Experimental Parasitology 122 (2009) 47–50

Contents lists available at ScienceDirect

Experimental Parasitology
journal homepage: www.elsevier.com/locate/yexpr

Toxoplasma gondii: Sensitive and rapid detection of infection by loop-mediated

isothermal amplification (LAMP) method
Houshuang Zhang a, Oriel M.M. Thekisoe a, Gabriel O. Aboge a, Hisako Kyan b, Junya Yamagishi a,
Noboru Inoue a, Yoshifumi Nishikawa a, Satoshi Zakimi c, Xuenan Xuan a,*
a
National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido 080-8555, Japan
b
Okinawa Prefectual Meat Inspection Office, Ominami 1-13-11, Nago, Okinawa 905-0015, Japan
c
Okinawa Prefectural Institute of Animal Health, Kohagura 112, Naha, Okinawa 900-0024, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Loop-mediated isothermal amplification (LAMP) method amplifies DNA with high specificity, sensitivity
Received 12 October 2008 and rapidity. In this study, we used a conserved sequence in the 200- to 300-fold repetitive 529 bp gene
Received in revised form 20 December 2008 of Toxoplasma gondii to design primers for LAMP test. Detection limit of T. gondii LAMP assay with the
Accepted 26 January 2009
primers is 1 pg/lL of T. gondii DNA, which was evaluated using 10-fold serially diluted DNA of cultured
Available online 1 February 2009
parasites. Furthermore, LAMP and conventional PCR methods were applied for amplification of the T. gon-
dii DNA extracted from the lymph nodes taken from pigs which were suspected to be Toxoplasma infec-
Keywords:
tion. As a result, 76.9% (70/91) and 85.7% (78/91) of the samples were positive on PCR and LAMP analyzes,
Toxoplasma gondii
Loop-mediated isothermal amplification
respectively. Therefore, the LAMP has a potential to be applied as an alternative molecular diagnostic tool
(LAMP) for detection of T. gondii infection from veterinary samples. This is the first study, which applies the LAMP
529 bp gene method to diagnose Toxoplasma from veterinary samples.
Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction
Toxoplasma gondii is an obligate intracellular protozoan parasite
belonging to the phylum Apicomplexa, subclass Coccidia. Infection
by parasite can be acquired by eating raw meat containing tissue
cysts, or food and water contaminated by oocysts (Dubey, 2004).
The clinical manifestation is usually benign in immunocompetent
hosts, but can be life-threatening in an immunocompromised pa-
tients (Luft and Remington, 1985).
Diagnosis of toxoplasmosis can be achieved by a number of dif-
ferent methods. Serological methods like indirect fluorescent anti-
body test (IFAT) and enzyme-linked immunosorbent assays (ELISA)
are used to detect antibodies against T. gondii (Jannuzzi et al., 1981;
Mondesire et al., 1981). Immunohistochemical staining and poly-
merase chain reaction (PCR) methods are also used for specific
diagnosis of T. gondii infection (Dubey and Beattie, 1988). The mod-
ified agglutination test (MAT), immunochromatographic test (ICT)
and the real-time PCR have also been developed as diagnostic
methods for T. gondii infection (Huang et al., 2004; Edvinsson
et al., 2006; Mainar-Jaime and Barberán, 2007). Despite these ad-
vances, diagnosis of T. gondii infection remains unsatisfactory be-
cause serological methods cannot differentiate past and present
* Corresponding author. Fax: +81 155 49 5643.
E-mail address: gen@obihiro.ac.jp (X. Xuan).
infections, whilst PCR methods are limited by need for expensive
equipment.
A novel nucleic acid amplification method, loop-mediated iso-
thermal amplification (LAMP), which amplifies DNA with high
specificity, efficiency, simplicity and rapidity under isothermal
conditions has recently been developed (Notomi et al., 2000). Since
the advent of the LAMP, it has been developed for detection of
many viral, bacterial, protozoan and fungal diseases (Kuboki
et al., 2003; Maruyama et al., 2003; Endo et al., 2004; Okafuji
et al., 2005). Recently, this method of novel gene amplification
has been developed and used successfully for the diagnosis of par-
asitic infections, such as malaria, trypanosomiasis, theileriosis and
babesiosis (Poon et al., 2006; Alhassan et al., 2007a,b; Iseki et al.,
2007; Thekisoe et al., 2007a,b,c; Njiru et al., 2008). As a result,
LAMP has been reported to be a highly sensitive and specific meth-
od for the detection of parasitic infections. Moreover, LAMP is an
attractive diagnostic method in resource poor countries where
facilities are minimal as a rapid test, independent of specialized
heating equipments.
The 200- to 300-fold repetitive 529 bp fragment of T. gondii
have been utilized for the development of a very sensitive and spe-
cific PCR for diagnostic purposes, and in a quantitative competi-
tive-PCR for the evaluation of cyst numbers in the brains of
chronically infected mice (Homan et al., 2000; Edvinsson et al.,
2006). In this study, we used the conserved region in the 529 bp
gene to design LAMP primers, for sensitive and specific detection

0014-4894/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.exppara.2009.01.012
48 H. Zhang et al. / Experimental Parasitology 122 (2009) 47–50
of T. gondii. Furthermore, we evaluated the detection sensitivity of
T. gondii LAMP in comparison with the conventional PCR on swine
DNA samples.
2. Materials and methods
2.1. Parasite culture and DNA extraction
Parasites were cultured and purified as described previously
(Zhang et al., 2006). Briefly, T. gondii tachyzoites (RH strain) were
maintained in African green monkey kidney (Vero) cells cultured
in a minimum essential medium (MEM, Sigma, MO, USA) supple-
mented with 8% heat-inactivated fetal bovine serum (FBS) and
50 lg/ml kanamycin at 37 °C in a 5% CO2 air environment. For
the purification of T. gondii tachyzoites, parasites and host cell deb-
ris were washed in cold phosphate-buffered saline (PBS), and the
final pellet was resuspended in cold PBS and passed three times
through a 27-gauge needle syringe. The parasites were then fil-
tered through a 5.0 lm pore filter (Millipore, MA, USA), washed
twice with 10 ml of PBS, and pelleted at 1500 rpm for 10 min.
The purified parasites were resuspended in a DNA extraction buffer
and DNA was extracted with a Dneasy Tissue Kit (Qiagen, Mary-
land, USA) according to the manufacturer’s instructions.
2.2. Swine sample collection and DNA extraction
A total of 91 lymph node (mainly mesenteric) samples with
hemorrhagic or necrotic lesions suspected of toxoplasmosis were
obtained from 91 pigs at an abattoir on Okinawa Island in Japan
from 2003 to 2005 (Zakimi et al., 2006). Parasite DNA was ex-
tracted from the lymph node samples using a SepaGene kit (San-
kyo Junyaku, Tokyo, Japan) according to the manufacturer’s
protocol. The purified DNA was dissolved in 20 lL of double-dis-
tilled water (DDW) for subsequent LAMP and PCR reactions. Nega-
tive control DNA was extracted from the lymph node of a specific
pathogen-free pig.
2.3. PCR
A pair of oligonucleotide primer sequences TOX4 (50 -
CGCTGCAGGGAGGAAGACGAAAGTTG-30 ) and TOX5 (50 -CGCTGCAG
ACACAGTGCATCTGGATT-30 ) were selected to specifically amplify
T. gondii targeting the 529 bp DNA fragment (GenBank Accession
No. AF146527) as described previously (Homan et al., 2000).
Briefly, PCR was performed in 50 lL of a reaction mixture contain-
ing 2 lL of template DNA, 5 lL of a 10 PCR buffer, 5 lL of 2 mM
each of the four deoxynucleoside triphosphates (dNTP) mixture,
0.25 lL of 0.5 U AmpliTaq Gold Taq DNA polymerase (Applied Bio-
systems, NJ, USA), 2 lL each of 10 pmol primers and 33.75 lL
DDW. The amplification conditions consisted of initial denatur-
ation at 94 °C for 7 min, followed by 35 cycles of 94 °C for 1 min,
primer annealing at 55 °C for 1 min, extension at 72 °C for 1 min
and a final extension at 72 °C for 10 min. PCR products were elec-
trophoresed in a 1.5% agarose gel and stained with ethidium bro-
mide for visualization.
2.4. LAMP
Six oligonucleotide primers were used for the LAMP assay tar-
geting eight conserved regions within the sequence of 529 bp
DNA fragment of T. gondii. The outer forward primer (F3), outer
backward primer (B3), forward inner primer (FIP), backward inner
primer (BIP), loop forward (LF) and backward (LB) primers were
designed using PrimerExplorer V4 software (http://primerexplor-
er.jp/elamp4.0.0/index. html). All primer sequences are listed in
Table 1
Nucleotide sequences of LAMP primers designed in this study.
Primer Sequence (50 –30 )
F3 CCACAGAAGGGACAGAAGTC
B3 TCCGGTGTCTCTTTTTCCAC
FIP TCCTCACCCTCGCCTTCATCTAGGACTACAGACGCGATGC
BIP TGGTTGGGAAGCGACGAGAGTTCCAGGAAAAGCAGCCAAG
LF TCCAAGACGGCTGGAGGAG
LB CGGAGAGGGAGAAGATGTTTCC
Table 1. LAMP was carried out with the Loopamp DNA amplifica-
tion kit (Eiken Chemical Co. Ltd., Tokyo, Japan). In brief, the LAMP
reaction mixture (25 lL) contained 1 lL of template DNA, 40 pmol
each of FIP and BIP, 5 pmol each of F3 and B3, 20 pmol each of LF
and LB, 8 U of Bst DNA polymerase, 1.4 mM deoxynucleoside
triphosphates (dNTP), 2  reaction buffer (1.6 M betaine, 40 mM
Tris–HCl (pH 8.8), 20 mM KCl, 20 mM (NH4)2SO4, 16 mM MgSO4,
and 0.2% Tween 20). One microliter of fluorescent detection
reagent (Eiken Chemical Co. Ltd., Tokyo, Japan) was added in some
of the reactions and in such reactions the volume of DDW was
adjusted. The reaction mixture was incubated at 63 °C for 1 h in
a loopamp real-time turbidimeter (LA-200, Teramecs Co. Ltd.,
Kyoto, Japan).
2.5. Detection of LAMP product
The LAMP products were electrophoresed in an 1.5% agarose
gels stained with ethidium bromide solution (1 lg/ml) and visual-
ized under UV light. Visual inspection of the LAMP amplicons in the
reaction tube were performed by adding fluorescent detection re-
agent before the incubation of the reaction tubes, the fluorescent
signals of the solutions were observed under UV light.
2.6. Specificity and sensitivity of LAMP
The reaction temperature was optimized by conducting LAMP
reactions at different temperatures including 60, 63, 65 and 68 °C
to determine the temperature which gives fastest time for a posi-
tive reaction using loopamp real-time turbidimeter. The species
specificity of the T. gondii LAMP primers was determined by testing
them against DNA of Neospora caninum, Babesia gibsoni, B. bovis,
Cryptosporidium parvum, Trypanosoma brucei and Theileria parva.
The sensitivity of the assay was confirmed using genomic DNA,
which was diluted to contain an amount of DNA equivalent to a
range of 1–10,000 tachyzoites per LAMP and PCR reaction. Further-
more, detection sensitivity of LAMP in comparison to the conven-
tional PCR was determined using lymph node samples collected
from pigs.
3. Results and discussion
The optimal reaction temperature for the T. gondii LAMP assay
was found to be 63 °C as it gave faster threshold times (mean
20 min) for positive LAMP reactions using 1 ng/lL of T. gondii
DNA (Fig. 1). The results revealed that LAMP could further be
exploited for field test because the LAMP amplification can be per-
formed under isothermal conditions at 63 °C within 1 h using the
simple heating device such as a water bath or heat block (Notomi
et al., 2000).
To determine the specificity of T. gondii LAMP assay, reactions
were conducted for amplification of T. gondii DNA including non-
target DNA from other protozoan parasites including N. caninum,
B. gibsoni, B. bovis, C. parvum, T. brucei and T. parva. As a result, only
T. gondii DNA was amplified, whereas non-target DNA of other par-
asites was not amplified during the 60-min LAMP reaction as ex-
 H. Zhang et al. / Experimental Parasitology 122 (2009) 47–50 49

0.5 Table 2
T. gondii Comparison of the conventional PCR and loop-mediated isothermal amplification
0.4 (LAMP) for detection of T. gondii from veterinary samples collected from pigs.
N. caninum

0.3
B. gibsoni No. (%) with LAMP Total No. (%)
Turbidity

B. bovis
+ 
0.2 C. parvum
No. (%) with PCR + 70 (76.9) 0 (0) 70 (76.9)
T. brucei
 8 (8.8) 13 (14.3) 21 (23.1)
0.1 T. parva
Total No. (%) 78 (85.7) 13 (14.3) 91 (100)
0
16

24

28

48

60
0

8
12

20

32

36

40

44

52

56
-0.1
Time (min)
Fig. 1. Specificity of LAMP method. LAMP reaction was monitored for DNA
amplification of Toxoplasma gondii, Neospora caninum, Babesia gibsoni, B. bovis,
Cryptosporidium parvum, Trypanosoma brucei and Theileria parva by loopamp real-
time turbidimeter. The curve shows the amplification from T. gondii DNA, and no
reaction was observed from other species.
pected, whereby results were observed by loopamp real-time tur-
bidimeter (Fig. 1). The 529 bp fragment discriminated DNA of T.
gondii from those of other parasites (Echinococcus granulosis, Giar-
dia duodenalis, P. falciparum, Sarcocystis spp., Trichinella spiralis,
Trichomonas vaginalis and N. caninum) have been confirmed in pre-
vious study (Homan et al., 2000). Moreover, LAMP employs four
primers (F3, B3, FIP, and BIP) in the initial steps and two primers
(FIP and BIP) during the subsequent steps, thereby insuring high
specificity for target amplification (Notomi et al., 2000; Iwasaki
et al., 2003).
The genomic DNA of T. gondii tachyzoites was quantified from
1 ng down to 10 fg by 10-fold serial dilutions and used to evaluate
the sensitivity of T. gondii LAMP assay in comparison to the con-
ventional PCR method. As shown in Fig. 2A and B, the detection
limit of PCR and LAMP is 10 and 1 pg, respectively. One picogram
of DNA represents approximately one T. gondii tachyzoite. These
results indicated that the sensitivity of T. gondii LAMP assay is
slightly higher than that of the conventional PCR method for detec-
tion of T. gondii DNA from in vitro cultured tachyzoites and lymph
nodes of the field-infected pigs. The high sensitivity of LAMP is due
to six primers used in the reaction, which target eight distinct
internal regions on the target DNA and can detect DNA as few as
six copies (Nagamine et al., 2002). As shown in the results, the
amplification products of templates were detected after 20 min,
and 60 min amplification, which produced the best result when
monitored by loopamp real-time turbidimeter (Fig. 1). Moreover,
PCR with the 529 bp fragment has proved to be more sensitive than
that based on the 35-copy B1 gene (Homan et al., 2000; Edvinsson
et al., 2006), which is further to insure the sensitivity of LAMP as-
say. These findings are in agreement with previous reports that the
sensitivity of LAMP method is higher when compared to the con-
ventional PCR in detection of protozoan parasites such as Trypano-
soma spp., Theileria spp. and Babesia spp. (Thekisoe et al., 2005;
Alhassan et al., 2007a; Iseki et al., 2007).
The LAMP and conventional PCR assays were applied for detec-
tion of T. gondii DNA from veterinary samples collected from pigs,
the presence of the parasites had been determined by microscopic
examination of an acridine orange-stained stamp-smear sample
(59.3% were positive). The LAMP products were visualized under
UV light, the fluorescent signals of the solutions were observed
in the positive reactions without opening the tubes. For further
confirmation, the products were electrophoresed in an 1.5% aga-
rose gels stained with ethidium bromide solution and similar posi-
tive results were observed. Seventy out of 91 (76.9%) and 78/91
(85.7%) of the tested samples were positive by PCR and LAMP,
respectively (Table 2). All of the microscopically and PCR-positive
samples were also positive by LAMP. Once again LAMP showed
superior sensitivity than the conventional PCR for detection of T.
gondii infections from veterinary samples. An added advantage of
LAMP is that DNA amplification can be easily detected by visual
inspection of the turbidity or fluorescence of the reaction mixture,
or by loopamp real-time turbidimeter (Notomi et al., 2000; Mori
et al., 2001; Poon et al., 2006; Boehme et al., 2007). The visual
inspection does not only reduce the assay time, but also alleviate
the need for gel electrophoresis, and thus make the method adept
to field tests. These phenomena allow easy and rapid visual identi-
fication of amplified LAMP products, and enable LAMP to be ap-
plied as a rapid molecular diagnostic tool even in resource poor
countries.
In conclusion, the current results have demonstrated that the
LAMP method can be applied for detection of T. gondii parasites
for both in vitro cultured and field-infected samples. The experi-
ment protocol and the optimized conditions resulted in specific,
sensitive, rapid and easy detection of T. gondii DNA. Therefore,
LAMP method constitutes a powerful tool for the detection of T.
gondii infection, and further research for evaluation of the method
for the application to clinical diagnosis is required.

Acknowledgments

Fig. 2. Sensitivity of the LAMP and conventional PCR method. LAMP and PCR
methods were carried out using the extracted DNAs from parasites in the in vitro
culture. (A) PCR reaction with T. gondii DNA. (B) LAMP reaction with T. gondii DNA.
Lanes 1–7, 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg of DNA. Lane (M), 100 bp or
1 kbp DNA ladder.
This research was supported by a grant from The 21st Century
COE Program (A-1) and a Grant-in-Aid for Scientific Research, both
from the Ministry of Education, Culture, Sports, Science, and Tech-
nology of Japan.
50 H. Zhang et al. / Experimental Parasitology 122 (2009) 47–50

References Maruyama, F., Kenzaka, T., Yamaguchi, N., Tani, K., Nasu, M., 2003. Detection of
bacteria carrying the stx2 gene by in situ loop-mediated isothermal
amplification. Applied and Environmental Microbiology 69, 5023–5028.
Alhassan, A., Govind, Y., Tam, N.T., Thekisoe, O.M., Yokoyama, N., Inoue, N., Igarashi,
Mondesire, R.R., Charlton, D.E., Tizard, I.R., 1981. A standardized enzyme-linked
I., 2007a. Comparative evaluation of the sensitivity of LAMP, PCR and in vitro
immunosorbent assay (ELISA) for the detection of antibodies to Toxoplasma
culture methods for the diagnosis of equine piroplasmosis. Parasitology
gondii. Journal of Immunoassay 2, 45–57.
Research 100, 1165–1168.
Mori, Y., Nagamine, K., Tomita, N., Notori, T., 2001. Detection of loopmediated
Alhassan, A., Thekisoe, O.M., Yokoyama, N., Inoue, N., Motloang, M.Y., Mbati, P.A.,
isothermal amplification reaction by turbidity derived from magnesium
Yin, H., Katayama, Y., Anzai, T., Sugimoto, C., Igarashi, I., 2007b. Development of
pyrophosphate formation. Biochemical and Biophysical Research
loop-mediated isothermal amplification (LAMP) method for diagnosis of equine
Communications 289, 150–154.
piroplasmosis. Veterinary Parasitology 143, 155–160.
Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loopmediated
Boehme, C.C., Nabeta, P., Henastroza, G., Rubhana, R., Rahim, Z., Gerhardt, M., Sanga,
isothermal amplification using loop primers. Molecular and Cellular Probes 16,
E., Hoelscher, M., Notomi, T., Hase, T., Perkins, M.D., 2007. Operational feasibility
223–229.
of using loop-mediated isothermal amplification (LAMP) for the diagnosis of
Njiru, Z.K., Mikosza, A.S., Matovu, E., Enyaru, J.C., Ouma, J.O., Kibona, S.N., Thompson,
pulmonary TB in microscopy centres of developing countries. Journal of Clinical
R.C., Ndung’u, J.M., 2008. African trypanosomiasis: sensitive and rapid detection
Microbiology 45, 1936–1940.
of the sub-genus Trypanozoon by loop-mediated isothermal amplification
Dubey, J.P., 2004. Toxoplasmosis – a waterborne zoonosis. Veterinary Parasitology
(LAMP) of parasite DNA. International Journal for Parasitology 38, 589–599.
126, 57–72.
Notomi, T., Hiroto, O., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase,
Dubey, J.P., Beattie, C.P., 1988. Toxoplasmosis in Cattle. Toxoplasmosis of Animals
T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids
and Man. CRC Press, Boca Ratón. pp. 107–115.
Research 28, E63.
Edvinsson, B., Lappalainen, M., Evengård, B.ESCMID Study Group for Toxoplasmosis,
Okafuji, T., Yoshida, N., Fujino, M., Motegi, Y., Ihara, T., Ota, Y., Notomi, T., Nakayama,
2006. Real-time PCR targeting a 529-bp repeat element for diagnosis of
T., 2005. Rapid diagnostic method for detection of mumps virus genome by
toxoplasmosis. Clinical Microbiology and Infection 12, 131–136.
loop-mediated isothermal amplification. Journal of Clinical Microbiology 43,
Endo, S., Komori, T., Ricci, G., Sano, A., Yokoyama, K., Ohori, A., Kamei, K., Franco, M.,
1625–1631.
Miyaji, M., Nishimura, K., 2004. Detection of gp43 of Paracoccidioides brasiliensis
Poon, L.L., Wong, B.W., Ma, E.H., Chan, K.H., Chow, L.M., Abeyewickreme, W.,
by the loop-mediated isothermal amplification (LAMP) method. FEMS
Tangpukdee, N., Yuen, K.Y., Guan, Y., Looareesuwan, S., Peiris, J.S., 2006.
Microbiology Letters 234, 93–97.
Sensitive and inexpensive molecular test for falciparum malaria: detecting
Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren, H., 2000.
Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated
Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in
isothermal amplification. Clinical Chemistry 52, 303–306.
Toxoplasma gondii, and its use for diagnostic and quantitative PCR.
Thekisoe, O.M., Inoue, N., Kuboki, N., Tuntasuvan, D., Bunnoy, W., Borisutsuwan, S.,
International Journal for Parasitology 30, 69–75.
Igarashi, I., Sugimoto, C., 2005. Evaluation of loop-mediated isothermal
Huang, X., Xuan, X., Hirata, H., Yokoyama, N., Xu, L., Suzuki, N., Igarashi, I., 2004.
amplification (LAMP), PCR and parasitological tests for detection of
Rapid immunochromatographic test using recombinant SAG2 for detection of
Trypanosoma evansi in experimentally infected pigs. Veterinary Parasitology
antibodies against Toxoplasma gondii in cats. Journal of Clinical Microbiology 42,
130, 327–330.
351–353.
Thekisoe, O.M., Honda, T., Fujita, H., Battsetseg, B., Hatta, T., Fujisaki, K., Sugimoto,
Iseki, H., Alhassan, A., Ohta, N., Thekisoe, O.M., Yokoyama, N., Inoue, N., Nambota, A.,
C., Inoue, N., 2007a. A trypanosome species isolated from naturally infected
Yasuda, J., Igarashi, I., 2007. Development of a multiplex loop-mediated
Haemaphysalis hystricis ticks in Kagoshima Prefecture, Japan. Parasitology 134,
isothermal amplification (mLAMP) method for the simultaneous detection of
967–974.
bovine Babesia parasites. Journal of Microbiological Methods 71, 281–287.
Thekisoe, O.M., Kuboki, N., Nambota, A., Fujisaki, K., Sugimoto, C., Igarashi, I.,
Iwasaki, M., Yonekawa, T., Otsuka, K., Suzuki, W., Nagamine, K., Hase, T., Tatsumi, K.,
Yasuda, J., Inoue, N., 2007b. Species-specific loop-mediated isothermal
Horigome, T., Notomi, T., Kanda, H., 2003. Validation of the loop-mediated
amplification (LAMP) for diagnosis of trypanosomosis. Acta Tropica 102, 182–
isothermal amplification method for single nucleotide polymorphism
189.
genotyping with whole blood. Genome Letters 2, 119–126.
Thekisoe, O.M., Omolo, J.D., Swai, E.S., Hayashida, K., Zhang, J., Sugimoto, C.,
Jannuzzi, C., Canessa, A., Spandonari, M., Terragna, A., 1981. Evaluation of the dye test,
Inoue, N., 2007c. Preliminary application and evaluation of loop-mediated
IgM–IFAT, and ELISA for the diagnosis of toxoplasmic infection in pregnancy.
isothermal amplification (LAMP) for detection of bovine theileriosis and
International Journal of Biological Research in Pregnancy 2, 123–127.
trypanosomosis in Tanzania. Onderstepoort Journal of Veterinary Research
Kuboki, N., Inoue, N., Sakurai, T., Di Cello, F., Grab, D.J., Suzuki, H., Sugimoto, C.,
74, 339–342.
Igarashi, I., 2003. Loop-mediated isothermal amplification for detection of
Zakimi, S., Kyan, H., Oshiro, M., Sugimoto, C., Xuan, X., Fujisaki, K., 2006. Genetic
African trypanosomes. Journal of Clinical Microbiology 41, 5517–5524.
characterization of GRA6 genes from Toxoplasma gondii from pigs in Okinawa,
Luft, B.J., Remington, J.S., 1985. Toxoplasmosis of the central nervous system. In:
Japan. Journal of Veterinary Medical Science 68, 1105–1107.
Remington, J.S., Swartz, M.N. (Eds.), Current Clinical Topics in Infectious
Zhang, H., Compaore, K., Lee, E., Liao, M., Zhang, G., Sugimoto, C., Nishikawa, Y.,
Diseases. McGraw-Hill, New York, pp. 315–358.
Xuan, X., 2006. Apical membrane antigen 1 is a cross-reactive antigen between
Mainar-Jaime, R.C., Barberán, M., 2007. Evaluation of the diagnostic accuracy of the
Neospora caninum and Toxoplasma gondii, and the anti-NcAMA1 antibody
modified agglutination test (MAT) and an indirect ELISA for the detection of
inhibits host cell invasion by both parasites. Molecular and Biochemical
serum antibodies against Toxoplasma gondii in sheep through Bayesian
Parasitology 151, 205–212.
approaches. Veterinary Parasitology 148, 122–129.