, respectively.
A further 4,682 AI bulls in Ireland and 16,794 bulls and cows in Australia (12,056
Holstein and 4,738 Jersey) had Illumina BovineSNP50 beadchip genotypes (54,001
SNP), after applying similar quality control edits as for the HD genotypes, all lower
density genotypes were used to impute, within country, BovineHD genotypes using
Beagle (Browning and Browning, 2007).
Predicted transmitting ability values for calving interval for each of the Irish
genotyped bulls was available from the December 2013 Irish genetic evaluations.
Calving interval in Ireland is evaluated in a multi-trait model (with calving to first
service interval, number of services and survival) treating calving interval in each of the
first five parities as separate traits. The single PTA value per animal is the average of
each of the individual parity PTAs. Predicted transmitting ability values were
deregressed using the full pedigree as described by Purfield et al. (2014). Only animals
with a PTA reliability >40% were retained for the GWAS. The final dataset for the Irish
GWAS consisted of 2,660 sires.
Calving interval trait deviations (for cows) and daughter trait deviations (for
bulls) for the genotyped animals were available from the Australian Dairy Herd
Improvement Scheme official April 2013 evaluation for the genotyped animals in
162
Australia. Trait deviations were calculated within breed and were corrected for fixed
effects including contemporary group, age, and permanent environment, and heterosis.
Daughter trait deviations were the average of trait deviations for a bull’s daughters.
The GWAS in both countries were undertaken separately in WOMBAT (Meyer,

2007) using a series of univariate animal linear mixed models, where each SNP was
fitted, one at a time as a continuous fixed effect (i.e., number of copies of an allele) in
the model. In the Australian GWAS, additional fixed effects for breed, gender and
gender nested within breed were also included in the statistical model. The direct
additive genetic effect of the animal was included as a random effect linked to the
pedigree file. Phenotypes were weighted by a function of the information contributing
to that phenotypic record as outlined by Garrick et al. (2009). Test-statistics were
obtained for each SNP separately.
163
Table 6.2. Processing of endometrium and corpus luteum RNA-seq data
Reads Endometrium Corpus luteum
Original Read pairs (SD) 19,066,636 (2,652,478) 19,632,540 (3,667,891)
Quality Filtered Read Pairs (SD) 18,937,717 (2,614,068) 19,503,505 (3,652,194)
Uniquely Aligned Read Pairs (SD) 17,008,347 (2,571,379) 18,051,665 (3,463,308)
Uniquely Mapped Read Pairs Overlapping Protein Coding Genes (SD) 12,449,396 (1,895,381) 13,980,981 (2,354,851)
Genes in UMD 3.1

Total 24,616 24,616
Less than zero counts 5,006 5,185
1
Less than one count per million in n samples 5,665 6,343
Retained 13,945 13,088
1
Genes with less than one count per million in six endometrium samples or five corpus luteum samples were removed from the dataset.
Six and five samples represents to lowest number of replicates per genotype in the endometrium and corpus luteum, respectively.
164
6.4.10 Concordance Analysis
The genomic position of each DEG was identified using the Bos taurus genes
(UMD3.1) dataset downloaded from Ensembl BioMart database
(http://www.ensembl.org/biomart). A region 500 kilobases (kb) flanking either side of
the centre of each DEG was calculated. The number of SNP in this one megabase (Mb)
region included in the Irish and Australian GWAS was quantified and the number of
these SNP expected to be associated with calving interval in the GWAS was calculated
assuming a false discovery rate of 10-3. The false discovery threshold was calculated as
mP/n, where m is the total number of SNP tested, P is the P-value, and n is the number
of variants that were actually significant. If the number of SNP associated with fertility
in a one Mb region was greater than expected by chance, then the region was deemed to
have been validated and is hereafter referred to as a QTL region. Concordance of DEG
located on the X chromosome was not considered because SNP on the X chromosome
were not included in the Australian and Irish GWAS.
6.4.11 Genome-Wide Association using Whole Genome Sequence

Genotypes for variants of DEG in the CL and endometrium (including region 2 kb
upstream and downstream of these genes) identified in 1000 bull genomes Run2.0
(Daetwyler et al., 2014) from 129 Holstein and 15 Jerseys, were imputed into the
Australian data set of 16,794 bulls and cows with HD genotypes. Beagle (Browning and
Browning, 2007) was used for imputation.
The model fitted to the sequence variants was as described for the Australian
GWAS. Subsequently, the number of significant SNP (P < 10-5 and P < 10-8) within
each DEG, and 2 kb upstream and downstream of the gene start and stop position, was
counted. The false discovery threshold was calculated for each significance threshold as
mP/n, where m is the total number of variants tested per threshold, P is the P-value of
the threshold, and n is the number of variants that were actually significant at that
threshold.
165
6.5 Results
6.5.1 Gene Expression in Endometrium and Corpus Luteum of High and Low
Fertility cows
RNA from the endometrium (biopsy size: mean = 66.9 mg; SD = 32.9 mg) of eight
Fert+ and six Fert- cows, and from the CL (biopsy size: mean = 4.1 mg; SD = 2.7 mg)
of seven Fert+ and five Fert- cows was extracted and massively parallel sequenced.
Following stringent quality control, the number of filtered reads per cow was
19,066,636 and 19,632,540 read pairs were obtained from sequencing the endometrium
and CL libraries, respectively. Of these, ~65% and ~71% of the endometrium and CL
sequence reads, respectively, were uniquely mapped and overlapped with protein coding
genes. Gene body plots of the libraries indicated no bias in read coverage from 5’ to 3’
ends (Figure 6.1). Of the 24,616 genes in the bovine genome, ~57% and ~51%
(endometrium and CL respectively) had sufficient coverage for differential expression
following the quality control.
166
Figure 6.1 Gene body plots of RNA-sequenced libraries
167
6.5.2 Concordance of Differentially Expressed Genes in Endometrium and Corpus
Luteum with High-density Genome-wide Association Studies
Nine endometrial genes and 560 CL genes were differentially expressed between Fert+
and Fert- cows (P ≤ 0.05; Tables 6.3 and 6.4). Three genes, leukocyte immunoglobulin-
like receptor, subfamily A (with TM domain), member 6 (LILRA6*), SAA3* and feline
leukaemia virus subgroup C cellular receptor family, member 2 (FLVCR2) were
differentially expressed in both the endometrium and the CL, with the same direction of
expression between genotypes in both tissues; hence, a total of 566 DEG were identified
across the two tissues combined. Genome wide association studies for fertility with
630K genome wide SNP were conducted in two populations 1) 2,660 Holstein bulls
with daughters in Ireland recorded for calving interval, and 2) 16,794 bulls and cows in
Australia (12,056 Holstein cattle and 4,738 Jersey cattle). The fertility traits evaluated
were calving interval, and in the case of bulls, the average of their daughters calving
interval. Calving interval is the length in time in days from one calving to the next. A
linear mixed model fitting SNP as a fixed effect and population structure from pedigree
and breed was used (44) to evaluate the effect of each SNP on the fertility trait. The
GWAS identified a number of genome regions with significant SNP (Figure 6.2).
Next we investigated if the differentially expressed gene sets from the

endometrium and CL identified above were enriched for significant SNP from the
GWAS. The region 500 kb upstream and downstream of the gene centre was considered
in this analysis. Excluding DEG on the X chromosome, 547 individual DEG were
identified across the endometrium and CL datasets. Of the 547 DEG, 203 identified
QTL regions validated by the Australian GWAS (37%; indicated with AU), 245
identified QTL regions validated by the Irish GWAS (45%; indicated with IE) and 355
identified QTL regions validated by either the Irish GWAS or the Australian GWAS
(Figure 6.2, Table 6.3 and 6.4). Interestingly, 93 DEG identified QTL regions validated
by both the Irish GWAS and the Australian GWAS (17%; indicated with *). Of these 93
DEG, ~54% were located on the following chromosomes: BTA18 (23%), 5 (9%), 7
(8%), 8 (8%) and 29 (6%).
The endometrial expression profile identified: (i) more severe uterine

inflammation in Fert- cows indicated by greater expression of serum amyloid A3
(SAA3*) and secreted phosphoprotein 1 (SPP1)); (ii) suboptimal energy status in Fert-
cows indicated by greater expression of protein kinase, AMP-activated, gamma 3 non-
168
catalytic subunit (PRKAG3AU); and (iii) greater PGF2α synthesis and secretion in Fert-
cows indicated by greater expression of prostaglandin F synthetase II-like (PGFS2*)
and ATP-binding cassette sub-family C member 4 (ABCC4AU) compared with Fert+
cows.
The luteal expression profile identified greater PGF2α response in Fert- cows
compared with Fert+ cows indicated by lesser expression of two homologs of
ADAMTS-like 5 (ADAMTSL5IE), ATPase, Ca++ transporting, cardiac muscle, fast
twitch 1 (ATP2A1AU) and nuclear receptor subfamily 5, group A, member 1 (NR5A1)
and greater expression of crystallin, alpha B (CRYAB), inhibin, beta A (INHBA*),
interleukin 4 receptor (IL4R), serpin peptidase inhibitor, clade B (ovalbumin), member
2 (SERPINB2IE), thrombospondin 1 (THBS1IE) and tissue factor pathway inhibitor 2
(TFPI2AU). Reduced steroidogenesis in Fert- cows compared with Fert+ cows was
indicated by lesser expression of NR5A1 and two homologs of StAR-related lipid
transfer (START) domain containing 9 (STARD9IE) and greater expression of
cytochrome P450, subfamily IIIA, polypeptide 4 (CYP3A4). Genes involved in the
cytoskeleton, extracellular matrix (ECM), mRNA replication, zinc finger motifs; the
cell cycle, DNA repair and apoptosis were also differentially expressed between
genotypes, with their expression primarily down regulated in Fert- cows (Table 6.5).
KEGG pathway analysis of DEG in the CL revealed over-representation of genes
involved in the spliceosome pathway (P-value = 0.06).
169
170
Figure 6.2. Manhattan plots for calving interval in Australian (top panel) and Irish dairy cattle populations (bottom panel). Single
nucleotide polymorphisms highlighted green have p-values ≤ 0.001. Chromosome 30 was not included in the genome-wide association
study.
171
Table 6.3. Endometrial genes determined to be differentially expressed between Fert+ and Fert- cows on d 13 of the oestrous
cycle
Concordance
1
Australia Ireland2
3 4 5
Ensembl Gene ID Gene logFC P-value Chr Sig SNP Validated Sig SNP5 Validated6
6
ENSBTAG00000019547 LILRA6* -1.91 0.05 18 43 Yes 31 Yes

ENSBTAG00000020406 GPC3# 1.61 0.03 X - - - -
ENSBTAG00000005260 SPP1 1.76 0.03 6 0 No 0 No
ENSBTAG00000011985 FLVCR2 -1.76 0.03 10 0 No 0 No
AU
ENSBTAG00000013492 PRKAG3 1.63 0.03 2 1 Yes 0 No
ENSBTAG00000022396 SAA3* 1.80 0.02 29 1 Yes 2 Yes
ENSBTAG00000011873 KCNE3IE 2.30 0.004 15 0 No 10 Yes
ENSBTAG00000022570 PGFS2* 2.01 0.004 13 1 Yes 2 Yes
AU
ENSBTAG00000047383 ABCC4 3.09 <0.0001 12 19 Yes 0 No
1
Concordance between DEG in the endometrium of Fert+ cows and Fert- cows on d 13 of the oestrous cycle and the
Australian fertility genome wide association study
2
Concordance between DEG in the endometrium of Fert+ cows and Fert- cows on d 13 of the oestrous cycle and the Irish
fertility genome wide association study
3
log Fold-change of DEG for Fert- cows relative to Fert+ cows. Positive values indicate greater expression in Fert- cows
4
Significance level after controlling for multiple testing (Benjamini and Hochberg, 1995)
5
The number of single nucleotide polymorphisms significantly associated with calving interval in the 1 Mb region
surrounding the gene
6
A gene was validated if the number of Sig SNP in the 1 Mb region surrounding the gene was greater than expected by
chance at a false discovery rate of 10-3
*Indicates DEG validated by both Irish and Australian fertility genome-wide association studies
#
It was not possible to determine the concordance of GPC3 with both genome-wide association studies because SNP from
chromosome 30 were not included
172
Table 6.4. Corpus luteum genes determined to be differentially expressed between Fert+ and Fert- cows on day 13 of the
oestrous cycle
Concordance
Australia Ireland
Ensembl Gene ID Gene logFC P-value Chr Sig SNP Validated Sig SNP Validated
ENSBTAG00000001968 TTC14 -1.45 0.01 1 5 Yes 0 No
ENSBTAG00000003064 GCFC -1.49 0.01 1 0 No 0 No
ENSBTAG00000003718 HACL1 -0.97 0.04 1 0 No 12 Yes
ENSBTAG00000003851 CCNL1 -1.33 0.008 1 0 No 0 No
ENSBTAG00000005769 NPHP3 -1.30 0.04 1 0 No 0 No
ENSBTAG00000006158 DZIP3 -1.31 0.03 1 0 No 0 No
ENSBTAG00000009085 SLC35A5 -0.71 0.02 1 0 No 1 Yes
ENSBTAG00000009154 U2SURP -0.84 0.04 1 0 No 4 Yes
ENSBTAG00000009851 ROBO1 -0.89 0.01 1 0 No 0 No
ENSBTAG00000010462 ROBO2 -0.81 0.01 1 0 No 2 Yes
ENSBTAG00000010485 MFN1 -0.83 0.03 1 0 No 3 Yes
ENSBTAG00000010793 CCDC80 0.92 0.03 1 0 No 1 Yes
ENSBTAG00000011495 DIP2A -0.80 0.03 1 0 No 0 No
ENSBTAG00000013937 SPICE1 -1.02 0.04 1 0 No 0 No
ENSBTAG00000015198 DZIP1L -1.69 0.03 1 0 No 0 No
ENSBTAG00000015310 SLC25A36 -0.71 0.05 1 1 Yes 0 No
ENSBTAG00000015662 IMPG2 -1.57 0.02 1 0 No 5 Yes
ENSBTAG00000017666 ABCC5 -2.10 0.005 1 0 No 1 Yes
ENSBTAG00000021276 TFF3 4.67 0.01 1 0 No 22 Yes
ENSBTAG00000030670 PCNT -1.03 0.02 1 0 No 0 No
ENSBTAG00000038131 ABCC5 -2.70 0.0004 1 0 No 1 Yes
ENSBTAG00000002177 PIKFYVE -1.11 0.03 2 0 No 0 No
ENSBTAG00000003822 CROCC -3.00 0.002 2 0 No 0 No
ENSBTAG00000004835 HOXD3 -2.63 0.002 2 0 No 4 Yes
ENSBTAG00000005408 CLK1 -2.04 0.002 2 0 No 26 Yes
173
ENSBTAG00000006261 GPR17 -1.69 0.02 2 8 Yes 0 No
ENSBTAG00000008300 FN1 0.86 0.04 2 8 Yes 0 No
ENSBTAG00000008915 SF3B1 -1.00 0.03 2 0 No 0 No
ENSBTAG00000009725 AOX1 -1.40 0.01 2 0 No 35 Yes
ENSBTAG00000010366 HCRTR1 -1.68 0.009 2 0 No 0 No
ENSBTAG00000012263 ASAP3 -1.49 0.03 2 0 No 0 No
ENSBTAG00000013309 SFRS4 -0.90 0.03 2 0 No 1 Yes
ENSBTAG00000013916 HERC2 -0.80 0.03 2 0 No 0 No
ENSBTAG00000014714 TUBGCP5 -1.30 0.02 2 0 No 0 No
ENSBTAG00000014975 SLC4A3 -1.01 0.03 2 1 Yes 6 Yes
ENSBTAG00000015222 RSRP1 -1.96 0.01 2 0 No 3 Yes
ENSBTAG00000015240 UBR4 -0.87 0.04 2 0 No 6 Yes
ENSBTAG00000016000 CARF -1.08 0.02 2 0 No 3 Yes
ENSBTAG00000016448 ZBTB40 -0.89 0.05 2 4 Yes 0 No
ENSBTAG00000016512 TTC21B -0.73 0.04 2 0 No 0 No
ENSBTAG00000018067 S100PBP -0.77 0.05 2 0 No 1 Yes
ENSBTAG00000018520 SCN1A -1.34 0.04 2 0 No 0 No
ENSBTAG00000019291 GRB14 -1.05 0.01 2 7 Yes 0 No
ENSBTAG00000020654 BAZ2B -1.04 0.02 2 0 No 0 No
ENSBTAG00000027789 PPIG -0.77 0.04 2 0 No 0 No
ENSBTAG00000027875 CCDC141 -1.52 0.02 2 0 No 0 No
ENSBTAG00000039581 HOXD4 -3.03 0.002 2 0 No 4 Yes
ENSBTAG00000046176 SPEG -1.96 0.009 2 1 Yes 0 No
ENSBTAG00000000108 BLOM7 -0.90 0.03 3 0 No 0 No
ENSBTAG00000002078 KDM4A -0.60 0.04 3 0 No 19 Yes
ENSBTAG00000003928 ATG16L1 -0.91 0.04 3 3 Yes 1 Yes
ENSBTAG00000005580 SZT2 -1.25 0.01 3 0 No 20 Yes
ENSBTAG00000006720 GJA5 0.83 0.04 3 1 Yes 0 No
ENSBTAG00000008808 CCDC17 -1.58 0.03 3 0 No 6 Yes
ENSBTAG00000010670 VSIG8 -2.82 0.001 3 3 Yes 0 No
174
ENSBTAG00000012348 C3H1ORF92 -1.75 0.05 3 0 No 0 No
ENSBTAG00000012361 ARHGEF11 -0.88 0.02 3 0 No 0 No
ENSBTAG00000013946 PRPF3 -0.97 0.03 3 0 No 17 Yes
ENSBTAG00000015474 SFRS11 -1.29 0.007 3 0 No 21 Yes
ENSBTAG00000015896 CC2D1B -0.64 0.05 3 0 No 9 Yes
ENSBTAG00000018711 DENND4B -1.20 0.01 3 0 No 0 No
ENSBTAG00000018987 RPS25 0.68 0.05 3 0 No 0 No
ENSBTAG00000019093 AMY2B -3.10 0.0009 3 1 Yes 3 Yes
ENSBTAG00000020356 GON4L -0.72 0.04 3 0 No 1 Yes
ENSBTAG00000020616 DGKH -0.84 0.05 3 2 Yes 0 No
ENSBTAG00000021024 MACF1 -1.26 0.02 3 0 No 2 Yes
ENSBTAG00000024107 INPP5B -0.68 0.04 3 2 Yes 4 Yes
ENSBTAG00000040414 pseudogene 0.71 0.04 3 18 Yes 1 Yes
ENSBTAG00000047874 PRPF38B -0.71 0.04 3 0 No 12 Yes
ENSBTAG00000002912 INHBA 1.27 0.02 4 14 Yes 5 Yes
ENSBTAG00000003449 KCP -1.69 0.05 4 0 No 0 No
ENSBTAG00000006232 WDR86 -1.23 0.05 4 0 No 1 Yes
ENSBTAG00000007442 AKAP9 -1.12 0.01 4 0 No 0 No
ENSBTAG00000008032 ACTR3B -1.23 0.03 4 0 No 1 Yes
ENSBTAG00000010219 KRBA1 -1.95 0.008 4 0 No 9 Yes
ENSBTAG00000012128 AASS -0.69 0.05 4 1 Yes 5 Yes
ENSBTAG00000015844 TFPI2 0.84 0.02 4 1 Yes 0 No
ENSBTAG00000024199 KMT2C -1.15 0.01 4 0 No 0 No
ENSBTAG00000034645 PON3 3.13 0.002 4 0 No 2 Yes
ENSBTAG00000000049 CCDC77 -1.61 0.04 5 13 Yes 6 Yes
ENSBTAG00000000650 TUBGCP6 -1.16 0.01 5 0 No 0 No
175
ENSBTAG00000003367 PNPLA3 -1.95 0.006 5 2 Yes 0 No
ENSBTAG00000004376 PAN2 -1.25 0.01 5 0 No 7 Yes
ENSBTAG00000004999 LOC510651 -1.02 0.02 5 4 Yes 0 No
ENSBTAG00000005868 HEBP1 0.61 0.02 5 3 Yes 12 Yes
ENSBTAG00000006904 TENC1 -1.18 0.01 5 27 Yes 26 Yes
ENSBTAG00000009887 DDX17 -0.89 0.02 5 12 Yes 0 No
ENSBTAG00000010660 CACNA1C -1.42 0.02 5 19 Yes 0 No
ENSBTAG00000011927 RDH5 -1.61 0.02 5 0 No 0 No
ENSBTAG00000012267 ZFC3H1 -1.40 0.01 5 0 No 0 No
ENSBTAG00000014429 KMT2D -1.33 0.02 5 7 Yes 36 Yes
ENSBTAG00000014697 SMARCC2 -0.84 0.04 5 0 No 7 Yes
ENSBTAG00000016043 GNB3 -2.85 0.005 5 11 Yes 1 Yes
ENSBTAG00000016589 PRPF40B -2.04 0.002 5 2 Yes 16 Yes
ENSBTAG00000017840 BAZ2A -0.81 0.03 5 0 No 11 Yes
ENSBTAG00000018660 PPP6R2 -1.04 0.05 5 0 No 0 No
ENSBTAG00000019312 TFCP2 -0.68 0.05 5 0 No 4 Yes
ENSBTAG00000020758 MAP3K12 -1.69 0.004 5 33 Yes 25 Yes
ENSBTAG00000023471 RPL36 0.69 0.05 5 0 No 3 Yes
ENSBTAG00000026819 HDAC7 -0.88 0.04 5 1 Yes 18 Yes
ENSBTAG00000030180 SHANK3 -1.07 0.02 5 0 No 0 No
ENSBTAG00000030285 DCP1B -1.07 0.01 5 8 Yes 0 No
ENSBTAG00000031544 DDIT3 -1.12 0.03 5 0 No 4 Yes
ENSBTAG00000004277 EVC2 -1.28 0.03 6 0 No 3 Yes
ENSBTAG00000004316 BOD1L -1.12 0.02 6 0 No 0 No
ENSBTAG00000004797 TRMT44 -2.69 0.0008 6 1 Yes 0 No
ENSBTAG00000004893 ACOX3 -0.85 0.05 6 1 Yes 0 No
ENSBTAG00000005668 SLC39A8 1.20 0.04 6 5 Yes 0 No
ENSBTAG00000005754 PPM1K -0.68 0.04 6 0 No 0 No
ENSBTAG00000005773 PGM2 -0.67 0.05 6 0 No 1 Yes
176
ENSBTAG00000014512 WDR19 -1.59 0.005 6 0 No 0 No
ENSBTAG00000014803 CPZ 0.95 0.02 6 1 Yes 0 No
ENSBTAG00000017682 TET2 -1.01 0.01 6 0 No 5 Yes
ENSBTAG00000018638 CC2D2A -0.92 0.02 6 0 No 0 No
ENSBTAG00000019427 KIAA0232 -1.09 0.03 6 0 No 1 Yes
ENSBTAG00000001450 APBB3 -2.39 0.004 7 0 No 0 No
ENSBTAG00000001790 SAFB2 -1.04 0.02 7 9 Yes 40 Yes
ENSBTAG00000001796 CATSPERD -3.60 0.002 7 9 Yes 30 Yes
ENSBTAG00000003259 TCERG1 -0.89 0.03 7 0 No 2 Yes
ENSBTAG00000004200 GTPBP3 -1.27 0.04 7 0 No 5 Yes
ENSBTAG00000004262 ZNF454 -2.18 0.003 7 1 Yes 0 No
ENSBTAG00000006107 ANKRD32 -1.41 0.04 7 0 No 1 Yes
ENSBTAG00000006124 MAU2 -0.93 0.03 7 0 No 0 No
ENSBTAG00000006662 ADAMTSL5 -1.22 0.03 7 0 No 17 Yes
ENSBTAG00000008753 BRD8 -0.81 0.03 7 0 No 0 No
ENSBTAG00000009389 HNRNPH1 -0.98 0.05 7 0 No 0 No
ENSBTAG00000009513 TGFBI 0.99 0.01 7 4 Yes 7 Yes
ENSBTAG00000009569 DOCK6 -0.90 0.03 7 0 No 0 No
ENSBTAG00000010439 AKAP8L -1.87 0.002 7 3 Yes 6 Yes
ENSBTAG00000010871 EIF4EBP3 -0.60 0.03 7 0 No 0 No
ENSBTAG00000013288 SUGP2 -1.69 0.003 7 0 No 0 No
ENSBTAG00000013358 RPS23 0.69 0.03 7 0 No 33 Yes
ENSBTAG00000014207 ADAMTS10 -1.88 0.01 7 2 Yes 0 No
ENSBTAG00000014828 CACNA1A -1.72 0.02 7 1 Yes 2 Yes
ENSBTAG00000014835 SPARC 0.73 0.04 7 1 Yes 11 Yes
ENSBTAG00000015192 FAM193B -1.28 0.03 7 0 No 1 Yes
ENSBTAG00000015224 TCOF1 -0.92 0.04 7 0 No 1 Yes
ENSBTAG00000017280 C3 1.52 0.01 7 4 Yes 0 No
ENSBTAG00000018349 IFI30 1.00 0.03 7 0 No 19 Yes
177
ENSBTAG00000020766 ABCA7 -1.11 0.02 7 0 No 18 Yes
ENSBTAG00000021115 FLJ20531 -1.45 0.008 7 0 No 3 Yes
ENSBTAG00000021520 DDX46 -0.78 0.04 7 0 No 0 No
ENSBTAG00000032364 USP6NL -1.29 0.05 7 0 No 0 No
ENSBTAG00000035584 LOC787645 -1.21 0.01 7 9 Yes 32 Yes
ENSBTAG00000045086 7SK -2.24 0.002 7 0 No 4 Yes
ENSBTAG00000046263 ADAMTSL5 -1.17 0.05 7 0 No 17 Yes
ENSBTAG00000000078 GLIPR2 0.71 0.03 8 3 Yes 0 No
ENSBTAG00000000575 TNC 2.07 0.0002 8 7 Yes 12 Yes
ENSBTAG00000005469 CCAR2 -0.82 0.04 8 0 No 1 Yes
ENSBTAG00000010107 DFNB31 -1.33 0.05 8 1 Yes 17 Yes
ENSBTAG00000011417 CNTRL -1.46 0.01 8 0 No 0 No
ENSBTAG00000011420 CA9 -2.37 0.02 8 5 Yes 10 Yes
ENSBTAG00000011434 NPR2 -1.05 0.03 8 4 Yes 2 Yes
ENSBTAG00000015005 FANCG -1.27 0.01 8 2 Yes 11 Yes
ENSBTAG00000016957 LOC616903 -1.58 0.04 8 0 No 0 No
ENSBTAG00000019187 ZNF462 -1.37 0.02 8 1 Yes 4 Yes
ENSBTAG00000019807 COL27A1 -1.86 0.01 8 0 No 12 Yes
ENSBTAG00000025756 FBXW12 -2.22 0.002 8 3 Yes 0 No
ENSBTAG00000044135 PIGO -0.80 0.05 8 2 Yes 11 Yes
ENSBTAG00000047389 TNFRSF10D -2.02 0.0002 8 0 No 1 Yes
ENSBTAG00000000243 HEBP2 0.65 0.04 9 0 No 1 Yes
ENSBTAG00000000918 ERMARD -1.30 0.02 9 0 No 2 Yes
ENSBTAG00000001644 MDN1 -1.33 0.01 9 0 No 0 No
ENSBTAG00000005557 MLLT4 -0.98 0.05 9 0 No 1 Yes
ENSBTAG00000009362 SYNE1 -1.43 0.008 9 0 No 1 Yes
ENSBTAG00000015242 SLC18B1 -1.22 0.02 9 2 Yes 0 No
ENSBTAG00000019730 SFRS18 -2.41 0.0005 9 1 Yes 0 No
178
ENSBTAG00000023792 LOC524507 0.84 0.02 9 9 Yes 0 No
ENSBTAG00000000362 SPG11 -0.60 0.05 10 0 No 0 No
ENSBTAG00000001179 TEP1 -1.10 0.02 10 1 Yes 0 No
ENSBTAG00000002006 THBS1 0.97 0.03 10 0 No 32 Yes
ENSBTAG00000002748 TMEM55B -0.69 0.05 10 1 Yes 0 No
ENSBTAG00000003043 GNG2 0.61 0.02 10 0 No 5 Yes
ENSBTAG00000003754 STARD9 -1.99 0.007 10 0 No 69 Yes
ENSBTAG00000005751 CDAN1 -1.38 0.02 10 0 No 69 Yes
ENSBTAG00000005753 PARP6 -2.22 0.01 10 0 No 0 No
ENSBTAG00000006440 IGDCC4 -0.81 0.02 10 1 Yes 1 Yes
ENSBTAG00000006688 RPS6KL1 -1.77 0.01 10 0 No 0 No
ENSBTAG00000006784 PLA2G4B -2.14 0.01 10 0 No 18 Yes
ENSBTAG00000006790 SPTBN5 -4.16 0.0001 10 0 No 20 Yes
ENSBTAG00000006884 PABPN1 -1.25 0.04 10 0 No 0 No
ENSBTAG00000007099 AP1G2 -1.08 0.02 10 0 No 0 No
ENSBTAG00000008868 CAPN3 -2.62 0.001 10 0 No 56 Yes
ENSBTAG00000010119 ALDH1A2 0.99 0.05 10 0 No 1 Yes
ENSBTAG00000011319 SLTM -0.98 0.02 10 0 No 0 No
ENSBTAG00000011571 ACIN1 -1.87 0.002 10 0 No 0 No
ENSBTAG00000011596 SFRS5 -1.64 0.005 10 0 No 0 No
ENSBTAG00000011985 FLVCR2 -2.39 0.002 10 0 No 0 No
ENSBTAG00000013774 C15orf52 -2.08 0.01 10 0 No 23 Yes
ENSBTAG00000017177 RBM25 -1.11 0.02 10 0 No 1 Yes
ENSBTAG00000017683 LYSMD2 -0.80 0.03 10 0 No 1 Yes
ENSBTAG00000018297 PLEKHH1 -1.55 0.01 10 0 No 0 No
ENSBTAG00000018852 APC -0.70 0.03 10 0 No 0 No
ENSBTAG00000019474 HERC1 -0.94 0.02 10 0 No 8 Yes
ENSBTAG00000021414 TMCO5B -1.10 0.04 10 0 No 0 No
ENSBTAG00000025450 SYNE2 -1.27 0.02 10 0 No 0 No
ENSBTAG00000030456 SPATA7 -1.90 0.005 10 14 Yes 0 No
179
ENSBTAG00000039789 STARD9 -2.52 0.002 10 0 No 57 Yes
ENSBTAG00000045619 RPL39 0.75 0.04 10 0 No 0 No
ENSBTAG00000000054 SNAPC4 -2.77 0.0009 11 0 No 0 No
ENSBTAG00000005190 TSC1 -1.28 0.005 11 0 No 5 Yes
ENSBTAG00000005432 CAPG 0.74 0.03 11 0 No 0 No
ENSBTAG00000006963 RPL12 0.81 0.03 11 0 No 0 No
ENSBTAG00000007689 LPIN1 -1.72 0.0004 11 0 No 19 Yes
ENSBTAG00000009017 NR5A1 -0.72 0.04 11 0 No 0 No
ENSBTAG00000009694 PUS10 -1.93 0.004 11 9 Yes 0 No
ENSBTAG00000010520 C8G -2.24 0.03 11 1 Yes 0 No
ENSBTAG00000010849 ANKRD23 -2.53 0.006 11 0 No 0 No
ENSBTAG00000011172 ALMS1 -1.26 0.02 11 0 No 10 Yes
ENSBTAG00000012121 NOXA1 -2.44 0.03 11 0 No 0 No
ENSBTAG00000012126 PNPLA7 -1.46 0.009 11 0 No 0 No
ENSBTAG00000014679 DHX57 -1.21 0.01 11 2 Yes 10 Yes
ENSBTAG00000017448 EFEMP1 1.37 0.008 11 0 No 0 No
ENSBTAG00000018157 IFT172 -1.03 0.04 11 0 No 0 No
ENSBTAG00000019017 IFITM2 0.88 0.02 11 1 Yes 34 Yes
ENSBTAG00000019182 TIA1 -1.20 0.02 11 0 No 1 Yes
ENSBTAG00000019458 ASB3 -1.10 0.03 11 4 Yes 0 No
ENSBTAG00000020311 USP20 -1.19 0.01 11 3 Yes 4 Yes
ENSBTAG00000024091 MALL 0.89 0.05 11 0 No 23 Yes
ENSBTAG00000038139 CERCAM 0.62 0.04 11 0 No 0 No
ENSBTAG00000047061 NDOR1 -1.28 0.03 11 1 Yes 0 No
ENSBTAG00000007067 ZC3H13 -0.91 0.03 12 0 No 2 Yes
ENSBTAG00000011860 FAM48A -1.59 0.008 12 0 No 13 Yes
ENSBTAG00000013159 PHF11 -1.30 0.01 12 0 No 0 No
ENSBTAG00000015124 ARGLU1 -1.74 0.004 12 1 Yes 0 No
ENSBTAG00000017289 MCF2L -1.30 0.02 12 0 No 0 No
180
ENSBTAG00000018851 MYCBP2 -1.03 0.03 12 0 No 1 Yes
ENSBTAG00000019886 BORA -1.48 0.02 12 0 No 0 No
ENSBTAG00000021725 PCID2 -1.07 0.03 12 0 No 0 No
ENSBTAG00000025400 PARP4 -0.68 0.04 12 0 No 0 No
ENSBTAG00000035926 EEF1a 1.03 0.009 12 0 No 1 Yes
ENSBTAG00000000654 ARMC4 -1.21 0.05 13 15 Yes 9 Yes
ENSBTAG00000006002 DIDO1 -0.72 0.05 13 0 No 0 No
ENSBTAG00000006021 CEP250 -1.42 0.01 13 1 Yes 0 No
ENSBTAG00000008527 SRSF6 -1.32 0.01 13 0 No 0 No
ENSBTAG00000009165 LPIN3 -1.10 0.03 13 3 Yes 1 Yes
ENSBTAG00000011646 ZNF512B -1.45 0.01 13 0 No 0 No
ENSBTAG00000012297 FAM65C -1.11 0.05 13 4 Yes 0 No
ENSBTAG00000012377 ECHDC3 -1.09 0.01 13 0 No 0 No
ENSBTAG00000013163 ADAM33 -3.83 0.0003 13 0 No 0 No
ENSBTAG00000019197 FAM208B -0.79 0.03 13 1 Yes 0 No
ENSBTAG00000019606 IFT52 -0.88 0.04 13 0 No 0 No
ENSBTAG00000020797 CABLES2 -1.14 0.02 13 0 No 0 No
ENSBTAG00000021096 RTEL1 -2.14 0.006 13 0 No 0 No
ENSBTAG00000021669 SOGA1 -1.08 0.05 13 0 No 0 No
ENSBTAG00000032704 NAPB -1.60 0.03 13 1 Yes 0 No
ENSBTAG00000040046 LOC522322 -1.82 0.01 13 0 No 0 No
ENSBTAG00000046375 LOC100850808 4.33 0.04 13 0 No 1 Yes
ENSBTAG00000047150 RTEL -1.68 0.01 13 0 No 0 No
ENSBTAG00000007753 KIFC2 -2.28 0.01 14 1 Yes 0 No
ENSBTAG00000008079 NRBP2 -2.03 0.0009 14 1 Yes 1 Yes
ENSBTAG00000008355 CPSF1 -0.83 0.05 14 1 Yes 0 No
ENSBTAG00000011064 ADCK5 -1.31 0.01 14 1 Yes 0 No
ENSBTAG00000012353 ZNF34 -1.32 0.005 14 0 No 0 No
ENSBTAG00000014458 MROH1 -1.20 0.01 14 1 Yes 0 No
ENSBTAG00000014689 CSPP1 -1.09 0.04 14 0 No 0 No
181
ENSBTAG00000017281 OPLAH -0.89 0.04 14 1 Yes 0 No
ENSBTAG00000019864 MAPK15 -1.53 0.01 14 1 Yes 2 Yes
ENSBTAG00000000434 CRYAB 1.39 0.01 15 0 No 0 No
ENSBTAG00000002450 FAM111A -2.98 0.0007 15 0 No 0 No
ENSBTAG00000004275 DKK3 0.86 0.005 15 2 Yes 0 No
ENSBTAG00000007148 F2 -2.28 0.02 15 6 Yes 0 No
ENSBTAG00000007196 TAGLN 1.14 0.02 15 1 Yes 0 No
ENSBTAG00000009611 PHF21A -0.99 0.05 15 7 Yes 1 Yes
ENSBTAG00000014137 CEP164 -1.83 0.01 15 0 No 0 No
ENSBTAG00000014354 FXYD6 0.64 0.03 15 0 No 0 No
ENSBTAG00000018093 KMT2A -1.20 0.02 15 0 No 0 No
ENSBTAG00000019059 ATG16L2 -1.59 0.04 15 0 No 1 Yes
ENSBTAG00000019627 THY1 0.77 0.03 15 6 Yes 0 No
ENSBTAG00000020911 FNBP4 -2.09 0.002 15 36 Yes 17 Yes
ENSBTAG00000021223 CRY2 -0.84 0.03 15 7 Yes 1 Yes
ENSBTAG00000027610 RPL36AL 0.92 0.05 15 0 No 5 Yes
ENSBTAG00000002126 PFKFB2 -1.07 0.02 16 0 No 0 No
ENSBTAG00000004492 C16H1ORF26 -1.04 0.03 16 0 No 0 No
ENSBTAG00000004873 CCNL2 -1.65 0.004 16 7 Yes 1 Yes
ENSBTAG00000008126 NPHP4 -1.55 0.04 16 0 No 0 No
ENSBTAG00000008153 CAMSAP2 -0.97 0.04 16 0 No 1 Yes
ENSBTAG00000009309 PEX10 -1.28 0.02 16 7 Yes 2 Yes
ENSBTAG00000009856 ACAP3 -1.64 0.03 16 0 No 0 No
ENSBTAG00000010696 DVL1 -0.80 0.05 16 7 Yes 1 Yes
ENSBTAG00000010720 MIB2 -1.18 0.01 16 7 Yes 2 Yes
ENSBTAG00000012808 MASP2 -1.95 0.008 16 0 No 0 No
ENSBTAG00000013813 KLHL17 -2.69 0.0005 16 0 No 0 No
ENSBTAG00000015885 PPFIA4 -2.59 0.001 16 0 No 0 No
ENSBTAG00000016733 NOL9 -1.08 0.03 16 0 No 0 No
182
ENSBTAG00000019556 MIIP -2.09 0.002 16 0 No 0 No
ENSBTAG00000020698 MTHFR -1.02 0.02 16 0 No 0 No
ENSBTAG00000020839 MEGF6 -1.42 0.04 16 0 No 0 No
ENSBTAG00000021211 DPT 1.25 0.002 16 0 No 0 No
ENSBTAG00000042180 SNORD47 -1.50 0.03 16 17 Yes 0 No
ENSBTAG00000000439 SFSWAP -1.15 0.03 17 0 No 0 No
ENSBTAG00000001164 ACAD10 -0.80 0.03 17 0 No 0 No
ENSBTAG00000005240 ZNF605 -1.69 0.02 17 0 No 0 No
ENSBTAG00000006118 RSRC2 -0.69 0.05 17 0 No 0 No
ENSBTAG00000008762 HECTD4 -1.14 0.02 17 0 No 0 No
ENSBTAG00000008996 SFI1 -1.87 0.01 17 0 No 5 Yes
ENSBTAG00000012990 PUS1 -1.15 0.04 17 0 No 1 Yes
ENSBTAG00000018563 SFRP2 1.97 0.03 17 10 Yes 10 Yes
ENSBTAG00000019857 OTUD4 -0.69 0.04 17 0 No 3 Yes
ENSBTAG00000024708 CABIN1 -0.87 0.05 17 1 Yes 9 Yes
ENSBTAG00000031814 SDS 1.28 0.01 17 0 No 0 No
ENSBTAG00000000621 CATSPERG -2.83 0.002 18 2 Yes 4 Yes
ENSBTAG00000000945 ATP2C2 -1.75 0.02 18 0 No 0 No
ENSBTAG00000001287 LRRC29 -1.32 0.03 18 5 Yes 0 No
ENSBTAG00000001906 FANCA -1.40 0.04 18 0 No 0 No
ENSBTAG00000002103 PLCG2 -1.19 0.04 18 0 No 0 No
ENSBTAG00000002368 TULP2 -1.88 0.02 18 9 Yes 1 Yes
ENSBTAG00000002579 FBL 0.59 0.04 18 2 Yes 3 Yes
ENSBTAG00000002763 KMT2B -0.87 0.02 18 0 No 0 No
ENSBTAG00000002844 PPFIA3 -1.36 0.03 18 14 Yes 1 Yes
ENSBTAG00000003514 HSF4 -2.80 0.001 18 5 Yes 0 No
ENSBTAG00000004017 PLEKHG2 -1.18 0.02 18 1 Yes 5 Yes
183
ENSBTAG00000005615 CEACAM1 -1.55 0.01 18 2 Yes 8 Yes
ENSBTAG00000006139 TRPM4 -0.86 0.03 18 14 Yes 1 Yes
ENSBTAG00000006487 RPS9 0.77 0.04 18 31 Yes 18 Yes
ENSBTAG00000006999 RYR1 -2.62 0.001 18 2 Yes 4 Yes
ENSBTAG00000007334 NFKBID -1.64 0.03 18 0 No 0 No
ENSBTAG00000009358 MTSS1L -1.56 0.01 18 0 No 0 No
ENSBTAG00000009714 ARHGAP33 -2.55 0.009 18 0 No 0 No
ENSBTAG00000011689 LENG8 -3.51 0.0002 18 42 Yes 28 Yes
ENSBTAG00000012186 DKKL1 0.87 0.02 18 20 Yes 1 Yes
ENSBTAG00000013436 HAUS5 -1.74 0.002 18 0 No 8 Yes
ENSBTAG00000013697 CLASRP -2.07 0.002 18 4 Yes 1 Yes
ENSBTAG00000015917 GAPDHS -1.83 0.01 18 0 No 14 Yes
ENSBTAG00000016006 ANKRD11 -1.27 0.02 18 0 No 0 No
ENSBTAG00000018421 WWP2 -1.05 0.02 18 4 Yes 18 Yes
ENSBTAG00000018772 TAF1C -1.27 0.01 18 0 No 0 No
ENSBTAG00000018912 ARHGEF1 -0.86 0.04 18 1 Yes 6 Yes
ENSBTAG00000019547 LILRA6 -2.12 0.04 18 43 Yes 31 Yes
ENSBTAG00000021165 VPS9D1 -1.33 0.02 18 0 No 0 No
ENSBTAG00000031001 MEGF8 -1.05 0.008 18 1 Yes 7 Yes
ENSBTAG00000031301 pseudogene -1.53 0.007 18 1 Yes 0 No
ENSBTAG00000032427 FHOD1 -1.14 0.01 18 5 Yes 0 No
ENSBTAG00000033642 - -1.45 0.05 18 60 Yes 13 Yes
ENSBTAG00000037581 MZF1 -1.86 0.002 18 6 Yes 1 Yes
ENSBTAG00000038134 ZDHHC1 -1.06 0.04 18 4 Yes 0 No
ENSBTAG00000002036 CACNB1 -1.52 0.01 19 0 No 0 No
ENSBTAG00000002279 LUC7L3 -1.44 0.008 19 0 No 3 Yes
ENSBTAG00000003889 PER1 -1.53 0.002 19 0 No 0 No
184
ENSBTAG00000004907 MINK1 -0.93 0.02 19 0 No 12 Yes
ENSBTAG00000005008 WSB1 -1.40 0.005 19 0 No 4 Yes
ENSBTAG00000006801 TMEM106A -1.25 0.02 19 0 No 1 Yes
ENSBTAG00000007084 MAP3K14 -1.43 0.04 19 0 No 2 Yes
ENSBTAG00000007193 CCL16 0.98 0.04 19 0 No 0 No
ENSBTAG00000008165 ITGA2B -1.69 0.01 19 0 No 0 No
ENSBTAG00000008591 CAMTA2 -1.01 0.02 19 0 No 12 Yes
ENSBTAG00000009835 CACNA1G -1.33 0.02 19 0 No 3 Yes
ENSBTAG00000010519 NEURL4 -1.46 0.008 19 0 No 2 Yes
ENSBTAG00000010527 ACAP1 -1.85 0.02 19 0 No 1 Yes
ENSBTAG00000011454 FKBP10 0.62 0.05 19 0 No 2 Yes
ENSBTAG00000011456 NT5C3L -1.43 0.01 19 0 No 2 Yes
ENSBTAG00000011483 SCARF1 -1.28 0.02 19 1 Yes 2 Yes
ENSBTAG00000011532 MLLT6 -1.21 0.02 19 0 No 0 No
ENSBTAG00000011715 RECQL5 -1.07 0.04 19 1 Yes 0 No
ENSBTAG00000013103 COL1A1 0.93 0.05 19 0 No 3 Yes
ENSBTAG00000013392 PLD2 -1.53 0.01 19 0 No 12 Yes
ENSBTAG00000013523 OSBPL7 -2.04 0.007 19 0 No 0 No
ENSBTAG00000014002 CEP95 -1.45 0.02 19 11 Yes 0 No
ENSBTAG00000015535 NEK8 -1.54 0.03 19 0 No 4 Yes
ENSBTAG00000015593 KIAA0753 -1.24 0.04 19 0 No 0 No
ENSBTAG00000016128 GGA3 -0.98 0.04 19 1 Yes 0 No
ENSBTAG00000017087 TOP3A -0.81 0.04 19 0 No 0 No
ENSBTAG00000017512 MAPT -1.42 0.02 19 0 No 0 No
ENSBTAG00000018175 HEXDC -1.04 0.03 19 1 Yes 0 No
ENSBTAG00000018316 ZMYND15 -1.05 0.05 19 0 No 12 Yes
ENSBTAG00000018423 DDX5 -1.07 0.03 19 11 Yes 0 No
ENSBTAG00000019090 PLEKHH3 -0.83 0.04 19 0 No 1 Yes
ENSBTAG00000019097 CNTNAP1 -1.64 0.008 19 0 No 1 Yes
ENSBTAG00000019321 CCDC57 -2.09 0.01 19 1 Yes 0 No
185
ENSBTAG00000019903 RAMP2 0.66 0.05 19 0 No 1 Yes
ENSBTAG00000020994 C17orf75 -0.72 0.05 19 6 Yes 0 No
ENSBTAG00000021468 MED24 -0.95 0.02 19 4 Yes 0 No
ENSBTAG00000022006 TRIM65 -1.36 0.02 19 0 No 0 No
ENSBTAG00000025752 LEPREL4 0.60 0.04 19 0 No 2 Yes
ENSBTAG00000030334 AOC2 -1.92 0.01 19 0 No 1 Yes
ENSBTAG00000030977 ULK2 -0.79 0.02 19 0 No 0 No
ENSBTAG00000034963 MKS1 -0.89 0.05 19 1 Yes 0 No
ENSBTAG00000045500 SGSM2 -1.09 0.05 19 0 No 4 Yes
ENSBTAG00000045885 bta-mir-3064 -3.44 0.0002 19 11 Yes 0 No
ENSBTAG00000046321 BZRAP1 -1.31 0.04 19 1 Yes 0 No
ENSBTAG00000047756 CNTROB -1.52 0.01 19 0 No 0 No
ENSBTAG00000047875 0 -3.43 0.0002 19 11 Yes 0 No
ENSBTAG00000000586 C5orf42 -1.02 0.03 20 0 No 16 Yes
ENSBTAG00000007321 SREK1 -1.70 0.005 20 0 No 2 Yes
ENSBTAG00000011334 NADK2 -0.95 0.02 20 0 No 0 No
ENSBTAG00000016963 ADAMTS6 -2.27 0.002 20 0 No 1 Yes
ENSBTAG00000001618 ALPK3 -0.95 0.02 21 0 No 1 Yes
ENSBTAG00000002440 KIF7 -1.62 0.01 21 1 Yes 0 No
ENSBTAG00000002603 PRPF39 -1.98 0.001 21 5 Yes 8 Yes
ENSBTAG00000004272 ISG12(B) 1.17 0.03 21 9 Yes 2 Yes
ENSBTAG00000005838 ULK3 -1.78 0.002 21 0 No 1 Yes
ENSBTAG00000007348 STRA6 1.37 0.01 21 0 No 2 Yes
ENSBTAG00000007368 MAN2C1 -1.16 0.004 21 0 No 0 No
ENSBTAG00000009086 LOXL1 0.66 0.05 21 0 No 2 Yes
ENSBTAG00000009966 XRCC3 -1.56 0.03 21 0 No 1 Yes
ENSBTAG00000010992 CTSH 0.62 0.04 21 0 No 0 No
186
ENSBTAG00000026995 PNN -1.52 0.004 21 2 Yes 9 Yes
ENSBTAG00000000671 PARP3 -2.76 0.002 22 1 Yes 1 Yes
ENSBTAG00000002321 AMT -4.31 0.0001 22 2 Yes 0 No
ENSBTAG00000002774 PTPN23 -1.23 0.01 22 4 Yes 0 No
ENSBTAG00000002795 NKTR -1.75 0.001 22 0 No 5 Yes
ENSBTAG00000005433 SSUH2 -1.50 0.02 22 0 No 0 No
ENSBTAG00000006328 RBM6 -1.07 0.03 22 2 Yes 0 No
ENSBTAG00000006330 RBM5 -1.18 0.009 22 2 Yes 0 No
ENSBTAG00000007362 XPC -1.55 0.003 22 2 Yes 1 Yes
ENSBTAG00000007966 TTLL3 -2.68 0.0002 22 0 No 3 Yes
ENSBTAG00000008567 DLEC1 -2.27 0.01 22 2 Yes 0 No
ENSBTAG00000010477 TTC21A -1.76 0.02 22 0 No 0 No
ENSBTAG00000011585 MST1 -0.90 0.02 22 2 Yes 0 No
ENSBTAG00000011588 RNF123 -0.71 0.04 22 2 Yes 0 No
ENSBTAG00000011795 TRXR3 -1.17 0.03 22 1 Yes 1 Yes
ENSBTAG00000011896 GRIP2 -2.23 0.001 22 2 Yes 0 No
ENSBTAG00000016563 GOLGA4 -0.91 0.04 22 0 No 0 No
ENSBTAG00000017812 ALS2CL -1.99 0.002 22 4 Yes 0 No
ENSBTAG00000018020 GNAT1 -2.51 0.005 22 0 No 0 No
ENSBTAG00000018227 SLC4A7 -0.86 0.05 22 0 No 0 No
ENSBTAG00000018238 ABTB1 -1.36 0.01 22 1 Yes 0 No
ENSBTAG00000018921 USP19 -0.89 0.02 22 3 Yes 0 No
ENSBTAG00000019193 SETD5 -0.80 0.05 22 0 No 3 Yes
ENSBTAG00000020802 LOC100847355 -1.89 0.02 22 0 No 16 Yes
ENSBTAG00000022635 LAMC1 -0.95 0.02 22 2 Yes 0 No
ENSBTAG00000039664 pseudogene -4.13 0.009 22 1 Yes 1 Yes
ENSBTAG00000047794 DNAH1 -2.36 0.03 22 3 Yes 1 Yes
ENSBTAG00000001123 SNRNP48 -1.37 0.03 23 0 No 17 Yes
ENSBTAG00000004104 RUNX2 -1.20 0.04 23 0 No 0 No
187
ENSBTAG00000005530 GNMT -1.53 0.01 23 2 Yes 0 No
ENSBTAG00000005532 PEX6 -1.12 0.01 23 2 Yes 0 No
ENSBTAG00000005589 STK19 -1.64 0.01 23 0 No 0 No
ENSBTAG00000005842 ABCC10 -1.75 0.006 23 1 Yes 0 No
ENSBTAG00000006170 ZNF76 -0.91 0.05 23 0 No 0 No
ENSBTAG00000006941 ATAT1 -1.42 0.01 23 0 No 1 Yes
ENSBTAG00000007074 ZNF192 -1.37 0.02 23 0 No 0 No
ENSBTAG00000007268 F13A1 0.99 0.03 23 0 No 20 Yes
ENSBTAG00000007450 C2 1.19 0.02 23 0 No 0 No
ENSBTAG00000008349 ZNF311 -1.63 0.03 23 0 No 0 No
ENSBTAG00000008981 USP49 -1.59 0.02 23 6 Yes 0 No
ENSBTAG00000010698 VARS2 -0.93 0.04 23 0 No 0 No
ENSBTAG00000011189 TJAP1 -1.29 0.02 23 1 Yes 0 No
ENSBTAG00000013533 CLIC1 0.63 0.03 23 0 No 0 No
ENSBTAG00000014490 DDX39B -0.99 0.03 23 0 No 0 No
ENSBTAG00000016890 ANKS1A -0.89 0.04 23 0 No 0 No
ENSBTAG00000017239 GABBR1 -2.02 0.005 23 0 No 1 Yes
ENSBTAG00000019908 CUL9 -1.60 0.008 23 1 Yes 0 No
ENSBTAG00000020975 SYNGAP1 -1.83 0.01 23 0 No 1 Yes
ENSBTAG00000021237 DST -1.20 0.02 23 0 No 0 No
ENSBTAG00000021359 LOC531747 -2.04 0.02 23 5 Yes 0 No
ENSBTAG00000022590 NC3*50201 2.11 0.03 23 0 No 0 No
ENSBTAG00000025526 MDC1 -1.20 0.01 23 0 No 0 No
ENSBTAG00000031869 ZSCAN26 -0.95 0.05 23 0 No 0 No
ENSBTAG00000035959 LOC782954 1.02 0.01 23 0 No 0 No
ENSBTAG00000038619 LOC512672 -0.91 0.03 23 0 No 1 Yes
ENSBTAG00000002125 GNAL -1.69 0.04 24 0 No 0 No
ENSBTAG00000006393 FECH -0.80 0.01 24 0 No 0 No
ENSBTAG00000008275 GREB1L -0.96 0.05 24 0 No 1 Yes
188
ENSBTAG00000013221 RTTN -1.38 0.02 24 0 No 0 No
ENSBTAG00000013380 CEP192 -1.08 0.04 24 0 No 1 Yes
ENSBTAG00000021884 CXXC1 -0.98 0.03 24 0 No 0 No
ENSBTAG00000022902 RPL17 0.69 0.05 24 0 No 0 No
ENSBTAG00000023026 SERPINB2 3.20 0.03 24 0 No 2 Yes
ENSBTAG00000045568 LOC618220 0.67 0.03 24 0 No 2 Yes
ENSBTAG00000046337 TUBB6 0.70 0.01 24 0 No 0 No
ENSBTAG00000001602 IL4R 0.81 0.04 25 0 No 0 No
ENSBTAG00000003169 FBXO24 -2.46 0.006 25 3 Yes 0 No
ENSBTAG00000004509 FANCP -1.42 0.01 25 0 No 3 Yes
ENSBTAG00000005934 TTYH3 -0.73 0.03 25 0 No 0 No
ENSBTAG00000006541 ATP2A1 -3.56 0.0002 25 12 Yes 0 No
ENSBTAG00000007113 TRRAP -0.89 0.03 25 1 Yes 0 No
ENSBTAG00000009153 MLXIPL -1.81 0.01 25 0 No 2 Yes
ENSBTAG00000009441 RBBP6 -1.43 0.01 25 0 No 0 No
ENSBTAG00000012683 SRRM2 -2.06 0.002 25 0 No 6 Yes
ENSBTAG00000014503 IQCE -1.14 0.02 25 0 No 0 No
ENSBTAG00000014742 LRWD1 -1.20 0.05 25 7 Yes 0 No
ENSBTAG00000015738 GIGYF1 -2.02 0.005 25 4 Yes 0 No
ENSBTAG00000016568 LUC7L -1.88 0.003 25 0 No 0 No
ENSBTAG00000017422 TAOK2 -0.83 0.03 25 3 Yes 0 No
ENSBTAG00000017435 KCTD7 -1.27 0.01 25 1 Yes 0 No
ENSBTAG00000017456 NYAP1 -1.04 0.04 25 3 Yes 0 No
ENSBTAG00000017999 TNRC6A -1.36 0.007 25 0 No 0 No
ENSBTAG00000020107 DNASE1 -1.69 0.01 25 0 No 3 Yes
ENSBTAG00000020528 PCOLCE 0.61 0.04 25 3 Yes 0 No
ENSBTAG00000020619 PKD1 -1.20 0.02 25 12 Yes 3 Yes
ENSBTAG00000020735 SMG1 -1.27 0.02 25 3 Yes 2 Yes
189
ENSBTAG00000026461 CACNA1H -1.12 0.001 25 0 No 0 No
ENSBTAG00000032087 ATXN2L -1.17 0.009 25 12 Yes 0 No
ENSBTAG00000033677 WDR90 -2.08 0.01 25 0 No 0 No
ENSBTAG00000034372 ZG16B 2.96 0.04 25 11 Yes 6 Yes
ENSBTAG00000037566 ZNF500 -2.23 0.008 25 0 No 0 No
ENSBTAG00000047379 CYP3A4 1.65 0.04 25 0 No 0 No
ENSBTAG00000000951 JAKMIP3 -2.06 0.02 26 0 No 3 Yes
ENSBTAG00000004899 ABLIM1 -0.65 0.04 26 3 Yes 10 Yes
ENSBTAG00000005791 UROS -0.91 0.05 26 43 Yes 9 Yes
ENSBTAG00000007460 RAB11FIP2 -1.05 0.04 26 0 No 0 No
ENSBTAG00000011651 HECTD2 -1.44 0.03 26 0 No 0 No
ENSBTAG00000011734 ANKRD1 2.59 0.006 26 0 No 0 No
ENSBTAG00000014614 ACTA2 1.04 0.05 26 22 Yes 0 No
ENSBTAG00000016336 MGEA5 -0.65 0.03 26 4 Yes 0 No
ENSBTAG00000039132 CC2D2B -3.12 0.0009 26 1 Yes 0 No
ENSBTAG00000004517 TARBP1 -1.36 0.009 28 0 No 0 No
ENSBTAG00000012657 ZSWIM8 -1.19 0.02 28 4 Yes 3 Yes
ENSBTAG00000020219 MSS51 -2.02 0.02 28 4 Yes 5 Yes
ENSBTAG00000000455 CREBZF -1.52 0.005 29 0 No 0 No
ENSBTAG00000001902 KIAA1731 -1.36 0.01 29 0 No 0 No
ENSBTAG00000005929 SPTBN2 -2.04 0.01 29 2 Yes 0 No
ENSBTAG00000006910 ASRGL1 1.02 0.004 29 4 Yes 0 No
ENSBTAG00000008683 LDHA 1.07 0.002 29 1 Yes 2 Yes
ENSBTAG00000009488 NXF1 -1.15 0.04 29 5 Yes 0 No
ENSBTAG00000010433 M-SAA3.2 4.42 0.0007 29 1 Yes 2 Yes
ENSBTAG00000011248 MSANTD2 -1.26 0.03 29 0 No 1 Yes
ENSBTAG00000012510 PLCB3 -0.84 0.05 29 7 Yes 2 Yes
ENSBTAG00000015183 TPCN2 -0.92 0.04 29 0 No 0 No
190
ENSBTAG00000015263 CPSF7 -1.00 0.04 29 5 Yes 2 Yes
ENSBTAG00000015277 PCF11 -1.08 0.008 29 0 No 0 No
ENSBTAG00000019334 KLC2 -0.72 0.04 29 11 Yes 0 No
ENSBTAG00000022147 EPS8L2 -1.59 0.005 29 0 No 0 No
ENSBTAG00000022185 IGHMBP2 -2.09 0.004 29 0 No 0 No
ENSBTAG00000022396 SAA3 2.18 0.03 29 1 Yes 2 Yes
ENSBTAG00000046587 LOC100336823 1.05 0.05 29 11 Yes 8 Yes
ENSBTAG00000000902 OGT -1.75 0.002 X 0 No 0 No
ENSBTAG00000006122 HUWE1 -0.86 0.04 X 0 No 0 No
ENSBTAG00000006878 LOC101909859 -0.85 0.04 X 0 No 0 No
ENSBTAG00000007788 GRIPAP1 -1.17 0.01 X 0 No 0 No
ENSBTAG00000008492 ZMYM3 -1.05 0.02 X 0 No 0 No
ENSBTAG00000008993 DDX26B -1.20 0.03 X 0 No 0 No
ENSBTAG00000013289 PHF8 -1.49 0.05 X 0 No 0 No
ENSBTAG00000014771 RBMX2 -1.78 0.007 X 0 No 0 No
ENSBTAG00000016688 - 1.16 0.05 X 0 No 0 No
ENSBTAG00000019553 AKAP17A -1.51 0.03 X 0 No 0 No
ENSBTAG00000021351 MED12 -1.07 0.02 X 0 No 0 No
ENSBTAG00000021421 SSR4 0.79 0.03 X 0 No 0 No
ENSBTAG00000031564 GNL3L -0.92 0.05 X 0 No 0 No
ENSBTAG00000035615 UPF3B -1.53 0.02 X 0 No 0 No
ENSBTAG00000037686 SRPX2 0.92 0.05 X 0 No 0 No
ENSBTAG00000039794 CSNK1B -3.00 0.002 X 0 No 0 No
ENSBTAG00000045550 TSPAN6 0.62 0.05 X 0 No 0 No
ENSBTAG00000045697 CMC4 -1.71 0.01 X 0 No 0 No
1
Australian fertility genome-wide association study
2
Irish fertility genome-wide association study
3
log Fold-change of DEG for Fert- cows relative to Fert+ cows. Positive values indicate greater expression in Fert- cows
191
4
Significance level after controlling for multiple testing (Benjamini and Hochberg, 1995)
5
The number of single nucleotide polymorphisms significantly associated with calving interval in the 1 Mb region
surrounding the gene
6
A gene was validated if the number of Sig SNP in the 1 Mb region surrounding the gene was greater than expected by
chance at a false discovery rate of 10-3
*Indicates DEG validated by both fertility genome-wide association studies
#It was not possible to determine the concordance of GPC3 with both genome wide association studies because the Irish
fertility GWAS did not include single nucleotides polymorphisms from chromosome 30
192
Table 6.5. Categories of differentially expressed genes in the corpus luteum between Fert+ and Fert- cows on day 13 of the
oestrous cycle
Gene-category Lesser expression in Fert- cows Greater expression in Fert- cows
AU IE
Cytoskeleton ABLIM1*, ABTB1 , ANKRD11, ANKRD23, ANKRD32 , ACTA2AU, ANKRD1, TUBB6,
AU IE
ANKS1A, ASB3 , ATAT1 , CCDC64, CCDC141, CCNL1, CCDC80IE
CCNL2*, CEP95AU, CEP250AU, CNTRL, CNTROB, CSPP1,
DNAH1*, DST, KIFC2AU, KIF7AU, KLC2AU, LOC522322,
MACF1IE,
MAPT, PCNT, SHANK3, SPTBN2AU, SPTBN5IE, SYNE1IE,
SYNE2, TTLL3IE, TUBGCP5, TUBGCP6, UBR4IE, ZMYM3
Extracellular matrix ABLIM1*, ATAT1IE, DST, LAMC1AU, TENC1* ACTA2AU, DPT, EFEMP1, FNIAU,
SPARC*, TAGLNAU, TGFBI*,
THBS1AU, TNC*
AU
mRNA replication ACIN1, AKAP17A, CLASRP*, DDX5 , DDX39B, DDX46, RPS6KL1
IE
EIF4EBP3, LOC618220 , LUC7L, PABPN1, PCF11,
PRPF3*, PRPF38BIE, PRPF39*, PRPF40B*, RBM5AU,
RBM25IE, RPL12, RPL17, RPL36IE, RPL36ALIE, RPL39,
RPS9*, RPS23IE, RPS25, SF3B1, SFRS4IE, SFRS5, SFRS11IE,
SFRS18AU, SFSWAP, SREK1IE, SUGP2, TCERG1IE,
U2SURPIE,
Zinc finger FLJ20531IE, LOC528802*, MSS51*, ZBTB40AU, ZC3H13IE,
ZDHHC1AU, ZMYM3, ZMYND15IE, ZNF34, ZNF76, ZNF192,
ZNF236AU, ZNF311, ZNF318AU, ZNF454AU, ZNF462*,
ZNF500, ZNF512B, ZNF598*, ZNF605, ZNF784*, ZSCAN26,
ZSWIM8*,
Cell-cycle CCAR2IE, CDAN1IE, CLK1IE, CLK2IE, CLK4IE, two homologs FBL*
of CCAR1IE, PPP6R2, RTEL1, SFI1IE SPICE1, TRRAPAU
DNA repair FANCA, FANCG*, FANCPIE, MDC1, PARP3*, PARP4,
PARP6, RECQL5AU
Apoptosis ACIN1, CCAR2IE, DDX17AU, MKS1AU, RBBP6, TNFRS10DIE ISG12b*, CRYAB
Spliceosome ACIN1, PRPF38BIE, U2SURPIE, DDX39B, DDX46, PRPF3IE,
PRPF40B*, RBM25IE, TCERG1IE, SFRS4IE, SFRS5, SF3B1
* = DEG validated by both the Australian and Irish GWAS
193
6.5.3 Sequence Variants Genome-wide Association Study for Fertility
In an attempt to identify possible sequence variants that underlie the significant
associations in the DEG regions, we imputed whole genome sequence variant genotypes
in these regions two kb upstream and downstream of gene start and gene stop,
respectively into all animals used in the Australian GWAS, using the 1000 bull
genomes sequence data (Daetwyler et al., 2014). When the imputed variants were tested
for association with calving interval, seventeen variants in eight DEG regions were
significantly associated with fertility (P < 10-5) in the Australian dairy cattle population
(Table 6.6), of which nine were highly significant (P < 10-8). On BTA21 and BTA18,
one upstream variant of pre-mRNA processing factor 39 (PRPF39*) and one upstream
variant, one intron variant and six downstream variants of ribosomal protein S9
(RPS9*) had the strongest associations with fertility (P < 10-10). In addition to the
variants flanking RPS9*, one upstream variant and one 3’UTR variant of leukocyte
receptor cluster (LRC) member 8 (LENG8*; both P < 10-8) and one downstream variant
of leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
(LILRA6*; P < 10-5) significantly associated with fertility were located within a 280 kb
region at 63 Mb. Also on BTA18, one upstream variant of lysine (K)-specific
methyltransferase 2B (KMT2B) was associated with fertility. On BTA7, one missense
variant of eukaryotic translation initiation factor 4E binding protein 3 (EIF4EBP3) was
significantly associated with fertility (P < 10-5). The missense variant of EIF4EBP3 had
a SIFT (Ng and Henikoff, 2003) value of 0.01, indicating the amino acid substitution
was predicted to affect protein function. On BTA19, one 3’UTR variant and one
missense variant of RecQ protein-like 5 (RECQL5AU) were associated with fertility (P <
10-5). The missense variant of RECQL5AU had a SIFT value of 0.51, indicating the
amino acid substitution was predicted to not affect protein function.
194
Table 6.6. Sequence variants associated with fertility in the Australian dairy cattle population
Ensembl Gene ID Gene BTA Position -log10(p-value) Annotation SIFT
AU
ENSBTAG00000014742 LRWD1 25 35,098,555 5.37 intron variant
ENSBTAG00000002603 PRPF39* 21 55,288,491 11.83 upstream gene variant
ENSBTAG00000011715 RECQL5AU 19 56,579,964 5.58 3 prime UTR variant
ENSBTAG00000011715 RECQL5AU 19 56,578,201 5.18 missense variant 0.51
ENSBTAG00000006487 RPS9* 18 63,381,402 10.58 downstream gene variant
ENSBTAG00000006487 RPS9* 18 63,383,118 10.58 intron variant
ENSBTAG00000006487 RPS9* 18 63,389,258 10.58 upstream gene variant
ENSBTAG00000011689 LENG8* 18 63,114,910 7.78 3 prime UTR variant
ENSBTAG00000002763 KMT2B 18 46,620,241 7.65 upstream gene variant
ENSBTAG00000011689 LENG8* 18 63,107,476 7.51 upstream gene variant
ENSBTAG00000019547 LILRA6* 18 63,155,939 5.7 downstream gene variant
ENSBTAG00000010871 EIF4EBP3 7 53,334,235 5.97 Missense variant 0.01
195
6.6 Discussion
The results of this study indicate that the combination of transcriptomic data from key
reproductive tissues with GWAS data, and imputed whole genome sequence provided a
novel and useful approach to elucidate the mechanisms contributing to suboptimal
reproductive performance in lactating dairy cows. A differential expression analysis
between Fert+ and Fert- cows revealed nine DEG in the endometrium and 560 DEG in
the CL. The DEG in the endometrium were primarily involved in processes associated
with uterine inflammation, energy status and PGF2α synthesis and secretion. The DEG
in the CL were primarily involved in processes associated with the PGF2α response,
steroidogenesis and mRNA processing. Many of the DEG identified QTL regions
associated with fertility in the Australian and Irish dairy populations or proximal to SNP
previously associated with dairy cow fertility (Huang et al., 2010, Pryce et al., 2010,
Sahana et al., 2010, Cole et al., 2011, Cochran et al., 2013, Hoglund et al., 2014).
Additionally, sequence variants strongly associated with fertility were identified within
2 kb upstream and downstream of many DEG.
6.6.1 Concordance between Differentially Expressed Genes and Fertility Genome-

wide Association Studies
Although genomic regions associated with dairy cattle fertility have previously been
identified, they have extended Mb in length due to their long range linkage
disequilibrium (LD) with SNP markers, making it difficult to identify the causative
mutation. Furthermore, there has been little agreement between studies, likely due to
limited power for this low heritability trait (Khatkar et al., 2014). Here, RNA-
sequencing technology was used to determine the global gene expression profile in the
endometrium and the CL (both key reproductive tissues) of Fert+ and Fert- cows,
allowing us to identify a strong list of candidates for genes affecting fertility prior to
undertaking the GWAS. Importantly, tissue samples were collected on day 13 of the
oestrous cycle, a critical time point for embryo development in cattle, coinciding with
the initiation of conceptus elongation and secretion of interferon-τ in preparation for
maternal recognition of pregnancy (Ealy and Yang, 2009, Forde et al., 2011). This
period also coincides with the majority of pregnancy loss in cattle (Diskin et al., 2011).
The differential expression analysis allowed us to reduce the number of SNP tested, to
some extent reducing multiple testing.
196
Three hundred and fifty-five QTL regions were identified from the concordance
analysis with either the Australian GWAS or Irish GWAS. Identifying QTL regions that
were validated in both dairy populations further reduced the likelihood of false
discoveries. Of the 355 QTL regions, 93 were validated in both populations, primarily
on BTA18, 5, 7, 8 and 29. Both dairy cattle populations have experienced substantial
introgression of Holstein genes in recent decades (Thurn and McClintock, 2003, Evans
et al., 2006) and the correlation between countries for fertility genetic evaluations is
0.88 (i.e. relatively high;
http://www.interbull.org/web/static/mace_evaluations/1408r/fert1408r.pdf. Last
accessed February 28th 2015). A recent meta-analysis of published GWAS indicated the
importance of BTA1, 5, 13, 16 and 18 to fertility in cattle (Khatkar et al., 2014). One
meta-GWAS peak for fertility was within the QTL region around ribosomal protein L36
(RPL36) on BTA5. Eight other QTL regions around mitofusin 1 (MTFN1) on BTA1,
around transcription factor CP2 (TFCP2), KIAA1551, calcium channel, voltage-
dependent, L type alpha 1C subunit (CACNA1C), and DEAD (Asp-Glu-Ala-Asp) box
polypeptide 17 (DDX17*) on BTA5, and around acyl-CoA oxidase 3, pristanoyl
(ACOX3), tRNA methyltransferase 44 homolog (S. cerevisiae) (TRMT44) and
carboxypeptidase Z (CPZ) on BTA6 were each within 0.5 MB of a meta-GWAS peaks
for fertility identified by the meta-analysis. Additionally, 58 of the 93 QTL regions
validated (62%) by both GWAS contained SNP previously associated with female
fertility traits (Huang et al., 2010, Pryce et al., 2010, Sahana et al., 2010, Cole et al.,
2011, Cochran et al., 2013, Hoglund et al., 2014) (Table 6.7). Combined, these data
provide strong evidence that these QTL regions contribute to the variation in dairy cow
fertility.
197
Table 6.7. QTL regions validated by both the Irish GWAS and Australian GWAS previously associated with female fertility traits
Ensembl Gene ID Gene Chr QTL region start QTL region stop Previous report
ENSBTAG00000019093 AMY2B 3 39,437,622 40,437,622 Hoglund et al., 2014
ENSBTAG00000024107 INPP5B 3 108,122,989 109,122,989 Hoglund et al., 2014
ENSBTAG00000040414 pseudogene 3 110,530,548 111,530,548 Hoglund et al., 2014
ENSBTAG00000003928 ATG16L1 3 113,099,942 114,099,942 Hoglund et al., 2014
ENSBTAG00000012128 AASS 4 86,837,375 87,837,375 Hoglund et al., 2014
ENSBTAG00000020758 MAP3K12 5 26,198,639 27,198,639 Hoglund et al., 2014
ENSBTAG00000016589 PRPF40B 5 29,880,165 30,880,165 Hoglund et al., 2014
ENSBTAG00000014429 KMT2D 5 30,447,999 31,447,999 Hoglund et al., 2014
ENSBTAG00000016043 GNB3 5 103,468,090 104,468,090 Hoglund et al., 2014
ENSBTAG00000000049 CCDC77 5 107,309,446 108,309,446 Hoglund et al., 2014
ENSBTAG00000012157 CCDC158 6 92,516,851 93,516,851 Hoglund et al., 2014
ENSBTAG00000010439 AKAP8L 7 8,270,667 9,270,667 Cole et al., 2011
ENSBTAG00000014828 CACNA1A 7 12,877,767 13,877,767 Cole et al., 2011
ENSBTAG00000001796 CATSPERD 7 19,295,519 20,295,519 Hoglund et al., 2014
ENSBTAG00000001790 SAFB2 7 19,422,650 20,422,650 Hoglund et al., 2014
ENSBTAG00000015005 FANCG 8 59,251,185 60,251,185 Hoglund et al., 2014
ENSBTAG00000044135 PIGO 8 59,258,985 60,258,985 Hoglund et al., 2014
ENSBTAG00000011420 CA9 8 59,763,416 60,763,416 Hoglund et al., 2014
ENSBTAG00000011434 NPR2 8 59,873,557 60,873,557 Hoglund et al., 2014
ENSBTAG00000010107 DFNB31 8 104,877,121 105,877,121 Hoglund et al., 2014
ENSBTAG00000000575 TNC 8 105,516,693 106,516,693 Hoglund et al., 2014
ENSBTAG00000006440 IGDCC4 10 11,777,870 12,777,870 Hoglund et al., 2014
ENSBTAG00000016600 CCDC142 11 9,637,717 10,637,717 Cochran et al., 2013; Hoglund et al., 2014
ENSBTAG00000014679 DHX57 11 20,692,032 21,692,032 Hoglund et al., 2014
ENSBTAG00000000654 ARMC4 13 36,457,808 37,457,808 Hoglund et al., 2014
ENSBTAG00000022570 PGFS2 13 43,574,843 44,574,843 Hoglund et al., 2014
ENSBTAG00000009165 LPIN3 13 70,174,865 71,174,865 Hoglund et al., 2014
ENSBTAG00000008079 NRBP2 14 1,656,130 2,656,130 Hoglund et al., 2014
198
ENSBTAG00000020911 FNBP4 15 78,196,433 79,196,433 Hoglund et al., 2014
ENSBTAG00000018563 SFRP2 17 3,333,850 4,333,850 Hoglund et al., 2014
ENSBTAG00000024708 CABIN1 17 72,865,738 73,865,738 Hoglund et al., 2014
ENSBTAG00000018421 WWP2 18 36,526,074 37,526,074 Huang et al., 2010; Hoglund et al., 2014
ENSBTAG00000000621 CATSPERG 18 47,928,144 48,928,144 Hoglund et al., 2014
ENSBTAG00000006999 RYR1 18 48,066,704 49,066,704 Hoglund et al., 2014
ENSBTAG00000002368 TULP2 18 55,434,485 56,434,485 Cochran et al., 2013
ENSBTAG00000002844 PPFIA3 18 55,598,703 56,598,703 Cochran et al., 2013
ENSBTAG00000006139 TRPM4 18 55,635,966 56,635,966 Cochran et al., 2013
ENSBTAG00000012186 DKKL1 18 55,799,283 56,799,283 Cochran et al., 2013
ENSBTAG00000048204 LOC101908627 18 57,520,571 58,520,571 Hoglund et al., 2014
ENSBTAG00000016299 ZNF784 18 61,873,358 62,873,358 Cochran et al., 2013
ENSBTAG00000011689 LENG8 18 62,612,392 63,612,392 Pryce et al., 2010; Hoglund et al., 2014
ENSBTAG00000019547 LILRA6 18 62,650,571 63,650,571 Pryce et al., 2010; Hoglund et al., 2014
ENSBTAG00000006487 RPS9 18 62,885,072 63,885,072 Pryce et al., 2010; Hoglund et al., 2014
ENSBTAG00000000195 LOC528802 18 64,309,985 65,309,985 Cole et al., 2011
ENSBTAG00000002603 PRPF39 21 54,807,246 55,807,246 Hoglund et al., 2014
ENSBTAG00000000671 PARP3 22 49,041,527 50,041,527 Hoglund et al., 2014
ENSBTAG00000039664 pseudogene 22 49,161,080 50,161,080 Hoglund et al., 2014
ENSBTAG00000001023 ZNF598 25 1,057,409 2,057,409 Hoglund et al., 2014
ENSBTAG00000020619 PKD1 25 1,147,033 2,147,033 Hoglund et al., 2014
ENSBTAG00000034372 ZG16B 25 1,715,818 2,715,818 Hoglund et al., 2014
ENSBTAG00000020735 SMG1 25 16,091,179 17,091,179 Cochran et al., 2013; Hoglund et al., 2014
ENSBTAG00000004899 ABLIM1 26 34,792,353 35,792,353 Hoglund et al., 2014
ENSBTAG00000020219 MSS51 28 29,083,715 30,083,715 Hoglund et al., 2014
ENSBTAG00000008683 LDHA 29 26,049,090 27,049,090 Hoglund et al., 2014
ENSBTAG00000022396 SAA3 29 26,169,924 27,169,924 Sahana et al., 2010; Hoglund et al., 2014
ENSBTAG00000010433 M-SAA3.2 29 26,257,553 27,257,553 Sahana et al., 2010; Hoglund et al., 2014
ENSBTAG00000012510 PLCB3 29 42,679,868 43,679,868 Hoglund et al., 2014
199
ENSBTAG00000046587 LOC100336823 29 44,271,197 45,271,197 Huang et al., 2010; Hoglund et al., 2014
200
6.6.2 PGF2α-related QTL Regions Associated with Fertility
Greater endometrial expression of PGFS2* and ABCC4AU in the Fert– cows indicates
greater synthesis and secretion of PGF2α in the Fert- cows (Goff, 2004, Lacroix-Pepin et
al., 2011). Greater secretion of PGF2α, the primary luteolytic agent in cattle, on day 13
of the oestrous cycle may be sufficient to compromise CL development and P4
production in the Fert- cows as previously identified (Cummins et al., 2012b, Moore et
al., 2014b), without inducing complete luteolysis. In support of this, nine DEG
(ADAMTSL5IE, ATP2A1AU, NR5A1, CRYAB, INHBA*, IL4R, SERPINB2IE, THBS1IE,
TFPI2AU) were previously reported to be associated with the CL response to exogenous
PGF2α (Mondal et al., 2011, Atli et al., 2012, Farberov and Meidan, 2014), of which six
were validated by the Australian or Irish GWAS.
6.6.3 Steroidogenesis-related QTL Regions Associated with Fertility

Luteal genes associated with steroidogenesis were differentially expressed between
Fert+ and Fert- cows and were validated by the Australian and Irish fertility GWAS.
Greater CL expression of CYP3A4 (Yamazaki and Shimada, 1997) and ECM-related
genes, and lesser expression of NR5A1, two homologs of STARD9IE (Mlynarczuk et al.,
2013), period circadian clock 1 (PER1), cryptochrome circadian clock 2 (CRY2*)
(Sellix, 2014) and the majority of cytoskeleton-related genes (Sewer and Li, 2008) in
Fert- cows compared with Fert+ cows suggested CL development and P4 production
capacity was compromised in Fert- cows. Importantly, this luteal expression profile
supports the previous findings that the CL of Fert- cows have reduced steroidogenic
capacity (Cummins et al., 2012b, Moore et al., 2014b).
NR5A1 regulates the expression of genes involved in the ECM, cell

proliferation, apoptosis, steroidogenesis and lipid metabolism, cytoskeleton dynamics,
angiogenesis and transcriptional regulation (Lalli et al., 2013). Conditional knockout of
NR5A1, a gene associated with luteal P4 secretion, in Leydig cells of male mice resulted
in reduced Leydig cell expression of CYP11A and STAR in males (Jeyasuria et al.,
2004). Conditional knockout of NR5A1 in females resulted in ovaries with reduced
ovarian expression of anti-müllerian hormone, reduced gonadotropin-induced
expression of aromatase and cyclin D2, reduced follicle count and absence of ovulation
(Jeyasuria et al., 2004, Pelusi et al., 2008).
201
Lesser expression of PER1 and CRY2* in Fert- cows implicates potential
disruption of circadian rhythms regulating cellular processes, including steroidogenesis
(Urlep and Rozman, 2013). Disruption of the circadian clock by conditional knockout
of BMAL1 in the ovary of mice resulted in reduced steroidogenic capacity, reduced
circulating P4 concentrations and implantation failure (Liu et al., 2014). The incidence
of normal oestrous cycles and the reproductive rate were reduced in mice with
homozygous null genotypes for either PER1 or PER2 compared with wild-type mice
(Pilorz and Steinlechner, 2008).
Components of the cytoskeleton are involved in the intracellular transport of

substrates for steroidogenesis (Sewer and Li, 2008). Cytoskeleton-related DEG had
primarily lesser expression in Fert- cows compared with Fert+ cows that may
compromise steroidogenesis in the luteal cells of Fert- cows. Greater CL expression of
genes associated with the ECM, i.e. fibronectin 1 (FN1AU), secreted protein, acidic,
cysteine-rich (SPARC*), THBS1IE and tenascin C (TNC*) in the Fert- cows compared
with Fert+ cows (Sage and Bornstein, 1991, Joseph et al., 2012) may be indicative of
greater tissue remodelling and the delayed CL development in the Fert- cows compared
with Fert+ cows (Cummins et al., 2012b, Moore et al., 2014b). Interestingly, FN1 has
been identified as harbouring genetic variants associated with increased risk of
endometriosis in humans (Fung et al., 2015).
6.6.4 mRNA Processing-related QTL Regions and Sequence Variants Associated

with Fertility
Functional differences between the CL of Fert+ and Fert- cows may also be explained
by the differential expression of genes involved in mRNA replication, zinc finger
motifs, the cell-cycle, DNA repair and apoptosis. In general, the majority of DEG linked
to these processes had lesser expression in Fert- cows compared with Fert+ cows. In
addition, there was an over-representation of genes involved in the spliceosome
pathway. Lesser expression of EIF4EBP3, poly(A) binding protein, nuclear 1
(PABPN1) and genes encoding ribosomal proteins in the Fert- cows compared with
Fert+ suggests differences between genotypes in translation initiation in luteal cells
(Costello et al., 2015). Many of the DEG i.e. CEP250AU, CDC-like kinase 4 (CLK4IE),
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 (DDX46), EIF4EBP3, PABPN1,
PRPF39*, RECQL5AU, RPS9* and Tumor necrosis factor receptor superfamily member
10D (TNFRSF10DIE) identified QTL regions associated with fertility. Evidence for the
202
importance of mRNA processing for fertility performance in dairy cows is further
strengthened by sequence variants in or within two kb upstream and downstream of
PRPF39*, RPS9* and EIF4EBP3 being associated fertility. Interestingly, the missense
variant of EIF4EBE was predicted to be deleterious to protein function.
6.6.5 Immune-related QTL Regions and Sequence Variants Associated with

Fertility
A properly functioning immune system is essential to animal health and fertility. In
support of this, immune-related genes were differentially expressed between the Fert+
and Fert- cows that identified QTL regions and sequence variants associated with
fertility. Greater endometrial expression of SAA3* in the Fert- cows compared with
Fert+ cows is indicative of the severity of subclinical endometritis (Walker et al., 2015)
and endometrial inflammation (Chapwanya et al., 2009a) in cattle. Inflammation should
have been absent when the endometrial biopsies were collected based on the report of
Chapwanya et al. (2012). Our results suggest a prolonged inflammatory response in
Fert- cows, which is supported by their greater endometrial expression of SPP1 (Ashkar
et al., 2000, Sorokin, 2010). These alterations to the local immune system are likely a
result of a prolonged chronic infection in Fert- cows, consistent with our previous
observation of postpartum uterine infection assessed by vaginal mucus scores and
endometrial cytology (Moore et al., 2014a). The negative effects of increased
endometrial polymorphonuclear neutrophil infiltration on phenotypic fertility are well
established (Drillich et al., 2012, Hoelker et al., 2012).
Endometrial and luteal expression of LILRA6* and luteal expression of LENG8*

was lesser in Fert- cows compared with Fert+ cows. Both LILRA6* and LENG8* are
members of the leukocyte receptor cluster (Barrow and Trowsdale, 2008). The QTL
regions around both genes are located close to a haplotype on BTA18 associated with
calving interval in the Australian dairy cattle population (Pryce et al., 2010) and
sequence variants in or within two kb upstream and downstream of both genes were
significantly associated with fertility. Luteal expression of major histocompatabity
complex (MHC) NC3*50201 was greater in Fert- cows compared with Fert+ cows. In
cattle, the MHC is identified as bovine leukocyte antigen (BoLA) and is located on
BTA23. A recent GWAS of immune response traits in Canadian Holstein cattle
(Thompson-Crispi et al., 2014) reported that >90% of SNP associated with antibody-
mediated immune response were located on BTA 23. Luteal expression of IFITM2* and
203
complement component 3 (C3AU) was greater in Fert- cows compared with Fert+ cows.
IFITM2* is a member of the interferon-induced transmembrane gene family that, in
pigs, is involved in antiviral activities (Miller et al., 2014). The complement system, of
which C3AU is a member, is part of the innate immune system. C3AU deficient mice
have reduced levels of mast cell granulation, TNF-α production, neutrophil infiltration
and clearance of bacteria (Prodeus et al., 1997).
The expression profile of the immune-related genes in the CL may be associated

with premature luteal regression in the Fert- cows, as immune function is central to CL
regression and influxes of macrophages, monocytes and T lymphocytes have been
described prior to the onset of luteolysis (Penny et al., 1999, Bauer et al., 2001,
Walusimbi et al., 2013). This interpretation further supports our summarization above
and previously, that CL function is compromised in Fert- cows (Cummins et al., 2012b,
Moore et al., 2014b).
6.6.6 Energy Status-related QTL Region Associated with Fertility

Previously, we reported that Fert+ cows have greater postpartum dry matter intake,
adipose reserves and circulating concentrations of insulin, glucose and insulin-like
growth factor-1 (Cummins et al., 2012a,c, Moore et al., 2014a,b). PRKAG3AU encodes
for the γ3-subunit of the adenosine monophosphate-activated kinase (AMPK) complex,
the primary energy sensor in eukaryotic cells (Hardie et al., 2012, Hardie, 2014).
Differential expression of the γ3-subunit in the endometrium may represent a
mechanism linking whole-animal bioenergetic status and the local endometrium
bioenergetic status.
204
6.7 Conclusions
The study highlights the usefulness of the Fert+/Fert- lactating cow genetic model of
fertility for elucidating the genetic control of dairy cow reproductive performance. This
is the first study to examine the transcriptome of the endometrium and the CL on day 13
of the oestrous cycle in Holstein cows genetically divergent for fertility. The DEG
indicate a complex dialogue between the CL and the endometrium that influences the
likelihood of pregnancy establishment via effects on circulating P4 concentrations and
the uterine environment. Fert- cows had an endometrial expression profile indicative of
an on-going inflammatory response that presumably started following exposure to
pathogens after parturition. Furthermore, the validation of candidate genes using the
GWAS analysis of large dairy cattle populations in two countries and sequence variant
identification highlighted the value of this model for identifying genomic regions and
variants associated with the reproductive performance in independent dairy cattle
populations. The variants identified here could be incorporated in genomic prediction of
dairy cow fertility, to improve rates of genetic gain for this critical trait. Finally the
DEG identified here add to the list of potential candidate genes affecting female fertility
in lowly fecund mammals.
205
6.8 References
Aschebrook-Kilfoy, B., M. Argos, B. L. Pierce, L. Tong, F. Jasmine, S. Roy, F. Parvez,

A. Ahmed, T. Islam, M. G. Kibriya, and H. Ahsan. 2015. Genome-Wide
Association Study of Parity in Bangladeshi Women. Plos One 10(3):e0118488.
Ashkar, S., G. F. Weber, V. Panoutsakopoulou, M. E. Sanchirico, M. Jansson, S.
Zawaideh, S. R. Rittling, D. T. Denhardt, M. J. Glimcher, and H. Cantor. 2000.
Eta-1 (Osteopontin): An Early Component of Type-1 (Cell-Mediated) Immunity.
Science 287(5454):860-864.
Atli, M. O., R. W. Bender, V. Mehta, M. R. Bastos, W. Luo, C. M. Vezina, and M. C.
Wiltbank. 2012. Patterns of Gene Expression in the Bovine Corpus Luteum
Following Repeated Intrauterine Infusions of Low Doses of Prostaglandin
F2alpha. Biology of Reproduction 86(4):130, 131-113.
Barrow, A. D. and J. Trowsdale. 2008. The extended human leukocyte receptor
complex: diverse ways of modulating immune responses. Immunological
Reviews 224(1):98-123.
Bauer M, Reibiger I, Spanel-Borowski K. Leucocyte proliferation in the bovine corpus
luteum. Reproduction. 2001;121(2):297-305.
Benjamini, Y. and Y. Hochberg. 1995. Controlling the False Discovery Rate: A
Practical and Powerful Approach to Multiple Testing. Journal of the Royal
Statistical Society. Series B (Methodological) 57(1):289-300.
Berry, D. P., J. W. M. Bastiaansen, R. F. Veerkamp, S. Wijga, E. Wall, B. Berglund,
and M. P. L. Calus. 2012. Genome-wide associations for fertility traits in
Holstein–Friesian dairy cows using data from experimental research herds in
four European countries. Animal 6(08):1206-1215.
Berry, D. P. and J. F. Kearney. 2011. Imputation of genotypes from low- to high-density
genotyping platforms and implications for genomic selection. Animal
5(08):1162-1169.
performance in dairy and beef cattle. Animal 8(Supplements1):105-121.
for management of reproduction in dairy cows. Animal 8(Supplements1):151-
159.
Browning, S. R. and B. L. Browning. 2007. Rapid and Accurate Haplotype Phasing and
Missing-Data Inference for Whole-Genome Association Studies By Use of
206
Localized Haplotype Clustering. The American Journal of Human Genetics
81(5):1084-1097.
Butler, S. T. 2013. Genetic control of reproduction in dairy cows. Reproduction,
Fertility and Development 26(1):1-11.
pasture-based systems. Animal 8(Supplements1):15-26.
Chapwanya, A., K. G. Meade, M. L. Doherty, J. J. Callanan, J. F. Mee, and C.
O’Farrelly. 2009a. Histopathological and molecular evaluation of Holstein-
Friesian cows postpartum: Toward an improved understanding of uterine innate
immunity. Theriogenology 71(9):1396-1407.
Chapwanya, A., K. G. Meade, C. Foley, F. Narciandi, A. C. O. Evans, M. L. Doherty, J.
J. Callanan, and C. O’Farrelly. 2012. The postpartum endometrial inflammatory
response: a normal physiological event with potential implications for bovine
fertility. Reproduction, Fertility and Development 24(8):1028-1039.
Chapwanya, A., K. G. Meade, F. Narciandi, P. Stanley, J. F. Mee, M. L. Doherty, J. J.
Callanan, and C. O'Farrelly. 2009b. Endometrial biopsy: a valuable clinical and
research tool in bovine reproduction. Theriogenology 73(7):988-994.
Chen, K., J. W. Wallis, M. D. McLellan, D. E. Larson, J. M. Kalicki, C. S. Pohl, S. D.
McGrath, M. C. Wendl, Q. Zhang, D. P. Locke, X. Shi, R. S. Fulton, T. J. Ley,
R. K. Wilson, L. Ding, and E. R. Mardis. 2009. BreakDancer: an algorithm for
high-resolution mapping of genomic structural variation. Nature Methods
6(9):677-681.
Chomczynski, P. and N. Sacchi. 1987. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry
162(1):156-159.
Cochran, S., J. Cole, D. Null, and P. Hansen. 2013. Discovery of single nucleotide
polymorphisms in candidate genes associated with fertility and production traits
in Holstein cattle. BMC Genetics 14(1):49.
Cole, J., G. Wiggans, L. Ma, T. Sonstegard, T. Lawlor, B. Crooker, C. Van Tassell, J.
Yang, S. Wang, L. Matukumalli, and Y. Da. 2011. Genome-wide association
analysis of thirty one production, health, reproduction and body conformation
traits in contemporary U.S. Holstein cows. BMC Genomics 12(1):408.
Costello, J., L. Castelli, W. Rowe, C. Kershaw, D. Talavera, S. Mohammad-Qureshi, P.
Sims, C. Grant, G. Pavitt, S. Hubbard, and M. Ashe. 2015. Global mRNA
selection mechanisms for translation initiation. Genome Biology 16(1):10.
207
95(7):3698-3710.
Science 95(7):3711-3721.
Daetwyler, H. D., A. Capitan, H. Pausch, P. Stothard, R. van Binsbergen, R. F.
Brondum, X. Liao, A. Djari, S. C. Rodriguez, C. Grohs, D. Esquerre, O.
Bouchez, M.-N. Rossignol, C. Klopp, D. Rocha, S. Fritz, A. Eggen, P. J.
Bowman, D. Coote, A. J. Chamberlain, C. Anderson, C. P. VanTassell, I.
Hulsegge, M. E. Goddard, B. Guldbrandtsen, M. S. Lund, R. F. Veerkamp, D. A.
Boichard, R. Fries, and B. J. Hayes. 2014. Whole-genome sequencing of 234
bulls facilitates mapping of monogenic and complex traits in cattle. Nature
Genetics 46(8):858-865.
Drillich, M., D. Tesfaye, F. Rings, K. Schellander, W. Heuwieser, and M. Hoelker.
2012. Effects of polymorphonuclear neutrophile infiltration into the endometrial
environment on embryonic development in superovulated cows. Theriogenology
77(3):570-578.
Ealy, A. D. and Q. E. Yang. 2009. Control of Interferon-Tau Expression During Early
Pregnancy in Ruminants. American Journal Of Reproductive Immunology
61(2):95-106.
Erbe, M., B. J. Hayes, L. K. Matukumalli, S. Goswami, P. J. Bowman, C. M. Reich, B.
A. Mason, and M. E. Goddard. 2012. Improving accuracy of genomic
predictions within and between dairy cattle breeds with imputed high-density
single nucleotide polymorphism panels. Journal of Dairy Science 95(7):4114-
4129.
208
Farberov, S. and R. Meidan. 2014. Functions and Transcriptional Regulation of
Thrombospondins and Their Interrelationship with Fibroblast Growth Factor-2
in Bovine Luteal Cells. Biology of Reproduction 91(3):58, 51-10.
Forde, N., P. A. McGettigan, J. P. Mehta, L. O'Hara, S. Mamo, F. W. Bazer, T. E.
Spencer, and P. Lonergan. 2014a. Proteomic analysis of uterine fluid during the
pre-implantation period of pregnancy in cattle. Reproduction 147(5):575-587.
2013. Alterations in expression of endometrial genes coding for proteins
secreted into the uterine lumen during conceptus elongation in cattle. BMC
Genomics 14(1):321.
Forde, N., F. Carter, T. E. Spencer, F. W. Bazer, O. Sandra, N. Mansouri-Attia, L. A.
Okumu, P. A. McGettigan, J. P. Mehta, R. McBride, P. O'Gaora, J. F. Roche,
and P. Lonergan. 2011. Conceptus-Induced Changes in the Endometrial
Transcriptome: How Soon Does the Cow Know She Is Pregnant? Biology of
Forde, N., C. A. Simintiras, R. Sturmey, S. Mamo, A. K. Kelly, T. E. Spencer, F. W.
Bazer, and P. Lonergan. 2014b. Amino Acids in the Uterine Luminal Fluid
Reflects the Temporal Changes in Transporter Expression in the Endometrium
and Conceptus during Early Pregnancy in Cattle. Plos One 9(6):e100010.
Fung, J. N., P. A. W. Rogers, and G. W. Montgomery. 2015. Identifying the Biological
Basis of GWAS Hits for Endometriosis. Biology of Reproduction 92(4):87, 81-
12.
Garrick, D., J. Taylor, and R. Fernando. 2009. Deregressing estimated breeding values
and weighting information for genomic regression analyses. Genetics Selection
Evolution 41(1):55.
Goff, A. K. 2004. Steroid Hormone Modulation of Prostaglandin Secretion in the
Ruminant Endometrium During the Estrous Cycle. Biology of Reproduction
71(1):11-16.
Hardie, D. G. and M. L. J. Ashford. 2014. AMPK: Regulating Energy Balance at the
Cellular and Whole Body Levels. Physiology 29(2):99-107.
209
Hardie, D. G., F. A. Ross, and S. A. Hawley. 2012. AMPK: a nutrient and energy sensor
that maintains energy homeostasis. Nature Reviews. Molecular Cell Biology
13(4):251-262.
synchronization treatments on ovarian follicular dynamics, corpus luteum
growth, and circulating steroid hormone concentrations in lactating dairy cows.
Hoelker, M., D. Salilew-Wondim, M. Drillich, G.-B. Christine, N. Ghanem, L. Goetze,
D. Tesfaye, K. Schellander, and W. Heuwieser. 2012. Transcriptional response
of the bovine endometrium and embryo to endometrial polymorphonuclear
neutrophil infiltration as an indicator of subclinical inflammation of the uterine
environment. Reproduction, Fertility and Development 24(6):778-793.
Hoglund, J., G. Sahana, B. Guldbrandtsen, and M. Lund. 2014. Validation of
associations for female fertility traits in Nordic Holstein, Nordic Red and Jersey
dairy cattle. BMC Genetics 15(1):8.
Huang, W., B. W. Kirkpatrick, G. J. M. Rosa, and H. Khatib. 2010. A genome-wide
association study using selective DNA pooling identifies candidate markers for
fertility in Holstein cattle. Animal Genetics 41(6):570-578.
Jeyasuria, P., Y. Ikeda, S. P. Jamin, L. Zhao, D. G. de Rooij, A. P. N. Themmen, R. R.
Behringer, and K. L. Parker. 2004. Cell-Specific Knockout of Steroidogenic
Factor 1 Reveals Its Essential Roles in Gonadal Function. Molecular
Joseph, C., M. G. Hunter, K. D. Sinclair, and R. S. Robinson. 2012. The expression,
regulation and function of secreted protein, acidic, cysteine-rich in the follicle–
luteal transition. Reproduction 144(3):361-372.
Kadri, N. K., G. Sahana, C. Charlier, T. Iso-Touru, B. Guldbrandtsen, L. Karim, U. S.
Nielsen, F. Panitz, G. P. Aamand, N. Schulman, M. Georges, J. Vilkki, M. S.
Lund, and T. Druet. 2014. A 660-Kb Deletion with Antagonistic Effects on
Fertility and Milk Production Segregates at High Frequency in Nordic Red
Cattle: Additional Evidence for the Common Occurrence of Balancing Selection
in Livestock. PLoS Genetics 10(1):e1004049.
Kanehisa, M., S. Goto, Y. Sato, M. Kawashima, M. Furumichi, and M. Tanabe. 2014.
Data, information, knowledge and principle: back to metabolism in KEGG.
Nucleic Acids Research 42(D1):D199-D205.
210
Kosova, G., Nicole M. Scott, C. Niederberger, Gail S. Prins, and C. Ober. 2012.
Genome-wide Association Study Identifies Candidate Genes for Male Fertility
Traits in Humans. The American Journal of Human Genetics 90(6):950-961.
Kot, K., L. E. Anderson, S. J. Tsai, M. C. Wiltbank, and O. J. Ginther. 1999.
Transvaginal, ultrasound-guided biopsy of the corpus luteum in cattle.
Lacroix-Pepin, N., G. Danyod, N. Krishnaswamy, S. Mondal, P. Rong, P. Chapdelaine,
and M. A. Fortier. 2011. The Multidrug Resistance-Associated Protein 4
(MRP4) Appears as a Functional Carrier of Prostaglandins Regulated by
Oxytocin in the Bovine Endometrium. Endocrinology 152(12):4993-5004.
Lalli, E., M. Doghman, P. Latre de Late, A. E. Wakil, and I. Mus-Veteau. 2013. Beyond
steroidogenesis: Novel target genes for SF-1 discovered by genomics. Molecular
and Cellular Endocrinology 371(1–2):154-159.
Liao, Y., G. K. Smyth, and W. Shi. 2014. featureCounts: an efficient general purpose
program for assigning sequence reads to genomic features. Bioinformatics
30(7):923-930.
Liu, Y., B. P. Johnson, A. L. Shen, J. A. Wallisser, K. J. Krentz, S. M. Moran, R.
Sullivan, E. Glover, A. F. Parlow, N. R. Drinkwater, L. A. Schuler, and C. A.
Bradfield. 2014. Loss of BMAL1 in ovarian steroidogenic cells results in
implantation failure in female mice. Proceedings of the National Academy of
Sciences 111(39):14295-14300.
Meidan, R. 2014. Corpus luteum regression or maintenance: a duel between
prostaglandins and interferon tau. Pages 345-358 in Reproduction in Domestic
Ruminants VIII. J. L. Juengel, A. Miyamoto, C. Price, L. P. Reynolds, M. F.
Smith, and R. Webb, ed. Society for Reproduction and Fertility, UK.
Meyer, K. 2007. WOMBAT—A tool for mixed model analyses in quantitative genetics
by restricted maximum likelihood (REML). Journal of Zhejiang University
Science B 8(11):815-821.
Miller, L. C., Z. Jiang, Y. Sang, G. P. Harhay, and K. M. Lager. 2014. Evolutionary
characterization of pig interferon-inducible transmembrane gene family and
211
member expression dynamics in tracheobronchial lymph nodes of pigs infected
with swine respiratory disease viruses. Veterinary Immunology and
Immunopathology 159(3–4):180-191.
Mlynarczuk, J., M. H. Wrobel, R. Rekawiecki, and J. Kotwica. 2013. The expression of
Steroidogenic Factor-1 and its role in bovine steroidogenic ovarian cells during
the estrus cycle and first trimester of pregnancy. Animal Reproduction Science
138(1–2):74-81.
Mondal, M., B. Schilling, J. Folger, J. P. Steibel, H. Buchnick, Y. Zalman, J. J. Ireland,
R. Meidan, and G. W. Smith. 2011. Deciphering the luteal transcriptome:
potential mechanisms mediating stage-specific luteolytic response of the corpus
luteum to prostaglandin F2α. Physiological Genomics 43(8):447-456.
Moore, S. G., T. Fair, P. Lonergan, and S. T. Butler. 2014a. Genetic merit for fertility
traits in Holstein cows: IV. Transition period, uterine health, and resumption of
cyclicity. Journal of Dairy Science 97(5):2740-2752.
Moore, S. G., S. Scully, J. A. Browne, T. Fair, and S. T. Butler. 2014b. Genetic merit
for fertility traits in Holstein cows: V. Factors affecting circulating progesterone
concentrations. Journal of Dairy Science 97(9):5543-5557.
Ng, P. C. and S. Henikoff. 2003. SIFT: predicting amino acid changes that affect
protein function. Nucleic Acids Research 31(13):3812-3814.
Pausch, H., S. Kölle, C. Wurmser, H. Schwarzenbacher, R. Emmerling, S. Jansen, M.
Trottmann, C. Fuerst, K.-U. Götz, and R. Fries. 2014. A Nonsense Mutation in
TMEM95 Encoding a Nondescript Transmembrane Protein Causes Idiopathic
Male Subfertility in Cattle. PLoS Genetics 10(1):e1004044.
Pelusi, C., Y. Ikeda, M. Zubair, and K. L. Parker. 2008. Impaired Follicle Development
and Infertility in Female Mice Lacking Steroidogenic Factor 1 in Ovarian
Granulosa Cells. Biology of Reproduction 79(6):1074-1083.
Penny LA, Armstrong D, Bramley TA, Webb R, Collins RA, Watson ED. Immune cells
and cytokine production in the bovine corpus luteum throughout the oestrous
cycle and after induced luteolysis. Journal of Reproduction and Fertility.
1999;115(1):87-96.
Pilorz, V. and S. Steinlechner. 2008. Low reproductive success in Per1 and Per2 mutant
mouse females due to accelerated ageing? Reproduction 135(4):559-568.
Pimentel, E. C. G., S. Bauersachs, M. Tietze, H. Simianer, J. Tetens, G. Thaller, F.
Reinhardt, E. Wolf, and S. König. 2011. Exploration of relationships between
production and fertility traits in dairy cattle via association studies of SNPs
212
within candidate genes derived by expression profiling. Animal Genetics
42(3):251-262.
Prodeus, A. P., X. Zhou, M. Maurer, S. J. Galli, and M. C. Carroll. 1997. Impaired mast
cell-dependent natural immunity in complement C3-deficient mice. Nature
390(6656):172-175.
Pryce, J. E., S. Bolormaa, A. J. Chamberlain, P. J. Bowman, K. Savin, M. E. Goddard,
and B. J. Hayes. 2010. A validated genome-wide association study in 2 dairy
cattle breeds for milk production and fertility traits using variable length
haplotypes. Journal of Dairy Science 93(7):3331-3345.
Pryce, J. E., R. Woolaston, D. P. Berry, E. Wall, M. Winters, R. Butler, and M. Shaffer.
2014. World Trends in Dairy Cow Fertility. Proceedings, 10th World Congress
of Genetics Applied to Livestock Production.
Purfield, D. C., D. G. Bradley, J. F. Kearney, and D. P. Berry. 2014. Genome-wide
association study for calving traits in Holstein–Friesian dairy cattle. Animal
8(02):224-235.
R Development Core Team, 2014. R Foundation for Statistical Computing, Vienna,
Austria. http://www.R-project.org.
Raven, L.-A., B. Cocks, M. Goddard, J. Pryce, and B. Hayes. 2014. Genetic variants in
mammary development, prolactin signalling and involution pathways explain
considerable variation in bovine milk production and milk composition.
Genetics Selection Evolution 46(1):29.
Robinson, M., D. McCarthy, and G. Smyth. 2010. edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics
26:139-140.
Robinson, R. S., A. J. Hammond, D. C. Wathes, M. G. Hunter, and G. E. Mann. 2008.
Corpus Luteum–Endometrium–Embryo Interactions in the Dairy Cow:
Underlying Mechanisms and Clinical Relevance. Reproduction in Domestic
Animals 43:104-112.
Robinson, R. S., K. J. Woad, M. G. Hunter, K. D. Sinclair, M. Laird, C. Joseph, A. J.
Hammond, and G. E. Mann. 2014. Corpus luteum development and
angiogenesis. in Reproduction in Domestic Ruminants VIII. J. L. Juengel, A.
Miyamoto, C. Price, L. P. Reynolds, M. F. Smith, and R. Webb, ed. Society for
Reproduction and Fertility, UK.
213
Sage, E. H. and P. Bornstein. 1991. Extracellular proteins that modulate cell-matrix
interactions. SPARC, tenascin, and thrombospondin. J Biol Chem
266(23):14831-14834.
Sahana, G., B. Guldbrandtsen, C. Bendixen, and M. S. Lund. 2010. Genome-wide
association mapping for female fertility traits in Danish and Swedish Holstein
cattle. Anim Genet 41(6):579-588.
Sellix, M. T. 2014. Circadian Clock Function in the Mammalian Ovary. Journal of
Biological Rhythms.
Sewer, M. and D. Li. 2008. Regulation of Steroid Hormone Biosynthesis by the
Cytoskeleton. Lipids 43(12):1109-1115.
Sorokin, L. 2010. The impact of the extracellular matrix on inflammation. Nat Rev
Immunol 10(10):712-723.
Spencer, T. E., O. Sandra, and E. Wolf. 2008. Genes involved in conceptus-endometrial
interactions in ruminants: insights from reductionism and thoughts on holistic
approaches. Reproduction 135(2):165-179.
Thompson-Crispi, K., M. Sargolzaei, R. Ventura, M. Abo-Ismail, F. Miglior, F.
Schenkel, and B. Mallard. 2014. A genome-wide association study of immune
response traits in Canadian Holstein cattle. BMC Genomics 15(1):559.
Thurn, P. E. and A. E. McClintock. 2003. Twenty years of genetic progress in
Australian Holsteins. Vol. 15. Proceedings of the Association for the
Advancement of Animal Breeding and Genetics
Urlep, Z. and D. Rozman. 2013. The interplay between circadian system, cholesterol
synthesis, and steroidogenesis affects various aspects of female reproduction.
Frontiers in Endocrinology 4.
Walker, C. G., S. Meier, H. Hussein, S. McDougall, C. R. Burke, J. R. Roche, and M.
D. Mitchell. 2015. Modulation of the immune system during post-partum uterine
inflammation.
123(3–4):127-138.
Walusimbi SS, Pate JL. Physiology and Endocrinology Symposium: role of immune
cells in the corpus luteum. Journal of Animal Science. 2013;91(4):1650-9.
Wang, L., S. Wang, and W. Li. 2012. RSeQC: quality control of RNA-seq experiments.
Bioinformatics 28(16):2184-2185.
214
Yamazaki, H. and T. Shimada. 1997. Progesterone and Testosterone Hydroxylation by
Cytochromes P450 2C19, 2C9, and 3A4 in Human Liver Microsomes. Arch
Biochem Biophys 346(1):161-169.
Zimin, A., A. Delcher, L. Florea, D. Kelley, M. Schatz, D. Puiu, F. Hanrahan, G. Pertea,
C. Van Tassell, T. Sonstegard, G. Marcais, M. Roberts, P. Subramanian, J.
Yorke, and S. Salzberg. 2009. A whole-genome assembly of the domestic cow,
Bos taurus. Genome Biology 10(4):R42.
215
Chapter Seven
General Discussion
7.1 Summary
The objectives of the studies described in this thesis were to elucidate the physiological
mechanisms contributing to phenotypic fertility differences between cows with similar
proportions of Holstein genetics, similar genetic merit for milk production traits, but
with good (Fert+) or poor (Fert-) genetic merit for calving interval. The studies
specifically focused on characterising milk production, dry matter intake, energy status,
adipose mobilisation, circulating concentrations of metabolites and metabolic
hormones, uterine health, ovarian activity, circulating concentrations of reproductive
hormones, progesterone metabolic clearance rate, hepatic mRNA of progesterone
catabolic enzymes, fatty acid and amino acid concentrations in follicular fluid and
serum, and the transcriptomes of the endometrium and corpus luteum in this unique
lactating cow genetic model of fertility. Genomic regions and variants associated with
fertility were identified.
7.2 Chapter 2 – Literature Review

Objective: To provide an up to date review of the literature on dairy cow fertility
 Dairy production in Ireland is primarily pasture-based, centred on achieving
high milk solids production per cow and per hectare. A compact calving
pattern, defined as 90% of the herd calving in six weeks, facilitates maximal
utilisation of grazed pasture in the diet, and is critical for the productivity and
profitability of the farm.
 In recent decades, the reproductive performance of Irish dairy cows declined.
This was primarily due to genetic selection solely for milk production, and the
introgression of North American Holstein genes.
 In the past decade, the reproductive performance of Irish dairy cows has begun
to improve. This is primarily due to the use of a multi trait selection index
(Economic Breeding Index) that has placed sufficient emphasis (currently
34.9%) on fertility traits.
216
 Disruption of the postpartum recovery of uterine heath, delayed resumption of
ovarian cyclicity, abnormal concentrations of reproductive hormones,
suboptimal follicular and uterine environments, reduced oocyte competence
and compromised embryo development have been implicated in reduced
reproductive performance in dairy cows.
 Reproductive performance of dairy cows is under genetic control. Substantial
variation in phenotypic fertility performance exists between dairy breeds,
strains of Holstein and genotypes that have varying genetic merit for fertility
traits.
7.3 Chapter 3 - Genetic Merit for Fertility Traits in Holstein cows: Transition
Period, Uterine Health and Resumption of Cyclicity
Objective: To determine the effect of genetic merit for fertility traits on DMI, energy
balance, blood indicators of metabolic status during late gestation and the early lactation
period, postpartum uterine health and the resumption of ovarian cyclicity.
 Twenty six (15 Fert+ and 11 Fert-) cows were enrolled in the study. Dry matter
intake, metabolic status and uterine health were recorded during the transition
and early lactation periods. The resumption of ovarian cyclicity was determined
and milk production and body condition score were recorded throughout the
lactation.
 Fert+ cows had 17% greater daily DMI than Fert- cows (P = 0.02) during the
early postpartum period. Energy balance was greater in Fert+ cows only during
the first week postpartum (2.3 vs. -1.12 UFL/d, P = 0.02).
 Fert+ cows had more favourable metabolic status compared with Fert- cows.
Circulating concentrations of IGF1, insulin and glucose were 81% (P = 0.001),
24% (P = 0.08) and 13% (P = 0.04) greater in Fert+ cows compared with Fert-
cows, respectively. Fert+ cows also maintained 9% greater mean BCS units (P <
0.001) throughout lactation compared with Fert- cows.
 Fert+ cows had 9% greater daily milk solids production (P = 0.05) and tended to
have 9% greater daily milk yield (P = 0.08) throughout lactation.
 Fert+ cows had better uterine health compared with Fert- cows as determined by
weekly vaginal mucus scores for the first eight weeks postpartum and evaluation
of uterine cytology for the presence of polymorphonuclear neutrophils at week
three and six postpartum. Fert+ cows had lower vaginal mucus scores during
217
weeks two to six postpartum. Uterine cytology indicated that a smaller
proportion had endometritis at weeks three (0.42 vs. 0.78, P = 0.09) and six
(0.25 vs. 0.75, P = 0.04).
 A greater proportion of Fert+ cows had resumed cyclicity by week 6 postpartum
(0.86 vs. 0.20, P = 0.009) compared with Fert- cows.
 The more favourable fertility phenotypes of the Fert+ cows were achieved
 This chapter demonstrates that genetic merit for fertility traits is associated with
postpartum uterine health status and earlier resumption of cyclicity, potentially
mediated through differences in DMI, energy balance, insulin, IGF1and BCS
profiles.
7.4 Chapter 4 - Genetic Merit for Fertility Traits in Holstein cows: Factors
Affecting Circulating Progesterone Concentrations
Objective: To determine the effect of genetic merit for fertility traits on the factors
affecting circulating P4 concentrations in Fert+ and Fert- cows.
 This chapter consisted of two studies:

 Study 1: At 61±13 (± SD) days postpartum, 28 cows (15 Fert+, 13 Fert-) were
enrolled on an ovulation synchronisation protocol. Progesterone concentrations
were determined from d 0 to 9 (d 0 = oestrus), and on d 7 CL volume and BFA
were measured. Hepatic mRNA abundance of genes involved in P4 catabolism
and the metabolic clearance rate of progesterone were determined.
 Fert+ cows tended to have 3.6% greater DMI compared with Fert- cows (P =
0.06), but similar milk yield (P = 0.98).
 The rate of increase in circulating P4 concentrations after ovulation was greater
in Fert+ cows compared with Fert- cows (P = 0.03). There was no effect of
genotype on CL volume, but BFA was 42% greater (P = 0.03) in Fert+ cows
compared with Fert- cows.
 Fert- cows had greater mRNA abundance of CYP3A (P = 0.05) compared with
Fert+ cows, but mRNA abundance of AKR1C1, AKR1C3, AKR1C4 and CYP2C
were similar (all P > 0.2).
 The half-life and MCR of P4 were similar (both P > 0.7) in Fert+ cows and Fert-
cows.
218
 Study 2: At 55±7 (± SD) days postpartum, 23 cows (13 Fert+, 10 Fert-) were
enrolled on an ovulation synchronisation protocol.
 On d 4, 7, 10 and 13 (d 0 = oestrus), CL volume and BFA were measured.
Circulating P4 concentrations were measured from d 1 to 13.
 Fert+ cows had 41% greater CL volume (P 0.04) compared with Fert- cows but
there was no effect of genotype on BFA (P = 0.15). Circulating P4
concentrations were 79% greater (P < 0.0001) in Fert+ cows compared with
Fert- cows. Milk yield was similar in both genotypes (P = 0.81).
 This chapter demonstrates that greater circulating P4 concentrations were
primarily due to greater CL P4 synthetic capacity rather than differences in P4
clearance.
7.5 Chapter 5 - Differences in Follicular Fluid and Serum Metabolites between

Holstein Cows Selected for High and Low Fertility are Predictive of Fertility
Genotype
Objective: To characterise the fatty acid and amino acid composition of follicular fluid
and serum collected on d 7 of the oestrous cycle from Fert+ and Fert- cows, and to
identify potential biomarkers of fertility in dairy cows.
 Twenty-eight lactating dairy cows (15 Fert+, 13 Fert-) and seven non-lactating
dairy cows (3 Fert+, 4 Fert-) were enrolled on an ovulation synchronisation
protocol at 60±14 (± SD) and 605±78 (± SD) days postpartum, respectively. All
cows were fed a total mixed ration diet during the study.
 On day 7 of the oestrous cycle (0 = oestrus), follicular fluid from the largest
follicle and serum were collected. Metabolite concentrations were determined by
gas chromatography mass spectrometry.
 Follicular fluid concentrations of the predominant fatty acids were not affected
by genotype; however, alterations to the abundance of seven fatty acids that
collectively accounted for 1.7% of the total fatty acid content may reflect small
but important differences to the follicular microenvironment.
 In serum, greater abundance of total PUFA and n-6 PUFA in Fert+ cows, and
greater abundance of total SFA in Fert- cows represented the most pronounced
effect of genotype in the study. Follicular fluid and serum concentrations of four
and five amino acids were significantly affected by genotype, respectively.
219
 Receiver operating characteristic curve analysis indicated that the follicular fluid
and serum fatty acids and follicular fluid amino acids that were significantly
affected by genotype were potential candidates to successfully predict fertility
genotype.
7.6 Chapter 6 - Differentially Expressed Genes in the Endometrium and Corpus

Luteum of Holstein cows Selected for High and Low Fertility are Enriched for
Sequence Variants Associated with Fertility
Objectives: (i) to determine if aberrant gene expression in the endometrium and corpus
luteum is a contributor to the phenotypic fertility differences observed between cows
divergent in genetic for reproductive performance; (ii) to enhance our understanding of
the genetic architecture of fertility; and (iii) to identify genetic variants that could be
used to accelerate genomic selection for improved fertility in dairy cattle.
 Fourteen cows (8 Fert+, 6 Fert-) were enrolled on an ovulation synchronisation

protocol at 55 ± 7 (± SD) days postpartum and biopsies of the endometrium and
corpus luteum were collected on d 13 of the oestrous cycle.
 cDNA libraries generated from extracted RNA were sequenced on the Illumina
HiSeq 2500 platform. Differential expression analysis was performed using the
edgeR package.
 Fertility genome-wide association studies of greater than 20,000 Irish and
Australian dairy cattle were performed.
 In the endometrium, nine genes were differentially expressed between Fert+ and
Fert- cows. In the corpus luteum, 560 genes were differentially expressed
between Fert+ and Fert- cows.
 Concordance analysis between differentially expressed genes and genome-wide
association studies revealed 355 QTL regions primarily associated with
prostaglandin F2α, steroidogenesis, mRNA processing, immune-related processes
and cellular energy sensing.
 Of the 355 QTL regions, 93 were validated by both the Australian and Irish
dairy populations, with signals for fertility detected primarily on BTA18, 5, 7, 8
and 29.
 The fertility genome-wide association study with imputed sequence data
identified 17 variants associated with fertility representing plausible causal
mutations. One missense variant was predicted to affect the protein function of
220
eukaryotic translation initiation factor 4E binding protein 3, a gene involved in
translation initiation.
221
7.7 Limitations
7.7.1 Sample Size
Maintaining herd size is an issue when fertility is compromised. Since the establishment
of the Fert+/Fert- animal model, breeding a sufficient number of female replacements
was difficult. This problem was most apparent in the Fert- genotype compared with the
Fert+ genotype. Interestingly, marked phenotypic differences were detected between
genotypes despite the small sample size.
7.7.2 Endometrial Biopsy

An inherent issue with the endometrial biopsy technique was the small tissue sample
collected. Because it was necessary to prioritise the sample for differential expression
analysis, it was not possible to determine by histology if the endometrial sample was
caruncular or intercaruncular tissue. This unknown may have introduced some
unaccounted-for variation to the RNA-seq dataset.
7.7.3 Association versus Causation

The research experiments described in this thesis were primarily established to identify
the phenotypic difference that existed between Fert+ and Fert- cows. The observed
differences in uterine health or resumption of ovarian cyclicity may be attributed to
differences in circulating concentrations of insulin, glucose and IGF1, but it was not
possible to reveal the mechanisms. Greater DMI in Fert+ cows may explain their greater
metabolic status, but the regulation of voluntary feed intake of was not examined. The
more rapid of increase in circulating E2 (follicular phase) and P4 concentrations (luteal
phase) may be important contributors to oestrous behaviour, alterations in the
endometrial transcriptome and to embryo development, but the mechanisms that were
responsible for differences in follicle and CL development and steroidogenesis between
Fert+ and Fert- cows are not yet understood.
7.8 Future Work

7.8.1 Validation of Detailed Phenotypes
Phenotypes identified in these studies as being under the control of genetic merit for
fertility include resumption of ovarian cyclicity, uterine health, metabolic status and
hormonal environment. The potential usefulness of these deep phenotypes as fertility
biomarkers needs to be first validated using a larger group of dairy cows.
222
7.8.2 Further Characterisation of Fert+ and Fert- cows
If a larger sample size became available in the future, it could be possible to perform
more in depth studies to further explore the effect of genetic merit for fertility on
fertility phenotypes. Possible experiments might include: (i) elucidating the mechanisms
influencing immune function; (ii) artificial manipulation of circulating P4
concentrations in both genotypes; (iii) nutritional studies to alter the energy intake of
both genotypes; and (iv) examination of the variation in circulating concentrations of
metabolites and reproductive hormones within genotype.
There is evidence that differences exist between genotypes in their response to

synchronisation protocols. Fert- cows have a greater incidence of anovulation and silent
heats, have reduced intensity of oestrous behaviour and appear to be less responsive to
exogenous PGF2α. These data indicate that the hypothalamic-pituitary-ovarian axis is
under the control of genetic merit for fertility. Examination of these tissues around the
peri-oestrous period is warranted.
7.8.3 Mechanisms Linking Metabolism with Fertility

Characterisation of the energetic status of Fert+ and Fert- cows has indicated that
differences in dry matter intake and circulating concentrations of glucose, insulin and
IGF1 are important contributors to fertility. Developing strategies to create a more
favourable energetic environment may lead to improvements in the uterine
environment, follicle and CL development, oocyte competence and embryo
development. Examination of the genomic control of voluntary feed intake is warranted.
223
7.9 Overall Conclusions and Implications
The study has identified important physiological mechanisms contributing to the
reproductive performance of dairy cows that are controlled by genetic merit for fertility.
These mechanisms are important factors that influence ovarian characteristics and the
uterine environment; both critical components of pregnancy establishment.
The results of this study validate the robustness of this unique lactating cow
genetic model of fertility and corroborate the findings of Cummins et al. (2012a). Both
studies reported greater body condition score in Fert+ cows compared with Fert- cows,
It has been well established that dairy cows require a smooth transition during
the early lactation period to achieve optimal milk production and reproductive
performance (Drackley, 1999). Evidence that genetic merit for fertility affects early
postpartum uterine health and resumption of ovarian cyclicity are unique findings from
this study. Greater dry matter intake and greater circulating concentrations of insulin,
insulin-like growth factor-1 and glucose in Fert+ cows are important findings. This
study also indicates that they are most reliable metabolic indicators associated with the
reproductive performance. Differences in the concentrations of these metabolic
indicators are likely to be responsible for superior uterine health, earlier resumption of
ovarian cyclicity and reduced mobilisation of adipose tissue in the Fert+ cows compared
with the Fert- cows. The study clearly demonstrated that the Fert+ cows had a smoother
transition during the early lactation period compared with the Fert- cows.
Genomic control of feeding behaviour is an area that should be investigated, as

the differences in dry matter intake between genotypes may be the critical factor
influencing the metabolic environment during early lactation. Understanding the genetic
control of feed intake may be realised in the near future (Berry et al., 2014), which will
also facilitate examination of the genetic relationship between feed intake and
reproductive performance. Interestingly, Coyral-Castel et al. (2013) reported differences
in feeding behaviour between Fertil+ haplotype (good fertility genotype) cows
compared with Fertil- haplotype cows (poor fertility genotype).
Only very minor differences in the fatty acid and amino acid composition of
follicular fluid were detected between Fert+ and Fert- cows. These fatty acids and
224
amino were highly predictive of fertility genotype, however, and may reflect an
important contribution of the follicular environment to oocyte competence. Differences
in the fatty acid composition of serum between genotypes were also highly predictive of
genotype. In comparison with other models of fertility, there was a general trend for
greater saturated fatty acids in the low fertility groups.
The differences in circulating progesterone concentrations between Fert+ and

Fert- cows represented an important finding of the study and corroborated the findings
of Cummins et al. (2012b). The current study indicated that greater circulating
progesterone concentrations in Fert+ cows were primarily due to their greater corpus
luteum volume and steroidogenic capacity. Differences in the vascularisation of the
corpus luteum, assessed as blood flow area measured using Doppler ultrasonography,
did not contribute the differences in corpus luteum steroidogenesis in agreement with
Bollwein et al. (2012). Greater hepatic progesterone catabolism has been implicated as a
contributing factor to reduced circulating progesterone concentrations (Sangsritavong et
al., 2002, Vasconcelos et al., 2003). Similar findings were not detected in the current
study, reflecting the minor differences in dry matter intake between genotypes and no
differences in diet (Lemley et al., 2009). Previous studies have created a more
favourable progesterone environment during the oestrous cycle using exogenous
hormones (Larson et al., 2007, Herlihy et al., 2012, Nascimento et al., 2013a,b). The
current study indicated the important role of genetic selection for fertility in improving
circulating progesterone concentrations.
Examination of the transcriptome on the endometrium and corpus luteum on day

13 of the oestrous cycle represented a critical time point for embryo development,
coinciding with the secretion of interferon-τ in preparation for maternal recognition of
pregnancy. It is well documented that the majority of pregnancy loss in cattle occurs
around this period (Diskin et al., 2011). A prolonged inflammatory response in the
endometrium of Fert- cows may have been due to the greater severity of uterine
infection experienced by this genotype in early lactation. While the greater expression
of PRKAG3 in the endometrium of Fert- cows may represent a mechanism whereby
their lower energy balance status impacts the uterine environment. The gene expression
profiles of the endometrium and corpus luteum also revealed the likely mechanisms for
compromised corpus luteum development and progesterone concentrations in Fert-
cows. Greater expression of genes involved in prostaglandin F2α synthesis and secretion
225
in the endometrium of Fert- cows may have had a negative impact on corpus luteum
development. In addition, the corpus luteum gene expression profile suggested reduced
prostaglandin F2α response and greater steroidogenesis in the Fert+ cows. Differences in
these functional pathways between the genotypes are likely to represent critical
mechanisms contributing to phenotypic fertility differences between Fert+ and Fert-
cows. Concordance analysis between the differentially expressed genes and two fertility
genome-wide association studies in independent dairy populations was a novel
approach to identifying QTL regions and variants associated with fertility. A high level
of agreement indicated the differentially expressed genes were truly associated with
fertility genotype and offers additional support to using this animal model for
elucidating the molecular mechanisms responsible for fertility failure. The methodology
described here to examine the concordance between transcriptomic and genomic data
should be utilised in future research studies to further our understanding of the genomic
architecture of complex traits.
The QTL regions and sequence variants identified in the current study likely
represent important genomic regions and variants underlying the genetic variation in
dairy cow fertility. Importantly, opportunities exist to use this information to accelerate
the genetic improvement of dairy cow fertility. At present, genomic selection exploits
the strong LD that exists between SNP markers and the causative mutations; its
accuracy, however, declines as the relationship between the reference population and
the animal to be evaluated increases. The absence of causative mutations on SNP arrays
has, however, limited the ability of genomic selection and GWAS to identify the vast
majority of genomic variants contributing to variation in phenotypic fertility.
Consequently, it is anticipated that the QTL regions and sequence variants, such as
those identified in the current study, are more informative and will enhance genomic
predictions to accelerate genetic improvement in dairy cow fertility. To facilitate this
approach, statistical methodology has been developed to incorporate sequence variants
into Bayesian framework (MacLeod et al., 2014).
226
7.10 References
Berry, D. P., M. P. Coffey, J. E. Pryce, Y. de Haas, P. Løvendahl, N. Krattenmacher, J.

J. Crowley, Z. Wang, D. Spurlock, K. Weigel, K. Macdonald, and R. F.
Veerkamp. 2014. International genetic evaluations for feed intake in dairy cattle
through the collation of data from multiple sources. Journal of Dairy Science
97(6):3894-3905.
mechanism and clinical relevance. Reproduction, Fertility and Development
25(1):71-79.
Coyral-Castel, S., P. Faverdin, C. Ramé, S. Fréret, D. Guillaume, S. Fritz, and J.
Dupont. 2013. Significant differences in fertility between dairy cows selected for
one QTL located on bovine chromosome 3 are not attributable to energy
balance, although eating behaviour is affected. animal 7(04):610-617.
95(7):3698-3710.
Forde, N., J. P. Mehta, M. Minten, M. A. Crowe, J. F. Roche, T. E. Spencer, and P.
Lonergan. 2012. Effects of Low Progesterone on the Endometrial Transcriptome
in Cattle. Biology of Reproduction 87(5):124, 121-111.
synchronization treatments on ovarian follicular dynamics, corpus luteum
growth, and circulating steroid hormone concentrations in lactating dairy cows.
227
Lemley, C. O., T. A. Wilmoth, L. R. Tager, K. M. Krause, and M. E. Wilson. 2009.
Effect of a high cornstarch diet on hepatic cytochrome P450 2C and 3A activity
and progesterone half-life in dairy cows. Journal of Dairy Science 93(3):1012-
1021.
Nascimento, A. B., R. W. Bender, A. H. Souza, H. Ayres, R. R. Araujo, J. N. Guenther,
R. Sartori, and M. C. Wiltbank. 2013a. Effect of treatment with human chorionic
gonadotropin on day 5 after timed artificial insemination on fertility of lactating
Nascimento, A. B., A. H. Souza, J. N. Guenther, F. P. Costa, R. Sartori, and M. C.
Wiltbank. 2013b. Effects of treatment with human chorionic gonadotrophin or
intravaginal progesterone-releasing device after AI on circulating progesterone
concentrations in lactating dairy cows. Reproduction, Fertility, and Development
25(5):818-824.
85(11):2831-2842.
Vasconcelos, J. L. M., S. Sangsritavong, S. J. Tsai, and M. C. Wiltbank. 2003. Acute
reduction in serum progesterone concentrations after feed intake in dairy cows.
228

Moore Ucd 5090D 10045

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Moore Ucd 5090D 10045

Uploaded by

Copyright:

Available Formats

Provided by the author(s) and University College Dublin Library in accordance with publisher

policies., Please cite the published version when available.

Title Genetic control of dairy cow reproduction

Authors(s) Moore, Stephen

Publication date 2015

Publisher University College Dublin. School of Agriculture and Food Science

Link to online version http://dissertations.umi.com/ucd:10045

Item record/more information http://hdl.handle.net/10197/6812

List of Tables ................................................................................ xi

Literature Review ........................................................................... 6

Genetic merit for fertility traits in Holstein cows: Transition

Genetic merit for fertility traits in Holstein cows: Factors

Follicular fluid and serum metabolites in Holstein cows are

Differentially expressed genes in the endometrium and corpus

General Discussion .................................................................... 216

To my fellow mischief makers/debaters/pals – Will, Vinny, Brian, PJ, Cathal,

Peer-reviewed journal publications

Butler, S. T., S. B. Cummins, M. M. Herlihy, I. A. Hutchinson and S. G. Moore. 2014.

Refereed conference publications

Moore, S. G., M. McCabe, P. Cormican, T. Fair, P. Lonergan, A.J. Chamberlain, J.E.

Table Title Page

Figure Title Page

Introduction to this Thesis

The sequence of biological processes that must successfully occur in a timely

Bender, K., S. Walsh, A. C. O. Evans, T. Fair, and L. Brennan. 2010. Metabolite

Figure 2.1. Schematic representation of pasture-based seasonal-calving systems of milk

2.2 Global Trends in Dairy Cow Fertility

Table 2.2. Global Trends in Dairy Cow Fertility

2.3 Genetic Selection in Ireland

Figure 2.2. Reproductive outcomes in British-Friesian versus Holstein-Friesian cows

2.4 Fertility in the Dairy Cow

2.4.1 Postpartum Uterine Health and Resumption of Ovarian Cyclicity

Coincident with the recovery of uterine health, resumption of ovarian cyclicity

2.4.2 The Oestrous Cycle

2.4.3 Follicular Environment and Oocyte Competence

2.4.4 Corpus Luteum Development

Table 2.3. Structural characteristics of cells of dioestrus bovine

Luteinizing hormone is the primary hormone responsible for CL maintenance and P4

2.4.5 Circulating Progesterone Concentrations

Insufficient P4 synthesis by the CL and greater metabolic clearance rate (MCR)

2.4.6 Uterine Environment and Embryo Development

The events leading to maternal recognition of pregnancy on days 15 to 18 after

Alterations to the uterine environment imposed by lactation status or infection

2.4.7 Embryo Loss

2.5 Major Animal Factors Controlling the Reproductive Performance of Dairy

2.5.1 Metabolic Status

The metabolic status during the postpartum period is characterised by alterations

2.5.2 Body Condition Score

2.5.3 Genetic influence on Reproductive Performance

2.5.3.2 Genetic Influence on Detailed Reproductive Phenotypes

2.5.3.3 Influence of Genomic Regions and Variants on Reproductive Performance

2.5.3.4 Influence of Dairy Breeds on Reproductive Performance

The genetic and physiological mechanisms contributing to the phenotypic

2.5.3.5 Influence of Holstein Strain on Reproductive Performance

2.5.3.6 Influence of Genetic Merit for Fertility on Reproductive Performance

2.6 Rationale for the Studies Undertaken

The objectives of the research reported in this thesis are:

Adams, G. P., R. Jaiswal, J. Singh, and P. Malhi. 2008. Progress in understanding

Genetic merit for fertility traits in Holstein cows:

Positive effects of BCS on fertility have been reported in pasture and

We have previously validated a lactating Holstein cow genetic model of fertility

3.4.1 Animal Model

3.4.2 Feed and Management System