Comparison

of

conventional

PCR and the

new

amplification

methods

such as

qPCR and
S4619481
RT-PCR
By
Mercy Otto from the

SNPs ACTN-

3 gene
1.Introduction
Amplification methods alike, such as conventional PCR and newer methods such as qPCR

and RT-PCR, are all dependant on the use of primers designs (Cheng-Hong Yang, Yu-Huei

Cheng, Cheng-Huei Yang & Li-Yeh Chuang, 2012). The use of primer designs is to create

primers that will identify the specific DNA sequence needed to be amplified. Without specific

primers, PCR synthesis cannot begin (Cheng-Hong Yang, Yu-Huei Cheng, Cheng-Huei

Yang & Li-Yeh Chuang, 2012). Although there are universal primers that can anneal to most

sequences, but in cases where the genetic sequence is already known, or a specific gene is

a target only specific primers can be used (Aleksic, 2016).

Similarly, to conduct qPCR and RT-PCR, the core technique of conventional PCR is very

evident. All methods are conducted under the three stages of Denaturation, Annealing, and

Elongation (Yamashita, Nakagawa, Sakaguchi, Arima & Kikoku, 2017). However, all

methods are different, respectively. qPCR or real-time compared to PCR uses assay such

as SYBR green and TaqMan probe mastermixes(Rejali, Zuiter, Quackenbush & Wittwer,

2020) to measure the accumulation of the amplified DNA throughout the whole process

(Mohsina, Kaur, Bowman, Powell & Tamplin, 2020). These assays respectively signal the

formation of a new amplicon during elongation (Mohsina, Kaur, Bowman, Powell & Tamplin,

2020).

Likewise, PCR products can only be seen at the endpoint after the product has been put

through Gel electrophoresis. On the other hand, reverse transcription or RT-PCR like PCR

follow similar steps; however, RT-PCR exclusively uses mRNA as the template and is

transcribed by a reverse transcription enzyme called MMLV to synthesis a complementary

DNA which then is later used to conduct PCR (Rejali, Zuiter, Quackenbush & Wittwer, 2020).

Once the process has been completed, the product can now be used in sequencing and

genotyping of specific genes, for example, ACTN-3. ACTN-3 is a gene usually found in

professional athletes (Orysiak et al., 2014). This gene is known as a Single-nucleotide

Polymorphism as the gene encodes a premature stop codon in a muscle protein called
alpha-actinin-3. The polymorphism alters position 577 of the alpha-actinin-3 protein (Orysiak

et al., 2014). If the gene is expressed, the allele is RR or RX, but if not expressed, the allele

is XX (Orysiak et al., 2014). Therefore, the aim of this study was to gain experience in

converting RNA to cDNA via reverse transcription and to conduct gene expression and

genotyping through qPCR to find the unknown allele from the gene ACTN-3.

2.Materials & Methods

2.1 Reverse transcription of RNA

According to the human genetic lab 3 manual, the reverse transcription was conducted; in a

0.2 ml tube, the 5 ul of the reverse transcription master mix was added. At the end of the

reaction, add 90 ul of nuclease-free water.

2.2 Quantitative real-time PCR

SYBR Green for RNA:

Real-time PCR was conducted according to the human genetic lab 3 manual; SsoAdvanced

universal SYBR Green supermix and other frozen reaction components were thawed at

room temperature and then centrifuged to collect the solution at the bottom of the tube to be

used in the experiment. PCR master mix was used with an added ‘2ul of the template ’ with a

total mixture volume of 1ml for 96 reactions.

TaqMan probe assay:

According to the human genetics' lab 4 manual, the TaqMan probe assay was conducted:

thaw genomic DNA sample from lab 1, TaqMan® assay, and centrifuge to collect the

solution to the bottom of the tube used. Thoroughly mix the TaqMan® Universal PCR Master

Mix.

Condition of master mixes: Both master mixes were conducted under 95C Denaturation for

10 min, followed by 40 cycles of 95C for 15 s and 60C for 60 s.

2.3 Primer design for PCR of DNA

Conducted according to the Human genetics’ lab 4 manual. Ncbis website was used to

create the primers.

3. Results

Target gene PGC1a Control Experiment

Repeat 1. 24.21127 24.31213

Repeat 2. 24.01193 24.31073

Housekeeping gene Repeat 1. 24.46271 24.39798

Repeat 2. 24.84344 24.66107

Double delta cal. ∆CtC= 0.54 ∆CtE=0.22

Table1. Ct values from qPCR

Figure1. From the data given from the qPCR, the housekeeping gene in green was the gene believed would not
change, and it was used as a comparison against the target gene, which is in red. Using the double delta Ct
calculation, it was clearly shown that both the control and the experimental groups differ in abundance within the
target gene. According to the results, it indicates that the gene was abundantly regulated in the control group
compared to the experimental group, indicating a downregulation of the experimental group.

Table2. Ct values for the ACTN-3 gene

Positive control Lane 2 FAM VIC

Allele RR Repeat 1 20.62 35.15
Repeat 2 20.62 35.15

Lane 4 Repeat1 20.58 22.05

Allele RX Repeat 2 20.49 22.17

Lane 6 Repeat 1 34.35 22.21

Allele XX Repeat 2 34.25 22.01

Lane 5 Repeat 1 20.52 22.11

Allele unknown Repeat 2 20.45 22.15
Figure 2. In all the known lanes, the ACTN-3 gene is being expressed. From the results in table 2 alone without
the double delta calculations, the unknown could have had the allele RX as both the FAM and the VIC figures
only have slight differences in figures. Hence, according to the double delta calculation, both lane 4 and the
unknown in lane 5 have the same abundance of the ACTN-3 gene with a Delta Delta Ct value of 0.16 for lane 4
and 0.17 for lane 5 indicating that the allele for the unknown in lane 5 is RX as the Ct values on a qPCR graph
the values will be exactly corresponding each other.

Table 3. primer design

Sequence
T. L. Start. Stop. Tm GC% S-C
(5'->3')
Forward 6655783 6655785
GTGCCAGCTGGAGATCAACT Plus 20 60.04 55.00 8.00 3.00
primer 6 5
Reverse 6655794 6655792
GTGTAGAGCTCACCGAGACC Minus 20 59.55 60.00 6.00 3.00
primer 2 3
Product
107
length
Figure 3. A designed primer for the ACTN-3 gene in Homo-sapiens, the primer has both forward and reverse and
a bp length of 20.

Image1. Agarose gel electrophoresis analysis of PCR-amplified ACTN3 gene fragments

4. Discussion

It can be agreed that the core technique of the new method qPCR is relative to the

conventional PCR, as both methods require Denaturation, annealing, and elongation

(Yamashita, Nakagawa, Sakaguchi, Arima & Kikoku, 2017). Also, All methods are equally

dependent on the use of “good primer designs," as primers are crucial for annealing and

elongation stages, and are essential for vital reactions (Cheng-Hong Yang, Yu-Huei Cheng,

Cheng-Huei Yang & Li-Yeh Chuang, 2012).

In figure 3, the designed primer for the gene ACTN-3 was created at an optimal length

between 18-22 bp, which is adequate enough for the primer to bind efficiently to the template

strand and had both forward and reverse primers with an optimal melting temperature

between 58-65oC. Hence, the primer created can be noted to be a good primer that can be

used in both PCR and qPCR conducted in the laboratory.

qPCR compared to PCR, allows for the accumulation and the amplification of the product to

be measured during the process after each cycle, unlike PCR, where the product can only

be measured at the endpoint (Rejali, Zuiter, Quackenbush & Wittwer, 2020). To amplify,

qPCR uses assays such as SYBR green or TaqMan probe. However, both assays have

disadvantages and advantages of their own, respectively.

For example, SYBR green assay is used primarily in gene expression; due to the DNA-dye

complex, it absorbs blue light and emits intense green light (Cruz-Flores, Mai & Dhar, 2019).

As the PCR generates more cDNA from the conducted RT-PCR, the more SYBR green dye
molecules bind and create a fluorescent light that is easily detectable, measurable, and the

process is inexpensive and easy to conduct. Nevertheless, due to the binding ability of the

SYBR green dye, it can easily bind to any double-stranded DNA and cause the over

quantification of the product, which makes the SYBR green lose its specificness and

becomes nonspecific(Cruz-Flores, Mai & Dhar, 2019).

TaqMan probe assays like SYBR green follow the same steps as PCR, but TaqMan

however, requires a third sequence-specific, which is a probe in genotyping (Xue et al.,

2020). The probe consists of a fluorescent reporter that is bound to the 5' end and a

quencher, which is at the 3' end (Xue et al., 2020). The probe relies on the 5’-3’ exonuclease

of the enzyme Taq polymerase to degrade the probes during extension(Xue et al., 2020).

When the enzyme reaches the probe, it cleaves it off as it goes to make a new amplicon,

and as the quencher and reporter are separated, the reporter signifies that a product has

been made (Xue et al., 2020). When the reporter and the quencher are within close range of

each other, there is no detection as the quencher is used to inactivate the reporter molecule

(Xue et al., 2020).

TaqMan probe assay, unlike SYBR green, is highly specific since the probe detects the

specific amplification products and can target multiple genes at once (Cruz-Flores, Mai &

Dhar, 2019) . Therefore, From table 2 the use of TaqMan and probe assay to genotype was

evident as it was used to detect and amplify the unknown allele in lane 5 that was found to

be RX from the SNP gene ACTN-3 which has three alleles RR, RX and XX as both lane 4

and five had similar double delta figures(Orysiak et al., 2014). Likewise, for table 1, SYBR

green was used to amplify the gene expressed in both the control and experimental groups.

The use of the TaqMan probe assay in genotyping is very significant as it figures out what

sort of alleles a particular gene has, which was evident in table 2, where the unknown allele

from the ACTN-3 gene was figured out. These results can later be used to group individual

athletes into respective groups to show if they are a sprinter, a long-distance runner, or do

not run at all depending on what specific allele is amplified (Orysiak et al., 2014).
Another amplification technique that can be used is reverse transcriptase. However, RT-

PCR method is not like qPCR or PCR. This method is solely used to amplify mRNA to

complementary DNA or cDNA because mRNA that was extracted in Lab 1 on its own can

disintegrate, but when it is in cDNA, the mRNA is more stable (Rejali, Zuiter, Quackenbush

& Wittwer, 2020).

RT-PCR, like both PCR and qPCR, follow the same three-step process of Denaturation,

annealing, and elongation, and requires specific primers. However, RT-PCR then differs as it

uses RNA as a template which can be an advantage because as mentioned before RNA as

a single stand is very unstable, which makes it very hard to work with so by converting the

RNA to a stable cDNA first it will be more comfortable to work with and to amplify via PCR.

Also, another difference is the use of MMLV or he Moloney Murine Leukemia Virus reverse

transcriptase (Rejali, Zuiter, Quackenbush & Wittwer, 2020).MMLV is the standard enzyme

that is used to transcribe the dNTps. However, this enzyme has limitations as the enzyme

only has an optimum use at 37oC, which can be an issue if the template has a lot of

secondary structures to deal with (Rejali, Zuiter, Quackenbush & Wittwer, 2020).

5. conclusion

The traditional PCR method, like the new qPCR method and Rt, can be both conducted

under the condition of suitable primers to amplify specific genes for gene expression and

genotyping. RT to PCR only differs in the fact that it uses RNA as a template before the RNA

can be amplified because mRNA by itself is too unstable, so it must be converted to stable

form before amplification. qPCR compared to PCR, in reality, would be more used due to the

duality of qPCR to be quantitative as the amplified sample can be measured during the

process by using SYBR green or TaqMan probe assay which is used further to detect and

amplify the unknown allele in the ACTN-3 gene that is usually noticed in athletes. By this, the

athletes can be sorted into groups that show the different alleles, so it can be understood

that this athlete is a sprinter if they show RR or a long-distance runner if they show RX and if

they do not express the ACTN-3 gene they show XX. Likewise, it can also group and identify
different nationalities as it is known higher frequencies of the gene are found to be of African

descent countries compared to Asian and European descent countries.

6.References

Cheng-Hong Yang, Yu-Huei Cheng, Cheng-Huei Yang, & Li-Yeh Chuang. (2012). Mutagenic
Primer Design for Mismatch PCR-RFLP SNP Genotyping Using a Genetic Algorithm.
IEEE/ACM Transactions on Computational Biology and Bioinformatics, Computational
Biology and Bioinformatics, IEEE/ACM Transactions on, IEEE/ACM Trans. Comput. Biol.
and Bioinf, 9(3), 837–845. https://doi.org/10.1109/TCBB.2012.25
Cheng-Hong Yang, Yu-Huei Cheng, & Li-Yeh Chuang. (2010). PCR-CTPP primer design
using chaotic inertia weight particle swarm optimization. 2010 International Computer
Symposium (ICS2010), Computer Symposium (ICS), 2010 International, 777–782.
https://doi.org/10.1109/COMPSYM.2010.
Aleksić Jelena M. (2016). Family-specific vs. universal PCR primers for the study of
mitochondrial DNA in plants. Genetika, 48(2), 777–798.
https://doi.org/10.2298/GENSR1602777A
Mohsina, K., Kaur, M., Bowman, J., Powell, S., & Tamplin, M. (2020). qPCR quantification of
Carnobacterium maltaromaticum, Brochothrix thermosphacta, and Serratia liquefaciens
growth kinetics in mixed culture. Journal Of Microbiological Methods, 175, 105961. doi:
10.1016/j.mimet.2020.105961
Rejali, N., Zuiter, A., Quackenbush, J., & Wittwer, C. (2020). Reverse transcriptase kinetics
for one-step RT-PCR. Analytical Biochemistry, 601, 113768. doi: 10.1016/j.ab.2020.113768
Orysiak, J., Busko, K., Michalski, R., Mazur-Różycka, J., Gajewski, J., & Malczewska-
Lenczowska, J. et al. (2014). Relationship between ACTN3 R577X polymorphism and
maximal power output in elite Polish athletes. Medicina, 50(5), 303-308. doi:
10.1016/j.medici.2014.10.002
Yamashita, S., Nakagawa, H., Sakaguchi, T., Arima, T., & Kikoku, Y. (2018). Design of a
species-specific PCR method for the detection of the heat-resistant fungi Talaromyces
macrosporus and Talaromyces trachyspermus. Letters in Applied Microbiology, 66(1), 86–
92. https://doi.org/10.1111/lam.12818
Cruz-Flores, R., Mai, H. N., & Dhar, A. K. (2018). Multiplex SYBR Green and duplex TaqMan
real-time PCR assays for the detection of Photorhabdus Insect-Related (Pir) toxin genes
pirA and pirB. Molecular and Cellular Probes. https://doi.org/10.1016/j.mcp.2018.12.004
Xue, B., Li, Y., Wang, X., Li, R., Zeng, X., Yang, M., Xu, X., Ye, T., Bao, L., & Huang, Y.
(2020). TaqMan-MGB probe quantitative PCR assays to genotype and quantify three mtDNA
mutations of Leber hereditary optic neuropathy. Scientific Reports, 10(1).
https://doi.org/10.1038/s41598-020-69220-7