Akash Mehta

Jimmy Butler
GROUP FOUR

RIFAMPICIN RESISTANCE. PCR amplification of the RNA polymerase beta subunit

fragment (rpoB)

Bacterial lysis and DNA preparation

1. Today you will extract DNA from your resistant mutant and then use the Polymerase
Chain Reaction (PCR) to amplify a fragment of the bacterial the rpoB gene. In order
to keep track of your sample you will be assigned a number by your TA. Write it
down and make sure you will remember for next week’s lab.
2. To extract DNA from your resistant mutant obtain lysis buffer. The DNA extraction
solution used to lyse open the bacterial cells is located in the ice bucket at your bench.
3. Using a sterile “Dispo” needle, touch one colony that grew on the “rif” plate. The
bacteria should be visible on the needle, but you need very little. Suspend the
bacteria in the extraction solution; try rotating the needle rapidly between your fingers
to dislodge the bacteria.
4. Cap the tube, being careful when closing the cap. Vortex for 15 seconds.
5. Transfer the tube to 65C; incubate for 6 minutes.
6. Vortex for 15 seconds.
7. Transfer the tube to 98C; incubate for 2 minutes.
8. Vortex lightly to mix, then set tube on ice.

PCR amplification of the rpoB gene

8. For each PCR reaction get a 0.2-ml “Ready-to-Go” PCR tube. The fluffy pellet
inside the tube is dehydrated PCR mix. The PCR mix contains Taq polymerase, the
four nucleoside triphosphates (dATP, dCTP, dGTP, and dTTP) and buffer with the
Mg+2 required by the DNA polymerase.

9. Assemble your PCR reactions in “Ready-to-Go” tubes in this order:

22.5 uL of mixed rpoB1240F and rpoB2226R primers

CHANGE THE PIPETTE TIP

2.5 µl bacterial lysate

10. After adding the solutions, carefully close the tube. Label the tube with your assigned
number on the side and on top.

11. Finger-tap the tube to dissolve the beads. Pulse centrifuge the tubes briefly.

12. Keep assembled reactions on ice until ready to start the thermal cycler. Your TA will

1
 collect the PCR tubes and start the thermal cycler.

Thermal cycling for PCR amplification

13. Bring your tubes and place them in numerical order in the PCR machine. It is good to
have tubes in order because labels often rub off.

14. Start the thermal cycler. The PCR thermal cycler will be programmed for these
conditions:

Initial Step: HOLD at 95°C for 4 min.

Cycling steps:
Denature: 95°C for 30 sec.
Anneal: 60°C for 30 sec
Extend: 72°C for 60 sec
Cycle 35 times
Extension Step: HOLD 72°C for 10 min.
Final Step: HOLD at 4°C

16. After PCR cycling is complete, the samples will be stored at –20˚C.

For your information:

• Primer rpoB1240F has the sequence 5’- TCGAAGGTTCCGGTATCCTGAGC 23 nts
• Primer rpoB2226R has the sequence 5’- GGATACATCTCGTCTTCGTTAAC 23 nts

ANSWER THE FOLLOWING QUESTIONS:

The Polymerase Chain Reaction: 16S and rpoB

1. (5 points) The following enzymes and other molecules are involved in DNA
replication “in vivo”. For each enzyme and molecule discussed above describe
how that specific function is accomplished in the PCR.
a. DNA polymerase
i. Taq polymerase. DNA Polymerase adds nucleotides to the new
strand; Taq polymerase is a DNA Polymerase isolated from a heat-
tolerant bacteria species called Thermus aquaticus.
b. Helicase
i. High temperature. Whereas in vivo replication requires helicase to
unzip the DNA, because we’re only amplifying a short length we can
accomplish this by means of a specific temperature that breaks the
hydrogen bonds between the bases.
c. Topoisomerase
i. High temperature. Whereas in vivo replication requires
topoisomerase to relieve tension in the DNA, the high temperature is

2
 enough to separate the two strands completely and thus remove all
tension.
d. Nucleotides
i. Nucleotides are the building blocks of DNA; in PCR, we use four
nucleoside triphosphates (dATP, dCTP, dGTP, and dTTP) that the Taq
polymerase uses as materials for the new strand.
e. Primase
i. Unlike in in vivo replication, we don’t use primase; rather, it’s enough
to throw in the rpoB1240F and rpoB2226R primers.

2. (2 points) Compare the 16S PCR and today’s PCR. What is the final goal of each
experiment?
a. The goal of this PCR is to amplify a specific segment of resistant bacterial
DNA that is responsible for the beta subunit of the RNA polymerase so that
we can identify what the mutation changes in the DNA, whereas the goal of
the 16S PCR was to amplify the 16S ribosomal subunit of a particular
bacteria in order to identify the bacteria.
3. (2 point) For each experiment, what is the template we use for the PCR?
a. For this week’s lab, the whole genome of the mutant resistant bacteria; for
last week’s, the whole genome of one species of bacteria found on our
phone/keyboard.
4. (2 point) For each experiment, which gene portion did we amplify?
a. In this week’s lab, we amplify the segment that is responsible for the beta
subunit of the RNA polymerase. In last week’s lab, we amplified the
segment that is responsible for the 16S ribosomal subunit.
5. (3 point) For each experiment explain why we chose that particular region (in your
answer include a description of the 16S gene)?
a. In this week’s lab, we amplify the segment that is responsible for the beta
subunit of the RNA polyermase, because a mutation in this subunit has
been shown to confer resistance to rifampicin. In last week’s lab, we
amplified the 16S ribosomal subunit because that part has alternating
conserved/variable regions; the primers stuck to the conserved regions and
the variable regions in between were amplified, which we can use to
identify the species.