Scientia Horticulturae 224 (2017) 68–73

Contents lists available at ScienceDirect

Scientia Horticulturae
journal homepage: www.elsevier.com/locate/scihorti

SSR marker analysis points to population admixture and continuum of MARK

genetic variation among Indian landraces of brinjal (Solanum melongena L.)
Sushil Kumar Choureya, Shailendra Solankia, Ambika Baldev Gaikwadb, Chithra Devi Pandeyb,
⁎
Sunil Archakb,
a
Division of Plant Genetic Resources, Indian Agricultural Research Institute, Pusa Campus, New Delhi, India
b
ICAR-National Bureau of Plant Genetic Resources, Pusa Campus, New Delhi, India

A R T I C L E I N F O A B S T R A C T

Keywords: India, as a centre of diversity of cultivated brinjal (Solanum melongena L.), possesses a large number of mor-
Brinjal phologically distinct landraces, in addition to wild and weedy forms. To understand if distinct landraces exist as
Solanum melongena independent populations and what is the nature of genetic relationships among them, 96 landraces of brinjal
SSR markers collected from all over India between 1985 and 2012 and conserved in the Indian National Genebank were
Genetic diversity
analysed for molecular genetic variation using simple sequence repeats (SSR) loci. Seven polymorphic SSR loci
Landrace
exhibited fragment length polymorphism with 16 distinct alleles resulting in modest polymorphic information
content (0.36) and gene diversity (0.432). Genetic diversity was computed for 96 individuals distributed among
six geographical populations (based on site of collection). There were no private alleles in any of the populations.
Unbiased expected heterozygosity over loci was 0.321 and Shannon’s information index was 0.396. Source of
variation among the populations, based on analysis of molecular variance, was mainly within populations
(52.3%) translating into clear differentiation (0.13) of otherwise heterozygous populations. On the other hand,
six distinct (0.40) genetic clusters were identified by structure analysis. These genetic sub-populations did not
overlap with populations indicating admixture of genotypes across geographical populations. Substantial gene
flow (Nm = 1.67) leading to continuum of variation among Indian landraces belonging to different geographic
regions was attributed to human-mediated movement of genotypes between locations and to the occurrence of
cultivated brinjal and weedy forms throughout India with natural outcrossing among landraces and across
species.

1. Introduction
India possesses rich diversity and immense variability in cultivated
brinjal (Solanum melongena L.) and its closely related wild species
(Karihaloo and Gottlieb, 1995). Brinjal landraces represent this native
adapted diversity. Local preferences for fruit colour, size, shape, taste
and fibre content combined with native environmental and soil factors
affecting availability of moisture and uptake, earliness of flowering,
growth habit, plant vigour and yield have led to the existence of a large
number of morphologically distinct landraces in India. As a result, India
is home for almost all classes of brinjal cultivars, found anywhere in the
world (Martin and Rhodes, 1979). The landraces are traditionally cul-
tivated by the farmers and serve as a source of allelic diversity for
important traits of breeding value.
Brinjal behaves as an often cross-pollinated crop and the extent of
natural outcrossing is up to 24% in varieties (Kanwar and Gill, 2000)
reaching as high as 48% among Indian populations (Chen, 2001). Ad-
ditionally, occurrence of cultivated brinjal with wild and weedy forms
(S. insanum) throughout India coupled with natural outcrossing has led
to extravagant genetic identities among them (Karihaloo et al., 1995).
Such contexts favour admixtures and require systematic studies to re-
solve population structure (Falush et al., 2003). Such investigations
have been reported, for instance, in sorghum landraces of Cameroon
(Barnaud et al., 2007), East African (Asfaw et al., 2009) and Brazilian
(Burle et al., 2010) landraces of common bean, and Chinese landraces
of soybean (Li et al., 2008) and foxtail millet (Wang et al., 2012).
Population structure and genetic relationships among populations
of cultivated brinjal were previously elucidated using simple sequence
repeats (SSR) marker profiles of 52 accessions from China, Spain, and
Sri Lanka (Hurtado et al., 2012), 238 lines from Asia (containing 24
lines of Indian origin) and Mediterranean (Cericola et al., 2013), 92
accessions collected from seven areas in China (Ge et al., 2013), and

⁎
Corresponding author.
E-mail address: sunil.archak@icar.gov.in (S. Archak).

http://dx.doi.org/10.1016/j.scienta.2017.06.001
Received 8 January 2017; Received in revised form 31 May 2017; Accepted 2 June 2017
0304-4238/ © 2017 Elsevier B.V. All rights reserved.
S.K. Chourey et al. Scientia Horticulturae 224 (2017) 68–73

populations of wild/weedy and cultivated brinjal in South India

(Mutegi et al., 2015). Nevertheless, in spite of their diversity, evolu-
tionary significance and economic value, little is known if distinct
landraces exist as independent populations in India and what is the
nature of genetic relationships among them.
Understanding the genetic relationships among brinjal landraces is a
prerequisite to develop conservation programs, facilitate their re-
introduction to farmers’ fields and enhance their utilization in breeding
(Muñoz-Falcón et al., 2011). Here we report use of SSR marker data on
a set of 96 brinjal landraces recognized by vernacular names and de-
marcated by geographical areas, in order to understand the existence
and nature of population structure in terms of geographical delimita-
tion.

2. Materials and methods

2.1. Brinjal landraces

India’s National Genebank, located at the ICAR-National Bureau of

Plant Genetic Resources, New Delhi conserves as many as 5096 brinjal
accessions among which 3576 are of native origin (www.nbpgr.ernet.
in/pgrportal). Ninety-six landraces (Supplementary Table 1) native to
24 states of India, collected between 1985 and 2012 and conserved in
the genebank, were analysed in the present study.

Fig. 1. Marker profile of 96 brinjal landraces at locus EM-155.

2.2. SSR analysis

Thirty-two mapped SSR loci (Supplementary Table 2) reported to be
hyper-variable (high polymorphism information content) were selected
based on published sources (Nunome et al., 2003; Vilanova et al.,
2012). Thirty seeds of each accession were germinated and DNA was
extracted from bulked plants. Protocols established in our laboratory
were followed for genomic DNA extraction, PCR amplification and
electrophoresis (Archak et al., 2003). Genomic DNA (15 ng) was am-
plified in 20-μl reaction mixture consisting 1 × Taq buffer, 1.25 mM
MgCl2, 0.2 mM dNTPs, 1.0 μM of each primer, and one unit Taq DNA
polymerase in a thermocycler. The PCR conditions were as follows:
initial denaturation at 94 °C for 4 min, 30 cycles of denaturation at
94 °C for 1 min, annealing at experimentally determined annealing
temperature of each primer pair based on Tm (Supplementary Table 2)
for 45 s, and then extension at 72 °C for 45 s followed by a final ex-
tension at 72 °C for 7 min. The amplified fragments were separated on
1.5% agarose gel and visualized by ethidium bromide staining. Geno-
types were scored for amplicon size (in base pairs). A rectangular data
matrix was prepared and basic indices like polymorphism information
content (PIC) and gene diversity were computed using PowerMarker
ver. 3.25 (Liu and Muse, 2005).
2.3. Computation of genetic diversity indices
Allelic patterns, effective number of alleles (Ne), Shannon’s
Information index (I), and expected heterozygosity (He) indices were
estimated on the basis of codominant allelic data using the GenAlEx
software version 6.5 (Peakall and Smouse, 2006, 2012). Analysis of
Molecular Variance (AMOVA) and F-statistics were computed using the
ARLEQUIN software 3.5.1.3 (Excoffier and Lischer, 2010). Because FST
and gene flow (Nm) are inversely related, FST was used to compute gene
(1 − F )
flow as: Nm = 4F ST and the extent of gene flow was used as an in-
ST
direct measure of effective proportion of immigrants across popula-
tions.
carried out based on the codominant allelic data at seven loci using a
correlated allele frequency model. Initial STRUCTURE runs were car-
ried out with a length of burn-in of 10,000 and MCMC (Markov Chain
Monte Carlo) of 10,000. The number of genetic groups (K) in the data
set was inferred and individuals among the groups were assigned based
on Bayesian analysis allowing K to vary from 2 to 30 with five in-
dependent simulations per each K value. Most likely number of genetic
clusters (K) was detected by the method developed by Evanno et al.
(2005) using Structure Harvester (Earl and vonHoldt, 2012).
3. Results
3.1. Marker polymorphism
Out of the 32 hyper-variable SSR markers screened in the study, 24
produced clear and sharp amplification pattern. Fig. 1 shows a re-
presentative allelic profile of 96 brinjal accessions at locus EM-155.
However, out of 24 SSR primer pairs, only seven viz. CSM-31, CSM-36,
CSM-44, CSM-54, CSM-78, EM-140 and EM-155 exhibited fragment
length polymorphism with 16 different alleles (Table 1). PIC of the
markers ranged from 0.27 (CSM-36) to 0.54 (CSM-78), less than what
was reported earlier (Nunome et al., 2003; Vilanova et al., 2012).
Marker polymorphisms are summarized in Table 1. Fewer alleles and
preponderance of major allele among genotypes resulted in modest PIC
(0.36) and gene diversity (0.432). In our study, amplified fragments
were separated on a 1.5% agarose gel and visualized by ethidium
bromide staining. In contrast, Nunome et al. (2003) used urea-for-
mamide sequencing gel and Vilanova et al. (2012) used ABI Prism 3100
capillary sequencer for fragment separation. It appears therefore that
the technique of fragment separation was the main reason for drastic
reduction in the polymorphic loci. Genotypic differences among the
samples used in these studies cannot explain lack of polymorphism in as
many as 32 hypervariable loci screened.

2.4. Determination of population structure 3.2. Genetic diversity

Population structure was determined using software STRUCTURE Mean polymorphism observed among populations was 63.7%.
version 2.3.4 (Falush et al., 2003; Pritchard et al., 2000). The runs were Average number of alleles per population was 1.7 whereas effective

69
S.K. Chourey et al. Scientia Horticulturae 224 (2017) 68–73

Table 1
Summary of the SSR marker diversity indices among 96 brinjal landraces.

# Locus Primer Sequence (5′ → 3′) Forward (top) and reverse (bottom) PIC(S)b Repeat Major Allele No. of Genotypes No. of Gene PIC
Frequency Alleles Diversity

1 CSM31 CAACCGATATGCTCAGATGC 0.82 (AG)28 0.78 3 2 0.347 0.29

GCCCTATGGTCATGTTTTGC
2 CSM36 CCTCAATGGCAGTAGGTCAGA 0.85 (GA)27 0.80 3 2 0.316 0.27
GTTCTTTGAGCCTCCAGTGC
3 CSM44 CGTCGTTGTAACCCATCATC 0.75 (AG)14 0.77 3 2 0.353 0.29
TTGCCAAATTCCTTGTGTTC
4 CSM54 ATGTGCCTCCATTCTGCAAG 0.75 (GA)19 0.69 2 2 0.424 0.33
TGGGTGGGATGCTGAGTAAG
5 CSM78 AGGGAGGAGCTCTCGTGTG 0.68 (CT)19 0.51 6 3 0.614 0.54
CAATAACGTAGCTTAATTACTCCCAAG
a
6 EM140 CCAAAACAATTTCCAGTGACTGTGC 0.70 (AC)n 0.56 6 3 0.564 0.48
GACCAGAATGCCCCTCAAATTAAA
7 EM155 CAAAAGATAAAAAGCTGCCGGATG 0.63 (CT)38 0.72 3 2 0.403 0.32
CATGCGTGAGTTTTGGAGAGAGAG

a
(AC)n is (AC)4GC(AC)5T(AC)3ATGC(AC)4AT(AC)6(AT)5G(TA)13.
b
PIC values as reported in the source; primers 1–5 were from Vilanova et al. (2012) and primers 6–7 were from Nunome et al. (2003).

number of alleles was 1.5. There were no private alleles in any of the
populations. Shannon’s information was distributed mainly within po-
pulations (69%) compared to among populations (31%) with Shannon’s
information index of 0.396. Expected and observed heterozygosity va-
lues among populations were 0.264 and 0.149 respectively. Unbiased
expected heterozygosity over loci (calculated to compensate for small
population sizes) was 0.321.
Sources of variation based on analysis of molecular variance
(AMOVA) were distributed among populations (13.1%), within popu-
lations (52.3%) and among individuals across populations (34.6%).
This translated into a fair amount of differentiation (FST: 0.13) of
otherwise heterozygous populations (FIS: 0.60) with an overall fixation
index (FIT) of 0.65 and gene flow (Nm) of 1.67.
3.3. Population structure
Structure analysis based on the genotypic data grouped 96 landraces
into various clusters (Fig. 2). Evanno’s method based on ΔK identified
most likely number of clusters to be 11 (Supplementary Table 3). De-
tails of clustering of landraces are given in Supplementary Table 4 in-
cluding proportion of membership of brinjal landrace genotypes in each
of the 11 clusters as well as proportion of membership of brinjal
landrace population (based on the site of germplasm collection). It was
evident that genetic clusters (K) did not entirely overlap with corre-
sponding place of origin surrogated by site of collection (Fig. 3). It was
observed that each cluster was composed of individuals representing
various populations pointing towards admixture of genotypes across
geographical locations (Supplementary Table 4).
4. Discussion
Identification of genetic structure of populations from multilocus
genotype data has become a central component of modern population
genetic analysis (Wall, 2003). Determining the population structure of
landraces is essential to devise suitable recollection, conservation,
evaluation and utilization strategies. Brinjal is propounded to have
been domesticated in the Indo-Burma region, which is also the primary
centre of diversity for this crop (Khan, 1979). From there brinjal spread
to other regions, and variations accumulated in several secondary
centres of diversity. In India, for instance, brinjal landraces evolved
with continuous intervention of native farmers. This phenomenon has
multiple foci characterized by culinary choice, food-habits (e.g. rice-
based or millet-based staple food), soil and climate, agricultural pro-
duction systems, etc. It is not understood if manifestation of great
morphological diversity among these brinjal landraces across the
country is structured into genetically distinct groups. The aim of pre-
sent work was to find out, through SSR marker analysis, if brinjal
landraces represented by 96 accessions exhibit any population structure
demarcated by geographical areas.

Fig. 2. Population structure of 96 brinjal landraces collected from 24 states of India.

Bar graphs show the average probability of membership (y-axis) of individuals (N = 96, x-axis) in K = 11 cluster as identified by programme STRUCTURE. Samples are arranged as per
clustering output. Each bar represents a brinjal landrace and is designated by number corresponding to list in Supplementary Table 4. Number in parenthesis indicates population (see
Supplementary Table 4 for details of designation).

70
S.K. Chourey et al.
4.1. Nature of genetic differentiation among brinjal landraces
Greater diversity was observed within populations in our study as
reported earlier (Hurtado et al., 2012). Brinjal landraces in India ex-
perience overlapping flowering window along the latitude from south
to north in the direction the season moves allowing outcrossing (Chen,
2001). Potential of inter-crossing between S. melongena and S. insanum
in India has been well documented (Davidar et al., 2015; Mutegi et al.,
2015). A direct outcome would be modest genetic differentiation and
substantial gene flow between geographic populations. The observa-
tions in Indian domestication centre were in consonance with those
reported from a genetic analysis of 92 accessions collected from seven
areas in China, another domestication centre (Ge et al., 2013). Low
values of FST are commonly observed in wild populations reflecting
high levels of gene flow between populations (Latch et al., 2006).
However, significant amount of gene flow observed among the land-
races in this study could be due to human-mediated movement of
landraces between locations in addition to high degree of outcrossing
known to exist in Indian populations (Chen, 2001).
4.2. Morphological variability vs. molecular variability
Vernacular names of landraces are based on their morphological
distinctiveness. Our SSR-based analysis detected existence of moderate
molecular diversity and lack of extensive population differentiation.
Lester and Daunay (2003) have argued that manifestation of great
morphological diversity but low diversity in molecular markers was
particularly obvious amongst the brinjal cultivars. This argument of low
marker diversity has been supported by many previous brinjal genetic
diversity studies involving Bangladeshi and Taiwanese brinjal germ-
plasm (Khorsheduzzaman et al., 2008), eggplant accessions from three
geographically distant secondary centres of China, Spain, and Sri Lanka
71
Scientia Horticulturae 224 (2017) 68–73
Fig. 3. Distribution of 96 brinjal landraces based on site of
germplasm collection and membership of genetic clusters.
The shapes used to depict the brinjal landraces show their
membership of 11 clusters detected by structure analysis.
Clusters 1, 2 and 3 are shown as red triangle, circle and
squares; clusters 4, 5 and 6 are shown as yellow triangle,
circle and squares; clusters 7, 8 and 9 are shown as blue tri-
angle, circle and squares; and clusters 10 and 11 are shown as
orange triangle and circles.
(Hurtado et al., 2012), genotypes from Asia and the Mediterranean
(Cericola et al., 2013), world-wide collections (Naegele et al., 2014)
and Philippine landraces (Caguiat and Hautea, 2014). It would be
preposterous to conclude, based on the results obtained in this study,
that there might not be sufficient molecular genetic diversity among
brinjal landraces of India. For instance, Behera et al. (2006) have re-
ported high genetic diversity among 73 indigenous and 19 exotic
brinjal genotypes.
4.3. Landraces may not show population structure because they are
managed populations
Landraces, unlike modern varieties, are a composite of several
genotypes. Because of the heterogeneous composition of the popula-
tion, high level of polymorphism is expected among landraces.
However, whether a landrace exists as distinct population or share
genotypes with other landraces that share the agro-ecosystem depends
upon its antiquity, ethno-botanical aspects, breeding behaviour and the
extent of human intervention in its maintenance. Extent of population
differentiation was modest (0.13) on the basis of site of collection. On
the other hand, measure of population differentiation increased (0.40)
if analysed on the basis marker data. Such observation is typical of
“managed populations” (to distinguish from natural populations). In
fact Casañas et al. (2017) have proposed a more inclusive definition of
landraces to include cultivated varieties that have evolved under the
influence of local human culture in both traditional and modern agri-
cultural environments.
An agricultural crop such as brinjal with a long cultivation history,
adaptation to wide agro-climatic zones and multiple uses is bound to
have population structure altered by anthropogenic incursions and
culminate as “managed populations”. Population structure of maize or
rice is known to have been drastically influenced by human
S.K. Chourey et al.
intervention and illustrate how demographic processes have influenced
the genetic diversity and distribution of a species (reviewed by Platt
et al., 2010). Furthermore, in a native crop like brinjal, the habitat
range mostly coincides with human activity and farmers had an op-
portunity to acquire, cultivate and select superior genotypes from dif-
ferent regions until the genotypes were adapted to local conditions.
Such “Managed populations” may not exhibit significant differentiation
if the populations were to be based on site of collection. For instance,
grouping of landraces based on fruit shape (a trait of immense im-
portance for selection by farmers) has shown extensive allele sharing
among geographic populations (Naegele et al., 2014).
4.4. Population admixture and continuum of variation among landraces
Brinjal landraces reported here did not exhibit any population
structure expected in an autogamous plant species. Distribution of
membership of landrace accessions across 11 clusters identified by
structure analysis indicated that the population genetic structure
among Indian brinjal landraces was independent of the locations
(Adeniji et al., 2012; Caguiat and Hautea, 2014; Wang et al., 2010) and
that the landraces included in this study were likely to have experi-
enced extensive gene flow among different geographic regions of India
(Meyer et al., 2012). The results showed how not just allelic pattern but
genotypes were shared as a result of natural outcrossing reported
among brinjal varieties (Kanwar and Gill, 2000), Indian brinjal popu-
lations (Chen, 2001) and between cultivated brinjal with wild and
weedy forms of S. insanum (Karihaloo et al., 1995; Mutegi et al., 2015).
These factors, inter alia, may have led to the existence of a continuum of
variations among landraces (Prohens et al., 2005) and resulted in the
absence of a clear genetic structure as observed in our study.
Current conservation programs in India’s genebank focus on utili-
zation and hence development of core sets. If the brinjal landraces
grouped based on locations from where they were collected, core de-
velopment starts with primary stratification of accessions based on their
ecogeographic locations. On the contrary, absence of any groups based
on site of collection, as observed in the current study, calls for core
development based entirely on morphological traits or molecular
markers (Archak et al., 2016). Results presented in this study are ex-
pected to guide brinjal conservation and utilization programs in the
Indian genebank.
5. Conclusions
Genetic analysis of 96 Indian landraces of brinjal was carried out
using SSR markers to understand the nature of population structure.
Moderate differentiation was observed among populations. Structure
analysis identified 11 distinct genetic clusters and admixture of geno-
types across populations. Substantial gene flow and continuum of var-
iation among landraces was attributed to the known occurrence of
cultivated brinjal and weedy forms throughout India with natural
outcrossing among landraces and across species, and to human-medi-
ated movement of genotypes across locations.
Acknowledgements
The lab work was supported by ICAR-NBPGR’s institutional project
on “Development of genomic tools for enhanced utilization of horti-
cultural crops”. Sushil Chourey acknowledges ICAR-IARI for graduate
research fellowship. Sunil Archak is supported by ICAR-National
Fellowship.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the
online version, at http://dx.doi.org/10.1016/j.scienta.2017.06.001.
72
Scientia Horticulturae 224 (2017) 68–73
References
Adeniji, O.T., Kusolwa, P., Reuben, S.O., 2012. Molecular diversity among seven Solanum
(eggplant and relatives) species assessed by simple sequence repeats (SSRs) markers.
African J. Biotech. 11, 15643–15653.
Archak, S., Gaikwad, A.B., Gautam, D., Rao, E.V., Swamy, K.R., Karihaloo, J.L., 2003.
Comparative assessment of DNA fingerprinting techniques (RAPD: ISSR and AFLP)
for genetic analysis of cashew (Anacardium occidentale L.) accessions of India.
Genome 46, 362–369.
Archak, S., Tyagi, R.K., Harer, P.N., Mahase, L.B., Singh, N., Dahiya, O.P., Nizar, M.A.,
Singh, M., Tilekar, V., Kumar, V., Dutta, M., 2016. Characterization of chickpea
germplasm conserved in the Indian National Genebank and development of a core set
using qualitative and quantitative trait data. Crop J. 4 (5), 417–424.
Asfaw, A., Blair, M.W., Almekinders, C., 2009. Genetic diversity and population structure
of common bean (Phaseolus vulgaris L.) landraces from the East African highlands.
Theor. Appl. Genet. 120, 1–2.
Barnaud, A., Deu, M., Garine, E., McKey, D., Joly, H.I., 2007. Local genetic diversity of
sorghum in a village in northern Cameroon: structure and dynamics of landraces.
Theor. Appl. Genet. 114, 237–248.
Behera, T.K., Sharma, P., Singh, B.K., Kumar, G., Kumar, R., Mohapatra, T., Singh, N.K.,
2006. Assessment of genetic diversity and species relationships in eggplant (Solanum
melongena L.) using STMS markers. Sci. Hort. 107, 352–357.
Burle, M.L., Fonseca, J.R., Kami, J.A., Gepts, P., 2010. Microsatellite diversity and genetic
structure among common bean (Phaseolus vulgaris L.) landraces in Brazil: a secondary
center of diversity. Theor. Appl. Genet. 121, 801–813.
Caguiat, X.G.I., Hautea, D.M., 2014. Genetic diversity analysis of eggplant (Solanum
melongena L.) and related wild species in the Philippines using morphological and SSR
markers. SABRAO J. Breed. Genet. 46, 183–201.
Casañas, F., Simó, J., Casals, J., Prohens, J., 2017. Toward an evolved concept of land-
race. Front. Pl. Sci. 8. http://dx.doi.org/10.3389/fpls.2017.00145.
Cericola, F., Portis, E., Toppino, L., Barchi, L., Acciarri, N., Ciriaci, T., Sala, T., Rotino,
G.L., Lanteri, S., 2013. The population structure and diversity of eggplant from Asia
and the Mediterranean Basin. PLoS One 8, e73702.
Chen, N.C., 2001. Eggplant Seed Production: AVRDC International Co-operators’ Guide.
Asian Vegetable Research and Development Centre, Shanhua, Taiwan.
Davidar, P., Snow, A.A., Rajkumar, M., Pasquet, R., Daunay, M.C., Mutegi, E., 2015. The
potential for crop to wild hybridization in eggplant (Solanum melongena; Solanaceae)
in southern India. Am. J. Bot. 102, 129–139.
Earl, D.A., vonHoldt, B.M., 2012. STRUCTURE HARVESTER: a website and program for
visualizing STRUCTURE output and implementing the Evanno method. Conserv.
Genet. Resour. 4, 359–361.
Evanno, G., Regnaut, S., Goudet, J., 2005. Detecting the number of clusters of individuals
using the software STRUCTURE: a simulation study. Mol. Eco. 14, 2611–2620.
Excoffier, L., Lischer, H.E., 2010. Arlequin suite ver 3.5: a new series of programs to
perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour.
10, 564–567.
Falush, D., Stephens, M., Pritchard, J.K., 2003. Inference of population structure using
multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164,
1567–1587.
Ge, H., Liu, Y., Jiang, M., Zhang, J., Han, H., Chen, H., 2013. Analysis of genetic diversity
and structure of eggplant populations (Solanum melongena L.) in China using simple
sequence repeat markers. Sci. Hort. 162, 71–75.
Hurtado, M., Vilanova, S., Plazas, M., Gramazio, P., Fonseka, H.H., Fonseka, R., Prohens,
J., 2012. Diversity and relationships of eggplants from three geographically distant
secondary centers of diversity. PLoS One 7, e41748.
Kanwar, J.S., Gill, B.S., 2000. Natural cross pollination and pollen dispersal studies in
brinjal. Veg. Sci. 27, 145–147.
Karihaloo, J.L., Gottlieb, L.D., 1995. Allozyme variation in the eggplant, Solanum mel-
ongena L. (Solanaceae). Theor. Appl. Genet. 90, 578–583.
Karihaloo, J.L., Brauner, S., Gottlieb, L.D., 1995. Random amplified polymorphic DNA
variation in the eggplant Solanum melongena L. (Solanaceae). Theor. Appl. Genet. 90,
767–770.
Khan, R., 1979. Solanum melongena and the problem of its origin and phylogenetic affi-
nities. J. Indian Bot. Soc. 58, 99–109.
Khorsheduzzaman, A.K., Alam, M.Z., Rahman, M.M., Mian, M.A., Mian, M.I., Hossain,
M.M., 2008. Molecular characterization of five selected brinjal (Solanum melongena
L.) genotypes using SSR markers. Bangladesh J. Plant Breed. Genet. 21, 1–6.
Latch, E.K., Dharmarajan, G., Glaubitz, J.C., Rhodes Jr., O.E., 2006. Relative performance
of Bayesian clustering software for inferring population substructure and individual
assignment at low levels of population differentiation. Conserv. Genet. 7, 295–302.
Lester, R.N., Daunay, M.C., 2003. Diversity of African vegetable Solanum species and its
implications for a better understanding of plant domestication. Schriften zu
Genetischen Ressourcen 22, 137–152.
Li, Y., Guan, R., Liu, Z., Ma, Y., Wang, L., Li, L., Lin, F., Luan, W., Chen, P., Yan, Z., Guan,
Y., 2008. Genetic structure and diversity of cultivated soybean (Glycine max (L.)
Merr.) landraces in China. Theor. Appl. Genet. 117, 857–871.
Liu, K., Muse, S.V., 2005. PowerMarker: an integrated analysis environment for genetic
marker analysis. Bioinformatics 21, 2128–2129.
Martin, F.W., Rhodes, A.M., 1979. Sub-specific grouping of eggplant cultivars. Euphytica
28, 367–383.
Meyer, R.S., Karol, K.G., Little, D.P., Nee, M.H., Litt, A., 2012. Phylogeographic re-
lationships among Asian eggplants and new perspectives on eggplant domestication.
Mol. Phylogenet. Evol. 63, 685–701.
Muñoz-Falcón, J.E., Vilanova, S., Plazas, M., Prohens, J., 2011. Diversity, relationships,
and genetic fingerprinting of the Listada de Gandía eggplant landrace using genomic
S.K. Chourey et al.
SSRs and EST-SSRs. Sci. Hort. 129 (2), 238–246.
Mutegi, E., Snow, A.A., Rajkumar, M., Pasquet, R., Ponniah, H., Daunay, M.C., Davidar,
P., 2015. Genetic diversity and population structure of wild/weedy eggplant
(Solanum insanum, Solanaceae) in southern India: implications for conservation. Am.
J. Bot. 102, 140–148.
Naegele, R.P., Boyle, S., Quesada-Ocampo, L.M., Hausbeck, M.K., 2014. Genetic diversity,
population structure, and resistance to Phytophthora capsici of a worldwide collection
of eggplant germplasm. PLoS One 9, e95930.
Nunome, T., Suwabe, K., Iketani, H., Hirai, M., 2003. Identification and characterisation
of microsatellites in eggplant. Plant Breed. 122, 256–262.
Peakall, R.O.D., Smouse, P.E., 2006. GENALEX 6: genetic analysis in Excel: population
genetic software for teaching and research. Mol. Ecol. Notes 6, 288–295.
Peakall, R., Smouse, P.E., 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic
software for teaching and research-an update. Bioinformatics 28, 2537–2539.
Platt, A., Horton, M., Huang, Y.S., Li, Y., Anastasio, A.E., Mulyati, N.W., Ågren, J.,
Bossdorf, O., Byers, D., Donohue, K., Dunning, M., 2010. The scale of population
structure in Arabidopsis thaliana. PLoS Genet. 6, e1000843.
73
Scientia Horticulturae 224 (2017) 68–73
Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of population structure using
multilocus genotype data. Genetics 155, 945–959.
Prohens, J., Blanca, J.M., Nuez, F., 2005. Morphological and molecular variation in a
collection of eggplants from secondary center of diversity: implications for con-
servation and breeding. J. Am. Soc. Hort. Sci. 130, 54–63.
Vilanova, S., Manzur, J.P., Prohens, J., 2012. Development and characterization of
genomic simple sequence repeat markers in eggplant and their application to the
study of diversity and relationships in a collection of different cultivar types and
origins. Mol. Breed. 30, 647–660.
Wall, J.D., 2003. Estimating ancestral population sizes and divergence times. Genetics
163, 395–404.
Wang, Q.J., Zhao, F.K., Sun, Q.P., Yang, A.Z., 2010. Genetic diversity of eggplant revealed
by SSR markers. In: Bioinformatics and Biomedical Engineering (iCBBE). 4th
International Conference. pp. 1–4.
Wang, C., Jia, G., Zhi, H., Niu, Z., Chai, Y., Li, W., Wang, Y., Li, H., Lu, P., Zhao, B., Diao,
X., 2012. Genetic diversity and population structure of Chinese foxtail millet [Setaria
italica (L.) Beauv.] landraces. G3 Genes, Genomes. Genetics 2, 769–777.