Plant Health Progress ¿ 2020 ¿ 21:166–172
1094/PHP-12-19-0095-DG
Diagnostic Guide
Diagnostic Guide for Cucurbit Downy Mildew
Andres Salcedo,1 Mary Hausbeck,2 Stacey Pigg,3 and Lina M. Quesada-Ocampo1,†
1
Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695-7613
2
Department of Plant, Soil and Microbial Sciences, Michigan State University, East Lansing, MI 48824
3
Department of English, North Carolina State University, Raleigh, NC 27695-8105
Accepted for publication 18 April 2020.
Hosts: Under natural conditions cucurbit downy mildew affects most
of the economically important species of the Cucurbitaceae family
including cucumber (Cucumis sativus L.), cantaloupe (Cucumis melo L.),
squashes and pumpkins (Cucurbita spp.), watermelon (Citrullus
lanatus [Thunberg] Matsumura and Nakai), sponge gourd (Luffa
aegyptiaca Mill.) (syn. Luffa cylindrica [L.] M.J. Roem), bottle
gourd (Lagenaria siceraria [Molina] Stand.), and wax gourd
(Benincasa hispida [Thunb.] Cogn.) (Savory et al. 2011). Cucurbit
downy mildew also affects several semicultivated and wild
Cucurbitaceae species such as buffalo gourd, balsam apple, and
balsam pear (Wallace et al. 2014, 2016).
Disease: Cucurbit downy mildew.
Pathogen: Pseudoperonospora cubensis (Berk. and M.A. Curtis)
Rostovzev, 1903.
Taxonomy
P. cubensis belongs to a distinct phylogenetic lineage of mi-
croscopic, filamentous, fungal-like organisms known as oomycetes
or water molds (Thines 2014). Oomycetes include ecologically
significant pathogens in marine, freshwater, and terrestrial envi-
ronments (McCarthy and Fitzpatrick 2017). P. cubensis is a
member of the highly diverse Peronosporaceae family, which in-
cludes more than 600 species (Thines and Choi 2016). The genus
Pseudoperonospora comprises six plant-pathogenic species, of
which P. humuli, the causal agent of hop downy mildew (Rahman
et al. 2019), and P. cubensis are economically the most important
(Cohen et al. 2015; Holmes et al. 2015; Ojiambo et al. 2015;
Rahman et al. 2017). The current taxonomic classification of
P. cubensis is shown in Table 1.
Symptoms and Signs
P. cubensis infects the leaves of cucurbitaceous hosts and can
occur at all developmental stages, causing significant reduction of
both yield and fruit quality (Lebeda and Cohen 2011). Defoliation
results in fruits that are misshapen, undersized, and/or sun-scalded
(Savory et al. 2011) (Fig. 1).
†
Corresponding author: L. M. Quesada-Ocampo; lmquesad@ncsu.edu
Funding: This work was supported by the United States Department of Agriculture
(USDA) Awards National Institute of Food and Agriculture Award 2016-68004-
024931 and NC State Hatch project number NC02628.
The author(s) declare no conflict of interest.
© 2020 The American Phytopathological Society
PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 166
https://doi.org/10.
The pathogen is favored by cool and moist conditions and
progresses during the growing season as inoculum increases
(Granke and Hausbeck 2011; Granke et al. 2014). The latent period
from penetration to first symptoms ranges from 4 to 12 days, and its
severity depends on environmental conditions, inoculum load, and
host susceptibility (Cohen 1977; Cohen and Eyal 1977; Rotem et al.
1978). P. cubensis does not overwinter in geographic areas that
experience a hard frost (Holmes et al. 2015). During the growing
season in the United States (U.S.), pathogen spores may be dis-
persed across long distances and transported North via air currents
from warmer areas (Ojiambo et al. 2015). Year-round greenhouse
production of susceptible hosts can also provide a green bridge for
P. cubensis for overwintering (Savory et al. 2011).
Cucumbers are especially susceptible to P. cubensis (Call et al.
2012). Initial symptoms include small (3 to 10 mm), water-soaked
lesions on the upper (adaxial) leaf surface that become chlorotic and
are frequently restricted by leaf veins (Savory et al. 2011). A
diseased leaf may appear to have a mosaic-like pattern of angular
lesions (Fig. 2A to C) (Hausbeck 2017). Signs of the pathogen
include a distinctive dark brown, gray, or violet-black “down” on
the underside (abaxial) leaf surface (Fig. 2E to G) resulting from the
pathogen’s sporangia (Hausbeck 2017). Symptoms and signs may
be readily observed during extended dew periods or following a rain
event (Granke et al. 2014). The sporangia of P. cubensis may be
dispersed via air currents or water splashing (Ojiambo et al. 2015).
The chlorotic lesions become necrotic and coalesce, forming
blighted areas that may cover the entire leaf, resulting in defoliation
in a short period of time (Lebeda and Cohen 2011). As the disease
progresses, the infected leaves turn dry and curl upward (Holmes
et al. 2015) (Fig. 2C).
Although cucumber displays distinctive downy mildew symptoms,
other cucurbit crops usually display variable symptoms, making
accurate pathogen identification somewhat difficult (Crandall et al.
2018; Withers et al. 2016). At intermediate stages of disease de-
velopment, squash leaves may display pale-green to yellow, round or
irregular lesions sharply defined by veins on the upper surface that
become necrotic (Cespedes-Sanchez et al. 2015). In cantaloupe,
pumpkin, and watermelon, lesions frequently do not have the angular
shape that is characteristic of the disease on cucumber (Holmes et al.
2015). Instead, the lesions are irregular in shape, unrestricted by leaf
veins, and appear yellow to brown in color (Fig. 3). Pathogen
sporulation on cantaloupe and watermelon tissue may be scarce
(Crandall et al. 2018) but sufficient for diagnosis.
Host Range
P. cubensis infects members of the Cucurbitaceae family, in-
cluding over 50 species in 20 genera (Lebeda 1992; Lebeda and
Widrlechner 2003; Palti and Cohen 1980; Wallace et al. 2014, hubbard), gourds, and pumpkin; and Citrullus including wa-
2016). However, P. cubensis isolates exhibit host adaptation, termelon (Citrullus lanatus [Thunberg] Matsumura and Nakai)
preferentially infecting some cucurbits but not others (Quesada- (Holmes et al. 2015). Limited capacity to infect hosts other than
Ocampo et al. 2012; Summers et al. 2015b). Historically, isolates cucurbits has been observed in P. cubensis, particularly on sus-
displaying differences in their ability to infect a panel of cucurbit ceptible hop (Humulus lupus) (Cannabaceae) under laboratory
hosts have been designated as pathotypes. To date, at least six conditions (Mitchell et al. 2011), and Impatiens irvingii (Balsa-
pathotypes of P. cubensis have been described in the U.S., Israel, minaceae) (Voglmayr et al. 2009).
and Japan (Cohen et al. 2003; Sarris et al. 2009), and roughly 67
pathotypes have been described in Europe (Lebeda et al. 2013). Geographic Distribution
Nine of the 12 cultivated cucurbit species may be infected by P. P. cubensis occurs throughout the world wherever cucurbits are
cubensis along with semicultivated and wild species (Lebeda and cultivated (Quesada-Ocampo et al. 2012). The pathogen can be
Cohen 2011; Mitchell et al. 2011; Palti and Cohen 1980; Wallace found in temperate (Cappelli et al. 2003; Pavelková et al. 2011),
et al. 2014, 2016) (Table 2). Several economically important cu- subtropical, and tropical areas (Salati et al. 2010), as well as in
curbit species including five major food crops are hosts to P. greenhouses (Naegele et al. 2016). However, crop damage is
cubensis. The following cucurbit genera are affected: Cucumis variable among geographic areas (Lebeda 1992; Lebeda and Cohen
including cucumber (C. sativus L.) and cantaloupe (C. melo L.); 2011; Lebeda and Widrlechner 2003; Savory et al. 2011; Spring
Cucurbita including summer squashes (zucchini, marrow, crook- et al. 2018). Because Cucumis is the most susceptible genus to
neck squash), winter squashes (delicata, acorn, spaghetti, butternut, P. cubensis, a majority of global downy mildew reports have in-
volved cucumber and cantaloupe (Palti and Cohen 1980). In
Europe, the pathogen was originally restricted to the Mediterranean
region, but it then spread to most European countries (Lebeda and
TABLE 1 Schwinn 1994). The disease occurs in Cucumis spp. in East Africa,
Pseudoperonospora cubensis taxonomic statusa western equatorial Africa, and South Africa. In Asia, downy mildew
Rank Name occurs in the major cucurbit producing countries of China, India,
Domain Eukaryota Japan, Indonesia, the Philippines, and the Middle East (Israel and
Superkingdom Chromalveolata Lebanon). The pathogen also affects production in Canada, the
Kingdom Chromista U.S., Central America, the Caribbean, Brazil, and Argentina (Palti
Infrakingdom Heterokonta or Stramenopiles
and Cohen 1980).
The geographical distribution of P. cubensis among members of
Phylum Pseudofungi (Oomycota)
the Cucurbita genus has included approximately 40 countries.
Class Peronosporea
There are reports of P. cubensis on members of the Citrullus genus
Order Peronosporales
from approximately 25 countries, primarily on watermelon (C.
Family Peronosporaceae
lanatus) (Cohen et al. 2003; Palti and Cohen 1980).
Genus Pseudoperonospora After years of managing P. cubensis in cucumber using resistant
Scientific name Pseudoperonospora cubensis cultivars, the pathogen re-emerged in 2004 in the eastern U.S.
(Berk. and M.A. Curtis) Rostovzev 1903 (Holmes et al. 2015). A shift in P. cubensis populations in the U.S.
a
Based on Beakes et al. (2012), Lebeda and Cohen (2011), Thines (2014), resulted in failure of the resistance provided by the dm-1 gene
and Global Biodiversity Information Facility (2020). (Barnes and Epps 1954; Pierce and Wehner 1990; Quesada-Ocampo

FIGURE 1
Cucurbit downy mildew caused by Pseudoperonospora cubensis on cucumbers results in defoliation and plant death (A) and in sun-scalded and misshapen fruit
of nonmarketable size (B).

PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 167

et al. 2012; Runge et al. 2011; Summers et al. 2015a). Since 2004, relied upon fungicides throughout the eastern U.S. (Blum et al.
frequent and intensive fungicide applications have been required, 2011; Goldenhar and Hausbeck 2019; Keinath et al. 2019). Similar
resulting in the development of pathogen resistance to commonly population shifts in P. cubensis resulting in disease outbreaks and

FIGURE 2
Symptoms and signs of cucurbit downy mildew caused by Pseudoperonospora cubensis on cucumber. Symptoms on the upper (adaxial) side of the leaf include
chlorotic (A) or necrotic (B), angular lesions that can coalesce (C), resulting in defoliation. Symptoms on the underside (abaxial) of the leaf include water-soaked
(D) and necrotic lesions (E) that may become covered in sporangia. The characteristic sign of P. cubensis is dark sporulation with downy appearance in the
underside of the leaf (D to F).

FIGURE 3
Symptoms and signs of cucumber downy mildew caused by Pseudoperonospora cubensis at early and intermediate stages of infection on cultivated cucurbits
including squash (Cucurbita pepo), pumpkin (Cucurbita maxima), cantaloupe (Cucumis melo), and watermelon (Citrullus lanatus). Lesions in noncucumber hosts
can be more variable in shape and not restricted by leaf veins. Signs of P. cubensis are also variable because the pathogen does not sporulate profusely in hosts
such as watermelon.

PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 168

failure of fungicides have been observed in Europe (Kitner et al.
2015; Urban and Lebeda 2007).
Pathogen Isolation
P. cubensis is an obligate biotrophic parasite, requiring a living
host to survive and reproduce (Savory et al. 2011). Field isolates can
be collected by placing an entire infected leaf in a plastic bag
containing a moist paper towel and then storing the sample in a
cooler for transport to the laboratory. To obtain P. cubensis isolates,
single lesions are identified using a dissecting microscope and
excised from infected leaves using a sterile scalpel (Wallace and
Quesada-Ocampo 2017). Sporulation before lesion excision can be
induced by placing infected leaves in a plastic bag or humid
chamber over the upper side and incubating them at 18°C under
dark conditions for 24 h (Cohen and Eyal 1977). A humid chamber
may consist of sterile paper towel moistened with sterile distilled
water placed in a square bioassay dish (245 × 25 mm) (Fig. 4A).
Isolates are propagated by droplets or spray inoculation. Inoc-
ulum is prepared by excision of a discrete lesion from a leaf and
agitation in distilled sterile water to release the sporangia. A small
droplet (10 to 20 µl) of sporangia suspension is used for direct
inoculation on the underside of the detached leaf. Inoculum sus-
pension can be sprayed as microdroplets using a Preval Complete
Spray Unit (Precision Valve Corporation, Yonkers, NY) over the
underside leaf surface of a susceptible host inside a biosafety
cabinet (Fig. 4B). Inoculated leaves are incubated under 21/18°C
day/night temperatures
_
with a 12/12-h light/day photoperiod
(100 µE m2 s 1); the paper towel in the humid chamber is moistened
every other day with sterile distilled water under sterile conditions.
Sporangia generally develop 7 to 8 days after inoculation (Withers
et al. 2016). This propagation procedure can be performed with
sporangial serial dilutions to eventually obtain a single sporangium
for pure culture; however, this strategy may be difficult because not
all isolates infect all hosts equally and may not survive the serial
dilution and reinfection process. Alternatively, single-sporangium
infection can be performed placing ;100 µl of sporangium sus-
pension in a Petri dish and with the help of a dissecting microscope
and a micropipette to aspire a single sporangium in minimum
volume (5 µl) to inoculate a host underside leaf surface (Gent et al.
2008). Inoculated leaves are incubated as described above.

Pathogen Identification
Cucurbit downy mildew is usually diagnosed by visual inspection
TABLE 2 of symptoms on the upper side of the leaf and sporulation on the
Some semicultivated cucurbit species infected by underside of the leaf (Savory et al. 2011). The pathogen is confirmed
Pseudoperonospora cubensisa as P. cubensis by examination of sporangiophores and sporangia
Genus Scientific name Common name presence, morphology, and pigmentation using a low-magnification
lens (10× lens) or a dissecting microscope (Crandall et al. 2018;
Cucurbita C. argyrosperma Huber Cushaw pumpkin
C. ficifolia Bouche Fig-leaf gourd
Rahman et al. 2017) (Fig. 5A to C). For compound microscope
observations, sporangiophore and sporangia may be removed from
Citrullus C. colocynthis (L.) Schrad Bitter apple
the leaf epidermis with precision tweezers, transferred to a drop of
Lagenaria L. sphaerica (Sond.) Naud. Wild bottle gourd
water on a microscope slide, and covered with a coverslip.
Luffa L. acutangula (L.) Roxb. Sponge gourd
The sporangia of P. cubensis are produced on a hyaline tree-like
Momordica M. charantia L. Bitter melon
structure called a sporangiophore (Fig. 5D). The sporangiophore
Trichosanthes Trichosanthes spp. Snake gourd is straight, nonseptate, and slightly swollen at its base. Sporan-
a giophore branching is monopodial, occasionally dichotomous or
Based on Lebeda and Widrlechner (2003), Palti and Cohen (1980), and
Wallace et al. 2014, 2016). pseudo-dichotomous, displaying a branching architecture from

FIGURE 4
Propagation of Pseudoperonospora cubensis: P. cubensis is propagated on detached leaves of a susceptible host (cucumber leaves in the photo) using a humid
chamber (A); a sporangia suspension is used to spray-inoculate the underside of leaves as microdroplets in a biosafety cabinet (B); and sporangia are harvested
in a 1.5-ml microcentrifuge tube (C). Microbial contamination is accumulated on the top white layer.

PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 169

three to five orders at acute angles. The ultimate branchlets are
straight to substraight with a subtruncate apex. The sporangium is
lemon-shaped ovoid to ellipsoidal, olivaceous-brown, thin-walled,
with a short protruding pedicel (Runge and Thines 2011). The
appearance and size of sporangia and the morphological characters
of sporangiophores are influenced by environmental conditions
such as temperature, light intensity (Cohen and Eyal 1977), and the
cucurbit host (Runge and Thines 2011). Among morphological
characters, the length of sporangiophores is the most variable
(Runge et al. 2012).
Diagnostics of P. cubensis may be difficult in some cucurbit hosts
due to similarity of leaf lesions to other diseases and low sporulation
(Crandall et al. 2018). Microscopy techniques have been used to
visualize P. cubensis infection before noticeable symptoms de-
velop. Early pathogen identification may be achieved via obser-
vation using a compound microscope with iodine staining (Koroch
et al. 2013) and epifluorescence microscopy with aniline blue and
calcofluor staining (Cohen and Rubin 2012) (Table 3).
FIGURE 5
Pseudoperonospora cubensis sporangiophores and sporangia on cucumber
leaves. Sporulation observed under a dissecting microscope at 20× (A and B)
and 160× (C) magnification. Characteristic branching pattern of the hyaline
sporangiophore bearing brown, oval or lemon-shaped sporangia (D) ob-
served under a compound microscope (400× magnification). Bar: 20 µm.
TABLE 3
Microscopy procedures for identification of Pseudoperonospora cubensis
Method
Leaf clarification
Method 1: Iodine solution and compound microscopy
(Koroch et al. 2013)
Method 2: Basic aniline blue-calcofluor and
epifluorescence microscopy (Cohen and Rubin 2012)
PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 170
Alternatively, molecular diagnostic assays based on sensitive
nucleic acid methods have been developed to identify P. cubensis
when traditional diagnostics are not sufficient for prompt pathogen
identification (Withers et al. 2016). Because P. cubensis is host-
specific, cucurbit downy mildew is assumed to be caused by this
pathogen (Savory et al. 2011). However, other downy mildew
pathogens have been reported infecting cucurbits (Wallace et al.
2016), and other Pseudoperonospora species may coexist in the
same region as P. cubensis due to host availability (Ojiambo et al.
2015). Thus, when spore traps are used for sporangial sampling and
identification of the pathogen, microscopy may be insufficient to
differentiate between P. cubensis and P. humuli sporangia (Rahman
et al. 2017). To overcome this limitation, P. cubensis can be dif-
ferentiated by molecular diagnostics using a specific DNA poly-
morphism on the cytochrome oxidase subunit II (cox2) gene
(Summers et al. 2015b) or a species-specific marker (Withers et al.
2016). In addition, species-specific molecular diagnostic assays
have also been developed for P. humuli, a sister species of P.
cubensis (Summers et al. 2015a) (Table 4).
Pathogen Storage
P. cubensis isolates can be maintained long term (4 to 7 years) by
vacuum-drying the sporangia on an infected leaf, placing the leaf
with sporangia in a polypropylene screw-cap tube, and immediately
placing the tube in a liquid nitrogen storage tank (Gulya et al. 1993).
Isolates of P. cubensis may be maintained for a short period of time
via subculturing on infected detached cucurbit leaves, or by storing
infected leaves at –80°C. For propagation, sporangia suspended in
sterile water are adjusted to approximately 5 × 104 sporangia/ml using
a hemocytometer, sprayed onto cucumber leaves, and incubated in a
humid chamber. Sporangia develop within 7 to 8 days of incubation;
noncollapsed infected leaves with sporulating P. cubensis are rolled
and stored in 50-ml polystyrene tubes at –80°C (Withers et al. 2016).
Sporangia remain viable for approximately 6 months.
Sporangia for DNA isolation can be harvested by washing and
filtering as follows. After inspecting under the dissecting micro-
scope for sporangia, a P. cubensis-infected leaf is placed into a
funnel with the underside side facing up. A stream of sterile distilled
water is directed to the leaf surface to dislodge the sporangia using a
Preval Complete Spray Unit (Precision Valve Corporation). The
sporangia are then passed through a 40-µm pore size “cell strainer”
placed on top of a 50-ml tube to remove leaf trichomes and plant
debris. Sporangia are harvested by spinning down the 50-ml tube at
Procedure
Clarify a leaf section in boiling ethanol for 10 min, or 2 days with ethanol or
Visikol.
1. Place specimen on a cover slip and apply two drops of Lugol’s iodine
solution for 1 min.
2. Add one drop of 70% sulfuric acid.
3. Cover with a coverslip and observe under a microscope. Cell walls of the
pathogen will have a brown-red coloration, contrasting with the plant tissue.
1. Place specimen in 0.05 M basic aniline blue solution (pH 8.9) for 20 h at
4°C.
2. Treat the sample with 0.01% Tris HCl pH 7.5 calcofluor or Uvitex 2B
solution for 15 min.
3. Examine with epifluorescence microscopy under UV light. Mycelium
strands inside the leaf will fluoresce green-yellow.
 TABLE 4
Available nucleic acid assays for Pseudoperonospora cubensis-specific diagnostics
Reference Target Primer/probe pair name Method Size (bp)
Summers et al. (2015a) cox2 RT33F: AACTCCCGTTATGGAAGGTATT High resolution melt curve 149
RT182R: CCATGTACAACAGTAGCTGGA and locked nucleic acid
CUBprobe: HEXACAAACGAATACT-BHQ1a
Withers et al. (2016) Crinkler CRN Forward: ATTTCACCTTAGAGTCACGGC 486
Reverse: CGGCCATCAACTCGTATCTC
Forward: GGAGACACGACAACAAATGCAG 854
Reverse: TGCGCGGCAAGAATTTAGG
Unknown Forward: ATGCAGCGGGTATCCTTCC 448
Reverse: CACGAAGAAGCAGGAAATGC
Unknown Forward: CGCGCAACCTTGAATACCTAC PCR 831
Reverse: CACCCGCTCGCAGTAATGAC
Unknown Forward: GACGCAACCCAGCATAACAAG 787
Reverse: TGCGCTCGAGTATCTTCTACC
Unknown Forward: TCATCACCATATCCGCTTCCTG 595
Reverse: TGCGTGAATGCTGTGCGAC
NPP1 Forward: CAGTTCTCGATTTCCCTCGTC 867
Reverse: CTCTACTCACAAGATCTGCCAC
a
Locked nucleotides on the probe are underlined. Conserved SNP at base 105 of the cox2 gene region is in bold.

10,000 × g for 5 min at 4°C. The supernatant is discarded, and the
pellet is resuspended with 1 ml of sterile distilled water. The
sporangial suspension is transferred to a 1.5-ml microcentrifuge
tube and spun down at 15,000 × g for 1 min in a benchtop
microcentrifuge. The supernatant is removed from the tube via a
pipette without disturbing the black sporangial pellet. While dis-
carding the supernatant, it is recommended to remove as much of
the white layer from the surface of the black spore pellet as possible
to decrease bacterial and fungal contaminants (Fig. 4C). The
sporangial pellet can be stored at –20°C to use for DNA isolation
but not for inoculum, because the sporangia will not remain viable.
Pathogenicity Tests
Pathogenicity and host specificity of a P. cubensis isolate is
frequently performed by quantifying the surface cover with spo-
rangia production on adult plants, detached leaves, cotyledons, or
leaf disks. For adult plants, P. cubensis sporangial suspension is
sprayed onto the underside of the first true leaves of the cucurbit
host and immediately placed into a moist chamber at 25°C under
light for 6 h. Plants are kept in the greenhouse under 25/20°C day/
night_ temperatures with a 16/8-h day/night photoperiod (300 µE
m2 s 1). Plants are assessed for the first downy mildew symptoms
every day and scored visually for pathogen presence, calculating the
percentage of leaf area covered with symptoms of downy mildew
(Oerke et al. 2006). Cotyledons and primary or secondary leaves (1-
to 2-month-old plants), depending on the host, can be used for the
pathogenicity test (Withers et al. 2016). Inoculum can be applied as
a spray or droplets to cotyledons, full leaves, or leaf disks (20-mm
diameter), and incubated in a humid chamber under 21/18°C day/
night_ temperatures with a 12/12-h day/night photoperiod (100 µE
m2 s 1). Disease severity, evaluated as a percentage of leaf area
infected, and sporulation can be assessed 5 to 8 days after inoc-
ulation. To assess sporulation, a leaf disk can be cut out of the
infected leaf, placed into a microcentrifuge tube with 50% ethanol,
and vortexed for 5 min to dislodge sporangia. Concentrations of
sporangia per leaf area unit can be determined by counting spo-
rangia in a hemocytometer under a microscope (Cohen et al. 2003;
Salati et al. 2010).
Pathogenicity tests using host differentials have been proposed
for P. cubensis to classify isolates into pathotypes (Thomas et al. 1987).
The initial set of hosts proposed included Cucumis sativus, C. melo var.
reticulatus, C. melo var. conomon, C. melo var. acidulus, Citrullus
lanatus, and Cucurbita pepo. Follow-up studies expanded the host
differentials to 15 cucurbits from eight genera and added Benincasa,
Luffa, Lagenaria, Momordica, and Trichosanthes to the initial set
(Cohen et al. 2015; Lebeda and Widrlechner 2003). Nonetheless,
classification of pathogens into pathotypes and races continues to be
problematic due to the risk of false negatives that are common in an
obligate pathogen and the lack of curation of host differentials to
ensure they are true to type in all studies (Crandall et al. 2018).
Acknowledgments
The authors thank all of the members of the Quesada lab for their
valuable help.
Literature Cited
Barnes, W. C., and Epps, W. M. 1954. An unreported type of resistance to
cucumber downy mildew. Plant Dis. Rep. 38:620.
Beakes, G. W., Glockling, S. L., and Sekimoto, S. 2012. The evolutionary
phylogeny of the oomycete “fungi”. Protoplasma 249:3-19.
Blum, M., Waldner, M., Olaya, G., Cohen, Y., Gisi, U., and Sierotzki, H. 2011.
Resistance mechanism to carboxylic acid amide fungicides in the cucurbit downy
mildew pathogen Pseudoperonospora cubensis. Pest Manag. Sci. 67:1211-1214.
Call, A. D., Criswell, A. D., Wehner, T. C., Klosinska, U., and Kozik, E. U.
2012. Screening cucumber for resistance to downy mildew caused by (Berk.
and Curt.) Rostov. Crop Sci. 52:577-592.
Cappelli, C., Buonaurio, R., and Stravato, V. M. 2003. Occurrence of Pseu-
doperonospora cubensis pathotype 5 on squash in Italy. Plant Dis. 87:449.
Cespedes-Sanchez, M. C., Naegele, R. P., Kousik, C. S., and Hausbeck, M. K.
2015. Field response of cucurbit hosts to Pseudoperonospora cubensis in
Michigan. Plant Dis. 99:676-682.
Cohen, Y. 1977. The combine effect of temperature, leaf wetness, and inoculum
concentration on infection of cucumbers with Pseudoperonospora cubensis.
Can. J. Bot. 55:1478-1487.
Cohen, Y., and Eyal, H. 1977. Growth and differentiation of sporangia and
sporangiophores of Pseudoperonospora cubensis on cucumber cotyledons
under various combinations of light and temperature. Physiol. Plant Pathol.
10:93-103.

PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 171

Cohen, Y., Meron, I., Mor, N., and Zuriel, S. 2003. A new pathotype of
Pseudoperonospora cubensis causing downy mildew in cucurbits in Israel.
Phytoparasitica 31:458-466.
Cohen, Y., and Rubin, A. E. 2012. Mating type and sexual reproduction of
Pseudoperonospora cubensis, the downy mildew agent of cucurbits. Eur.
J. Plant Pathol. 132:577-592.
Cohen, Y., Van den Langenberg, K. M., Wehner, T. C., Ojiambo, P. S.,
Hausbeck, M., Quesada-Ocampo, L. M., Lebeda, A., Sierotzki, H., and Gisi,
U. 2015. Resurgence of Pseudoperonospora cubensis: The causal agent of
cucurbit downy mildew. Phytopathology 105:998-1012.
Crandall, S. G., Rahman, A., Quesada-Ocampo, L. M., Martin, F. N., Bilodeau,
G. J., and Miles, T. D. 2018. Advances in diagnostics of downy mildews: Lessons
learned from other oomycetes and future challenges. Plant Dis. 102:265-275.
Gent, D. H., Nelson, M. E., and Grove, G. G. 2008. Persistence of phenylamide
insensitivity in Pseudoperonospora humuli. Plant Dis. 92:463-468.
Global Biodiversity Information Facility. 2020. Pseudoperonospora cubensis.
https://www.gbif.org/occurrence/1099063210.
Goldenhar, K. E., and Hausbeck, M. K. 2019. Fungicides for control of downy
mildew on pickling cucumber in Michigan. Plant Health Prog. 20:165-169.
Granke, L. L., and Hausbeck, M. K. 2011. Dynamics of Pseudoperonospora
cubensis sporangia in commercial cucurbit fields in Michigan. Plant Dis. 95:
1392-1400.
Granke, L. L., Morrice, J. J., and Hausbeck, M. K. 2014. Relationships between
airborne Pseudoperonospora cubensis sporangia, environmental conditions,
and cucumber downy mildew severity. Plant Dis. 98:674-681.
Gulya, T. J., Masirevic, S., and Thomas, C. E. 1993. Preservation of air-dried
downy mildew sporangia in liquid nitrogen without cryoprotectants or
controlled freezing. Mycol. Res. 97:240-244.
Hausbeck, M. K. 2017. Downy mildew. Pages 56-58 in: Compendium of
Cucurbit Diseases and Pests. A. P. Keinath, W. M. Wintermantel, and T. A.
Zitter, eds. APS Press, St. Paul, MN.
Holmes, G. J., Ojiambo, P. S., Hausbeck, M. K., Quesada-Ocampo, L., and
Keinath, A. P. 2015. Resurgence of cucurbit downy mildew in the United
States: A watershed event for research and extension. Plant Dis. 99:428-441.
Keinath, A. P., Miller, S. A., and Smart, C. D. 2019. Response of Pseudo-
peronospora cubensis to preventative fungicide applications varies by state
and year. Plant Health Prog. 20:142-146.
Kitner, M., Lebeda, A., Sharma, R., Runge, F., Dvořák, P., Tahir, A., Choi, Y.-J.,
Sedláková, B., and Thines, M. 2015. Coincidence of virulence shifts and
population genetic changes of Pseudoperonospora cubensis in the Czech
Republic. Plant Pathol. 64:1461-1470.
Koroch, A. R., Villani, T. S., Pyne, R. M., and Simon, J. E. 2013. Rapid staining
method to detect and identify downy mildew (Peronospora belbahrii) in
basil. Appl. Plant Sci. 1:1300032.
Lebeda, A. 1992. Screening of wild Cucumis species against downy mildew
(Pseudoperonospora cubensis) isolates from cucumbers. Phytoparasitica 20:
203-210.
Lebeda, A., and Cohen, Y. 2011. Cucurbit downy mildew (Pseudoperonospora
cubensis)—Biology, ecology, epidemiology, host-pathogen interaction and
control. Eur. J. Plant Pathol. 129:157-192.
Lebeda, A., Pavelková, J., Sedláková, B., and Urban, J. 2013. Structure and
temporal shifts in virulence of Pseudoperonospora cubensis populations in
the Czech Republic. Plant Pathol. 62:336-345.
Lebeda, A., and Schwinn, F. J. 1994. The downy mildews—An overview of
recent research progress. J. Plant Dis. Prot. 101:225-254.
Lebeda, A., and Widrlechner, M. 2003. A set of Cucurbitaceae taxa for dif-
ferentiation of Pseudoperonospora cubensis pathotypes. J. Plant Dis. Prot.
110:337-349.
McCarthy, C. G. P., and Fitzpatrick, D. A. 2017. Phylogenomic reconstruction
of the oomycete phylogeny derived from 37 genomes. mSphere 2:e00095-17.
Mitchell, M. N., Ocamb, C. M., Grünwald, N. J., Mancino, L. E., and Gent, D. H.
2011. Genetic and pathogenic relatedness of Pseudoperonospora cubensis
and P. humuli. Phytopathology 101:805-818.
Naegele, R. P., Quesada-Ocampo, L. M., Kurjan, J. D., Saude, C., and Hausbeck,
M. K. 2016. Regional and temporal population structure of Pseudoper-
onospora cubensis in Michigan and Ontario. Phytopathology 106:372-379.
Oerke, E. C., Steiner, U., Dehne, H. W., and Lindenthal, M. 2006. Thermal
imaging of cucumber leaves affected by downy mildew and environmental
conditions. J. Exp. Bot. 57:2121-2132.
Ojiambo, P. S., Gent, D. H., Quesada-Ocampo, L. M., Hausbeck, M. K., and
Holmes, G. J. 2015. Epidemiology and population biology of Pseudoper-
onospora cubensis: A model system for management of downy mildews.
Annu. Rev. Phytopathol. 53:223-246.
Palti, J., and Cohen, Y. 1980. Downy mildew of cucurbits (Pseudoperonospora
cubensis): The fungus and its hosts, distribution, epidemiology and control.
Phytoparasitica 8:109-147.
PLANT HEALTH PROGRESS ¿ 2020, Vol. 21, No. 3 ¿ Page 172
Pavelková, J., Lebeda, A., and Sedláková, B. 2011. First report of Pseudo-
peronospora cubensis on Cucurbita moschata in the Czech Republic. Plant
Dis. 95:878.
Pierce, L. K., and Wehner, T. C. 1990. Review of genes and linkage groups in
cucumber. HortScience 25:605-615.
Quesada-Ocampo, L. M., Granke, L. L., Olsen, J., Gutting, H. C., Runge, F.,
Thines, M., Lebeda, A., and Hausbeck, M. K. 2012. The genetic structure of
Pseudoperonospora cubensis populations. Plant Dis. 96:1459-1470.
Rahman, A., Góngora-Castillo, E., Bowman, M. J., Childs, K. L., Gent, D. H.,
Martin, F. N., and Quesada-Ocampo, L. M. 2019. Genome sequencing and
transcriptome analysis of the hop downy mildew pathogen Pseudoper-
onospora humuli reveal species-specific genes for molecular detection.
Phytopathology 109:1354-1366.
Rahman, A., Miles, T. D., Martin, F. N., and Quesada-Ocampo, L. M. 2017.
Molecular approaches for biosurveillance of the cucurbit downy mildew
pathogen, Pseudoperonospora cubensis. Can. J. Plant Pathol. 39:282-296.
Rotem, J., Cohen, Y., and Bashi, E. 1978. Host and environmental influences on
sporulation in vivo. Annu. Rev. Phytopathol. 16:83-101.
Runge, F., Choi, Y.-J., and Thines, M. 2011. Phylogenetic investigations in the
genus Pseudoperonospora reveal overlooked species and cryptic diversity in
the P. cubensis species cluster. Eur. J. Plant Pathol. 129:135-146.
Runge, F., Ndambi, B., and Thines, M. 2012. Which morphological charac-
teristics are most influenced by the host matrix in downy mildews? A case
study in Pseudoperonospora cubensis. PLoS One 7:e44863.
Runge, F., and Thines, M. 2011. Host matrix has major impact on the mor-
phology of Pseudoperonospora cubensis. Eur. J. Plant Pathol. 129:147-156.
Salati, M., Wong, M. Y., Sariah, M., and Nik Masdek, H. 2010. First report of
Pseudoperonospora cubensis causing downy mildew of Trichosanthes
cucumerina in Malaysia. Plant Dis. 94:642.
Sarris, P., Abdelhalim, M., Kitner, M., Skandalis, N., Panopoulos, N., Doulis,
A., and Lebeda, A. 2009. Molecular polymorphisms between populations
of Pseudoperonospora cubensis from Greece and the Czech Republic and
the phytopathological and phylogenetic implications. Plant Pathol. 58:
933-943.
Savory, E. A., Granke, L. L., Quesada-Ocampo, L. M., Varbanova, M.,
Hausbeck, M. K., and Day, B. 2011. The cucurbit downy mildew pathogen
Pseudoperonospora cubensis. Mol. Plant Pathol. 12:217-226.
Spring, O., Gomez-Zeledon, J., Hadziabdic, D., Trigiano, R. N., Thines, M., and
Lebeda, A. 2018. Biological characteristics and assessment of virulence
diversity in pathosystems of economically important biotrophic oomycetes.
Crit. Rev. Plant Sci. 37:439-495.
Summers, C. F., Adair, N. L., Gent, D. H., McGrath, M. T., and Smart, C. D.
2015a. Pseudoperonospora cubensis and P. humuli detection using species-
specific probes and high definition melt curve analysis. Can. J. Plant Pathol.
37:315-330.
Summers, C. F., Gulliford, C. M., Carlson, C. H., Lillis, J. A., Carlson, M. O.,
Cadle-Davidson, L., Gent, D. H., and Smart, C. D. 2015b. Identification of
genetic variation between obligate plant pathogens Pseudoperonospora
cubensis and P. humuli using RNA sequencing and genotyping-by-se-
quencing. PLoS One 10:e0143665.
Thines, M. 2014. Phylogeny and evolution of plant pathogenic oomycetes—A
global overview. Eur. J. Plant Pathol. 138:431-447.
Thines, M., and Choi, Y.-J. 2016. Evolution, diversity, and taxonomy of the
Peronosporaceae, with focus on the genus Peronospora. Phytopathology 106:
6-18.
Thomas, C. E., Inaba, T., and Cohen, Y. 1987. Physiological specialization in
Pseudoperonospora cubensis. Phytopathology 77:1621-1624.
Urban, J., and Lebeda, A. 2007. Variation of fungicide resistance in Czech
populations of Pseudoperonospora cubensis. J. Phytopathol. 155:143-151.
Voglmayr, H., Pia˛ tek, M., and Mossebo, D. C. 2009. Pseudoperonospora
cubensis causing downy mildew disease on Impatiens irvingii in Cameroon:
A new host for the pathogen. Plant Pathol. 58:394.
Wallace, E., Adams, M., Ivors, K., Ojiambo, P. S., and Quesada-Ocampo, L. M.
2014. First report of Pseudoperonospora cubensis causing downy mildew on
Momordica balsamina and M. charantia in North Carolina. Plant Dis. 98:
1279.
Wallace, E., Choi, Y. J., Thines, M., and Quesada-Ocampo, L. M. 2016. First
report of Plasmopara aff. australis on Luffa cylindrica in the United States.
Plant Dis. 100:537.
Wallace, E. C., and Quesada-Ocampo, L. M. 2017. Analysis of microsatellites
from the transcriptome of downy mildew pathogens and their application for
characterization of Pseudoperonospora populations. PeerJ 5:e3266.
Withers, S., Gongora-Castillo, E., Gent, D., Thomas, A., Ojiambo, P. S., and
Quesada-Ocampo, L. M. 2016. Using next-generation sequencing to develop
molecular diagnostics for Pseudoperonospora cubensis, the cucurbit downy
mildew pathogen. Phytopathology 106:1105-1116.