Parasitol Res (2008) 103:1207–1211
DOI 10.1007/s00436-008-1117-y
ORIGINAL PAPER
Recombinant Cryptosporidium parvum p23 as a target
for the detection of Cryptosporidium-specific
antibody in calf sera
Parviz Shayan & Elahe Ebrahimzadeh &
Mohamad-Reaza Mokhber-Dezfouli & Sadegh Rahbari
Received: 17 March 2008 / Accepted: 12 June 2008 / Published online: 3 August 2008
# Springer-Verlag 2008
Abstract Cryptosporidium parvum is a widely distributed
coccidian parasite and causes enteric disease in humans and
animals. In addition to being a cause of life-threatening
disease in immunodeficient people, mostly AIDS patients,
C. parvum has been reported as a common serious primary
cause of outbreaks of diarrhea in newborn calves, especially
newborn ruminants (De Graaf et al. in Int J Parasitol
29:1269–1287, 1999). To obtain the recombinant P23
protein, we isolated the mRNA from oocyst of C. parvum
and amplified the cDNA of P23 gene by reverse transcrip-
tase PCR. Sequencing of cDNA showed 100% homology
to the known P23 sequences. The double strand P23-cDNA
was then cloned in pGEX-5X-2 expression vector. Western
blot analysis of recombinant P23 showed that it could be
recognized by the positive C. parvum serum. Since P23 is
an immunodominant surface glycoprotein expressed in the
early phase of infection (Jakobi and Petry in Microbes
Infect 8:2186–2194, 2006) and the immunogenic epitopes
are also found in the residual chain of amino acid sequence
of this glycoprotein, the recombinant P23 was used for the
screening of 437 serum samples collected from calves
(#264) and cattle (#173). The dot blot analysis showed that
from 264 calf and 173 cattle sera, 33% and 37% sera were
positive, respectively. Due to the simple handling and
equipment, dot blot analysis with P23 could be recom-
mended for calves screening against cryptosporidiosis.
P. Shayan (*) : E. Ebrahimzadeh : M.-R. Mokhber-Dezfouli :
S. Rahbari
Department of Parasitology, Faculty of Veterinary Medicine,
University of Tehran,
Tehran, Iran
e-mail: pshayan@ut.ac.ir
Introduction
Cryptosporidium parvum is a widely distributed coccidian
parasite that causes enteric disease in humans and animals.
In addition to being a cause of life-threatening disease in
immunodeficient people, mostly AIDS patients, C. parvum
has been reported as a common serious primary cause of
outbreaks of diarrhea, especially in newborn ruminants,
resulting in significant economic losses (De Graaf et al.
1999).The main clinical signs in newborn ruminants are
depression, anorexia, abdominal pain, diarrhea, weight loss,
retarded growth during the first weeks of life, and high
mortality rate (Fayer 1997). It is known that newborn and
young calves are more susceptible than adults (Wyatt
2000). The animals are mostly infected with C. parvum
between day 4 and the third week of age (Pohlenz et al.
1978). Since the immunoglobulins cannot be transmitted
through placenta, transmission of C. parvum-specific anti-
bodies through the colostrum is very important to protect
newborns (Tennant et al 1969; Weaver et al. 2000).
Therefore, determination of specific antibodies in serum
of dam could be helpful for the management of cryptospo-
ridiosis. For the identification of the C. parvum-specific
antibodies in sera and colostrum, many suitable antigens
such as CP15/P60 and P23 were applied (Reperant et al.
1994; Perryman et al. 1999; Wang et al. 2003). Perryman et
al. (1999) introduced the recombinant P23 as a suitable
antigen for vaccination, which induced the desirable
protective immunity through colostrum in calves (Perryman
et al. 1999). The aim of this study was to produce the
recombinant P23 and use it to determine the specific
antibodies against C. parvum in serum of calves and cows.
Due to the simple handling and equipment, dot blot
analysis was applied.
1208
Materials and methods
Collection serum samples
Blood samples from 264 calves and 173 cows were taken
from the jugular vein. The whole blood samples were
incubated at room temperature for 1 h and then centrifuged
at 1,000 ×g at 4°C for 20 min. The sera were collected and
stored at −20°C until use.
Collection of C. parvum oocysts and experimental infection
Oocysts of C. parvum obtained from naturally infected
calves were collected and purified as described by Lorenzo
et al. (1993). To confirm that the collected oocysts belong
to Cryptosporidium spp., DNA was extracted from oocysts
using DNA extraction kit (MBST, Tehran, Iran) and
amplified using two primers (F1 and R1) derived from
18S rRNA gene of Cryptosporidium spp. (Table 1). The
PCR product was amplified with C. parvum-specific
primers F2 and common primer R1 either directly or after
isolation and purification from the agarose gel using DNA
isolation from agarose gel kit (MBST). After characteriza-
tion, 5×106 C. parvum oocysts were inoculated orally in a
1-day old C. parvum seronegative calf. C. parvum oocysts
were then obtained from the feces of the experimentally
infected calf during 5 to 11 days post inoculation. The
isolated oocysts were treated in 10% sodium hypochlorite
and subsequently washed three times in distilled water and
stored at 4°C until use. Sera before and after inoculations
were collected from the calf, stored at −20°C and used as
negative and positive controls.
P23-cDNA cloning
Total RNA was isolated from oocyst by RNA isolation kit
(MBST). One microgram of total RNA was used for cDNA
synthesis. For cDNA synthesis, 2 μl M-MULV enzyme
(40 μM, Roche), 1 μl oligo d(T)15 primer (Roche), 1 μl
dNTP RNase free (20 μm, Gibco BRL), and 5 μl 5× buffer
Table 1 Primers used in this study were derived from P23 mRNA and pGEX-5X-2 sequences
Primer Accession no. Gene
F1 AF093489, AF093496, AF112575,
AF112574, AF093495, AF112573, Canis
R1 AF093489 18 S rRNA genes
F2 AF093489, AF093496, AF112575, 18 S rRNA genes
AF112574, AF093495, AF112573, Canis
F3 Y16243,VersionY16243,1 P23
R2 Y16243,VersionY16243,1 P23
F4 Amersham Biosciences pGEX-5X-2
R3 Amersham Biosciences pGEX-5X-2
Parasitol Res (2008) 103:1207–1211
in an end volume of 25 μl were used. The cDNA synthesis
was performed at 37°C for 1 h. Reverse transcriptase PCR
(RT-PCR) amplification of cDNA was performed using
primers derived from nucleotide 16 to 39 as sense primer
(F3) and from 340 to 357 (R2) of P23 mRNA sequences
(Table 1). The nucleotide sequences of BamHI restriction
site were added to the 5′ ends of primers (Table 1). After
sequencing of RT-PCR product, P23 double strand cDNA
was cloned in dephosphorylated pGEX-5X-2 using rapid
DNA ligation kit (Roche, Germany). The recombinant P23
cDNA-pGEX-5X-2 was then transferred to the competent
Escherichia coli BL21. The E. coli clones were separately
grown and the plasmids were isolated using Plasmid
Isolation Kit (MBST). The presence of insert DNA in
pGEX-5X-2 was controlled using primers F4 and R3 (F4
and R3 were derived from the flanking region of multi-
cloning site in vector) and the direction of P23 cDNA in
vector DNA was determined using primers F1 and R3
(Table 1).
SDS-PAGE and Western blot
C. parvum oocysts were lysed in PBS/PMSF (1 mM) buffer
by freeze and defreeze and sonication (amplitude 70%, 0.5
cycles, Dr. Hielscher GmbH, Germany). The debris was
removed by centrifugation at 12,000 ×g at 4°C for 20 min.
Supernatant was collected and used for SDS-PAGE and
Western blotting (Lorenzo et al. 1993). Recombinant P23
plasmid was extracted by Plasmid Isolation Kit (MBST)
and was sequenced. Ten microliters of overnight-grown
transfected E. coli was incubated in 100 ml LB medium
containing 1 mM IPTG and 100 μl ampicillin (100 mg/ml)
for 3 h under shaking condition. Recombinant P23 protein
was then extracted using Microspin GST purification
Module kit and FactorXa (Amersham, USA) according to
the manufacturer’s instruction. The oocyst lysate, the P23-
GST fusion protein, and recombinant P23 were separated in
12% SDS-PAGE. The protein bands were either stained
with Coomassie brilliant blue solution (0.1 g Coomassie
brilliant blue in 50% H2O/40% methanol/10% acetic acid)
Sequence Melting temperature (°C)
5′ aagctcgtagttggatttctg 3′ 60
5′ taaggaacaacctccaatctc 3′ 60
5′ catattactatttttttttttag 3′ 52
5′ acggatccaaatgggttgttcatcatcaaagc 3′ 82.5
5′ acggatcctaatttaggcatcagctg 3′ 76
5′ gcatggcctttgcagggctgg 3′ 70
5′ cgaaacgcgcgaggcagatc 3′ 66
Parasitol Res (2008) 103:1207–1211 1209

Fig. 1 a Western blot reaction

of Cryptosporidium-positive se- a b
rum with the lysates from in- 2 1 M 1 2 3 4 5 6
duced P23-pGEX-5X-2
transfected E. coli BL2 (lane 2) A
and purified recombinant P23
(lane 1). M is prestained marker.
b Dot blot reaction of test sera B
with P23 recombinant protein
(lower left dot) and antigen from 170
Newcastle virus (upper right 130
C
dot) as negative control. Column 100
5/rows D and H, and column 6/ 72 - D
rows D and H showed the GST-P23 +
positive and negative serum 55
reactions, respectively
40 E

P23 33
F

24 G

-
17 + H

or transferred to the nitrocellulose membrane using Semi-
Dry trans-Blot (BioRad, USA). To determine the immuno-
genic bands, free binding sites on the membrane were first
blocked with 3% bovine serum albumin in TBS buffer
(20 mM Tris base and 0.15 M NaCl in H2O) containing
0.05% Tween 20 for 1 h at 37°C; subsequently, the mem-
brane was incubated in a corresponding diluted positive
serum (dilution of positive serum in TBS containing 0.05%
Tween 20:1, 1:10, 1:100, 1:200, 1:500, 1:1,000, and
1:10,000) for 1 h at room temperature (RT). The membrane
was then washed three times with TBS containing 0.05%
Tween 20 for 5 min at RT. Horseradish-conjugated rabbit
anti-bovine Ig (Dako, Denmark) (1:1,000) were added to the
washed membrane and incubated for 1 h at RT. After
incubation, the membrane was washed three times as
described above. The positive reaction was developed using
DAB (Sigma, USA) as substrate under visual observation
within 5 min. In all experiments, serum from newborn calf
before first feeding with colostrum was used as negative
serum control. Optimized serum dilution (1:200) was then
selected for the test sera.
colostrum was used as negative serum. The dot blot
analysis was performed as described above for Western
blot analysis with the test sera.
Results and discussion
C. parvum is a coccidian parasite that infects epithelial
intestine cells of newborn and young calves causing mild to
severe diarrhea, abdominal cramp, dehydration, and weight
loss. The infected calves shed a large number of infective
oocysts, which serve as source of contamination. It is
known that immune cows can protect calves through
colostrum. The protective immunity could be achieved
using different antigens such as whole oocyst antigens
(Harp and Goff 1995), P23 (Shirafuji et al. 2005), rC7
(Perryman et al. 1999), and CP15/60 (Jenkins et al. 1999).
Table 2 Test sera were analyzed using P23 recombinant protein by
dot blot

Dot blot Animal Number No. of seropositives Scoring in %

+ ++ +++ + ++ +++
One microliter of recombinant P23 (0.15 μg/1 μl PBS) was
dotted on one corner of a 1×1 cm square nitrocellulose Calves 264 38 41 8 14.3 15.5 3
membrane. As negative control, purified Newcastle virus Cows 173 45 14 5 26 8 2.8
Sum 437 83 55 13 19 12.5 3
antigen (provided by the Department of Virology, Faculty
of Veterinary Medicine, University of Tehran) was used. Scoring of color intensity showed the antibody reaction in sera with
Serum from newborn calf before first feeding with P23 recombinant protein is given as plus marks
1210
Since P23 is expressed in early and late stages of infection
and can also induce protective immunity (Shirafuji et al.
2005; Perryman et al. 1999), it is considered as a suitable
candidate tool for diagnosis and protection. To obtain the
P23 protein, oocysts of Cryptosporidium spp. were isolated
from feces of an infected calf. The purified oocysts were
analyzed by PCR. The amplification of the oocyst DNA
resulted in a PCR product of 412 bp in length. Semi-nested
PCR with forward primer specific for C. parvum resulted in
the expected C. parvum species-specific PCR product of
354 bp in length and confirmed that oocysts in fact
represent C. parvum (data not shown). The 18S rRNA
gene was also used for specification of Cryptosporidium in
studies of Xiao et al. (1999) and Santin et al. (2004). SDS-
PAGE analysis of soluble proteins from oocysts showed
several bands between 10 and 100 kDa; within these bands,
a protein of 23 kDa was detectable and Western blot
analysis showed a positive reaction with the antigen (data
not shown). The analysis of the P23 PCR product revealed
a 100% homology to the p23 mRNAs published in
GenBank. Sequence similarity suggests that the P23 protein
belongs to the conserved proteins of C. parvum. Western
blot analysis of lysate from P23 recombinant pGEX-5X-2
transfected E. coli BL2 showed that the fusion protein GST-
P23 could be detected with the C. parvum-positive serum
(Fig. 1a). Purified recombinant P23 was also recognized
with C. parvum-positive serum. It can be concluded that
this protein is an important antigen which stimulates host
immunity resulting in the specific antibody production
under natural infection. Therefore, P23 was applied for the
antibody screening of test sera in dot blot. A total of 437
sera (264 new born calves and 173 cows) were tested. All
of the 286 samples corresponding to 67% and 63% of the
sera obtained from calves and cows, respectively, were
negative (Table 2, Fig. 1b). Since the collected sera were
from the industrial cattle husbandry, our results serve as a
representative estimate of distribution of cryptosporidial
infection in newborn calves in Iran. In the present study,
seroprevalence of 37% in calves and 33% in cows showed
immunological interaction with the selected cryptosporidial
antigen. Interestingly the majority of the cow and calf sera
showed a low antibody reaction with P23, although P23
belong to the proteins which express in the early and late
stage of infection (Jakobi and Petry 2006). Our results
demonstrate a high risk of cryptosporidial infection in new-
born calves. The successful animal health management
requires knowledge of epidemiology and suitable equipment
employed for rapid and simple diagnosis. There are a lot of
works which confirm the use of recombinant proteins as
vaccines against causative agents of human and animal
diseases. Perrymann et al. (1999) used recombinant P23 for
immunizing pregnant cows to protect the calves against
cryptosporidiosis with immune bovine colostrum. Takashima
Parasitol Res (2008) 103:1207–1211
et al. (2003) have also emphasized the C. parvum P23 as a
potential vaccine for prevention.
In the present study, we demonstrated a new, easy and
rapid diagnostic tool for the analysis of cryptosporidial
infection, which may help to investigate the epidemiolog-
ical status of herds. Since it is not clear that the
seroreactivity of naturally infected cows against P23 and
protection are in fact correlated, it remains to be investi-
gated whether seropositivity, clinical, and parasitological
status of animals are interrelated.
Acknowledgements We thank the Iran National Science Foundation
for financial support of grant no. 84112/31 and Investigating Unit
“Molecular Biological System Transfer” (MBST) for technical
supports. We also thank Narges Amini for technical assistance.
References
De Graaf DC, Vanopdenbosch E, Ortega-Mora LM, Abbassi H,
Peeters JE (1999) A review of the importance of cryptosporid-
iosis in farm animals. Int J Parasitol 29:1269–1287
Fayer R (1997) Cryptosporidium and cryptosporidiosis. CRC,
NewYork
Harp JA, Goff JP (1995) Protection of calves with a vaccine against
Cryptosporidium parvum. J Parasitol 81(1):54–57
Jakobi V, Petry F (2006) Differential expression of Cryptosporidium
parvum genes encoding sporozoite surface antigens in infected
HCT-8 host cells. Microbes Infect 8:2186–2194
Jenkins MC, Fayer R, Tiley M, Upton SJ (1999) Cloning and
expression of a cDNA encoding epitopes shared by 15- and 60-
kilodalton proteins of Cryptosporidium parvum sporozoites.
Infect Immunol 61(6):2377–2382
Lorenzo MJ, Ares-Mazas E, villacorta Martinez de Maturana I (1993)
Detection of oocysts and IgG antibodies to Cryptosporidium
parvum in asymptomatic adult cattle. Vet Parasitol 47:9–15
Perryman LE, Kapil SJ, Jones ML, Hunt EL (1999) Protection of
calves against cryptosporidiosis with immune bovine colostrum
induced by a Cryptosporidium parvum recombinant protein.
Vaccine 17(17):2142–2149
Pohlenz J, Moon HW, Cheville NF, Bemrick WJ (1978) Cryptospo-
ridiosis as a probable factor in neonatal diarrhea of calves. J Am
Vet Med Ass 172:452–457
Reperant JM, Naciri M, Iochmann S, Tilley M, Bout DT (1994) Major
antigens of Cryptosporidium parvum recognized by serum
antibodies from different infected animal species and man. Vet
Parasitol 55:1–13
Santin M, Trout JM, Xiao L, Zhou L, Greiner E, Fayer R (2004)
Prevalence and age-related variation of Cryptosporidium species
and genotypes in dairy calves. Vet Parasitol 122:103–117
Shirafuji H, Xuan X, Kimata I, Takashima Y, Fukumoto S, Otsuka H,
Nagasawa H, Suzuki H (2005) Expression of p23 Cryptosporid-
ium parvum in Toxoplasma gondii and evaluation of its
protective effects. J Parasitol 91(2):476–479
Takashima Y, Xuan X, Kimata I, Iseki M, Kodama Y, Nagane N,
Nagasawa H, Matsumoto Y, Mikami T, Otsuka H (2003)
Recombinant bovine herpesvirus-1 expressing p23 protein of
Cryptosporidium parvum induces neutralizing antibodies in
rabbits. J Parasitol 89(2):276–282
Tennant B, Harrold D, Reina-Guerra M, Laben RC (1969) Neonatal
alterations in serum gamma globulin levels of Jersey and
Holstein–Friesian calves. Am J Vet Res 30:345–354
Parasitol Res (2008) 103:1207–1211
Wang HF, Swain JB, Besser TE, Jasmer D, Wyatt C (2003) Detection
of antibodies to a recombinant Cryptosporidium parvum P23 in
serum and feces from neonatal calves. Parasitol 89(5):918–923
Weaver DM, Tyler JW, Van Metre DC, Hostetler DE, Barrington GM
(2000) Passive transfer of colostral immunoglobulins in calves. J
Vet Internal Med 14:569–577
1211
Wyatt CR (2000) Cryptosporidium parvum and mucosal immunity in
neonatal calves. Anim Health Res Rev 1:25–34
Xiao L, Escalante L, Yang C, Sulaiman I, Escalante AA, Montali RJ,
Fayer R, Lal AA (1999) Phylogenic analysis of Cryptosporidium
parasites based on the small-subunit rRNA gene locus. Appl
Environ Microbial 65:1578–1583