Journal of Hazardous Materials 403 (2021) 123418

Contents lists available at ScienceDirect

Journal of Hazardous Materials

journal homepage: www.elsevier.com/locate/jhazmat

DNA nanotechnology: A recent advancement in the monitoring of T

microcystin-LR
Tiying Suoa,1, Muhammad Sohaila,1, Siying Xiea, Bingzhi Lia,*, Yue Chenb,*, Lihui Zhanga,*,
Xing Zhanga,*
a
School of Food Science and Pharmaceutical Engineering, Nanjing Normal University, Nanjing 210023, China
b
School of Nursing, Nanjing Medical University, Nanjing 211166, China

GRAPHICAL ABSTRACT

ARTICLE INFO ABSTRACT

Editor: R Teresa The Microcystin-Leucine-Arginine (MC-LR) is the most toxic and widely distributed microcystin, which origi-
nates from cyanobacteria produced by water eutrophication. The MC-LR has deleterious effects on the aquatic
Keywords:
lives and agriculture, and this highly toxic chemical could severely endanger human health when the polluted
MC-LR
DNA nanotechnology food was intaken. Therefore, the monitoring of MC-LR is of vital importance in the fields including environment,
Aptamer food, and public health. Utilizing the complementary base pairing between DNA molecules, DNA nano-
Immunoassay technology can realize the programmable and predictable regulation of DNA molecules. In analytical applica-
Signal processing tions, DNA nanotechnology can be used to detect targets via target-induced conformation change and the nano-
assemblies of nucleic acids. Compared with the conventional analytical technologies, DNA nanotechnology has
the advantages of sensitive, versatile, and high potential in real-time and on-site applications. According to the
molecular basis for recognizing MC-LR, the strategies of applying DNA nanotechnology in the MC-LR monitoring
are divided into two categories in this review: DNA as a recognition element and DNA-assisted signal processing.
This paper introduces state-of-the-art analytical methods for the detection of MC-LR based on DNA nano-
technology and provides critical perspectives on the challenges and development in this field.

⁎
Corresponding authors.
E-mail addresses: bingzhili@njnu.edu.cn (B. Li), chenyue1005@njmu.edu.cn (Y. Chen), zhanglihui@njnu.edu.cn (L. Zhang), zhangxing@njnu.edu.cn (X. Zhang).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.jhazmat.2020.123418
Received 23 April 2020; Received in revised form 24 June 2020; Accepted 5 July 2020
Available online 08 July 2020
0304-3894/ © 2020 Elsevier B.V. All rights reserved.
T. Suo, et al.
1. Introduction
A large amount of wastewater containing nitrogen and phosphorus
is discharged into seawater and lake water, which makes certain algae
get sufficient nutrients and grow rapidly (Cao et al., 2018; Wang et al.,
2020a, 2020b, 2020c; Wei et al., 2020). The bloom of cyanobacteria
has caused serious water pollution, further affecting the drinking water,
aquaculture, and agriculture industries, endangering the growth of the
social economy (Mohamed, 2018; Olson et al., 2020; M. Zhang et al.,
2020; X. Zhang et al., 2020). Many of these cyanobacteria can produce
toxic secondary metabolite cyanotoxins, which can be ingested by hu-
mans through the food chain (Engene et al., 2011; Moreira et al., 2013;
Vasconcelos, 2015). It is reported that about 40 genera of cyanobacteria
can produce cyanotoxins and target various organs and tissues, re-
sulting in serious dysfunctions in the liver and nervous system (Graham
et al., 2010; Salmaso et al., 2015; Zhong et al., 2020a,b). Different
species of cyanobacteria, including Anabaena, Anabaenopsis, Aphani-
zomenon, Aphanocapsa, Hapalosiphon, Nostoc, and Planktothrix (G.
Chen et al., 2020a; Ingrid Chorus, 2000; Svirčev et al., 2017), can
produce microcystins (MCs). MCs have grabbed the attention of the
researchers due to their extensive hazardous effects (Chen et al., 2020b,
2020c; Santos et al., 2020). The general ring structure of MCs is D-
Alanine-L-X-Red-β-methyl-D-Isoaspartic acid-L-Z-Adda-D-Isoglutamic
acid-N-Methyldehydroalanine, where the Adda group is responsible for
the toxicity (Welten et al., 2020). The molecular form of Adda is 3-
amino-9-methoxy-2, 6, 8-trimethyl-10-phenyldeca-4, 6-dienoic acid,
containing two variable amino acids. As a result, MCs have multiple
variants, such as Microcystin-Leucine-Arginine (MC-LR), Microcystin-
Arginine-Arginine (MC-RR) and Microcystin-Tyrosine-Arginine (MC-
YR), where MC-LR has the most extensive distribution and exhibits the
highest toxicity (Jia et al., 2014). MC-LR will accumulate in plants that
irrigated with polluted water, causing the reduction in the growth ca-
pacity and photosynthetic activity of plants, finally leading to plant
death (Ding et al., 2020; Santos et al., 2020; Wijewickrama and
Manage, 2019). The MC-LR enters the human body through aquatic
products, crops, and other agricultural products. It has toxic effects on
the liver, reproductive system, and nervous system (Huang et al., 2020).
Derived from its hepatotropic nature, the main target organ of the MC-
LR is the liver (Gu et al., 2020; Yang et al., 2020). The exposure to MC-
LR is closely related to the occurrence of hemorrhage, necrosis, and
cancer in the liver (Park et al., 2020). When hepatocytes absorb the MC-
LR, the MC-LR initially forms non-covalent bonds and, later, covalent
bonds with protein phosphatase 2A (PP2A) and 1 (PP1) (Bagu et al.,
1997; Lone et al., 2015; MacKintosh et al., 1990). This process results in
morphological and functional changes in the hepatocytes leading to
autophagia, apoptosis, necrosis, or cell proliferation (S. Wang et al.,
2020b). The MC-LR can also cross the blood-testis barrier, interfering
with the repair of DNA damage and the expression of apoptosis-related
genes, damaging the motility and morphology of sperms (Yang et al.,
2020; Yi et al., 2019).
Considering the severe harm of the MC-LR, the World Health
Organization (WHO) regulated that the highest concentration of the
MC-LR in drinking water is 1 μg/L (Trapmann et al., 1998). The tradi-
tional analytical methods for the detection of MC-LR include high-
performance liquid chromatography (HPLC) (Aguete et al., 2001;
Cadel-Six et al., 2014; Campos and Vasconcelos, 2010), protein phos-
phatase inhibition assay (PPIA) (Best et al., 2002; Bieczynski et al.,
2013; Covaci et al., 2012), and enzyme-link immunosorbent assay
(ELISA) (Lotierzo et al., 2012). HPLC is coupled with mass spectrometry
(MS) to enhance its sensitivity and specificity, however, HPLC-MS is a
highly costed instrument with the need for professional skills, which is
not practical for field-testing (Aguete et al., 2001; Came et al., 2004).
Both PPIA (Izaguirre et al., 2007) and ELISA (D’Angelo, 2019; Lu et al.,
2020) utilize the specific reactions of enzymes, which makes them ex-
hibit good sensitivity, but their detection processes are relatively
lengthy and tedious. Moreover, the enzymes and antibodies are easily
2
Journal of Hazardous Materials 403 (2021) 123418
affected by environmental factors, which may decrease the reproduci-
bility of the methods.
Currently, biosensors provide a simple detection platform for de-
tecting complex samples. Among them, optical and electrochemical
methods are the most frequently adopted strategies for the sensing of
the MC-LR. The optical methods mainly include colorimetry (Almeida
et al., 2006; Sassolas et al., 2011), fluorescence spectroscopy (Shen and
Qian, 2019; Shen et al., 2020a, 2020b). In recent years, colorimetry
relies mainly on the aggregation or dispersion of functionalized nano-
particles, so that the change of light absorption can be used for target
determination. In the colorimetric methods, the color change of sam-
ples can be directly observed by naked eyes without the need for so-
phisticated instruments, which is suitable for low-resource areas
(Metcalf et al., 2001).
In fluorescence, fluorescent label and fluorescence resonance energy
transfer (FRET) are typically used (Dai et al., 2020; Shen et al., 2020a,
2020b). Though highly sensitive, the fluorescent assays are easily in-
terfered by matrix conditions such as temperature, pH, and con-
centration of ions (Sotoud et al., 2013; Yang et al., 2018; Yao et al.,
2017). The electrochemical methods generally adopt the strategy of
immobilizing aptamers on electrodes and judges the content of target
through signal transductions (Chen et al., 2018; Vogiazi et al., 2019;
Wang et al., 2018a, 2018b), which shows high potential in fast and
portable detection. Whereas, the co-existing electrolyte in samples will
influence its outcome and produce false results (Bostan et al., 2018;
Pang et al., 2020; Singh et al., 2012). Therefore, the analytical methods
which can realize real-time and on-site monitoring of MC-LR with high
performance are highly desired.
As a natural biological macromolecule, the structure of DNA has
predictability and programmability because of unique and specific base
pairing (Degliangeli et al., 2014; Lombardo et al., 2020; Ravan and
Yazdanparast, 2013). Based on the programmability of DNA, modern
investigations have found that DNA can be endowed with structural or
functional specificities by adjusting the sequences of the nucleotides,
which causes the rise of DNA nanotechnology (Wang and Arrabito,
2015; Xiao et al., 2019; Ye et al., 2018). According to the different
research emphasis, DNA nanotechnology can be divided into structural
and functional subfields. The structural DNA nanotechnology focused
on the origami of two- or three-dimensional DNA nanostructure, while
the functional DNA nanotechnology pays more attention to the sti-
mulus-induced dynamic change of DNA strands (Ebrahimi et al., 2019;
Kwon et al., 2020; Palchetti and Mascini, 2008). However, it should be
noticed that there is no strict boundary between these two subfields of
DNA nanotechnology because the purpose of delicate structural con-
struction is always to create new properties for functional usage,
especially when it comes to the application of DNA nanotechnology in
the analytical field (Zhao et al., 2020; Zhou et al., 2020).
In current analytical investigations, the DNA can serve as a re-
cognition element, a transducer, or an effector, all rely on the in-
tegration of structural and functional aspects of DNA nanotechnology
(Kelley et al., 2014; Mascini et al., 2012; Turner, 2013). In structural
DNA nanotechnology, DNA origami is used to assemble DNA structures
originally designed (Rothemund, 2006; Wang et al., 2020a, 2020b,
2020c). Under the condition that the pattern constructed by the DNA
origami method is employed as a substrate, small molecules or nano-
particles (Okupnik et al., 2015) can be precisely nano-arranged under
various modifications or reactions, so that the self-assembly can
manage the spatial and temporal sites of functional materials (Andersen
et al., 2009; R. Li et al., 2020; X. Li et al., 2020; Lin et al., 2016b). DNA
origami pattern can also exist in solution, which is similar to the DNA
hybridization environment, making it possible to carry out molecular
detection in cells (Xiong et al., 2020). The functional DNA nano-
technology is that a stable autonomous device is formed by combining
functionalized DNA chains with modified solid materials (Campuzano
et al., 2019; Panigaj et al., 2019). Through reasonable design, the de-
vice can autonomously respond to external stimulus (antigens,
T. Suo, et al. Journal of Hazardous Materials 403 (2021) 123418

Fig. 1. Schematic diagram of the typical forms of DNA nanotechnology, the structure of MC-LR, and the participation of DNA nanotechnology in the monitoring of
MC-LR. The DNA nanotechnology participates in the monitoring of MC-LR by two approaches: (a) aptamer as a recognition element; (b) DNA-assisted signal
processing.

antibodies, even the target itself), including DNA strand polymeriza- performances. Finally, we will conclude the developments achieved
tion, morphological transformation, etc. (Douglas et al., 2009; Lin et al., nowadays and prospect future advancement in this area.
2015; Xavier and Chandrasekaran, 2018). Based on these responses,
various DNA biosensors with high sensitivity, low cost, and quick re-
2. DNA as a recognition element
sponse can be constructed.
This review discussed the application of DNA nanotechnology in
The emergence of aptamers has revealed that DNA can specifically
constructing functional DNA structures to monitor the MC-LR. As illu-
recognize non-nucleic-acid targets similar to the recognition between
strated in Fig. 1, there are currently two strategies in this research area:
antigen and antibody. Aptamers are DNA or RNA (mainly DNA) strands
1) DNA as a recognition element; 2) DNA-assisted signal processing. In
with a high affinity towards specific non-nucleic-acid targets (Zhong
the first strategy, functional nucleic acids can be encoded as aptamers
et al., 2020a,2020b). After screening and enrichment by systematic
to identify the MC-LR. Selected methods in these two categories are
evolution of ligands by exponential enrichment (SELEX) (Stanley et al.,
listed in Table 1, and their features including mechanisms, the real
2020; Stoltenburg et al., 2007), the obtained aptamers have preferable
samples tested, the limit of detection, and linear range are presented.
selectivity to target molecules. The aptamers have better stability and
Derived from the good biocompatibility and programmability of the
lower cost as compared to the antibodies (He et al., 2012; Lokesh et al.,
DNA nanostructure, aptamers can be modified to connect with various
2017; Wang et al., 2018a, 2018b). With the development of chemical
nanomaterials. Integrating the specificity of aptamers and the function
biology, nucleic acid-based detection methods have undergone great
of nanomaterials, this strategy is versatile and robust to realize reliable
development, making analytical technology entering a new era (Chen
detection. The second strategy shows that DNA nanotechnology can be
et al., 2020a, 2020b, 2020c; McConnell et al., 2020; M. Zhang et al.,
combined with signal processing technologies to improve analytical
2020; X. Zhang et al., 2020). Nucleic acid can be modified with various
performance. For example, the immune-based assay of the MC-LR is
functional groups and nanomaterials (Berti and Burley, 2008; Zhou
prone to be low sensitive and unstable because of the enzyme-based
et al., 2017), which is beneficial to strengthen the performance of
signal processing kinetics. The emerging of DNA nanotechnology has
sensors for identifying trace amounts of analytes. It is generally ac-
provided an alternative path for processing the binding signal of anti-
cepted that aptamer can directly recognize the target and hence, as-
body-antigen. By functionalizing the antibody with DNA segments, the
sisting the signal processing including transduction, amplification, and
recognition signal can be transduced into DNA signal, then processed by
detection steps (Fig. 1a).
rolling circle amplification (RCA) (Schweitzer et al., 2002; Yin et al.,
The selectivity and modifications of aptamers play a fundamental
2008), catalytic hairpin assembly (CHA) (Wei et al., 2018a, 2018b,
role in the field of analytical chemistry, therefore it is necessary to
2018c; Xing et al., 2019), hybridization chain reaction (HCR) (Bui et al.,
choose reasonable sequences with suitable modifications. In 2001,
2017; Dirks and Pierce, 2004) and other signal amplification techni-
Nakamura et al. (Nakamura et al., 2001) obtained the first aptamer
ques. The reaction kinetics of the DNA-assisted signal processing is
targeting microcystin-leucine-arginine (MC-LR) by an in vitro selection
typically rapid and controllable derived from the predictable thermo-
method of twelve rounds. They amplified the sequences of aptamer and
dynamics, and the construction of DNA nanostructures has greatly
utilized the surface plasmon resonance (SPR) apparatus to detect the
improved the performance of tracking and analyzing trace the MC-LR.
MC-LR. However, the specificity of the screened aptamer was poor,
This review aimed to discuss current strategies of applying DNA
where its binding affinity to microcystin-tyrosine-arginine (MC-YR) was
nanotechnology into the monitoring of the MC-LR. A summary of cur-
higher than that of the MC-LR. To conquer the defects, in 2012, Ng et al.
rent strategies will be introduced, along with their mechanisms and the
(Ng et al., 2012) reported aptamers for the detection of congener-

3
 T. Suo, et al.

Table 1
The comparison of representative methods for the analysis of MC-LR.
Category Methods Mechanism Real sample LOD (μg/L)1 linear range (μg/L) References
tested

DNA as a recognition Optical Colorimetric Aggregation or dispersion of AuNPs. water 3.7 × 10−1 0.5−7.5 × 103 (Li et al., 2016a)
element water 0.5 × 10−1 0.1−2.50 × 102 (Wang et al., 2015)
Fluorescence Distances between fluorescence pairs. water 10−4 1.0 × 10−4-1.0 × 102 (Lee and Son, 2019)
water 5.0 × 10−3 0.5−2.0 × 102 (Chinnappan et al., 2019)
water < 3.0 8−2.3 × 101 (Li et al., 2019)
water 3.0 × 10 −6 0.5 × 10−2 -1.2 × 103 (Zhang et al., 2019)
SERS2 The electromagnetic oscillation effect of the electron under water 9.82 × 10−3 0.1 × 10−1-1.0 × 102 (Zhao et al., 2019)
the action of the photoelectric field. water and food 2 × 10-3 0.1 × 10−1-2.0 × 102 (D. He et al., 2019;)
Electrochemi-cal SWV3 The change of the voltage, the current, and the impedance. water and fish 1.9 × 10−3 0.1 × 10−6- 1.0 (Eissa et al., 2014)

4
water 2.0 × 10−3 0.5 × 10−2–3.0 × 101 (X. Liu et al., 2019;)
EIS4 Serum and 1.5 × 10−2 6.0 × 10−2 -1.0 × 103 (Abnous et al., 2019)
water
water 1.8 × 10−2 5.0 × 10−2 - 1.0 × 102 (Lin et al., 2013)
DNA-assisted signal Immunoassa-y Photoelectrochemical method Photocurrent generated by energy transfer water 3 × 10−4 0.5 × 10−3-1.0 × 102 (Wei et al., 2018b)
processing Photoelectrochemis-try and Electron jumping and transduction. water 0.3 × 10−5 0.5 × 10−4-5.0 (Wei et al., 2018a)
Colorimetry Reduction of ions
DPSV5 Metal nanoparticles are reduced and embedded into DNA water 2.8 × 10−3 0.5 × 10−2-2.0 × 101 (Z. He et al., 2019)
double chains.

1
LOD: Limit of Detection.
2
SERS: Surface-Enhanced Raman scattering.
3
SWV: Square Wave Voltammetry.
4
EIS: Electrochemical Impedance Spectroscopy.
5
DPSV: Differential Pulse Stripping Voltammetry.
Journal of Hazardous Materials 403 (2021) 123418
T. Suo, et al.
specific microcystin. Firstly, the appropriate detection sequence was
selected from the random DNA library via in vitro multiple rounds of
screening. The selected fragments were then cloned and sequenced. To
verify whether the obtained aptamer had a high affinity, an electro-
chemical method was employed. The thiolated aptamer was attached to
the surface of the gold electrode and exposed to [Ru(NH3)6]3+ solution.
Due to the electrostatic interaction between the cation and the nega-
tively charged phosphate skeleton of DNA, the high current was gen-
erated. When the sensor sensed the target, the amount of current was
decreased due to conformational changes in the aptamer. The results
presented that the limit of detection (LOD) was 11.8 × 10−3 μg/L for
the MC-LR. The aptamer sequence obtained in this research (5′- GGC
GCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCC
CATCTCCGC) had high affinity and specificity, which was widely
adopted in subsequent investigations. Based on the attitude to deal with
the binding signal between MC-LR and aptamers, the methods using
DNA as recognition elements can be generally divided into direct and
indirect assays.
2.1. Direct assay
In direct assays, the MC-LR directly binds to the aptamer, and no
other complementary DNA strands are required to participate in the
detection. The signal changes were typically derived from the con-
formational changes of the aptamers that happened due to the inter-
action between aptamer and target. Because of the high affinity be-
tween the aptamer and their targets, the pretreatment of samples can be
simplified without the need for tedious separation. One of the great
challenges to heighten the signal-to-noise ratio due to the instability of
conformational changes.
Colorimetric methods have the advantages of convenience, rapid
process, and low-cost, which makes them suitable for the detection of
MC-LR in less-equipped areas. Li et al. (2016) fabricated a colorimetric
aptasensor by controlling the assembly of gold nanoparticles (AuNPs).
In the presence of salt solution, the AuNPs were aggregated because of
electrostatic screening effect, thus causing the color of the solution to
change from red to blue. Upon the addition of the MC-LR aptamer to the
AuNPs solution, the AuNPs will disperse and make the solution restore
its original claret-red. When MC-LR was present, the aptamer will de-
tach from the AuNPs and link with the MC-LR. As a result, the aptamer
became incapable of protecting AuNPs from salt-induced aggregation
and the color of the solution was turned to blue. The LOD of the sensor
was 3.7 × 10−1 μg/L, which met the requirements for the practical
applications in monitoring MC-LR in water samples.
Compared with colorimetric methods, fluorescent methods are ty-
pically more sensitive. Based on the principle of fluorescence detection,
it has been divided into photoelectron transfer (PET), intramolecular
charge transfer (ICT), and fluorescence resonance energy transfer
(FRET). As a commonly used method, FRET is distance-dependent and
needs a pair of fluorophores which acts as an energy donor and the
other as an energy acceptor, respectively. The change of fluorescence
signal is realized through energy transfer. Lee and Son (Lee and Son,
2019) designed a highly selective and sensitive detection technique for
the MC-LR using FRET-based aptasensor. They immobilized the ap-
tamer of the MC-LR on the surface of a composite composed of mag-
netic nano-beads and quantum dot nanoparticles (Fig. 2a). In this assay,
QD525 and PoPo-3 dye firstly served as a FRET pair. When the fluor-
escent pair were adjacent, the energy of QD525 will be transferred to
PoPo-3 dye, thus the fluorescence of PoPo-3 dye at 561 nm will be
weakened. The combination of the MC-LR and the aptamer destroyed
the structure of the complex and PoPo-3 dye was shed from the ap-
tamer, this ultimately led to the disappearance of fluorescence at
561 nm under the condition of excitation light at 530 nm. The LOD for
the FRET-based QD-aptasensor was 10−4 μg/L and the aptasensor was
capable of detecting the content of MC-LR in both laboratory samples
and environmental samples. The results obtained by the sensor were
5
Journal of Hazardous Materials 403 (2021) 123418
highly consistent with those measured by the standard detection
method of the enzyme-linked immunosorbent assay (ELISA), thus de-
monstrated the reliability of this aptasensor.
Xiang et al. (2014) developed an aptamer-MC-LR-antibody sand-
wich structure analyzer. The functionalized glass capillaries fixed with
the aptamer of MC-LR were served as the platform for capturing the
MC-LR. When MC-LR and competitive antibodies labeled with horse-
radish peroxidase (HRP) were added simultaneously, the sandwich
structure of aptamer-MC-LR-antibody will be formed. In the plot of
HRP-based catalysis, they turned a chemiluminescence signal into an
electrical signal via a silicon photodiode-based portable analyzer. The
new device exhibited excellent results compared to other MCs testing
methods and had the potential for on-site monitoring of the MC-LR in
real water samples.
The electrochemical sensors are typically portable, easy-to-operate,
and cost-effective, thus the electrochemical measurement of the MC-LR
is widely applied. Lin et al. (2013) employed the aptamer-based catcher
where the aptamer was linked to the gold electrode through Au-S in-
teraction. The presence of the MC-LR changed the electrochemical
impedance. The sensor had suitable sensitivity and was easy to operate.
The described system was used for the monitoring of the MC-LR in real
water samples and showed satisfactory results with the LOD of
1.8 × 10−2 μg/L. Wu et al. (2020) constructed a sensor complexed by
several nanomaterials, which improved the resistance of the sensor to
environmental influences. Two methods were adopted in this work: in
the first method, a glass carbon electrode (GCE) with MoS2-PtPd na-
noparticles (NPs) was decorated with the aptamer of MC-LR. When MC-
LR appeared, the electric current was cut down via H2O2-based cata-
lysis. The other way was to combine MoS2-PtPdNPs with aptamer and
zeolitic imidazolate framework (ZIF)-8-thionine (Thi)-AuNPs with DNA
strand complementary to the aptamer, which improved the sensitivity
of the detection system. It was supposed that the AuNPs and thionine
improved the conductivity and produced an agile current signal. The
LOD of the above two methods were 4.5 × 10−2 μg/L and 0.6 × 10−2
μg/L, respectively. Besides, the accuracy and credibility of the method
had been verified in environmental water samples.
The assays based on SERS have been well developed because of their
preponderance including high sensitivity, the dominating function, and
the pronounced effect. The SERS produced local electromagnetic en-
hancement, but only a few special materials can exhibit such an effect.
Zhao et al. (2019) established a device by connecting the Au@ga-
p@AgAuNPs and the surface of Graphene Oxide (GO)/Fe3O4 NPs for
the quantification of the MC-LR. The aptamers were connected to the
Au@gap@AgAu NPs by π-π stacking. Under the affinity between ap-
tamer and MC-LR, the SERS signal will be reduced. This work fabricated
a simple, rapid, and sensitive aptasensor with the LOD of 9.82 × 10−3
μg/L. Bilibana and coworkers (Bilibana et al., 2016) designed a nano-
composite to detect the MC-LR. This nanocomposite consisted of cobalt
(II) salicylaldiimine metallodendrimer (SDD–Co(II)) and electro-syn-
thesized silver nanoparticles (AgNPs), and then immobilized on the
glassy carbon electrode (GCE). The 5′ thiolated aptamer was conjugated
to the GCE|SDD-Co(II)|AgNPs via self-assembly. The steric hindrance
and electrostatic repulsion derived from the affinity between the MC-LR
and the aptamer had an impact on aptatoxisensor, which results in the
change of peak current. In water samples, the aptasensor shown the
desired results with the LOD of 0.4 × 10-1 μg/L.
The graphene oxide (GO) holds a large surface area and good
electrical conductivity, which has captured widespread attention on the
analytical field. Eissa and co-researchers (Eissa et al., 2014) constructed
a facile strategy to detect the MC-LR with the LOD of 1.9 × 10−3 μg/L
under optimized conditions. The analytical system was based on a non-
labeled DNA aptamer polymerized on a graphene electrode. Using the
change of square wave voltammetry (SWV) induced by the redox re-
action of [Fe(CN)6]3−/4−, precisely quantification of MC-LR was rea-
lized. This simple, high-performance, and low-cost detection device
presented excellent recovery in tap water and fish samples. Likewise,
T. Suo, et al.
Fig. 2. (a) Schematic diagram of detecting the MC-LR for the FRET-based QD-Aptasensor. The change of fluorescence intensity is realized by energy transfer between
QD525 and PoPo-3 (Lee and Son, 2019). (b) Schematic diagram of the flow of detecting MC-LR by microcantilever array sensor. The thiol modified aptamers were
fixed on the gold surface, and the aptamers changed in the presence of the MC-LR, which resulted in the deflection of the microcantilever array (Zhang et al., 2018).
(Adopted from Lee and Son, 2019; Zhang et al., 2018).
Hu group (Hu et al., 2012) used aptamer-decorated GO nanosheets for
the analysis of the MC-LR. After handling the GO nanosheets, they will
covalently link to the smart RNA aptamer and perform better than
utilizing the DNA as an aptamer. The RNA-GO nanosheets shielded the
catalytic effect of nucleases and the interaction of the aptamer and MC-
L and the MC-LR would change the results of the adsorption kinetics
test. The experiment has the advantages of enriching and separating
small molecules, and specifically identifying the targets. The results for
the analysis of environmental and biological samples were satisfactory.
Liu et al. (X. Liu et al., 2019; M. Liu et al., 2019) manufactured a
method to test the MC-LR with the integration of GO and nuclease-
assisted DNA amplifications. The sensor mixed the Au nanoparticles
with Au (AuNPs/Au) serving as electrode into graphene containing
aptamer for MC-LR. Furthermore, they applied DNase I enzyme to di-
gest the conjugation of the aptamer and the MC-R, which made it
possible to intensify the detection signal. Because of the material su-
periorities, the sensor presented convenient, sensitive features with the
LOD of 0.8 × 10−3 μg/L.
Different from the electrochemical method, the microcantilever
quantifies the analytes by using the influence of external stimuli on the
bending of the microcantilever. Zhang et al. (2018) designed a method
by fixing the aptamer of the MC-LR on the surface of the micro-
cantilever (Fig. 2b). The specific binding between the aptamer and the
MC-LR modified the surface stress of the microcantilever. Covalent
bonding of the aptamer to the gold surface of a microcantilever led to a
bending conformation. Additionally, the sensor can distinguish the
congeners of the MC-LR. The LOD was 1 μg/L and the detection range
was 1 μg/L to 5.0 × 102μg/L. Although the sensor had its merits such as
simple, rapid, real-time monitoring, label-free, and quantitative, the
6
Journal of Hazardous Materials 403 (2021) 123418
performance of microcantilever was easily affected by electrostatic re-
pulsion of the negatively charged aptamer and MC-LR.
Sensors for the detection of MC-LR based on photoelectrochemical
(PEC) techniques have dominances of better sensitivity and simplicity.
Du et al. (2018) constructed a sensitive photoelectrochemical apta-
sensor. They modified the AgI nitrogen-doped graphene (AgI-NG) on
indium tin oxide (ITO) as a negative electrode and adhered to the ap-
tamer on the AgI-NG surface as a trap for capturing the target. In which
the AgI, as a semiconductor, triggers the transfer of electron valence
bands under the stimulation of external light, thereby generating
electron-hole pairs. The NG acts as an electron reservoir, effectively
inhibiting the recombination effect of electron-hole pairs and accel-
erating electron transfer at the same time. Since the combination of the
target and the aptamer will hinder electron transfer and weaken pho-
tocurrent, the content of the target can be evaluated according to the
relationship between photocurrent and concentration of the target. This
way was capable of detecting the MC-LR in fish samples and has been
validated with the LOD of 1.7 × 10−5 μg/L.
In 1991, Japan’s NEC company discovered carbon nanotubes for the
first time. Due to their good thermal stability, considerable elasticity
and strength, the carbon nanotubes have been continuously developed
and improved for decades. Liu and coworkers (Liu et al., 2016) devel-
oped an aptasensor for detecting the MC-LR which consisted of gra-
phene-functionalized vertically-aligned titanium dioxide nanotubes
(TiO2 NTs) where the aptamer absorbed to the graphene through π-π
stacking interaction. The TiO2 materials can form nanospheres to pro-
vide a larger surface area to link with other substances, thus enabling
this aptasensor to detect MC-LR with a low LOD of 0.5 × 10−6 μg/L.
Tang et al. (2018) constructed a cell-like composite sensor by
T. Suo, et al.
depositing CuS nanoparticles on TiO2 nanospheres and coating the CuS-
TiO2 composite with chitosan film. The cell-like composite structure
was incubated with glutaraldehyde and placed on the ITO electrode to
connect with the aminated aptamer. When the aptasensor caught the
MC-LR, the photocurrent will be augmented and the LOD obtained was
2.0 × 10-5 μg/L. The probe has been successfully applied in the detec-
tion of various water samples.
The ECL produces a new product from the electrode which exerts
electrochemical signal to the chemiluminescence substance and the
product will be illuminated undergoing a series of reactions. Du et al.
(2016) designed an aptasensor to estimate the concentration of the MC-
LR in the environmental samples. They made the use of three-dimen-
sional boron and nitrogen mingled graphene hydrogels (BN-GHs) to
enhance steric hindrance. They also used a glassy carbon electrode
(GCE) functionalized by the aptamer of the MC-LR, BN-GHs, and the
complex of [Ru(bpy)3]2+. The aptamer3]2+ interacted with the tri-
propylamine (TPrA) and produced the ECL signal. When the MC-LR was
captured by the aptamer, the ECL intensity was dropped in the case of
TPrA catalysis. The said system can be detected low contents of the
target with the LOD of 0.3 × 10−4 μg/L. The proposed ECL aptasensor
was easy to operate and enabled quantitative determinations of the
analyte in real samples in a suitable range.
2.2. Indirect assay
The method elucidated as indirect assays are the ones utilizing the
complementary ssDNA to lock the aptamers of MC-LR. The binding of
MC-LR and the aptamers causes the release of the ssDNA, and then the
ssDNA was quantified to reflect the concentration of MC-LR. Indirect
experiments have two main advantages: (i) the aptamer strands do not
need to be chemically modified. (ii) The released ssDNA can be in-
volved in DNA computing and amplifications. This type of method is
gaining accumulating research interest, but it should be noticed that
competitive binding can lead to the loss of binding affinity between
targets and aptamers.
Some noble metal nanoparticles exhibit distance-dependent optical
properties with a high extinction coefficient, which makes them widely
used as a versatile sensing component in colorimetric assays (Ye et al.,
2017). The color change of solution caused by the assembly or dis-
assembly of these noble metal nanoparticles is derived from the loca-
lized surface plasmon resonance (LSPR), which is closely related to
inter-particle distances and aggregate size. (Ma et al., 2018; Yuan et al.,
2014). It is well established that the aggregation of gold nanoparticles
(AuNPs) can generate distinct color change, and most investigations
exploit a large number of AuNPs to produce the colorimetric signal.
Nevertheless, it has been recently reported that the use of AuNPs dimers
can produce improved sensing performance. Taken this advantage,
Wang and coworkers (Wang et al., 2015) developed an AuNPs dimer-
based colorimetric sensor by linking two AuNPs modified with Y-
shaped oligonucleotide chains containing aptamer of MC-LR (Fig. 3a).
The surface of AuNPs was functionalized with polyethylene glycol
(PEG) and different two probes (single-stranded DNA), and then a Y-
shaped DNA duplex was constructed with aptamer as a linker. One of
the main features of this experiment was that two probes were partially
complementary attached to the diverse AuNPs and the rest parts of the
two probes combined with aptamers for the MC-LR, which formed a Y-
shaped structure. The interaction between the target and the Y-shaped
complex resulted in the destruction of the Y-shaped structure accom-
panied by the color change of the solution from blue to red. In com-
parison to the aptasensor based on complex polymerization technique,
the described method had the LOD of 0.05 μg/L, an extended range of
activity, and a high degree of sensitivity and stability on-situ when
applied for the determination of MC-LR in food and environmental
samples. Besides, the whole reaction process only took 5 min to gain the
results. It can be seen that the use of the combination of the colori-
metric method and auxiliary materials can augment the advantages of
7
Journal of Hazardous Materials 403 (2021) 123418
the analytical probe.
The SERS-based methods have advantages including the realization
of on-site detection and high accuracy rate. The active substrates in
SERS are made of noble metals or transition metals and determine the
stability and reproducibility of the spectral signals. Hence, the selection
of suitable matrix materials is the key factor to determine the quality of
the test. He and co-researchers (D. He et al., 2019; Z. He et al., 2019)
designed a SERS-based sensor by combining magnetic nanoparticles
(MNPs) with complementary strands of the aptamer, and gold nano-
particles (AuNPs) with the aptamer of the MC-LR. The probe exhibited a
rapid and accurate measurement of the target analyte with the LOD of
0.2 × 10−2 μg/L and it was successfully applied for the monitoring of
the MC-LR in tap water samples.
It is reported that the affinity between the truncated aptamer and
the target is higher than of the full-length aptamer (Kwon et al. 2014;
Nadal et al., 2013). Therefore, it is valuable to explore the binding
region between aptamer and analyte and obtain high-affinity aptamer
fragments. Raja and co-workers (Chinnappan et al., 2019) obtained an
aptamer fragment of MC-LR with higher affinity by competitive dis-
placement fluorescence assay (Fig. 3b). Firstly, they utilized different
methods to truncate the full-length aptamer of MC-LR into shorter
fragments (MCLRAP1 and MCLRAP2). Secondly, two oligonucleotide
chains complementary to aptamer fragments were introduced and la-
beled with fluorophores and quenchers respectively. When there was no
target, the fluorescence of the truncated aptamer fragments had negli-
gible change. When the target was added, the fluorescence of MCLRAP2
(5′-ATACCACCTCATTATGCCCCATCTCCGC-3′) was enhanced while the
MCLRAP1(5′-GGACCACCATGACAATTACCC-3′) was unchanged. Fi-
nally, the short sequences of aptamers with higher affinity were ob-
tained according to the changes of fluorescence. The linear range of
detection and LOD obtained by the method were 0.5 × 10 −3 μg/L to
0.2 μg/L and 5.0 × 10 -6 μg/L respectively.
To realize facile detection, Li et al. (2019) developed a smartphone-
based sensor to monitor the MC-LR. They loaded pentagram chips
containing different aptamers and fluorescent dyes onto glass sheets
and placed them on a chip holder. Competitive binding between ssDNA
dye and analyte can change the fluorescence intensity, and the content
of the target can be evaluated by fluorescence change. In the absence of
the MC-LR, the ssDNA was excited at 462 nm by a blue laser diode and
then the emitted light was obtained at 528 nm. In the presence of the
MC-LR, the emitted light was not detected. Then the chip was in-
tegrated with the smartphone, and the results were analyzed by the
imaging system of the smartphone. The miniaturized detector had the
preponderance of short reaction time within 5 min and the LOD was
3 μg/L. It has great potential to analyze the practical samples.
The nanoclusters have become a research hotspot in recent years,
which is attributed to their ultra-small size, light resistance, and bio-
compatibility (Li et al., 2018, 2016a, 2016b). Zhang et al. (2019)
constructed an ssDNA comprising complementary sequences rich in A
and T bases at two ends, and the middle part is a sequence for capturing
a target analyte (Fig. 4a). Due to this special configuration, the aptamer
would form a hairpin DNA and the complementary parts of the two
ends served as templates for forming copper nanoclusters. The bond
between the part of the aptamer and MC-LR would damage the hairpin
DNA, which triggered the breaking of copper nanoclusters from the
ssDNA. Meanwhile, the above process was accompanied by the dis-
appearance of the emission wavelength of 575 nm under the excitation
condition of 340 nm. This strategy of converting a stem-loop DNA
structure into an ssDNA offered the LOD of 3 × 10−6 μg/L and can be
used in real sample analysis.
SWNTs have advantages in detection techniques because they can
provide ultra-high mobility for electrons and large surface area for in-
teracting with sensing components. Taghdisi et al. (2017) exploited a
fluorescent aptasensor to detect the MC-LR based on SWNTs. The
SWNTs were modified with the aptamer of MC-LR. In the presence of
both the MC-LR and the specific aptamer for dapoxyl (DAP-10), the
T. Suo, et al. Journal of Hazardous Materials 403 (2021) 123418

Fig. 3. (a) Schematic diagram of the structure of AuNP dimers and oligonucleotides. When the target appears, the combination of the aptamer and two probes is
initiated to form the AuNPs dimers (Wang et al., 2015). (b) Schematic diagram of truncating the aptamer of the MC-LR and the mechanism of detection for dsDNA
duplex. Different parts of the truncating aptamer are respectively combined with two complementary sequences carrying fluorophores and quenchers, and the
appearance of the target can cause the separation of fluorophores to produce fluorescence changes (Chinnappan et al., 2019). (Adopted from Chinnappan et al., 2019;
Wang et al., 2015).

aptamer for MC-LR will be separated from the SWNTs and the DAP-10 there is no target, the fluorescence signal was enhanced and positively
will be immobilized on the surface of the SWNTs. After adding DAP-10 correlated with the amount of dapoxyl within a certain range due to the
to the supernatant of the centrifuged solution, it will discover that the specific binding of dapoxyl and DAP-10. It was due to the occupation of
change of fluorescence signals is inconspicuous. Contrary to this, when aptamer upon SWNTs without extra space to attach DAP-10, which

Fig. 4. (a) Schematic diagram of using

the hpDNA-templated CuNCs to detect
the MC-LR. The target will destroy the
hairpin template and bring about the
CuNCs to fall off, which can make the
light to disappear (Zhang et al., 2019).
(b) Schematic diagram of simulta-
neously detecting MC-LR and OA based
on UCNPs. The presence of the target
will induce the distance change be-
tween fluorophore and quencher in
UCNPs, resulting in fluorescence
change (Wu et al., 2015). (Adopted
from Wu et al., 2015; Zhang et al.,
2019).

8
T. Suo, et al. Journal of Hazardous Materials 403 (2021) 123418

Fig. 5. (a) Schematic diagram of monitoring the MC-LR for immunosensor. Competitive binding of the target and antigen results in changes in photocurrent (Wei
et al., 2018a). (b) Schematic diagram of the preparation Dual-Modal PEC and the working process of the colorimetric immunosensor. CdS/ZnO-HNRs are used as
photoelectric material to modify the FTO electrode. AA serves as a reducing agent to deposit metal ions and producing a color change of the solution. The target will
affect the photocurrent and the color of the solution by electron transfer (Wei et al., 2018b). (Adopted from Wei et al., 2018a, 2018b).

made DAP-10 free in the centrifuged supernatant. This method
achieved outstanding characteristics for the target detection in tap
water and serum samples with LODs of 13.5 × 10−2 μg/L and
16.8 × 10−2 μg/L, respectively.
In the fluorescent analytical methods, the detecting signal is easily
affected by the autofluorescence and the light-scattering derived from
the interferents, while the application of rare-earth upconversion na-
noparticles (UCNPs) can overcome these issues (de Queiroz et al., 2020;
R. Li et al., 2020; X. Li et al., 2020). Wu and co-workers (Wu et al.,
2015) fabricated an aptasensor for simultaneous detection of MC-LR
and okadaic acid with UCNPs (Fig. 4b). The green donor NaYF4: Yb, Ho
UCNPs, and Mn2+-doped NaYF4 with red color: Yb, Er UCNPs, were
modified with aptamer1 for MC-LR and aptamer2 for okadaic acid, re-
spectively. With the addition of two ssDNA modified with a different
quencher (BHQ1 and BHQ3) complementary to the two aptamers, the
fluorescence of the UCNPs was quenched. When the analyte was added
to the reaction, the formation of the aptamer-target complex caused the
shedding of ssDNA and the increase in fluorescence signal. This atten-
tion-grabbing strategy yielded a detection range from 0.1–50 μg/L in
fish and shrimps.
It has been recognized that the functionalization of electrodes with
biopolymers can improve the performance of electrochemical sensors
(Maduraiveeran, 2020). Abnous and co-workers (Abnous et al., 2019)
fabricated an aptasensor by utilizing the conformational changes of the
DNA probes on the silver reference electrode and gold counter electrode
(SPGEs). The terminal deoxynucleotidyl transferase (TdT) with the
ability to elongate 3′−OH end of the DNA strand with deoxynucleo-
tides was used in this investigation. In the absence of MC-LR, the TdT
can catalyze the polymerization of T bases at the 3′−OH end of the
aptamer|[Ru(bpy)3]2+|BN-GHs|GCE. Since the aptamer|[Ru(bpy)3]
2+|BN-GHs|GCEs were designed with a polyA domain at the 5′ ends,
the TdT-treated aptamer|[Ru(bpy)3]2+|BN-GHs|GCEs can be self-cir-
culated via intramolecular hybridization between poly-T and polyA. On
this occasion, the surface of the electrode would be covered so that the
contact between [Fe(CN)6]3−/4− and the electrode would be blocked,
resulting in a low electrochemical signal. When the MC-LR was added,
it interacted with the aptamers to separate the aptamers from the
electrode. An obvious current generated by [Fe(CN)6]3−/4− was
subsequently recorded because of the increased contact between [Fe
(CN)6]3−/4− and the electrode. The LOD of this conformation-depen-
dent platform was 1.5 × 10-2 μg/L, and has been applied in detecting
MC-LR in serum and tap water. Through the competitive combination
of the two substances, Liu and co-workers (X. Liu et al., 2019; M. Liu
et al., 2019) achieved the aim of amplifying signals to detect the target.
They developed electrochemical aptasensor by exploiting the triple
complexes of gold nanoparticles (AuNPs), molybdenum disulfide
(MoS2), and TiO2 nanobeads (TiONBs). A thiolated aptamer of the MC-
LR was conjugated to the triple complex which was already connected
to the electrode. There is a competitive binding between MC-LR and the
complementary DNA of aptamer tailed with avidin–HRP towards the
aptamer. The HRP can catalyze the reduction of H2O2, thus generating
recordable differential pulse voltammetry (DPV) signal. This sensor
exhibited a novel three-dimensional nano-structure with the LOD of
0.2 × 10-2 μg/L and has been proved feasible in real water sample
analysis.
3. DNA-assisted signal processing
DNA nanotechnology can also be used to process the recognition
signal generated by antibodies, antigens, and other proteins (Fig. 1b).
Applications of functionalized nucleic acid on the described basis may
improve the sensitivity of immune detection by amplifying the signals.
Generally, the functional nucleic acids act as carriers or linkers in the
reaction to enhance the stability of the complex and reduce the external
disturbance. Although the pretreatment of such assays is strict and
complicated, they are widely used because of convenient operation.
The amplification of detection signals is an important topic in im-
munosensors. With the integration of nanomaterials and dual-signal
readout, the robustness of immunoassays can be improved. Wei et al.
(2018a) have constructed a triple-amplified signal sensor that involved
hybridization chain reaction (HCR), exciton-plasmon interaction (EPI),
and biocatalytic precipitation (BCP) (Fig. 5a). The CdS/Fe2O3-nanorod
arrays (CdS/Fe2O3-TNRs) were immobilized on the electrode to serve as
a carrier for competitive antigens. Due to the competitive relationship
between antigen and MC-LR, the content of MC-LR will influence the
binding amount of antigen and antibody, resulting in changes in

9
T. Suo, et al.
photocurrent. The Au@polyaniline nanocomposites (Au@PANI) loaded
with secondary antibodies and short DNA primers were introduced
based on the above sensors. This complex has two functions: (i) it can
transmit signals by connecting with competitive antigens on the sensor.
(ii) it can absorb the conjugates of streptavidin-labeled alkaline phos-
phatase and Au (SA–ALP-Au) by hybridizing with two DNA strands to
amplify the signal. With the addition of 4-aminophenyl phosphate
monosodium salt hydrate (4-APP) and AgNO3 reagent, the SA catalyzed
4-APP and was accompanied by the deposition of Ag, thus inhibiting
electron transfer. It was found the involvement of DNA-involved signal
amplification has significantly improved the sensitivity of this sensor.
The detection range of this method was from 5 × 10−4 μg/L to
1.0 × 102 μg/L and the LOD was 3 × 10-4 μg/L. In practical applica-
tions, the stability, reproducibility, and selectivity of the detector had
been confirmed to meet the requirements. The same group has built a
double readout immunosensor (Wei et al., 2018b) based on a similar
strategy. The ascorbic acid 2-phosphate (AAP) was used in this updated
method instead of 4-APP previously used. Under the catalysis of SA, the
generated ascorbic acid (AA) acted as an electron donor, which induce
the reduction of silver ions while changing the electrical (Fig. 5b). The
dual-model split-type immunosensor not only conquered the weak-
nesses of colorimetry but also enhanced the stability of the photoelec-
trochemical signals. Under the optimal conditions, the linear detection
range of this strategy was 0.5 × 10-4 μg/L to 5.0 μg/L and the LOD was
0.3 × 10-4 μg/L. In both of the two methods, the involvement of DNA
nanotechnology has provided abundant binding sites for electro-
chemical probes to contact with the electrodes, thus realizing the am-
plification of the detection signal.
To avoid the use of unstable enzymes, the group of He (D. He et al.,
2019; Z. He et al., 2019) manufactured an immunosensor that can read
out the double signals of silver and copper. The sensor can be roughly
divided into three parts: (i) the gold nanoparticles-decorated-carbon
nanotubes (AuNP-CNT) adhered to the microplate as carriers of the
target antigens; (ii) complex containing the silver nanoparticles and
gold nanorods (AgNP/AuNR) could connect secondary antibodies and
short DNA primers; (iii) the DNA strands used as a template for copper
nanoparticles (CuNPs). With the addition of the MC-LR, the binding
amount of antibody and antigen decreased, thus influencing the amount
of AuNP-CNT absorbed to the electrodes. Afterward, the hybridization
chain reaction was triggered by the addition of DNA strands to induce
the generation of long hybridized dsDNA, resulting in intensified dif-
ferential pulse stripping voltammetry (DPSV) signals. The im-
munosensor not only had a low LOD of 2.8 × 10−3 μg/L but also of-
fered result repeatability, stability, and specificity which were
according to the national requirements.
4. Conclusion and perspective
Algal toxins have long been a threat to humans and the environ-
ment, and the MC-LR is one of the most toxic carcinogens that poses a
serious threat to human life and health. Therefore, it is requisite to
develop facile techniques for monitoring the content of the MC-LR.
Through continuous research, it has been established that DNA nano-
technology is suitable for applying in the detection of this small mo-
lecular aquatic toxin, derived from advantages including the small size,
good biocompatibility, and plasticity of DNA system. During summar-
izing the MC-LR detection methods based on DNA nanotechnology, we
found that the modification of DNA with various functional blocks or
ligands plays a key role, either as a recognition element or as an aux-
iliary device to enhance the signal. The combination of a DNA chain
and multiple functional blocks can improve the robustness of the
methods by enhancing the stability of the nucleic acid chain, and op-
timize the analytical performance of the sensor at the same time.
The information encoded in DNA strands can be utilized to re-
cognize the MC-LR, which mainly based on the thriving development of
aptamer technology. When directly detecting the binding signal
10
Journal of Hazardous Materials 403 (2021) 123418
between the MC-LR and aptamers, though simplicity can be obtained,
the methods exhibited low sensitivity. In this regard, indirect methods
were developed, where the aptamer and the complementary nucleic
acid chain are introduced simultaneously to transduce the binding
event into a DNA signal by competitive binding processes. Whereas, this
strategy reduced the affinity between the aptamer and the target, which
may affect the accuracy of the detection results. As a potent tool to
improve traditional methods, it is also an important trend that the
nucleic acid chain is introduced as the auxiliary elements of signal
processing in immunoassays. Because the nucleic acid chain is amen-
able to modify and can be connected with various nanomaterials, the
detection signal is easy to be amplified, resulting in significantly im-
proved detection limits. Though sensitivity and reaction kinetics can be
improved, the accuracy of immune-based methods is still low because
of the difficulties in ensuring the quality of antibodies. We believe that
the overall performance of immunoassays will be improved by in-
creasing the properties of antibodies. Currently, almost all of the MC-LR
detection strategy based on DNA nanotechnology adopted simply
modified DNA strand and low-dimensional DNA nanostructures. With
the decreasing cost of DNA construction and increasing knowledge in
controllable fabrication of complexed DNA nanostructure, an advanced
structure of DNA will be applied to the detection of MC-LR. The ad-
vanced structure of DNA probes or nucleic acid networks applied in the
MC-LR monitoring are still at their early stage, but this efficient in-
tegration holds great potential in transferring the analysis of the MC-LR
from well-equipped labs to low-resourced monitoring points.
In the DNA nanotechnology-based sensing, the specific recognition
of targets is a major challenge. On the one hand, many aptamers of
targets have not yet been screened out. On the other hand, most anti-
bodies are produced by the expression system of mammals, which
makes the process of obtaining antibodies time-consuming and labor-
ious. These deficiencies hinder the universality of the strategy. For
example, aptamers and antibodies of some variants of the MC-LR have
not been acquired, which slows down the pace of DNA nanotechnology
in the sensing field of cyanotoxins. Moreover, the affinity and specifi-
city between targets and aptamers need to be enhanced to avoid non-
specific changes of aptamers caused by interferents.
Currently, most tests use lab-made nanomaterials to augment the
performance of the sensor, which requires intensive efforts in the
modification and fabrication of sensing components. These efforts de-
mand professional operations in well-controlled conditions, and the
deviation of a condition in obtaining those delicate sensing components
may lead to inconsistent analytical results.
The research significance of DNA-based nano-sensing technology
lies in solving practical issues, while the sensor based on DNA nano-
technology is still at the stage of exploration. The detection throughput
is a factor worth concerning. For example, though the aforementioned
microcantilever array and smartphone methods exhibited advantages in
portability, their low detection throughput has blocked their practical
applications. Additionally, in most of the current strategies, water
samples have been used to demonstrate the performance. It will be
valuable to broaden the scope of devices by exhibiting their perfor-
mance in various types of samples such as food, drugs, and other
samples as these real samples are more complex than that of water.
Taking into account the above shortcomings, there is a gap to be filled
before the popularization and marketization of this technology.
In the future, the main tasks of DNA nano-sensing lie in acquiring
improved components for recognition, as well as expanding the im-
plementable range of sensors. Present investigations have shown that
the employment of DNA nanotechnology can elevate the performance
of analytical methods targeting MC-LR, and this improvement is tightly
related to the programmable and predictable of DNA molecules. We
envision that the development of DNA nanotechnology will further
enrich the arsenal for the facile monitoring of MC-LR, serving appli-
cations in scenarios including agriculture, environmental protection,
food industry, and human health.
T. Suo, et al.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgments
This work was supported by grants from the National Key Research
and Development Project (No. 2019YFC1605800), the Natural Science
Foundation of Jiangsu Province (No. SBK2020040945), the National
Natural Science Foundation of China (No. 22007049), and the Scientific
Research Start-Up Funding for Nanjing Normal University Introduced
Talents (184080H202B246).
References
Abnous, K., Danesh, N.M., Nameghi, M.A., Ramezani, M., Alibolandi, M., Lavaee, P.,
Taghdisi, S.M., 2019. An ultrasensitive electrochemical sensing method for detection
of microcystin-LR based on infinity-shaped DNA structure using double aptamer and
terminal deoxynucleotidyl transferase. Biosens. Bioelectron. 144, 111674.
Aguete, E.C., Gago-Martinez, A., Rodriguez-Vazquez, J.A., O’Connell, S., Moroney, C.,
James, K.J., 2001. Application of HPLC and HPCE to the analysis of cyanobacterial
toxins. Chromatographia 53S (2), S254–S259.
Almeida, V.P.S., Cogo, K., Tsai, S.M., Moon, D.H., 2006. Colorimetric test for the mon-
itoring of microcystins in cyanobacterial culture and environmental samples from
southeast-Brazil. Braz. J. Microbiol. 37 (2), 192–198.
Andersen, E.S., Dong, M., Nielsen, M.M., Jahn, K., Subramani, R., Mamdouh, W., Golas,
M.M., Sander, B., Stark, H., Oliveira, C.L.P., Pedersen, J.S., Birkedal, V., Besenbacher,
F., Gothelf, K.V., Kjems, J., 2009. Self-assembly of a nanoscale DNA box with a
controllable lid. Nature 459 (7243), 73–76.
Bagu, J.R., Sykes, B.D., Craig, M.M., Holmes, C.F., 1997. A molecular basis for different
interactions of marine toxins with protein phosphatase-1. Molecular models for
bound motuporin, microcystins, okadaic acid, and calyculin A. J. Biol. Chem. 272 (8),
5087–5097.
Berti, L., Burley, G.A., 2008. Nucleic acid and nucleotide-mediated synthesis of inorganic
nanoparticles. Nat. Nanotechnol. 3 (2), 81–87.
Best, J.H., Pflugmacher, S., Wiegand, C., Eddy, F.B., Metcalf, J.S., Codd, G.A., 2002.
Effects of enteric bacterial and cyanobacterial lipopolysaccharides, and of micro-
cystin-LR, on glutathione S-transferase activities in zebra fish (Danio rerio). Aquat.
Toxicol. 60 (3), 223–231.
Bieczynski, F., Bianchi, V.A., Luquet, C.M., 2013. Accumulation and biochemical effects
of microcystin-LR on the Patagonian pejerrey (Odontesthes hatcheri) fed with the
toxic cyanobacteria Microcystis aeruginosa. Fish Physiol. Biochem. 39 (5),
1309–1321.
Bilibana, M.P., Williams, A.R., Rassie, C., Sunday, C.E., Makelane, H., Wilson, L.,
Ntshongontshi, N., Jijana, A.N., Masikini, M., Baker, P.G.L., Iwuoha, E.I., 2016.
Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-
Deposited Silver Nanoparticles on Poly(Propyleneimine) Dendrimer for the Detection
of Microcystin-LR in Freshwater. Sensors Basel (Basel) 16 (11).
Bostan, H.B., Taghdisi, S.M., Bowen, J.L., Demertzis, N., Rezaee, R., Panahi, Y., Tsatsakis,
A.M., Karimi, G., 2018. Determination of microcystin-LR, employing aptasensors.
Biosens. Bioelectron. 119, 110–118.
Bui, H., Miao, V., Garg, S., Mokhtar, R., Song, T., Reif, J., 2017. Design and analysis of
localized DNA hybridization chain reactions. Small 13 (12), 1602983.
Cadel-Six, S., Moyenga, D., Magny, S., Trotereau, S., Edery, M., Krys, S., 2014. Detection
of free and covalently bound microcystins in different tissues (liver, intestines, gills,
and muscles) of rainbow trout (Oncorhynchus mykiss) by liquid chromatography-
tandem mass spectrometry: method characterization. ENVIRON POLLUT 185,
333–339.
Came, N.A., Moreno, I.M., Ruiz, M.A.J., Pic, Y., 2004. Determination of microcystins in
natural blooms and cyanobacterial strain cultures by matrix solid-phase dispersion
and liquid chromatography-mass spectrometry. Anal. Bioanal. Chem. 380 (3),
537–544.
Campos, A., Vasconcelos, V., 2010. Molecular mechanisms of microcystin toxicity in
animal cells. Int. J. Mol. Sci. 11 (1), 268–287.
Campuzano, S., Gamella, M., Serafin, V., Pedrero, M., Yanez-Sedeno, P., Manuel
Pingarron, J., 2019. Biosensing and Delivery of Nucleic Acids Involving Selected
Well-Known and Rising Star Functional Nanomaterials. Nanomaterialsbasel 9
(161411).
Cao, Q., Steinman, A.D., Wan, X., Xie, L., 2018. Combined toxicity of microcystin-LR and
copper on lettuce (Lactuca sativa L.). Chemosphere 206, 474–482.
Chen, J., Gao, P., Wang, H., Han, L., Zhang, Y., Wang, P., Jia, N., 2018. A PPy/Cu2O
molecularly imprinted composite film-based visible light-responsive photoelec-
trochemical sensor for microcystin-LR. J. Mater. Chem. 6 (15), 3937–3944.
Chen, G., Zheng, Z., Bai, M., Li, Q., 2020a. Chronic effects of microcystin-LR at en-
vironmental relevant concentrations on photosynthesis of Typha angustifolia Linn.
Ecotoxicology 29 (5), 514–523.
Chen, Y., Chen, K., Zhou, Y., Li, X., Mao, X., Wei, X., Xu, Y., Yang, W., Chen, G., Liu, C.,
2020b. Microcystin-LR impairs glucose metabolism in pancreatic beta cells in vivo
11
Journal of Hazardous Materials 403 (2021) 123418
and in vitro. Toxicol. Lett. 326, 106–113.
Chen, Y., Qian, C., Liu, C., Shen, H., Wang, Z., Ping, J., Wu, J., Chen, H., 2020c. Nucleic
acid amplification free biosensors for pathogen detection. Biosens. Bioelectron. 153
(112049).
Chinnappan, R., AlZabn, R., Abu-Salah, K.M., Zourob, M., 2019. An aptamer based
fluorometric microcystin-LR assay using DNA strand-based competitive displace-
ment. Microchim Acta 186 (7).
Covaci, O.I., Sassolas, A., Alonso, G.A., Munoz, R., Radu, G.L., Bucur, B., Marty, J.L.,
2012. Highly sensitive detection and discrimination of LR and YR microcystins based
on protein phosphatases and an artificial neural network. Anal. Bioanal. Chem. 404
(3), 711–720.
He, D., Wu, Z., Cui, B., Jin, Z., 2019. A novel SERS-based aptasensor for ultrasensitive
sensing of microcystin-LR. Food Chem. 278, 197–202.
D’Angelo, E., 2019. Development and evaluation of a sensitive, Diffusive Gradients in
Thin-Films (DGT) method for determining microcystin-LR concentrations in fresh-
water and seawater. Harmful Algae 89 UNSP 101668.
Dai, J., Ma, C., Zhang, P., Fu, Y., Shen, B., 2020. Recent progress in the development of
fluorescent probes for detection of biothiols. Dye. Pigment. 177 (108321).
de Queiroz, T.B., Cabrera-Baez, M., Menegasso, P., Martinez, E.D., Garcia Flores, A.F.,
Rettori, C., Urbano, R.R., 2020. Probing surface effects on alpha-NaYF4 nanoparticles
by nuclear magnetic resonance. J. Phys. Chem. C 124 (17), 9523–9535.
Degliangeli, F., Kshirsagar, P., Brunetti, V., Pompa, P.P., Fiammengo, R., 2014. Absolute
and direct MicroRNA quantification using DNA-Gold nanoparticle probes. J. Am.
Chem. Soc. 136 (6), 2264–2267.
Ding, Q., Liu, K., Song, Z., Sun, R., Zhang, J., Yin, L., Pu, Y., 2020. Effects of Microcystin-
LR on metabolic functions and structure succession of sediment bacterial community
under anaerobic conditions. Toxins 12 (3), 183.
Dirks, R.M., Pierce, N.A., 2004. Triggered amplification by hybridization chain reaction.
Proc. Natl. Acad. Sci. U.S.A. 101 (43), 15275–15278.
Douglas, S.M., Dietz, H., Liedl, T., Högberg, B., Graf, F., Shih, W.M., 2009. Self-assembly
of DNA into nanoscale three-dimensional shapes. NATURE 459 (7245), 414–418.
Du, X., Jiang, D., Hao, N., Qian, J., Dai, L., Zhou, L., Hu, J., Wang, K., 2016. Building a
three-dimensional nano-bio interface for aptasensing: an analytical methodology
based on steric hindrance initiated signal amplification effect. Anal. Chem. 88 (19),
9622–9629.
Du, X., Jiang, D., Li, H., Hao, N., You, T., Wang, K., 2018. An intriguing signal-off re-
sponsive photoelectrochemical aptasensor for ultrasensitive detection of microcystin-
LR and its mechanism study. Sens. Actuators B Chem. 259, 316–324.
Ebrahimi, A., Ravan, H., Khajouei, S., 2019. DNA nanotechnology and bioassay devel-
opment. Trac. Trends Anal. Chem. 114, 126–142.
Eissa, S., Ng, A., Siaj, M., Zourob, M., 2014. Label-free voltammetric aptasensor for the
sensitive detection of Microcystin-LR using graphene-modified electrodes. Anal.
Chem. 86 (15), 7551–7557.
Engene, N., Choi, H., Esquenazi, E., Rottacker, E.C., Ellisman, M.H., Dorrestein, P.C.,
Gerwick, W.H., 2011. Underestimated biodiversity as a major explanation for the
perceived rich secondary metabolite capacity of the cyanobacterial genus Lyngbya.
Environ. Microbiol. 13 (6), 1601–1610.
Graham, J.L., Loftin, K.A., Meyer, M.T., Ziegler, A.C., 2010. Cyanotoxin mixtures and
taste-and-Odor compounds in cyanobacterial blooms from the Midwestern United
States. Environ. Sci. Technol. 44 (19), 7361–7368.
Gu, L., Li, S., Bai, J., Zhang, Q., Han, Z., 2020. α‐Lipoic acid protects against microcystin-
LR induced hepatotoxicity through regeneration of glutathione via activation of Nrf2.
Environ. Toxicol.
He, W., Elizondo-Riojas, M., Li, X., Lokesh, G.L.R., Somasunderam, A., Thiviyanathan, V.,
Volk, D.E., Durland, R.H., Englehardt, J., Cavasotto, C.N., Gorenstein, D.G., 2012. X-
Aptamers: a bead-based selection method for random incorporation of drug like
moieties onto next-generation aptamers for enhanced binding (vol 51, pg 8321,
2012). Biochemistryus 51 (47), 9592.
Hu, X., Mu, L., Wen, J., Zhou, Q., 2012. Immobilized smart RNA on graphene oxide
nanosheets to specifically recognize and adsorb trace peptide toxins in drinking
water. J. Hazard. Mater. 213-214, 387–392.
Huang, P., Chen, K., Ma, T., Cao, N., Weng, D., Xu, C., Xu, L., 2020. The effects of short-
term treatment of microcystin-LR on the insulin pathway in both the HL7702 cell line
and livers of mice. Environ. Toxicol.
Ingrid Chorus, I.R.F.H., 2000. Health risks caused by freshwater CYANOBACTERIA in
recreational waters. J. Toxicol. Environ. Health Part B 3 (4), 323–347.
Izaguirre, G., Jungblut, A., Neilan, B.A., 2007. Benthic cyanobacteria (Oscillatoriaceae)
that produce microcystin-LR, isolated from four reservoirs in southern California.
Water Res. 41 (2), 492–498.
Jia, X., Cai, C., Wang, J., Gao, N., Zhang, H., 2014. Endocrine-disrupting effects and
reproductive toxicity of low dose MCLR on male frogs (Rana nigromaculata) in vivo.
Aquat. Toxicol. 155, 24–31.
Kelley, S.O., Mirkin, C.A., Walt, D.R., Ismagilov, R.F., Toner, M., Sargent, E.H., 2014.
Advancing the speed, sensitivity and accuracy of biomolecular detection using multi-
length-scale engineering. Nat. Nanotechnol. 9 (12), 969–980.
Kwon, Y.S., Raston, N.H.A., Gu, M.B., 2014. An ultra-sensitive colorimetric detection of
tetracyclines using the shortest aptamer with highly enhanced affinity. Chem.
Commun. (Camb.) 50 (1), 40–42.
Kwon, P.S., Ren, S., Kwon, S., Kizer, M.E., Kuo, L., Xie, M., Zhu, D., Zhou, F., Zhang, F.,
Kim, D., Fraser, K., Kramer, L.D., Seeman, N.C., Dordick, J.S., Linhardt, R.J., Chao, J.,
Wang, X., 2020. Designer DNA architecture offers precise and multivalent spatial
pattern-recognition for viral sensing and inhibition. Nat. Chem. 12 (1), 26–35.
Lee, E., Son, A., 2019. Fluorescence resonance energy transfer based quantum dot-
Aptasensor for the selective detection of microcystin-LR in eutrophic water. Chem.
Eng. J. 359, 1493–1501.
Li, B., Wang, X., Shen, X., Zhu, W., Xu, L., Zhou, X., 2016. Aggregation-induced emission
T. Suo, et al.
from gold nanoclusters for use as a luminescence-enhanced nanosensor to detect
trace amounts of silver ions. J. Colloid Interf. Sci. 467, 90–96.
Li, X., Cheng, R., Shi, H., Tang, B., Xiao, H., Zhao, G., 2016a. A simple highly sensitive and
selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR
in water samples. J. Hazard. Mater. 304, 474–480.
Li, B., Chen, Y., Wang, J., Lu, Q., Zhu, W., Xu, L., Shen, X., Luo, J., Zhu, C., Li, X., Hong, J.,
Zhou, X., 2018. DNA-silver nanoclusters/polypyrrole nanoparticles: a label-free and
enzyme-free platform for multiplexed transcription factors detection. Sensor Actuat
B-Chem 274, 481–490.
Li, Z., Zhang, S., Yu, T., Dai, Z., Wei, Q., 2019. Aptamer-based fluorescent sensor array for
multiplexed detection of cyanotoxins on a smartphone. Anal. Chem. 91 (16),
10448–10457.
Lin, Z., Huang, H., Xu, Y., Gao, X., Qiu, B., Chen, X., Chen, G., 2013. Determination of
microcystin-LR in water by a label-free aptamer based electrochemical impedance
biosensor. Talanta 103, 371–374.
Lin, M., Wang, J., Zhou, G., Wang, J., Wu, N., Lu, J., Gao, J., Chen, X., Shi, J., Zuo, X., Fan,
C., 2015. Programmable engineering of a biosensing interface with tetrahedral DNA
nanostructures for ultrasensitive DNA detection. Angew. Chemie Int. Ed. 54 (7),
2151–2155.
Lin, M., Song, P., Zhou, G., Zuo, X., Aldalbahi, A., Lou, X., Shi, J., Fan, C., 2016b.
Electrochemical detection of nucleic acids, proteins, small molecules and cells using a
DNA-nanostructure-based universal biosensing platform. Nat. Protoc. 11 (7),
1244–1263.
Liu, M., Yu, J., Ding, X., Zhao, G., 2016. Photoelectrochemical aptasensor for the sensitive
detection of Microcystin-LR based on graphene functionalized vertically-aligned TiO2
nanotubes. Electroanal 28 (1), 161–168.
Lokesh, G.L., Wang, H., Lam, C.H., Thiviyanathan, V., Ward, N., Gorenstein, D.G., Volk,
D.E., 2017. X-aptamer selection and validation. Methods Mol. Biol. 1632, 151–174.
Lombardo, D., Calandra, P., Pasqua, L., Magazù, S., 2020. Self-assembly of organic na-
nomaterials and biomaterials: the bottom-up approach for functional nanostructures
formation and advanced applications. Materials 13 (5), 1048.
Lone, Y., Koiri, R.K., Bhide, M., 2015. An overview of the toxic effect of potential human
carcinogen Microcystin-LR on testis. Toxicol. Rep. 2, 289–296.
Lotierzo, M., Abuknesha, R., Davis, F., Tothill, I.E., 2012. A membrane-based ELISA assay
and electrochemical immunosensor for Microcystin-LR in water samples. Environ.
Sci. Technol. 46 (10), 5504–5510.
Lu, N., Ling, L., Guan, T., Wang, L., Wang, D., Zhou, J., Ruan, T., Shen, X., Li, X., Sun, Y.,
Lei, H., 2020. Broad-specificity ELISA with a heterogeneous strategy for sensitive
detection of microcystins and nodularin. TOXICON 175, 44–48.
Liu, M., Sun, C., Wang, G., Wang, Y., Lu, H., Shi, H., Zhao, G., 2019. A simple, super-
sensitive and highly selective electrochemical aptasensor for Microcystin-LR based on
synergistic signal amplification strategy with graphene, DNase I enzyme and Au
nanoparticles. Electrochim. Acta 293, 220–229.
Zhang, M., Ye, J., He, J., Zhang, F., Ping, J., Qian, C., Wu, J., 2020. Visual detection for
nucleic acid-based techniques as potential on-site detection methods. A review. Anal.
Chim. Acta 1099, 1–15.
Ma, X., Sun, M., Lin, Y., Liu, Y., Luo, F., Guo, L., Qiu, B., Lin, Z., Chen, G., 2018. Progress
of visual biosensor based on gold nanoparticles. Chinese J. Anal. Chem. 46 (1), 1–10.
MacKintosh, C., Beattie, K.A., Klumpp, S., Cohen, P., Codd, G.A., 1990. Cyanobacterial
microcystin-LR is a potent and specific inhibitor of protein phosphatases 1 and 2A
from both mammals and higher plants. FEBS Lett. 264 (2), 187–192.
Maduraiveeran, G., 2020. Bionanomaterial-based electrochemical biosensing platforms
for biomedical applications. Anal Methods-UK 12 (13), 1688–1701.
Mascini, M., Palchetti, I., Tombelli, S., 2012. Nucleic acid and peptide aptamers: funda-
mentals and bioanalytical aspects. Angew. Chemie Int. Ed. 51 (6), 1316–1332.
McConnell, E.M., Morrison, D., Rincon, M.A.R., Salena, B.J., Li, Y., 2020. Selection and
applications of synthetic functional DNAs for bacterial detection. Trac-Trend Anal
Chem 124 (115785).
Metcalf, J.S., Bell, S.G., Codd, G.A., 2001. Colorimetric immune-protein phosphatase
inhibition assay for specific detection of microcystins and nodularins of cyano-
bacteria. Appl Environ Microb 67 (2), 904–909.
Mohamed, Z.A., 2018. Potentially harmful microalgae and algal blooms in the Red Sea:
current knowledge and research needs. Mar. Environ. Res. 140, 234–242.
Moreira, C., Vasconcelos, V., Antunes, A., 2013. Phylogeny and biogeography of
Cyanobacteria and their produced toxins. Mar. Drugs 11 (11), 4350–4369.
Nadal, P., Svobodova, M., Mairal, T., O’Sullivan, C.K., 2013. Probing high-affinity 11-mer
DNA aptamer against Lup an 1 (beta-conglutin). Anal. Bioanal. Chem. 405 (29),
9343–9349.
Nakamura, C., Kobayashi, T., Miyake, M., Shirai, M., Miyakea, J., 2001. Usage of a DNA
aptamer as a ligand targeting microcystin. Mol. Cryst. Liq. Cryst. Sci. Technol. Sect. A
Mol. Cryst. Liq. Cryst. 371 (1), 369–374.
Ng, A., Chinnappan, R., Eissa, S., Liu, H., Tlili, C., Zourob, M., 2012. Selection, char-
acterization, and biosensing application of high affinity congener-specific micro-
cystin-targeting aptamers. Environ. Sci. Technol. 46 (19), 10697–10703.
Okupnik, A., Contardo-Jara, V., Pflugmacher, S., 2015. Potential role of engineered na-
noparticles as contaminant carriers in aquatic ecosystems: estimating sorption pro-
cesses of the cyanobacterial toxin microcystin-LR by TiO2 nanoparticles. Colloids
Surf. A Physicochem. Eng. Asp. 481, 460–467.
Olson, N.E., Cooke, M.E., Shi, J.H., Birbeck, J.A., Westrick, J.A., Ault, A.P., 2020. Harmful
algal bloom toxins in aerosol generated from Inland Lake Water. Environ. Sci.
Technol. 54 (8), 4769–4780.
Palchetti, I., Mascini, M., 2008. Nucleic acid biosensors for environmental pollution
monitoring. Analyst 133 (7), 846–854.
Pang, P., Lai, Y., Zhang, Y., Wang, H., Conlan, X.A., Barrow, C.J., Yang, W., 2020. Recent
advancement of biosensor technology for the detection of Microcystin-LR. B. Chem.
Soc. Jpn. 93 (5), 637–646.
12
Journal of Hazardous Materials 403 (2021) 123418
Panigaj, M., Johnson, M.B., Ke, W., McMillan, J., Goncharova, E.A., Chandler, M., Afonin,
K.A., 2019. Aptamers as modular components of therapeutic nucleic acid nano-
technology. ACS Nano 13 (11), 12301–12321.
Park, J., Kang, J., Jung, S., Choi, J., Lee, S., Yargeau, V., Kim, S., 2020. Investigating
Microcystin-LR adsorption mechanisms on mesoporous carbon, mesoporous silica,
and their amino-functionalized form: surface chemistry, pore structures, and mole-
cular characteristics. Chemosphere 247 (125811).
Li, R., Li, Z., Sun, X., Ji, J., Liu, L., Gu, Z., Wang, G., 2020. Graphene quantum dot-rare
earth upconversion nanocages with extremely high efficiency of upconversion lu-
minescence, stability and drug loading towards controlled delivery and cancer
theranostics. Chem. Eng. J. 382 (122992).
Ravan, H., Yazdanparast, R., 2013. Loop region-specific oligonucleotide probes for loop-
mediated isothermal amplification-enzyme-linked immunosorbent assay truly mini-
mize the instrument needed for detection process. Anal. Biochem. 439 (2), 102–108.
Rothemund, P.W., 2006. Folding DNA to create nanoscale shapes and patterns. Nature
440 (7082), 297–302.
Salmaso, N., Capelli, C., Shams, S., Cerasino, L., 2015. Expansion of bloom-forming
Dolichospermum lemmermannii (Nostocales, Cyanobacteria) to the deep lakes south
of the Alps: colonization patterns, driving forces and implications for water use.
Harmful Algae 50, 76–87.
Santos, A., Rachid, C., Pacheco, A.B., Magalhaes, V., 2020. Biotic and abiotic factors affect
microcystin-LR concentrations in water/sediment interface. Microbiol. Res. (Pavia)
236 (126452).
Sassolas, A., Catanante, G., Fournier, D., Marty, J.L., 2011. Development of a colorimetric
inhibition assay for microcystin-LR detection: comparison of the sensitivity of dif-
ferent protein phosphatases. Talanta 85 (5), 2498–2503.
Schweitzer, B., Roberts, S., Grimwade, B., Shao, W., Wang, M., Fu, Q., Shu, Q., Laroche, I.,
Zhou, Z., Tchernev, V.T., Christiansen, J., Velleca, M., Kingsmore, S.F., 2002.
Multiplexed protein profiling on microarrays by rolling-circle amplification. Nat.
Biotechnol. 20 (4), 359–365.
Shen, B., Qian, Y., 2019. Red emission cysteine probe with high selectivity based on
fluorescent protein chromophores and turn-on fluorescence in cell cultures. Dye.
Pigment. 166, 350–356.
Shen, B., Wang, L.F., Zhi, X., Qian, Y., 2020a. Construction of a red emission BODIPY-
based probe for tracing lysosomal viscosity changes in culture cells. Sensor Actuat B-
Chem 304 (127271).
Shen, B., Zhu, W., Zhi, X., Qian, Y., 2020b. A lysosome targeting probe based on fluor-
escent protein chromophore for selectively detecting GSH and Cys in living cells.
Talanta 208 (120461).
Singh, S., Srivastava, A., Oh, H., Ahn, C., Choi, G., Asthana, R.K., 2012. Recent trends in
development of biosensors for detection of microcystin. Toxicon 60 (5), 878–894.
Sotoud, H., Gribbon, P., Ellinger, B., Reinshagen, J., Boknik, P., Kattner, L., El-Armouche,
A., Eschenhagen, T., 2013. Development of a colorimetric and a fluorescence phos-
phatase-inhibitor assay suitable for drug discovery approaches. J. Biomol. Screen. 18
(8), 899–909.
Stanley, S., Vanarsa, K., Soliman, S., Habazi, D., Pedroza, C., Gidley, G., Zhang, T.,
Mohan, S., Der, E., Suryawanshi, H., Tuschl, T., Buyon, J., Putterman, C., Mok, C.C.,
Petri, M., Saxena, R., Mohan, C., 2020. Comprehensive aptamer-based screening
identifies a spectrum of urinary biomarkers of lupus nephritis across ethnicities. Nat.
Commun. 11 (1).
Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX-A (r)evolutionary method to
generate high-affinity nucleic acid ligands. Biomol. Eng. 24 (4), 381–403.
Svirčev, Z., Drobac, D., Tokodi, N., Mijović, B., Codd, G.A., Meriluoto, J., 2017.
Toxicology of microcystins with reference to cases of human intoxications and epi-
demiological investigations of exposures to cyanobacteria and cyanotoxins. Arch.
Toxicol. 91 (2), 621–650.
Taghdisi, S.M., Danesh, N.M., Ramezani, M., Ghows, N., Mousavi Shaegh, S.A., Abnous,
K., 2017. A novel fluorescent aptasensor for ultrasensitive detection of microcystin-
LR based on single-walled carbon nanotubes and dapoxyl. Talanta 166, 187–192.
Tang, Y., Chai, Y., Liu, X., Li, L., Yang, L., Liu, P., Zhou, Y., Ju, H., Cheng, Y., 2018. A
photoelectrochemical aptasensor constructed with core-shell CuS-TiO2 hetero-
structure for detection of microcystin-LR. Biosens. Bioelectron. 117, 224–231.
Trapmann, S., Etxebarria, N., Schnabl, H., Grobecker, K.H., 1998. Progress in herbicide
determination with the thylakoid bioassay. Environ. Sci. Pollut. Res. Int. 5 (1), 17–20.
Turner, A.P.F., 2013. Biosensors: sense and sensibility. Chem. Soc. Rev. 42 (8), 3184.
Vasconcelos, V., 2015. Global changes and the new challenges in the research on cya-
notoxin risk evaluation. Limnetica 34 (1), 149–158.
Vogiazi, V., de la Cruz, A., Mishra, S., Shanov, V., Heineman, W.R., Dionysiou, D.D.,
2019. A comprehensive review: development of electrochemical biosensors for de-
tection of cyanotoxins in freshwater. ACS Sens. 4 (5), 1151–1173.
Wang, L., Arrabito, G., 2015. Hybrid, multiplexed, functional DNA nanotechnology for
bioanalysis. Analyst 140 (17), 5821–5848.
Wang, F., Liu, S., Lin, M., Chen, X., Lin, S., Du, X., Li, H., Ye, H., Qiu, B., Lin, Z., Guo, L.,
Chen, G., 2015. Colorimetric detection of microcystin-LR based on disassembly of
orient-aggregated gold nanoparticle dimers. Biosens. Bioelectron. 68, 475–480.
Wang, H., Lam, C.H., Li, X., West, D.L., Yang, X., 2018a. Selection of PD1/PD-L1 X-
Aptamers. Biochimie 145, 125–130.
Wang, X., Xiang, P., Zhang, Y., Wan, Y., Lian, H., 2018b. The inhibition of Microcystis
aeruginos by electrochemical oxidation using boron-doped diamond electrode.
Environ. Sci. Pollut. R 25 (21SI), 20631–20639.
Wang, L., He, L., Zeng, H., Fu, W., Wang, J., Tan, Y., Zheng, C., Qiu, Z., Luo, J., Lv, C.,
Huang, Y., Shu, W., 2020a. Low-dose microcystin-LR antagonizes aflatoxin B1 in-
duced hepatocarcinogenesis through decreasing cytochrome P450 1A2 expression
and aflatoxin B1-DNA adduct generation. Chemosphere 248, 126036.
Wang, S., Gray, M.A., Xuan, S., Lin, Y., Byrnes, J., Nguyen, A.I., Todorova, N., Stevens,
M.M., Bertozzi, C.R., Zuckermann, R.N., Gang, O., 2020b. DNA origami protection
T. Suo, et al.
and molecular interfacing through engineered sequence-defined peptoids. Proc. Natl.
Acad. Sci. U.S.A. 117 (12), 6339–6348.
Wang, X., Li, Y., Xiao, H., Zhang, M., Bao, T., Luo, X., Chen, S., 2020c. Genotoxicity of
microcystin-LR in mammalian cells: implication from peroxynitrite produced by
mitochondria. Ecotox. Environ. Safe 195 (110408).
Wei, J., Chang, W., Qileng, A., Liu, W., Zhang, Y., Rong, S., Lei, H., Liu, Y., 2018a. Dual-
modal split-type immunosensor for sensitive detection of Microcystin-LR: enzyme-
induced photoelectrochemistry and colorimetry. Anal. Chem. 90 (15), 9606–9613.
Wei, J., Xie, X., Chang, W., Yang, Z., Liu, Y., 2018b. Ultrasensitive photoelectrochemical
detection of microcystin-LR based on hybridization chain reaction assisted exciton-
plasmon interaction and enzymatic biocatalytic precipitation. Sens. Actuators B
Chem. 276, 180–188.
Wei, Q., Huang, J., Li, J., Wang, J., Yang, X., Liu, J., Wang, K., 2018c. A DNA nanowire
based localized catalytic hairpin assembly reaction for microRNA imaging in live
cells. Chem. Sci. 9 (40), 7802–7808.
Wei, H., Wang, S., Xu, E.G., Liu, J., Li, X., Wang, Z., 2020. Synergistic toxicity of mi-
crocystin-LR and Cu to zebrafish (Danio rerio). Sci. Total Environ. 713, 136393.
Welten, R.D., Meneely, J.P., Elliott, C.T., 2020. A comparative review of the effect of
Microcystin-LR on the proteome. Expos Health 12 (2), 111–129.
Wijewickrama, M.M., Manage, P.M., 2019. Accumulation of Microcystin-LR in grains of
two rice varieties (Oryza sativa L.) and a leafy vegetable, Ipomoea aquatica. Toxins
11 (8), 432.
Wu, S., Duan, N., Zhang, H., Wang, Z., 2015. Simultaneous detection of microcysin-LR
and okadaic acid using a dual fluorescence resonance energy transfer aptasensor.
Anal. Bioanal. Chem. 407 (5), 1303–1312.
Wu, J., Yu, C., Yu, Y., Chen, J., Zhang, C., Gao, R., Mu, X., Geng, Y., He, J., 2020. Ultra-
sensitive detection of microcystin-LR with a new dual-mode aptasensor based on
MoS2-PtPd and ZIF-8-Thi-Au. Sens. Actuators B Chem. 305, 127280.
Li, X., Yang, D., Shen, L., Xu, F., Wang, P., 2020. Programmable assembly of DNA-protein
hybrid structures. Chem. Res. Chin. U 36 (2), 211–218.
Liu, X., Tang, Y., Liu, P., Yang, L., Li, L., Zhang, Q., Zhou, Y., Khan, M., 2019. A highly
sensitive electrochemical aptasensor for detection of microcystin-LR based on a dual
signal amplification strategy. Analyst 144 (5), 1671–1678.
Zhang, X., Ye, X., Chen, L., Zhao, H., Shi, Q., Xiao, Y., Ma, L., Hou, X., Chen, Y., Yang, F.,
2020. Functional role of bloom-forming cyanobacterium Planktothrix in ecologically
shaping aquatic environments. Sci. Total Environ. 710 (136314).
Xavier, P.L., Chandrasekaran, A.R., 2018. DNA-based construction at the nanoscale:
emerging trends and applications. Nanotechnology 29 (6), 62001.
Xiang, A., Lei, X., Ren, F., Zang, L., Wang, Q., Zhang, J., Lu, Z., Guo, Y., 2014. An ap-
tamer-based immunoassay in microchannels of a portable analyzer for detection of
microcystin-leucine-arginine. Talanta 130, 363–369.
Xiao, M., Lai, W., Man, T., Chang, B., Li, L., Chandrasekaran, A.R., Pei, H., 2019.
Rationally engineered nucleic acid architectures for biosensing applications. Chem.
Rev. 119 (22), 11631–11717.
Xing, C., Dai, J., Huang, Y., Lin, Y., Zhang, K.L., Lu, C., Yang, H., 2019. Active self-
assembly of train-shaped DNA nanostructures via catalytic hairpin assembly reac-
tions. Small 15 (27), 1901795.
Xiong, Q., Xie, C., Zhang, Z., Liu, L., Powell, J.T., Shen, Q., Lin, C., 2020. DNA origami
post-processing by CRISPR-Cas12a. Angew. Chemie Int. Ed. English 59 (10),
3956–3960.
13
Journal of Hazardous Materials 403 (2021) 123418
Yang, R., Song, D., Fang, S., Liu, Y., Zhou, X., Long, F., Zhu, A., 2018. Development of
novel portable and reusable fiber optical chemiluminescent biosensor and its appli-
cation for sensitive detection of microcystin-LR. Biosens. Bioelectron. 121, 27–33.
Yang, F., Huang, F., Feng, H., Wei, J., Massey, I.Y., Liang, G., Zhang, F., Yin, L., Kacew, S.,
Zhang, X., Pu, Y., 2020. A complete route for biodegradation of potentially carci-
nogenic cyanotoxin microcystin-LR in a novel indigenous bacterium. Water Res. 174
(115638).
Yao, J., Li, L., Li, P., Yang, M., 2017. Quantum dots: from fluorescence to chemilumi-
nescence, bioluminescence, electrochemiluminescence, and electrochemistry.
Nanoscale 9 (36), 13364–13383.
Ye, H., Yang, K., Tao, J., Liu, Y., Zhang, Q., Habibi, S., Nie, Z., Xia, X., 2017. An enzyme-
free signal amplification technique for ultrasensitive colorimetric assay of disease
biomarkers. ACS Nano 11 (2), 2052–2059.
Ye, D., Zuo, X., Fan, C., 2018. DNA nanotechnology-enabled interfacial engineering for
biosensor development. Annu. Rev. Anal. Chem. Palo Alto Calif (Palo Alto Calif) 11
(1), 171–195.
Yi, X., Xu, S., Huang, F., Wen, C., Zheng, S., Feng, H., Guo, J., Chen, J., Feng, X., Yang, F.,
2019. Effects of chronic exposure to Microcystin-LR on kidney in mice. Int. J. Env.
Res. Pub. HE 16 (24), 5030.
Yin, P., Choi, H.M.T., Calvert, C.R., Pierce, N.A., 2008. Programming biomolecular self-
assembly pathways. Nature 451 (7176), 318–322.
Yuan, L., He, Y., Zhao, H., Zhou, Y., Gu, P., 2014. Colorimetric detection of D-amino acids
based on anti-aggregation of gold nanoparticles. Chin. Chem. Lett. 25 (7), 995–1000.
He, Z., Cai, Y., Yang, Z., Li, P., Lei, H., Liu, W., Liu, Y., 2019. A dual-signal readout
enzyme-free immunosensor based on hybridization chain reaction-assisted formation
of copper nanoparticles for the detection of microcystin-LR. Biosens. Bioelectron.
126, 151–159.
Zhang, G., Li, C., Wu, S., Zhang, Q., 2018. Label-free aptamer-based detection of micro-
cystin-LR using a microcantilever array biosensor. Sens. Actuators B Chem. 260,
42–47.
Zhang, Y., Zhu, Z., Teng, X., Lai, Y., Pu, S., Pang, P., Wang, H., Yang, C., Barrow, C.J.,
Yang, W., 2019. Enzyme-free fluorescent detection of microcystin-LR using hairpin
DNA-templated copper nanoclusters as signal indicator. TALANTA 202, 279–284.
Zhao, Y., Zheng, F., Ke, W., Zhang, W., Shi, L., Liu, H., 2019. Gap-tethered Au@AgAu
raman tags for the ratiometric detection of MC-LR. Anal. Chem. 91 (11), 7162–7172.
Zhao, D., Kong, Y., Zhao, S., Xing, H., 2020. Engineering functional DNA-Protein con-
jugates for biosensing, biomedical, and nanoassembly applications. Top. Curr. Chem.
J. (J) 378 (413).
Zhong, Y., Shen, L., Ye, X., Zhou, D., He, Y., Li, Y., Ding, Y., Zhu, W., Ding, J., Zhang, H.,
2020a. Neurotoxic Anatoxin-a can also exert immunotoxicity by the induction of
apoptosis on Carassius auratus lymphocytes in vitro when exposed to en-
vironmentally relevant concentrations. Front. Physiol. 11 (316).
Zhong, Y., Zhao, J., Li, J., Liao, X., Chen, F., 2020b. Advances of aptamers screened by
Cell-SELEX in selection procedure, cancer diagnostics and therapeutics. Anal.
Biochem. 598 UNSP 113620.
Zhou, L., Ren, J., Qu, X., 2017. Nucleic acid-templated functional nanocomposites for
biomedical applications. Mater. Today 20 (4), 179–190.
Zhou, L., Jiao, X., Liu, S., Hao, M., Cheng, S., Zhang, P., Wen, Y., 2020. Functional DNA-
based hydrogel intelligent materials for biomedical applications. J. Mater. Chem. B
Mater. Biol. Med. 8 (10), 1991–2009.