Appl Microbiol Biotechnol (2017) 101:3811–3820
DOI 10.1007/s00253-017-8252-2
METHODS AND PROTOCOLS
An external substrate-free blue/white screening system
in Escherichia coli
Zhoujie Xie 1 & Zhao Zhang 1,2 & Zhenju Cao 1,2 & Meng Chen 1,2 & Pengwei Li 1 &
Weifeng Liu 3 & Hua Qin 1 & Xuejin Zhao 3 & Yong Tao 2,3 & Yihua Chen 1,2
Received: 19 December 2016 / Revised: 11 March 2017 / Accepted: 16 March 2017 / Published online: 28 March 2017
# Springer-Verlag Berlin Heidelberg 2017
Abstract Since the lacZα-based blue/white screening system
was introduced to molecular biology, several different visual
reporter systems were developed and used for various pur-
poses in Escherichia coli. A common limit to the existent
visual reporter systems is that an extracellular chromogenic
substrate has to be added for the visible pigment production.
In this study, we developed a new blue/white screening system
based on a non-ribosomal peptide synthetase encoded by idgS
from Streptomyces and a phosphopantetheinyl transferase
encoded by sfp from Bacillus. When IdgS is activated from
an apo-form to a holo-form via a posttranslational modifica-
tion catalyzed by Sfp, it can synthesize a blue pigment
indigoidine using L-glutamine, the amino acid abundant in
cells, as a substrate. The new blue/white screening system
contains a recipient E. coli strain with an optimized idgS gene
cassette and a cloning vector harboring an sfp gene with an in-
frame insertion of a multiple cloning site close to its N-termi-
nal. We demonstrated that the IdgS/Sfp-based blue/white
screening system is a powerful alternative to the lacZα-based
screening system, which does not require any external sub-
strate addition.
Electronic supplementary material The online version of this article
(doi:10.1007/s00253-017-8252-2) contains supplementary material,
which is available to authorized users.
* Yihua Chen
chenyihua@im.ac.cn
1
State Key Laboratory of Microbial Resources, Institute of
Microbiology, Chinese Academy of Sciences, Beijing 100101,
People’s Republic of China
2
University of Chinese Academy of Sciences, Beijing 100049, China
3
CAS Key Laboratory of Microbial Physiological and Metabolic
Engineering, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, China
Keywords Blue/white screening . Indigoidine synthetase .
Sfp . External substrate-free
Introduction
Gene cloning is one of the most frequently used techniques in
molecular biology. The gene cloning process has become
more and more rapid and easy due to the various screening
methods developed recently. Based on the screening strategy,
all the screening systems developed so far can be divided into
two classes: visual and non-visual. The visual screening sys-
tem has been developed normally based on reporter genes for
visible pigment production, such as the α-fragment of β-ga-
lactosidase-encoding gene (lacZα) (Langley et al. 1975), β-
glucuronidase enzyme-encoding gene (gusA) (Myronovskyi
et al. 2011), alkaline phosphatase gene (phoZ) (Chaffin and
Rubens 1998), etc. A common limit of these systems is that an
extracellular chromogenic substrate for visible pigment pro-
duction has to be added during the screening. Besides the
chromogenic reporter genes, fluorescent protein-encoding
genes were also used in some visual screening system
(Banerjee et al. 2010; Wong and Truong 2010). Although no
chromogenic substrate is required in this case, a UV emission
device is usually needed for screening.
The non-visual screening system is usually based on toxic
or antibiotic resistance genes. The toxic genes are used as
counter-selection markers, and only the positive cells with a
disrupted toxic gene by insertion of a DNA fragment into the
cloning site are able to grow on the selection medium. The
toxic gene ccdB, encoding a poisoning DNA gyrase, thereby
killing host cells when it is expressed functionally, has been
used in the construction of a variety of positive selection vec-
tors (Bernard et al. 1994; Miyazaki 2010). Maintaining or
amplifying vectors harboring the intact ccdB gene requires
3812 Appl Microbiol Biotechnol (2017) 101:3811–3820

special host strains carrying mutations in DNA gyrase

(gyrA462) (Bernard et al. 1994). Another toxic gene used in
non-visual screening system is p-fluorophenylalanine-sensi-
tive gene pheS, which encodes a phenylalanyl-tRNA synthe-
tase (Hennecke et al. 1982). Similarly, a special host strain
containing mutated pheS (phe12) and a special medium con-
taining p-fluorophenylalanine is required for the recombinant
plasmid screening (Hennecke et al. 1982). Antibiotic resis-
tance genes were also used for screening purpose in some
cloning vectors (Nakanishi et al. 1986). In these cases, replica
plating is usually required for screening the recombinant plas-
mid by identifying the insertion inactivation of antibiotic re-
sistance markers, which adds an extra laborious step in the
screening process.
Among all the aforementioned screening systems, the
lacZα-based system is still the most wildly used one. Cells
containing these empty vectors hydrolyze a chromogenic sub-
strate (5-bromo-4-chloro-3-indolyl-β-D-galactoside, X-Gal)
to give blue colonies. The DNA insertion into lacZα by re- Fig. 1 Indigoidine production by heterologous expression of indigoidine
combinant cloning results in an inactivated enzyme and the synthetase encoding gene. a Indigoidine production catalyzed by
cells harboring the recombinant plasmids generate white col- indigoidine synthetase. Schematic diagram shows that indigoidine
onies. Besides the extra labor and cost introduced by the ad- synthetase (IdgS) is modified by PPTase from apo-form to holo-form.
CoA is required for this modification. The holo-indigoidine synthetase
dition of X-Gal, another drawback of lacZα-based blue/white catalyzes the production of one molecule of indigoidine from two mole-
screening system comes from the instability of the chromo- cules of L-glutamine. b Requirement of co-expression of idgS and sfp in
genic substrate X-Gal, which is light-sensitive and heat- E. coli for the production of indigoidine. E. coli JM109 harboring plasmid
unstable and leads to false positive screening results some- pCIM2001, a plasmid with idgS insertion driven by the promoter ermEp*
(Li et al. 2015) (JM109 (idgS)); E. coli JM109 harboring plasmid
times (Heuermann and Cosgrove 2001). pCIM2002, a plasmid containing two gene operon (idgS-sfp) driven by
Thus, a screening system that meets the following require- the promoter ermEp* (Li et al. 2015) (JM109 (idgS-sfp))
ments is still desirable: (1) Cloning vector can be easily main-
tained and prepared in normal Escherichia coli host strain, (2)
normal medium without addition of extra substrate can be mechanism of indigoidine, a series of applications, such as
used in the screening process, and (3) discrimination between an in vivo reporter for bacterial and mammalian cells
positive and negative clones can be done visually without the (Muller et al. 2012) and a tool for analysis of PPTase enzymes
help of any extra equipment. For the purpose of developing (Owen et al. 2011), have been developed. We cloned the
such a system, we constructed a new system using the endog- encoding gene of indigoidine synthetase (idgS) from
enous production of pigment (indigoidine) as a selection Streptomyces lavendulae CGMCC 4.1386 and successfully
indicator. developed a screening system for gene inactivation in
Indigoidine is a water-insoluble blue pigment (Kuhn et al. Streptomyces species based on the gene pair of idgS and sfp
1965), which can be readily detected either in vivo or in vitro (a PPTase-encoding gene from Bacillus subtilis) (Li et al.
owing to its characteristic blue color and strong absorbance at 2015), demonstrating the feasibility of indigoidine production
590 nm. Its chemical properties give the producing strain a as a selection indicator in Streptomyces. In this report, we
dark blue colony phenotype. The enzymes and substrates re- describe the construction of the indigoidine-based blue/white
quired for the production of indigoidine have been well char- screening system and its use in recombinant DNA screening
acterized already (Reverchon et al. 2002; Takahashi et al. in E. coli.
2007). Indigoidine is synthesized from two molecules of L-
glutamine by indigoidine synthetase, a single module non-
ribosomal peptide synthase (NRPS). As the other NRPSs, Materials and methods
indigoidine synthetase’s activity is dependent on
phosphopantetheinyl transferase (PPTase) mediated posttrans- Bacterial strains and culture conditions
lational modification from an apo-form to a holo-form.
Therefore, co-expression of indigoidine synthetase and an ap- Bacterial strains used in this study are shown in Table 1.
propriate PPTase are necessary for the production of LB broth and agar were used for routine growth and
indigoidine (Fig. 1a). Based on the simple biosynthesis maintenance of all E. coli strains used in this study.
Appl Microbiol Biotechnol (2017) 101:3811–3820 3813

Table 1 Strains and plasmids

used in this study Strains and plasmids Characteristics References

E. coli strains
JM109 recA1, endA1, gyrA96, thi-1, hsdR17, e14-(mcrA-), Yanisch-Perron et al. (1985)
supE44, relA1, Δ (lac-proAB)
BW25113 rrnB3, ΔlacZ4787, hsdR514, Δ(araBAD)567, Datsenko and Wanner (2000)
Δ(rhaBAD)568, rph-1
IDG01 E. coli JM109, ompT::T5-idgS, KanR This study
TRI01 E. coli JM109, attB1::T5-RBSs-midgS, KanR This study
JRI01 E. coli JM109, attB1::J23100-RBSs-midgS, KanR This study
JRI02 E. coli JM109, attB1::J23100-RBSw-midgS, KanR This study
IDG02 E. coli JM109, attB1::T5-RBSs-midgS, markerless This study
Plasmids
pUKM-T5 pUC19 with T5-FRT-Kan-FRT cassette insertion, This study
KanR, AmpR
pUC19 Cloning vector, AmpR Yanisch-Perron et al. (1985)
pCIM001 pSET152::PermE-idgS, AprR Li et al. (2015)
R
pCIM002 pSET152::PermE-idgS-sfp, Apr Li et al. (2015)
pSFP01 pUC19-derived plasmid, lacZ−sfp+, with lac This study
repressor binding site deletion, AmpR
pSFP02 pSFP01-derived plasmid, with the deletion of This study
codons 1–7 of sfp, AmpR
pSFP03 pSFP01-derived plasmid, with MCS region This study
insertion after the 5th codon of sfp, AmpR
pSFP04 pSFP01-derived plasmid, containing MCS region This study
with orientation opposite to that of pSFP03,
AmpR
pOSIP-KO Plasmid used for clonetegration in E. coli, St-Pierre et al. (2013)
maintained and prepared in E. coli DB3.1, KanR
pJRI01 pPT02 with the insertion of J23100-RBSS-midgS This study
cassette, CmR
pJRI02 pPT02 with the insertion of J23100-RBSW-midgS This study
cassette, CmR
pIDG02 pPT02 with the insertion of midgS, CmR This study
pPT02 pSC101 ori, pSB4C5 derived cloning vector This study
containing sfGFP gene and two BsaI sites
upstream of sfGFP, CmR
pTGE33 pET28a::sfp, KanR Fang et al. (2008)
+ ts R R
pCP20 FLP , Rep , Amp , Cm Datsenko and Wanner (2000)

KanR kanamycin resistance, AmpR ampicillin resistance, CmR chloramphenicol resistance, AprR apramycin
resistance

Where it is necessary, media were supplemented with Primers and plasmids

100 μg/ml apramycin, 25 μg/ml chloramphenicol,
100 μg/ml ampicillin, or 50 μg/ml kanamycin. Unless
stated otherwise, strains expressing idgS and sfp were
plated on LB agar and incubated for 12–14 h at 37 °C
to facilitate colony formation. After that, the plates were
placed at room temperature (around 25 °C) and incubated
for another 3–4 h to facilitate indigoidine production. All
the images were captured using a digital camera with a
12-megapixel resolution and F2.2 aperture in this work.
To show the blue and white colonies clearly, the images
of plates with blue colonies were captured on a white
background, while the images of plates with white colo-
nies were captured on a black background.
The plasmids and strains used in this study are shown in
Table 1. The primers used in this study are shown in Table S1.
Preparation for the E. coli recipient strain construction
For the construction of E. coli strains with a higher ex-
pression level of IdgS, a DNA cassette (T5-RBSs-midgS)
containing a codon-optimized idgS gene (midgs) with a
strong ribosomal binding site (RBSs) driven by T5 pro-
moter was synthesized by TsingKe Co., Beijing, China
(see supplementary materials for full sequence of modi-
fied idgS). T5 promoter is a strong promoter from
3814 Appl Microbiol Biotechnol (2017) 101:3811–3820

bacteriophage T5 (Gentz and Bujard 1985). DNA cassette

of T5-RBSs-midgS was used for the construction of TRI01
(see following). Combined with midgS, promoter J23100
and two RBS region (RBSs and RBSw) were selected for
the constructions of the strains of JRI01 and JRI02 (see
following). RBS s (AGTTAGAAATTCAACAAAGC
ATAAGGAGGTATTTT) and RBS w (TCCCGTAG
TCTAAAAAGTTTAAAGGCAAGT) are two RBS mod-
ules designed using the RBS calculators (Salis et al.
2009). Strengths of RBSs and RBSw indicated by transla-
tion initiation rate (TIR) are 333,796 and 4844, respec-
tively. Promoter J23100 is a strong promoter from a com-
binatorial library of constitutive promoters (Registry for
Standard Biological Parts, http://parts.igem.com).
Promoter J23100 has been shown to be weaker than
promoter T5 (unpublished data).

Construction of E. coli strain IDG01
E. coli strain IDG01 (the E. coli strain harboring an idgS
gene driven by T5 promoter) was constructed by λ Red-
mediated recombination (Datsenko and Wanner 2000).
Briefly, a 3.9-kb DNA fragment containing the idgS gene
and its intact RBS region was amplified from genomic
DNA of S. lavendulae CGMCC 4.1386 using the primer
pair idgSF-kanT/idgSR, while a 1.6-kb fragment contain-
ing the KanR cassette and T5 promoter was amplified with
the primer pair kanF/kanT5-idgSF from pUKM-T5. The
overlapping regions between the two amplicons allow a
subsequent overlapping PCR using primer pair kanF-
ompTup and idgSR-ompTdn, two primers with 39-nt ho-
mology extensions corresponding to the ompT gene in
E. coli. The resulting 5.5-kb amplicon was electroporated
into E. coli BW25113 carrying plasmid pIJ790 as the
protocol described before (Datsenko and Wanner 2000).
The transformant, losing plasmid pIJ790 and carrying the
correct insertion of idgS gene driven by T5 promoter in
the ompT locus, was named as IDG01.
Construction of E. coli strain TRI01
As illustrated in Fig. 2a, strain TRI01 was constructed using
the one-step cloning and chromosomal integration method
(St-Pierre et al. 2013). Briefly, using the synthesized DNA
cassette (T5-RBSs-midgS Fragment) as a template, a 4.0-kb
DNA fragment was PCR amplified with the primer pair
T5F-SpeI and idgsmR-BamHI. The PCR products were dou-
ble digested with BamHI and SpeI and inserted into the same
sites of pOSIP-KO. The ligation products were transformed
into the competent cells of JM109 directly, and the integrants
were selected on LB plate containing kanamycin to obtain
strain TRI01.
Fig. 2 Construction and evaluation of the E. coli recipient strains TRI01,
JRI01, and JRI02. a Illustration of the constructions of the midgS
integration strains (TRI01, JRI01, JRI02) by an integration strategy. The
midgS cassette was cloned into pOSIP-KO and integrated into the chro-
mosome of E. coli JM109. After integration, the integration cassette (con-
taining kanR and integrase genes) could be removed by expressing FLP
recombinase. b Blue pigment production phenotypes of the three E. coli
recipient strains harboring plasmid pSFP01. Strain TRI01 containing
pSFP01 (TRI01 (pSFP01)); strain JRI01 containing pSFP01 (JRI01
(pSFP01)); strain JRI02 containing pSFP01 (JRI02 (pSFP01)). This ex-
periment was performed multiple times and got similar results
Construction of E. coli strain JRI01
Plasmid pJRI01 carring a 4.0-kb DNA insertion containing
midgS with RBSs driven by J23100 promoter (J23100-RBSs-
midgS) was used for the construction of E. coli strain JRI01.
Plasmid pJRI01 is derived from pIDG02, which was generat-
ed as described below. A 3.8-kb fragment was amplified with
primer pair pTPF-idgsR and pTPR-SidgS-St using pPT02 as a
template, while a 4.0-kb fragment containing midgS was am-
plified from the synthesized DNA cassette of T5-RBSs-midgS
with primer pair SigdS-ST and IdgSmR-BamHI. The overlap-
ping regions between the two amplicons facilitated the con-
struction of plasmid pIDG02 by assembling the two fragments
with ClonExpress II One-Step Cloning Kit (Vazyme Biotech
Co., Ltd., Nanjing, China). During the construction of
pIDG02, two BsaI recognition sites were introduced upstream
of the open reading frame of midgS. For pJRI01construction, a
DNA fragment containing PJ2300 promoter and RBSs was
PCR amplified with primer pair PRsF and PRsR and inserted
into the BsaI sites of pIDG02 by Golden Gate Cloning strat-
egy (Engler and Marillonnet 2014). A 4.0-kb fragment was
then amplified from plasmid pJRI01 with primer pair PJF-
SpeI and idgsmR-BamHI. The PCR products were digested
with SpeI and BamHI and inserted into the corresponding sites
of pOSIP-KO. Ligation products were transformed into
Appl Microbiol Biotechnol (2017) 101:3811–3820
JM109 and selected on LB plate containing kanamycin to
obtain JRI01.
Construction of E. coli strain JRI02
Plasmid pJRI02 carries a 4.0-kb DNA cassette containing
midgS with RBSw driven by J23100 promoter (J23100-
RBSw-midgS). A DNA fragment containing PJ2300 pro-
moter and an artificial RBS (RBSw) was PCR amplified
with primer pair PRwF and PRwR and inserted into the
BsaI sites of pIDG02 with the golden gate cloning way to
generate pJRI02. E. coli strain JRI02 was constructed
using a similar strategy as that of TRI01 and JRI01 con-
structions (Fig. 2a) (St-Pierre et al. 2013). Briefly, a 4.0-
kb fragment was amplified from plasmid pJRI02 with
primer pair PJF-SpeI and idgsmR-BamHI. The PCR prod-
ucts were digested with SpeI and BamHI and inserted into
the same sites of pOSIP-KO. Ligation products were
transformed into JM109 and selected on LB plate contain-
ing kanamycin to obtain strain JRI02.
Verification of E. coli strains TRI01, JRI01, and JRI02
All three strains were verified by a PCR strategy for test-
ing the presence of new locus-specific fragments of pre-
dicted sizes as described before (St-Pierre et al. 2013).
There are two putative integration sites (attB1and attB2)
on the chromosome of E. coli JM109 for pOSIP-KO vec-
tor (St-Pierre et al. 2013). The integration sites of the
three constructions were determined by two separate
PCR reactions using the genomic DNA of TRI01,
JRI01, or JRI02 as a template with the primer mix of
OP1, P2, P3, and OP4 and primer mix of P1, P2, P3,
and P4, respectively. Primers P1 and P4 flank the attB1
site, primers OP1 and OP4 flank the attB2 site, and the
binding sites of primers P2 and P3 locate on the vector
and flank the midgS cassette. The PCR program was set
as initial denaturation at 98 °C for 60 s followed by 30 cy-
cles of amplification (denaturation at 98 °C for 10 s, an-
nealing at 50 °C for 15 s, extension at 72 °C for 1 min),
and a final extension at 72 °C for 10 min. As depicted in
Fig. S2, successful integration into attB1 will give two
fragments of 389 and 328 bp from primer pairs P1/P2
and P3/P4, respectively, and the absence of integration
into attB2 will produce one fragment of 601 bp from
primer pair OP1/OP2.
Construction of E. coli strain IDG02
The markerless strain IDG02 was obtained by excision of the
kanamycin resistance and integration module from E. coli
TRI01 (Fig. 2a). Briefly, E. coli TRI01 was transformed with
the FLP recombinase expression plasmid pCP20 (Datsenko
3815
and Wanner 2000). When the transformants were selected
on LB plate with ampicillin at 30 °C, site-specfic recombina-
tion occurred between the two FRT sites which flank the kana-
mycin resistance gene and the integrase genes. After culture at
37 °C, a large majority of transformants lost the FRT flanked
kanamycin resistance gene and the integrase genes and also
the FLP helper plasmid pCP20. The final construction losing
all antibiotic resistances was selected as strain IDG02.
Construction of plasmid pSFP01-04
Using pTGE33 as a template, a 750-bp DNA fragment
(containing sfp gene) was PCR amplified with the primer
pair sfpF-pUC18r and sfpR-pUC18f, while a 2.7-kb frag-
ment was amplified from the plasmid pUC19 with the
primer pair pUC18F-sfp and pUC18R-sfp. The overlap-
ping regions between the two amplicons allow them to be
assembled into a plasmid using the One-Step Cloning Kit
(Vazyme Biotech Co., Ltd., Nanjing, China) to obtain
pSFP01. A 3.0-kb fragment was then PCR amplified
using pSFP01 as a template with the primer pair
sfp2ndATGF and sfp2ndATGR. The amplicon was treated
with T4 polynucleotide kinase (New England Biolabs
(Beijing) Ltd., China) and self-ligated to obtain pSFP02.
For the construction of pSFP03, a 3.1-kb fragment was
amplified from pSFP01 using primer pair pUCsfpF-
HindIII and pUCsfpR-EcoRI, while the two oligos
(MCSF and MCSR) were annealed to obtain the multi-
cloning site (MCS) fragment with the overhangs compli-
ment with the overhangs generated by EcoRI and HindIII
digestion. The annealed oligos and 3.1-kb fragment
digested with EcoRI and HindIII were linked together to
get plasmid pSFP03. The same way was used in the con-
struction of pSFP04, except that the 3.1-kb plasmid back-
bone was amplified with primer pair pUCsfpF-EcoRI and
pUCsfpR-HindIII.
sfGFP cloning using pSFP03 as a vector in the host
of E. coli IDG02
The sfGFP-encoding gene was PCR amplified from pPT02
using the primer pair GFPF-EcoRI and GFPR-HindIII. The
PCR products were double digested with EcoRI and HindIII
and inserted into the corresponding sites of pSFP03. The liga-
tion products were transformed into the competent cells of
IDG02 and selected on LB plate containing ampicillin. The
plate was inoculated at 30 °C for 16 h for blue/white
screening.
Nucleotide sequence accession number The T5-RBSs-midgS
gene cassette was deposited in GenBank under an accession
number KY381898.
3816
Results
Co-expression of idgS and sfp in E. coli leads to a blue
pigment production
BpsA from S. lavendulae ATCC 11924 is the first in vitro-
characterized indigoidine synthetase (Takahashi et al. 2007). It
was reported that the endogenous PPTases of E. coli are not
able to activate BpsA and that co-expression of an appropriate
PPTase is necessary for the production of the blue pigment
indigoidine in E. coli. Our previous study identified another
indigoidine synthetase-encoding gene (designated as idgS)
from S. lavendulae CGMCC 4.1386, which shows high sim-
ilarity with bpsA (Li et al. 2015). The plasmids of pCIM2001
(pUC replicon with the insertion of idgS driven by a constitu-
tive promoter) and pCIM2002 (pUC replicon with the inser-
tion of a two-gene operon idgS-sfp driven by a constitutive
promoter) are two constructions made during our efforts to
develop a gene inactivation system in Streptomyces (Li et al.
2015). In order to know whether the formation of holo-IdgS
needs an exogenous PPTase in E. coli, the two plasmids were
transformed into E. coli JM109, respectively. It was observed
that E. coli strain carrying pCIM2002 produced blue pigment
indigoidine effectively, while E. coil carrying pCIM2001
could not (Fig. 1b), indicating that the endogenous PPTases
of E. coli cannot, but Sfp can activate IdgS.
The observation that co-expression of idgS and sfp in
E. coli is required for the production of indigoidine promoted
us to make a new blue/white screening system in E. coli,
which will use the endogenous substrates (L-glutamine and
ATP) to make blue pigment. We envisaged that the novel
blue/white screening system will have two parts: an idgS
containing E. coli strain (recipient strain) and an sfp containing
vector (cloning vector). The recipient strain containing empty
cloning vector would display blue phenotype, and the strains
containing recombinant plasmids would show white pheno-
type due to the inactivation of sfp by the inserted foreign
DNA.
Construction and evaluation of the recipient E. coli strains
A prerequisite for such a screening system is to construct an
appropriate recipient strain. At first, strain IDG01 derived
from E. coli BW25113 with idgS gene and its intact RBS
driven by the strong T5 promoter (T5-RBSidgS-idgS) was con-
structed. To evaluate IGD01, plasmid pSFP01 was generated
by replacing the lacZ gene in pUC19 with the sfp gene. The
lac repressor binding site was also deleted during the con-
struction. Therefore, the sfp gene in pSFP01 can be expressed
constitutively. When pSFP01 was transformed into E. coli
IDG01, the transformants displayed a light brown phenotype
instead of the anticipated dark blue, indicating that a single
copy of the native idgS gene cannot produce enough enzyme
Appl Microbiol Biotechnol (2017) 101:3811–3820
even it is driven by the strong T5 promoter. We speculated that
a possible reason is that the idgS gene (G+C content 73%) is
not efficiently expressed in E. coli due to the codon bias. To
circumvent this problem, a codon-optimized idgS (midgS),
which has the same amino acid sequence as idgS but using
codons preferred by E. coli, was synthesized. The new midgS
gene was then used in place of idgS in the construction of the
following recipient strains.
Given that the appropriate expression level of IdgS in the
recipient strain is unknown, three strains (named as TRI01,
JRI01, and JRI02), designed to exhibit different expression
levels of IdgS, were made based on midgS. As shown in
Fig. 2a, the three recombinant E. coli strains were constructed
using the cloning and integration strategy developed by St-
Pierre and his colleagues (St-Pierre et al. 2013). The new
midgS cassette combined with different promoters (a relative-
ly strong promoter T5 and a weaker one J23100) and ribosom-
al binding sites (a relatively strong one RBSs and a weaker one
RBSw) was used in the construction of the three recombinant
strains. As illustrated in Fig. S1, E. coli TRI01 carries a DNA
insertion containing midgS with RBSs driven by T5 promoter
(T5-RBSs-midgS); E. coli JRI01 carries a DNA insertion con-
taining midgS with RBSs driven by J23100 promoter (J23100-
RBSs-midgS), and E. coli JRI01 carries a DNA insertion con-
taining midgS with RBS w driven by J23100 promoter
(J23100-RBSw-midgS). Among them, TRI01 is expected to
have the highest expression level of IdgS, while JRI02 is ex-
pected to have the lowest expression level. To determine
which one is the best recipient strain in our cloning system,
plasmid pSFP01 was transformed into them, respectively. It is
clear that the pSFP01/TRI01 transformants displayed the
strongest blue phenotype, while the pSFP01/JRI02
transformants showed the weakest blue color (Fig. 2b).
Finally, a markerless strain IDG02 was constructed by remov-
ing the kanamycin resistance and integration cassette from
TRI01 through FLP-mediated site-specific recombination
and was used as the recipient strain in our following studies.
Construction and evaluation of the cloning vectors
The cloning vectors with an MCS region inserted inside sfp
were constructed based on plasmid pSFP01. In order to ex-
plore the potential locations for inserting an MCS region in
sfp, the short N-terminal encoding region between the start
codon and the second ATG codon of sfp (the eighth codon,
Fig. 3a) was checked. Plasmid pSFP02 was constructed from
pSFP01 by deleting the first seven codons of the sfp gene and
transformed into IDG02. All transformants displayed white
phenotype as shown in Fig. 3b, indicating that the truncated
Sfp translated from the second ATG completely loses activity.
Thereafter, the tolerance of inserting an MCS region at the
short N-terminal encoding region was investigated. We chose
the polylinker sequence corresponding to the MCS region of
Appl Microbiol Biotechnol (2017) 101:3811–3820
Fig. 3 Properties of plasmids pSFP01, pSFP02, pSFP03, and pSFP04. a
A pUC replicon containing a full size sfp (pSFP01); a pUC replicon
containing an sfp lacking the first seven codons (pSFP02); a pUC
replicon containing an sfp with a MCS region inserted after the fifth
codon (pSFP03); a pUC replicon containing an sfp with a MCS region
pUC19 and made in-frame fusion to sfp gene after its fifth
codon. Corresponding to two orientations for the same MCS
region, two vectors pSFP03 and pSFP04 were constructed
from pSFP01. As illustrated in Fig. 3a, the MCS region inser-
tion will result in an in-fusion Sfp protein with 18 extra amino
acid insertions in both cases. The two vectors, pSFP03 and
pSFP04, were transformed into E. coli IDG02, respectively,
and assessed rapidly by visual inspection of blue pigment
production. As shown in Fig. 3b, transformants containing
pSFP03 showed a similar blue phenotype with transformants
containing pSFP01, while pSFP04 transformants displayed a
slight weaker blue phenotype.
Optimization of the cultivation conditions
The recipient strain E. coli IDG02 and the cloning vector
pSFP03 constitute the new blue/white screening system. It
should be mentioned that IdgS and Sfp, the two enzymes
recruited by the new screening system, have different op-
timum temperatures for their functionality. Accordingly,
we had to cultivate the transformants at two different tem-
peratures successively for the blue phenotype observation
(12–14 h at 37 °C for holo-IdgS accumulation and then 3–
4 h at room temperature for indigoidine synthesis). In
order to simplify the cultivation procedure, we sought to
find a constant temperature to incubate the transformants.
It has been reported that Sfp functions in a wide range of
3817
(having an opposite orientation to that in pSFP03) inserted after the fifth
codon (pSFP04). b Phenotypes of IDG02 strains transformed with
plasmid pSFP01, pSFP02, pSFP03, and PSFP04. This experiment was
performed multiple times and got similar results
temperature, which makes our attempt possible (Owen
et al. 2011). To determine the best incubation temperature
for our system, the strain IDG02 containing plasmid
pSFP01 was constantly cultivated at a serial of tempera-
ture (from 24 to 34 °C). When cultivated at 30 °C, the
E. coli strain displayed a reasonable colony size and clear
blue phenotype after 16-h incubation (Fig. S3). The result
suggested that cultivation constantly at 30 °C is appropri-
ate for the indigoidine-based blue/white screening system.
The effect of pH on the production of indigoidine in E. coli
was also investigated by growing strain IDG02 containing
plasmid pSFP03 on LB agar plates with an initial pH range
from 5.0 to 9.0. As shown in Fig. S5, when the E. coli strain
was spread on LB agar plate with pH of 6.0, 7.0, and 8.0, a
whole plate of blue colonies was observed; when it was spread
on LB agar plate with pH of 5.0 and 9.0, very few tiny colo-
nies, which were also blue, could grow up. These results re-
vealed that production of indigoidine in E. coli is insensitive to
medium pH. Therefore, LB medium without special pH ad-
justment (pH around 7.2) was used in the indigoidine-based
screening system.
Cloning the sfGFP gene with the new blue/white screening
system
To demonstrate the convenience of the new screening
system, we cloned the sfGFP gene into the EcoRI and
3818
HindIII sites of plasmid pSFP03 as a DNA cloning exam-
ple. E. coli IDG02 was used as the recipient strain, and
the transformants were cultivated at 30 °C for 16 h.
Almost all transformants show white phenotype (no blue
pigment production); meanwhile, these white colonies
display green fluorescence under UV condition, indicating
that all the white colonies are bacteria containing the cor-
rect recombinant plasmids (Fig. 4). Ten colonies were
randomly selected for plasmid extraction. Using the plas-
mid as a template, PCR with the sfGFP-specific primers
was performed. The PCR results showed that all ten plas-
mids have the correct sfGFP insertions (Fig. 4).
Discussion
In this study, we report the development of a novel blue/white
screening system in E. coli based on an indigoidine
synthetase-encoding gene (idgS) from Streptomyces and a
phosphopantetheinyl transferase-encoding gene (sfp) from
Bacillus. The new screening system consists of a recipient
strain E. coli IDG02 (containing a T5-RBSs-midgS cassette)
and a cloning vector pSFP03 (pUC replicon containing sfp
Fig. 4 sfGFP gene cloning using pSFP03 as a cloning vector and IDG02
as a recipient strain. a The transformants were incubated at 30 °C for 18 h,
and pictures were taken under the conditions of visible (Vis) light and
ultraviolet visible (UV) light, respectively. b Ten white colonies from the
transformation plate were randomly picked up for plasmid preparation
and then checked for the expected sfGFP inserts by PCR using the sfGFP-
specific primers. The sample denoted with a plus sign indicates a positive
control
Appl Microbiol Biotechnol (2017) 101:3811–3820
with a MCS region). The substrates for indigoidine bio-
synthesis, L-glutamine and ATP, are available inside the
bacterial cells, so no exogenous substrate is required for
this system. So far as we know, it is the first visual DNA
cloning system that utilizes only the endogenous sub-
strates to produce a pigment as the screening indicator.
Indigoidine has a strong absorbance at 560 nm, which
endows a dark blue color to its producer. To avoid any
external substance addition during the screening process,
the midgS gene in the recipient strain is driven by a con-
stitutive promoter and the sfp gene in the cloning vector is
driven by lac promoter without the lac repressor binding
site; therefore, no inducing compound such as IPTG is
required.
For the indigoidine-based system, we found that
transformant incubation constantly at 30 °C could give a
better screening result compared with the other tempera-
tures tested. This observation is consistent with the previ-
ous finding that the optimal temperature of indigoidine
synthetase is around 30 °C and Sfp functions at a wide
range of temperature (Owen et al. 2011; Quadri et al.
1998; Takahashi et al. 2007). The pigment production
on LB plate is accompanying with the colony formation,
which could give us increased sensitivity and earlier de-
tection of unstained colonies. It has been reported that
indigoidine exhibits low-level toxicity to E. coli (Owen
et al. 2011). We did have a similar observation by com-
paring the growth pattern of IDG02 strain carrying plas-
mid pSFP03, which is capable of producing indigiodine,
with that of IDG02 strain carrying plasmid pUC19 as a
control (Fig. S4). Therefore, it is not surprising that the
blue colonies are relatively smaller than the white colo-
nies on the same plate under our screening conditions.
However, white colonies are the targeting ones which
might contain the correct recombinant plasmids, so the
slower growth of the blue colonies does not affect the
screening process.
As mentioned above, there are some drawbacks for
lacZα-based screening system. Our studies have shown
that our indigoidine-based screening system provides a
powerful alternative to lacZα-based screening system.
There are two components for lacZα-based screening sys-
tem: a vector containing lacZα with MCS and an E. coli
strain harboring the lacZΔM15 mutation (Sambrook et al.
2001). Similarly, there are two components for the
indigoidine-based screening system: a vector containing
sfp with MCS and an E. coli strain harboring the midgS
gene. Theoretically, all lacZα-based screening system can
be replaced by the indigoidine-based screening system,
just by substituting the lacZα in the vector with sfp, at
the same time using the idgS containing strain instead of
the lacZΔM15 containing strain. A detailed comparison
of the two screening systems was made in Table S2, and
Appl Microbiol Biotechnol (2017) 101:3811–3820
the major advantage of the indigoidine-based screening
system is that it does not need any external substrate or
inducer, which simplifies the screening process. Although
the indigoidine-based screening system developed in this
study was particularly focused on E. coli, given the al-
ready successful application of indigoidine-based reporter
in different hosts, the concept can easily be developed for
a wide range of species. However, the indigoidine-based
screening system might not be fit for bacteria containing
endogenous homologs of idgS or sfp due to the possible
interfere caused by their endogenous homologs.
As a proof of concept, we demonstrated the utility of the
new blue/white screening system by cloning the sfGFP
gene. Upon selection, transformants harboring inserts
displayed white phenotype and transformants containing
the empty or self-ligation vectors show blue phenotype.
Besides its usefulness as a part of the cloning system, the
recipient strain constructed in this study may also be
employed for other application. For example, it can be
used in the screening of PPTase-encoding genes and the
associated natural product clusters from metagenome li-
braries. Previously, such screening has been carried out
using reporter strain with BpsA expressed in trans on a
plasmid (Owen et al. 2012). When doing such screening,
the plasmid-free, markerless strain IDG02 provides not on-
ly a more stable genetic background but also a better
choice without the concerns of replicon incompatibility
and selection marker confliction.
Acknowledgements The study was funded in part by the Ministry of
Science and Technology of China (2015CB150600 and 2013CB734000)
and the National Natural Science Foundation of China (31400048 and
31522001). Y.C. is an awardee for the BHundred Talents Program^ of the
Chinese Academy of Sciences.
Compliance with ethical standards
Conflict of interest Yihua Chen and Zhoujie Xie have filed a patent
application related to this work.
Ethical approval This article does not contain any studies with human
participants or animals performed by any of the authors.
References
Banerjee S, Kumar J, Apte-Deshpande A, Padmanabhan S (2010) A
novel prokaryotic vector for identification and selection of
recombinants: direct use of the vector for expression studies
in E. coli. Microb Cell Factories 9:30. doi:10.1186/1475-
2859-9-30
Bernard P, Gabant P, Bahassi EM, Couturier M (1994) Positive-
selection vectors using the F plasmid ccdB killer gene. Gene
148(1):71–74
3819
Chaffin DO, Rubens CE (1998) Blue/white screening of recombinant
plasmids in gram-positive bacteria by interruption of alkaline phos-
phatase gene (phoZ) expression. Gene 219(1–2):91–99
Datsenko KA, Wanner BL (2000) One-step inactivation of chromo-
somal genes in Escherichia coli K-12 using PCR products.
Proc Natl Acad Sci U S A 97(12):6640–6645. doi:10.1073/
pnas.120163297
Engler C, Marillonnet S (2014) Golden gate cloning. Methods Mol Biol
1116:119–131. doi:10.1007/978-1-62703-764-8_9
Fang J, Zhang Y, Huang L, Jia X, Zhang Q, Zhang X, Tang G, Liu W
(2008) Cloning and characterization of the tetrocarcin A gene cluster
from Micromonospora chalcea NRRL 11289 reveals a highly con-
served strategy for tetronate biosynthesis in spirotetronate antibi-
otics. J Bacteriol 190(17):6014–6025. doi:10.1128/JB.00533-08
Gentz R, Bujard H (1985) Promoters recognized by Escherichia coli
RNA polymerase selected by function: highly efficient promoters
from bacteriophage T5. J Bacteriol 164(1):70–77
Hennecke H, Gunther I, Binder F (1982) A novel cloning vector for the
direct selection of recombinant DNA in E. coli. Gene 19(2):231–234
Heuermann K, Cosgrove J (2001) S-Gal: an autoclavable dye for color
selection of cloned DNA inserts. BioTechniques 30(5):1142–1147
Kuhn R, Starr MP, Kuhn DA, Bauer H, Knackmuss HJ (1965)
Indigoidine and other bacterial pigments related to 3,3′-bipyridyl.
Arch Mikrobiol 51:71–84
Langley KE, Villarejo MR, Fowler AV, Zamenhof PJ, Zabin I (1975)
Molecular basis of beta-galactosidase alpha-complementation.
Proc Natl Acad Sci U S A 72(4):1254–1257
Li P, Li J, Guo Z, Tang W, Han J, Meng X, Hao T, Zhu Y, Zhang L, Chen
Y (2015) An efficient blue/white screening based gene inactivation
system for Streptomyces. Appl Microbiol Biotechnol 99(4):1923–
1933. doi:10.1007/s00253-014-6369-0
Miyazaki K (2010) Lethal ccdB gene-based zero-background vector for
construction of shotgun libraries. J Biosci Bioeng 110(3):372–373.
doi:10.1016/j.jbiosc.2010.02.016
Muller M, Auslander S, Auslander D, Kemmer C, Fussenegger M (2012)
A novel reporter system for bacterial and mammalian cells based on
the non-ribosomal peptide indigoidine. Metab Eng 14(4):325–335.
doi:10.1016/j.ymben.2012.04.002
Myronovskyi M, Welle E, Fedorenko V, Luzhetskyy A (2011) Beta-
glucuronidase as a sensitive and versatile reporter in actinomycetes.
Appl Environ Microbiol 77(15):5370–5383. doi:10.1128/AEM.
00434-11
Nakanishi N, Oshida T, Yano S, Takeda K, Yamaguchi T, Ito Y
(1986) Construction and characterization of new cloning vec-
tors derived from Streptomyces griseobrunneus plasmid pBT1
and containing amikacin and sulfomycin resistance genes.
Plasmid 15(3):217–229
Owen JG, Copp JN, Ackerley DF (2011) Rapid and flexible biochemical
assays for evaluating 4′-phosphopantetheinyl transferase activity.
Biochem J 436(3):709–717. doi:10.1042/BJ20110321
Owen JG, Robins KJ, Parachin NS, Ackerley DF (2012) A functional
screen for recovery of 4′-phosphopantetheinyl transferase and asso-
ciated natural product biosynthesis genes from metagenome librar-
ies. Environ Microbiol 14(5):1198–1209. doi:10.1111/j.1462-2920.
2012.02699.x
Quadri LE, Weinreb PH, Lei M, Nakano MM, Zuber P, Walsh CT (1998)
Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl
transferase for peptidyl carrier protein domains in peptide synthe-
tases. Biochemistry 37(6):1585–1595. doi:10.1021/bi9719861
Reverchon S, Rouanet C, Expert D, Nasser W (2002) Characterization of
indigoidine biosynthetic genes in Erwinia chrysanthemi and role of
this blue pigment in pathogenicity. J Bacteriol 184(3):654–665
Salis HM, Mirsky EA, Voigt CA (2009) Automated design of synthetic
ribosome binding sites to control protein expression. Nat Biotechnol
27(10):946–950. doi:10.1038/nbt.1568
3820
Sambrook J, MacCallum P, Russell D (2001) Molecular cloning—a lab-
oratory manual (3rd ed.) Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY
St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE (2013)
One-step cloning and chromosomal integration of DNA. ACS Synth
Biol 2(9):537–541. doi:10.1021/sb400021j
Takahashi H, Kumagai T, Kitani K, Mori M, Matoba Y, Sugiyama
M (2007) Cloning and characterization of a Streptomyces sin-
gle module type non-ribosomal peptide synthetase catalyzing a
Appl Microbiol Biotechnol (2017) 101:3811–3820
blue pigment synthesis. J Biol Chem 282(12):9073–9081. doi:
10.1074/jbc.M611319200
Wong SS, Truong K (2010) Fluorescent protein-based methods for on-
plate screening of gene insertion. PLoS One 5(12):e14274. doi:10.
1371/journal.pone.0014274
Yanisch-Perron C, Vieira J, Messing J (1985) Improved M13 phage clon-
ing vectors and host strains: nucleotide sequences of the M13mp18
and pUC19 vectors. Gene 33(1):103-119