Multiple TLRs Are Expressed in Human

Cholangiocytes and Mediate Host Epithelial

This information is current as
of June 9, 2017.
Defense Responses to Cryptosporidium
parvum via Activation of NF-κB
Xian-Ming Chen, Steven P. O'Hara, Jeremy B. Nelson,
Patrick L. Splinter, Aaron J. Small, Pamela S. Tietz, Andrew
H. Limper and Nicholas F. LaRusso
J Immunol 2005; 175:7447-7456; ;
doi: 10.4049/jimmunol.175.11.7447
http://www.jimmunol.org/content/175/11/7447

Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017

References This article cites 58 articles, 36 of which you can access for free at:
http://www.jimmunol.org/content/175/11/7447.full#ref-list-1
Subscription Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Permissions Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Email Alerts Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by

The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
 The Journal of Immunology

Multiple TLRs Are Expressed in Human Cholangiocytes and

Mediate Host Epithelial Defense Responses to Cryptosporidium
parvum via Activation of NF-␬B1

Xian-Ming Chen,* Steven P. O’Hara,* Jeremy B. Nelson,* Patrick L. Splinter,*

Aaron J. Small,* Pamela S. Tietz,* Andrew H. Limper,† and Nicholas F. LaRusso2*
Infection of epithelial cells by Cryptosporidium parvum triggers a variety of host-cell innate and adaptive immune responses
including release of cytokines/chemokines and up-regulation of antimicrobial peptides. The mechanisms that trigger these host-cell
responses are unclear. Thus, we evaluated the role of TLRs in host-cell responses during C. parvum infection of cultured human
biliary epithelia (i.e., cholangiocytes). We found that normal human cholangiocytes express all known TLRs. C. parvum infection
of cultured cholangiocytes induces the selective recruitment of TLR2 and TLR4 to the infection sites. Activation of several
downstream effectors of TLRs including IL-1R-associated kinase, p-38, and NF-␬B was detected in infected cells. Transfection of

Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017

cholangiocytes with dominant-negative mutants of TLR2 and TLR4, as well as the adaptor molecule myeloid differentiation
protein 88 (MyD88), inhibited C. parvum-induced activation of IL-1R-associated kinase, p-38, and NF-␬B. Short-interfering RNA
to TLR2, TLR4, and MyD88 also blocked C. parvum-induced NF-␬B activation. Moreover, C. parvum selectively up-regulated
human ␤-defensin-2 in directly infected cells, and inhibition of TLR2 and TLR4 signals or NF-␬B activation were each associated
with a reduction of C. parvum-induced human ␤-defensin-2 expression. A significantly higher number of parasites were detected
in cells transfected with a MyD88 dominant-negative mutant than in the control cells at 48 –96 h after initial exposure to parasites,
suggesting MyD88-deficient cells were more susceptible to infection. These findings demonstrate that cholangiocytes express a
variety of TLRs, and suggest that TLR2 and TLR4 mediate cholangiocyte defense responses to C. parvum via activation of
NF-␬B. The Journal of Immunology, 2005, 175: 7447–7456.

C ryptosporidium parvum, an intracellular parasite within
the protist phylum Apicomplexa, is one of the most com-
monly reported enteric pathogens in both immunocom-
petent and immunocompromised individuals worldwide (1). The
parasite infects gastrointestinal epithelia to produce diarrhea that is
self-limited in immunocompetent subjects but potentially life-
threatening in immunocompromised individuals, primarily those
with AIDS (2). Infection by this parasite accounts for ⬃6% of all
diarrheal disease in immunocompetent individuals and occurs in
⬃24% of AIDS patients with diarrhea worldwide (3). C. parvum is
also the single most common identifiable pathogen in the biliary
tract in patients with AIDS-cholangiopathy, an important biliary
disorder caused by opportunistic infection of the biliary epithelium
and resulting in significant morbidity and mortality in AIDS pa-
tients (4). Despite the magnitude and severity of C. parvum-in-
duced infection, the pathogenesis is poorly understood, and there is
currently no fully effective therapy (5–7).
The proportion of exposed individuals developing cryptospori-
diosis reflects both parasite infectivity and host immune responses.
Whereas both innate and adaptive immunity are involved in the
*The Center for Basic Research in Digestive Diseases, Division of Gastroenterology
and Hepatology and †Division of Pulmonary and Critical Care Medicine, Mayo Clinic
College of Medicine, Rochester, MN 55905
Received for publication April 28, 2005. Accepted for publication September 9, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grants DK57993 and
DK24031 (to N.F.L.), HL062150 (to A.H.L.), and by the Mayo Foundation.
2 3
Address correspondence and reprint requests to Dr. Nicholas F. LaRusso, Center for
Basic Research in Digestive Diseases, Mayo Clinic, 200 First Street, Southwest,
Rochester, Minnesota 55905. E-mail address: larusso.nicholas@mayo.edu
resolution of cryptosporidiosis and resistance to infection (8), the
mechanisms by which host epithelial cells elicit immune responses
are not well understood. Specific attachment to the apical epithelial
cell surface by C. parvum sporozoites, as well as parasite mole-
cules inserted into epithelia after its attachment (9, 10), appear to
activate host-cell secondary signal pathways and thereby alter cell
function (10 –12). The invasion of epithelial cells in vitro by C.
parvum results in the rapid expression of anti-microbial peptides
(e.g., ␤-defensins) and the inflammatory chemokines including
IL-8, TNF-␣, and prostaglandin E2, etc. (12–14). We previously
reported that one intracellular signal pathway activated by C. par-
vum and associated with the cytokine/chemokine release in in-
fected biliary epithelial cells (i.e., cholangiocytes) is the NF-␬B
signal pathway (12). Moreover, we showed that activation of
NF-␬B accounts for the antiapoptotic activation in C. parvum di-
rectly infected cholangiocytes and thus benefits parasite propaga-
tion (12). How C. parvum activates such host-cell intracellular
signaling pathways such as NF-␬B and mediates host-cell inflam-
matory and immune responses is still unclear.
TLRs are an evolutionarily conserved family of cell surface
molecules, which are key to innate immunity by detecting invading
pathogens (15). Most of the known TLRs, upon recognition of
discrete pathogen-associated molecular patterns, activate a com-
mon set of adaptor proteins, such as myeloid differentiation protein
88 (MyD88), and protein kinases including IL-1 receptor-associ-
ated kinase (IRAK).3 IRAK, in turn, activates downstream effec-
tors including p-38, ERK1/2, JNK, and I␬B kinases (16). Activa-
tion of the kinases leads to the nuclear translocation of
Abbreviations used in this paper: IRAK, IL-1R-associated kinase; HBD, human
␤-defensin; siRNA, short-interfering RNA; DN, dominant negative; DAPI, 4⬘, 6-dia-
midino-2-phenylindole; MBP, myelin basic protein.

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00

7448 TLRs IN C. parvum INFECTION

corresponding nuclear transcription factors, such as AP-1 and NF-
␬B, and thus regulates host-cell responses to pathogens (15, 16).
One important host epithelial defense response upon microbial in-
fection is the production of a variety of small cationic anti-
microbial peptides including ␤-defensins (17). Six human ␤-de-
fensins (HBDs) have been identified and cloned in human
epithelial cells. HBD-2 and -4 are identical and HBD-5 and -6 are
primarily expressed in the epididymis (17, 18). The induction of
HBD-2 transcription by IL-1 is dependent on a specific NF-␬B
binding site (⫺205 to ⫺186) and its interaction with p-65-p50
NF-␬B heterodimer (17, 19, 20). Whereas regulation of HBD ex-
pression has been well documented in epithelial cells upon micro-
bial infection (17, 21–22), the role of TLRs in this process has not
been fully explored. Moreover, expression and functions of TLRs
in the liver, particularly in cholangiocytes, which are the target
epithelial cells of a group of clinically important diseases, some of
which are of infectious nature, have not been characterized.
In the present study, we explored the role of TLR signals in
cholangiocyte responses to C. parvum infection. We found that
normal human cholangiocytes express all known TLRs. Whereas
liver harvested for transplant and have been extensively characterized (24).
For experiments, H69 cells were used between passage 23 and 30 and
maintained for three passages without coculture cells to ensure that the
culture was free of 3T3 fibroblasts.
In vitro models and infection assay
Infection with C. parvum was done in a culture medium consisting of
DMEM-F12, 100 U/ml penicillin, and 100 ␮g/ml streptomycin (Invitrogen
Life Technologies), and freshly excysted C. parvum sporozoites (1 ⫻ 106
sporozoites/per slide well or culture plate). Inactivated organisms (treated
at 65°C for 30 min) were used for sham infection controls. An attachment
model and an attachment/invasion model were used to assay the attachment
and invasion of C. parvum as described previously (23). Infection assays
(attachment rate or attachment/invasion rate) were conducted after incu-
bation for 2 h with the parasite using an indirect immunofluorescent tech-
nique as described previously (23). For the inhibitory experiments, two
selective inhibitors of NF-␬B, MG-132 and SN50 (25), were added in the
medium at the same time as C. parvum. A concentration of 1 ␮M MG-132
or 50 ␮g/ml SN50, which showed no cytotoxic effects on H69 cells or on
C. parvum sporozoites, was selected for the study. For the experiments to
test whether TLRs and TLR-associated signals are involved in cholangio-
cyte defense responses against C. parvum infection, cells in T25 flasks
were incubated with an equal number of C. parvum sporozoites (5 ⫻ 106)

Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017

C. parvum attachment to and invasion of cultured cholangiocytes
appear not to be dependent on host-cell TLRs, C. parvum infection
of cholangiocytes induces the recruitment of TLR2 and TLR4 to
the infection sites, resulting in activation of IRAK and phosphor-
ylation of p-38. Moreover, activation of NF-␬B by C. parvum in
directly infected cells is dependent on both TLR2 and TLR4 sig-
nals. In addition, a TLR2- and TLR4-dependent and NF-␬B-asso-
ciated induction of HBD-2, but not HBD-1 and HBD-3, occurs in
cells infected with C. parvum, whereas MyD88-deficient cells are
more susceptible to C. parvum infection in vitro. These findings
demonstrate that cholangiocytes express a variety of TLRs, and
TLR2 and TLR4 signals mediate cholangiocyte responses to C.
parvum via activation of NF-␬B, implicating an important role of
TLRs in cholangiocyte defense responses to microbial infection in
the biliary tree.
Materials and Methods
C. parvum and H69 cells
C. parvum oocysts of the Iowa strain were purchased from a commercial
source (Bunch Grass Farms). Before infecting cells, oocysts were excysted
to release infective sporozoites as described previously (23). H69 cells (a
gift from Dr. D. Jefferson, Tufts University, Boston, MA) are SV40-trans-
formed human bile duct epithelial cells originally derived from a normal
for 2 h, washed with culture medium to remove nonattached and nonin-
ternalized parasites, and were then further cultured for up to 96 h, followed
by PCR analysis for C. parvum.
RT-PCR
Total cellular RNA was extracted from the cells using Tri-Reagent (Sigma-
Aldrich). Total RNA (5 ␮g) was reverse transcribed to cDNA by using a
Moloney Murine Leukemia Virus Reverse Transcriptase Kit (Invitrogen
Life Technologies). After reverse transcription, cDNA was amplified using
PCR with gene-specific primers designed to amplify a portion of the coding
sequences (Table I). The PCR consisted of one cycle of 10-min denatur-
ation at 94°C; 18 –35 cycles of 1 min at 94°C, 1 min at 48 –55°C, and 1 min
at 72°C, and a final extension step at 72°C for 10 min. rRNA (18s) was also
amplified to confirm that an equal amount of total cDNA was used for each
sample, and all experiments were done in duplicate. Template cDNA pre-
pared from TIB-202, a normal human monocyte cell line that expresses all
known TLRs except TLR3 (15, 26), was used as positive control for TLR
mRNA detection in H69 cells. Sequencing was performed on all positive
PCR products (Mayo Molecular Core Facility, Rochester, MN) to confirm
the identity of amplified genes. To quantitatively measure C. parvum in-
fection in H69 cells, a quantitative RT-PCR approach using a LightCycler
(Roche Diagnostic Systems) was established by modification of a previous
report (27). Briefly, total RNA was harvested from the cells after exposure
to C. parvum and reverse transcribed to cDNA and amplified using Am-
plitag Gold PCR Master Mix (Roche Diagnostic Systems). Primers specific
for C. parvum 18s ribosomal RNA (Table I) were used to amplify the
cDNA specific to the parasite. Primers specific for human plus C. parvum

Table I. Primer sequences

Primers

Target mRNA Forward Reverse

TLR1 5⬘-AAACGGTCTCATCCACGTTC-3⬘ 5⬘-GAGCAATTGGCAGCACACTA-3⬘

TLR2 5⬘-GATGCCTACTGGGTGGAGAA-3⬘ 5⬘-CGCAGCTCTCAGATTTACCC-3⬘
TLR3 5⬘-CTTGACCTGGGCCTTAATGA-3⬘ 5⬘-TTTCCAGAGCCGTGCTAAGT-3⬘
TLR4 5⬘-CAACAAAGGTGGGAATGCTT-3⬘ 5⬘-TGCCATTGAAAGCAACTCTG-3⬘
TLR5 5⬘-TGCATCCAGATGCTTTTCAG-3⬘ 5⬘-CCAGCCATTTCCAGAAACAT-3⬘
TLR6 5⬘-TTCCAGAGCTGCCAGAAGAT-3⬘ 5⬘-GAGATACCAGGGCAGATCCA-3⬘
TLR7 5⬘-CCACAACCAACTGACCACTG-3⬘ 5⬘-GATCACACTTTGGCCCTTGT-3⬘
TLR8 5⬘-TGAAGCACATCCCAAATGAA-3⬘ 5⬘-TCAAAGGGGTTTCCGTGTAG-3⬘
TLR9 5⬘-GGACACTCCCAGCTCTGAAG-3⬘ 5⬘-TTGGCTGTGGATGTTGTTGT-3⬘
TLR10 5⬘-GGCACAGGGTTAGGAAAACA-3⬘ 5⬘-GAGATTGTGGTGGGCAAAGT-3⬘
MD-2 5⬘-AGGGGCACGAGGTAAATCTT-3⬘ 5⬘-AACTTCTTTGCGCTTTGGAA-3⬘
Myd88 5⬘-ACAGCTCCCAGGAACAGCTA-3⬘ 5⬘-CACCTAAGACCATGGCACCT-3⬘
IL-8 5⬘-GCCAAGAGAATATCCGAACT-3⬘ 5⬘-AAAGTGCAACCACATGTCCT-3⬘
HBD-1 5⬘-CATGAGAACTTCCTACCTTCTG-3⬘ 5⬘-GCTCACTTGCAGCACTTGGCC-3⬘
HBD-2 5⬘-GACTCAGCTCCTGGTGAAGC-3⬘ 5⬘-GAGACCACAGGTGCCAATTT-3⬘
HBD-3 5⬘-CCAGGTCATGGAGGAATCAT-3⬘ 5⬘-TCTTTCTTCGGCAGCATTTT-3⬘
C. parvum ⫺18s 5⬘-TAGAGATTGGAGGTTGTTCCT-3⬘ 5⬘-CTCCACCAACTAAGAACGGCC-3⬘
The Journal of Immunology
18s (28) were used to determine total 18s cDNA. Data were expressed as
copies of C. parvum 18s vs total 18s.
Plasmid constructs and short-interfering RNA (siRNA)
H69 cells stably transfected with constructs of TLR2-DN (dominant neg-
ative), TLR4-DN, and MyD88-DN were obtained by transfecting cells with
the constructs followed by antibiotic selection. Cells were plated at 50 –
80% confluency and transfected with the plasmid DNA using the Lipo-
fectamine Plus reagent kit (Invitrogen Life Technologies) according to the
manufacturer’s instructions. TLR2-DN and TLR4-DN are kinase-inactive
(DN) mutants of TLR2 and TLR4, respectively, and were kindly provided
by Dr. M. F. Smith (University of Virginia, Charlottesville, VA).
MyD88-DN is a DN mutant of MyD88 and was a gift from Prof. J.
Tschopp (University of Lausanne, Lausanne, Switzerland). Stable-trans-
fected clones were selected by adding Zeocin (600 ␮g/ml) (Invitrogen Life
Technologies) to the culture medium. Selected transfected cells were cul-
tured with Zeocin in the medium and then grown on 4-well chamber slides
or T25 flasks for the experiments.
Specific siRNAs to TLR2, TLR4, and MyD88, which target human
TLR2, TLR4, and MyD88 mRNA sequences were designed. For siRNA
transfection, H69 cells were grown to 40 – 60% confluency on 10-mm
dishes and were transfected with the siRNAs using the siPORT lipid trans-
fection agent (Ambion). siRNAs that showed the most inhibition of TLR2,
TLR4, or MyD88 protein expression were selected with approaches we
previously reported (28) and used in this study as follows: TLR2, AATAT
TCGTGTGCTGGATAAGCCTGTCTC (sense) and AACTTATCCAGC
ACACGAATACCTGTCTC (antisense); TLR4, AACTGCTGCTTCAAG
ATATACCCTGTCTC (sense) and AAGTATATCTTGAAGCAGCAGC
CTGTCTC (antisense); and MyD88, AACTGCTGCTTCAAGATATA
CCCTGTCTC (sense) and AAGTATATCTTGAAGCAGCAGCCTGTC
TC (antisense). These siRNA oligonucleotides were determined to have no
significant overlap with homologous gene sequences. Nonspecific siRNAs
containing the same nucleotides but in irregular sequence (i.e., scrambled
siRNAs) were used as the controls. The siRNAs were further labeled with
Cy3 using the Silencer siRNA labeling kit (Ambion) for the identification
of transfected cells by confocal microscopy.
Immunohistochemistry and immunofluorescent microscopy
For immunohistochemistry, paraffin-embedded normal human liver tissue
samples (Institutional Review Board no. 725-00) were used for TLRs im-
munohistochemistry. Tissue sections of 5 ␮m were deparaffinized in xy-
lene and rehydrated in ethanol followed by water and PBS. Endogenous
peroxidase was blocked by immersion in 3% hydrogen peroxide. The tissue
sections were then incubated with TLR Abs at a concentration of 5 ␮g/ml
for 1 h at room temperature. Seven TLR Abs currently available and spe-
cific for TLR2–9 were obtained and used in the study (Imgenex). Control
sections were incubated with PBS containing normal goat serum without a
primary Ab. Immunostaining was then detected with the Vectastain per-
oxidase kit (Vector Laboratories) and developed with diaminobenzidine
tetrahydrochloride. The sections were counterstained with hematoxylin fol-
lowed by light microscopy.
For immunofluorescent microscopy, H69 cells were exposed to C. par-
vum sporozoites as described above. After 2 h of incubation, cells were
fixed (0.1 mol/L 1,4-piperazinediethanesulfonic acid (pH 6.95), 1 mmol/L
EGTA, 3 mmol/L magnesium sulfate (Sigma-Aldrich), and 2% parafor-
maldehyde) at 37°C for 20 min and then permeabilized with 0.2% (v/v)
Triton X-100 in PBS. For double-immunofluorescent labeling, fixed cells
were incubated with primary mAbs to associated proteins mixed with a
polyclonal Ab against C. parvum sporozoite membrane proteins followed
by rhodamine-labeled anti-mouse and fluorescein-labeled anti-rabbit Abs
(Molecular Probes). Some cells were incubated with polyclonal Abs to
associated proteins mixed with a mAb against C. parvum (2H2; Immu-
nuCell) followed by rhodamine-labeled anti-rabbit and fluorescein-labeled
anti-mouse Abs. In some experiments, 4⬘,6-diamidino-2-phenylindole
(DAPI; 5 ␮M) was used to stain cell nuclei. Labeled cells were rinsed three
times with PBS and once with distilled water, then mounted with mounting
medium (H-1000; Vector Laboratories), and assessed by confocal laser
scanning microscopy. Images obtained from the Zeiss 510 confocal mi-
croscope (Zeiss) were manipulated uniformly for contrast and intensity
using the Adobe (Adobe Systems) Photoshop software.
Immunoprecipitation and activity of IRAK
H69 cells were grown in 10-cm dishes to 95% confluence and exposed to
C. parvum sporozoites at 37°C for 2 h. Cells were then rinsed with PBS and
scraped into 1 ml of cold lysis buffer (50 mM Tris-HCl (pH 8.0), 150 mM
NaCl, 1% Nonidet P-40, 0.5% deoxycholic acid, and 0.1% SDS) supple-
mented with 1 mM PMSF, leupeptin and pepstatin at 20 ␮g/ml, and ty-
7449
rosine phosphatase inhibitors, sodium orthovanadate and sodium fluoride
at 1 mM. The cell lysates were centrifuged at 13,000 ⫻ g for 10 min and
were assayed for protein concentration using the Bradford reagent (Sigma-
Aldrich). The cell lysates (1 mg of protein) were then incubated with 1 ␮g
of anti-IRAK (Upstate Biotechnology) for 2 h at 4°C. Fifty microliters of
10% protein A-Sepharose (Sigma-Aldrich) was then added and incubated
for an additional 2 h at 4°C. The beads were then washed once with lysis
buffer and twice with kinase buffer (10 mM HEPES (pH 7.6), 20 mM
MgCl2, 20 mM ␤-glycerophosphate, 20 mM p-nitrophenyl phosphate, 1
mM EDTA, and 1 mM benzamidine). The beads were incubated for 30 min
at 30°C in a final volume of 20 ␮l in the presence of 2 ␮g of myelin basic
protein (MBP) (Sigma-Aldrich), 100 ␮M ATP, and 5 ␮Ci of [␥-32P]ATP
(DuPont NEN Research Products). SDS sample buffer was added to protein
A beads and boiled for 5 min, and then subjected to SDS-PAGE analysis.
The gels were dried, and the intensity of the radioactive signal was quan-
tified using the Molecular Analyst software (Bio-Rad).
Western blotting
H69 cells were grown in T25 flasks to 95% confluence and exposed to C.
parvum sporozoites. Cells were then lysed with the M-PER mammalian
protein extraction reagent (Pierce), and protein concentrations were deter-
mined using Bradford reagent according to the instructions of the supplier
(Sigma-Aldrich). Twenty micrograms of lysate protein per lane were sep-
arated by SDS-PAGE under reducing conditions and blotted onto nitrocel-
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
lulose membranes. Membranes were incubated with the primary Abs to
TLR2 and TLR4 (Imgene), MyD88 (Imgene), p-p-38 (Cell Signaling Tech-
nology), p-ERK1/2 (Santa Cruz Biotechnology), p-JNK (Santa Cruz Bio-
technology), I␬B␣ (Santa Cruz Biotechnology), and HBD-2 (Alpha Diag-
nostic), and then with 0.2 ␮g/ml HRP-conjugated secondary Ab, and
revealed with ECL light substrate (ECL; Amersham Biosciences).
ELISA
To analyze the production of NF-␬B-associated proinflammatory cytokines
by H69 cells in response to C. parvum infection, H69 cells were grown to
subconfluence in 4-well chamber slides. After incubation with assay me-
dium containing freshly excysted sporozoites and various specific inhibi-
tors at 37°C for 12 h, supernatants were collected to assay the cytokines,
and cells were harvested for protein determination. IL-8 concentration in
the supernatants was determined by ELISA using a commercial kit (R&D
Systems). Cells were lysed with the M-PER mammalian protein extraction
reagent (Pierce), and protein concentrations were assessed with Bradford
reagent (Sigma-Aldrich). The concentrations of IL-8 detected were calcu-
lated from standard curves prepared with the recombinant proteins and
expressed as picogram of IL-8 per microgram cell protein.
Statistical analysis
All values are given as mean ⫹ SE. Means of groups were compared with
the Student’s t test (unpaired) or ANOVA test when appropriate. p values
⬍0.05 were considered statistically significant.
Results
Normal human cholangiocytes express multiple TLRs and
accessory molecules
mRNA expression of TLRs and accessory molecules MD-2 and
MyD88 was assessed by RT-PCR in a SV40-transformed normal
human cholangiocyte cell line, H69. TIB-202 cells, a human
monocyte cell line that expresses all known TLRs except TLR3
(15, 26), was used as the positive control. TLR1–10 mRNA was
detected in H69 cells (Fig. 1, A and B). Consistent with previous
reports, mRNA of all known TLRs except TLR3 was confirmed in
TIB-202 cells (Fig. 1, A and B). Both MD-2 and MyD88 mRNA
were also detected in H69 cells (Fig. 1B). Specificity of the PCR
products was confirmed by sequencing. Expression of selected
TLRs (i.e., TLR2 and TLR4) and MyD88 protein in H69 cells was
also detected by Western blotting (Fig. 1C).
To further test expression of TLRs at the protein level in human
cholangiocytes, we assessed TLR protein expression in cholangio-
cytes in normal human liver tissues with Abs currently available to
TLR2–9 by immunohistochemistry. Although the negative con-
trols, stained with normal goat serum and the secondary Ab,
showed no specific staining in cholangiocytes (Fig. 2A), strong
expression of TLR2–9 proteins was detected in cholangiocytes
7450
FIGURE 1. Expression of TLRs and accessory molecules in cultured
human cholangiocytes. A SV40-transformed normal human cholangiocyte
cell line, H69, was screened for the mRNA expression of all known human
TLRs and accessory molecules, MD-2 and MyD88, by RT-PCR. TIB-202
cells, a normal human monocyte cell line that expresses all known TLRs
except TLR3 (15, 26), was used as the positive control. Expression of
TLR1–10 (A and B), MD-2 and MyD88 (B) was detected in H69 cells.
Expression of TLR2, TLR4, and MyD88 protein was detected in H69 cells
by Western blotting (C). Neg Ctrl, negative control, reverse transcriptase
template from H69 cells.
along the biliary duct (Fig. 2, B–I). Expression was found predom-
inately in the apical membrane domain (the luminal domain) (ar-
rowheads in Fig. 2, B–I).
C. parvum recruits cholangiocyte TLR2 and TLR4, but not other
TLRs, to the attachment sites in vitro
Previous studies by us and others (9, 10, 29, 30) demonstrated that
C. parvum recruits a variety of host-cell receptors and exchangers
to the infection sites facilitating host-cell invasion by the parasite.
To test whether C. parvum induces membrane translocation of
TLRs in host-cells, accumulation of TLRs at the infection sites was
measured by dual immunofluorescent labeling using Abs to
TLR2–9 and C. parvum. Strong accumulation of TLR2 (in red,
arrowhead in Fig. 3A2) and TLR4 (in red, arrowhead in Fig. 3B2)
was observed at the infection site of C. parvum (in green, arrow-
heads in Fig. 3, A1 and B1). No obvious accumulation of TLR5
(Fig. 3, C1–C3), TLR9 (Fig. 3, D1–D3), and other analyzed TLRs
(data not shown) was found at C. parvum infection sites. No mem-
brane accumulation of TLR2–9 was found in the sham-infected
cells, and no positive staining was observed in the parasite itself
with the procedure used in the experiments (data not shown). To
test whether TLR2 and TLR4 activity is required for their accu-
mulation at the infection site, we stably transfected cells with DN
mutants of TLR2 and TLR4 and then exposed to C. parvum. Func-
tional inhibition by transfection of DNs was evidenced by the in-
hibition of activation of downstream effectors as described below.
A similar accumulation of TLR2 and TLR4 was detected in cells
transfected with TLR2-DN and TLR4-DN, respectively. Quanti-
tative analysis of TLR accumulation is shown in Fig. 3E.
C. parvum infection of cholangiocytes in vitro is not TLR2- and
TLR4-dependent
To determine whether TLR2 and TLR4 and their signal pathways
are involved in the infection process of C. parvum into host epi-
thelial cells, C. parvum attachment to and invasion of cells with
functional inhibition of TLR2, TLR4, and MyD88 was assessed.
When cholangiocytes were prefixed and then exposed to C. par-
TLRs IN C. parvum INFECTION
FIGURE 2. Expression of TLR2–9 proteins in cholangiocytes of nor-
mal human liver tissues. Expression of TLR2–9 proteins in normal human
liver tissue sections was assessed by immunohistochemistry followed by
light microscopy. Although the negative controls, stained with normal goat
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
serum and the secondary Ab, showed no specific staining in cholangiocytes
along the biliary duct (A), strong expression of TLR2–9 proteins was de-
tected in cholangiocytes (B–I). Insets in B–I are high magnification of the
boxed region in B–I. Arrowheads indicate staining at the apical surface.
Bar, 10 ␮m.
vum sporozoites (a model in which the organism can attach to but
not invade the fixed cell surface), no significant change in attach-
ment rate was found among nontransfected cells and cells trans-
fected with TLR2-DN, TLR4-DN, or MyD88-DN (Fig. 4A). When
unfixed cholangiocytes were exposed to C. parvum sporozoites (a
model in which the organism can both attach to and enter host
cells), no significant change in attachment/invasion rate was found
between nontransfected and transfected cells (Fig. 4B); these re-
sults suggest that C. parvum sporozoite attachment to and invasion
of cholangiocytes is not dependent upon host-cell TLR2 and TLR4
and their signaling pathways.
Activation of downstream effectors of TLR2 and TLR4 signal
pathways
To determine whether TLR signal pathways are activated during
C. parvum infection of cholangiocytes, we measured the activation
of various components of downstream effectors of TLRs. A sig-
nificant increase of IRAK activity, an immediate downstream ef-
fector for both TLR2 and TLR4 (16), was detected in cholangio-
cytes upon C. parvum infection as seen by phosphorylation of
MBP (31). A significant inhibition of IRAK activity was found in
cells transfected with TLR2-DN, TLR4-DN, or MyD88-DN by
quantitation of 32P labeling of the substrate MBP after SDS-PAGE
(Fig. 5A). To further test which downstream effectors of IRAK are
activated, cholangiocytes were exposed to C. parvum followed by
Western blotting using Abs to the activated phosphorylated forms
of various IRAK downstream kinases (16). A significant increase
of phosphorylation of p-38, but not JNK and ERK1/2, was de-
tected by immunoblotting using specific Abs against those phos-
phorylated kinases (Fig. 5, B and C). A significant inhibition of
p-38 phosphorylation was found in cells transfected with TLR2-
DN, TLR4-DN, or MyD88-DN (Fig. 5, B and C).
Activated IRAK can further activate the NF-␬B pathway (16).
When cholangiocytes were exposed to C. parvum for 2 h, a sig-
nificant decrease of I␬B␣ protein was detected (Fig. 6A). In con-
trast, a partial but significant inhibition of I␬B␣ decrease was
found in cells transfected with TLR2-DN or TLR4-DN. A com-
plete blockage of I␬B␣ decrease upon C. parvum infection was
The Journal of Immunology
FIGURE 3. Accumulation of cholangiocyte TLR2 and TLR4, but not
other TLRs, at the attachment sites during C. parvum infection. H69 cells
were exposed to C. parvum for 2 h followed by immunofluorescent mi-
croscopy. A1–D3, Representative confocal micrographs by dual labeling of
C. parvum (in green, left panel), TLRs (in red, middle panel), and the
merged images (right panel). Accumulation of TLR2 (arrowhead in A2)
and TLR4 (arrowhead in B2) was found at the host-cell-parasite interface.
No obvious accumulation of TLR5 (arrowhead in C2), TLR9 (arrowhead
in D2), and other TLRs (data not shown) was observed at the infection
sites. E, Quantitative analysis of accumulation of TLR2 and TLR4 at the
infection sites. No significant difference was found in the accumulation of
TLR2 and TLR4 at the infection sites between cells transfected with DN
mutants of TLR2 or TLR4 and cells transfected with empty vector controls.
Bar, 2 ␮m.
found in MyD88-DN-transfected cells (Fig. 6A). To further test the
nuclear translocation of NF-␬B in cells upon C. parvum infection,
we used an Ab to p-65, a component of the NF-␬B complex that
displays nuclear translocation in directly infected cholangiocytes
upon C. parvum infection (12), to measure NF-␬B activation in C.
parvum-infected cells by confocal immunofluorescent microscopy.
Consistent with results of our previous studies, nuclear transloca-
tion of p-65 was found in directly infected cells, not in bystander
noninfected cells (Fig. 6B). No nuclear translocation of p-65 was
found in both directly infected and bystander noninfected cells in
the TLR2-DN-, TLR4-DN-, and MyD88-DN-transfected cells
(Fig. 6, C–E). Whereas scrambled siRNAs had no effect on C.
parvum-induced NF-␬B nuclear translocation (Fig. 6, F and G), no
nuclear translocation of p-65 was found in infected cells trans-
fected with siRNAs to TLR4 (Fig. 6, H and I), TLR2, and MyD88
(data not shown). In contrast, a control experiment using 100
ng/ml Escherichia coli LPS, a well-known ligand for TLR4,
showed nuclear translocation of p-65 in most treated nontrans-
fected and empty vector-transfected cells, but not in TLR4-DN-
and MyD88-DN-transfected cells (data not shown), confirming the
existence of the TLR4/MyD88/NF-␬B pathway in H69 cells.
Equally important, these results exclude LPS contamination in our
7451
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
FIGURE 4. C. parvum attachment to and invasion of human cholangio-
cytes in culture is not dependent upon host-cell TLR2 and TLR4. H69 cells
or cells stably transfected with functional inhibitory DN mutants of TLR2,
TLR4, or MyD88 were exposed to C. parvum for 2 h followed by immu-
nofluorescent confocal microscopy. A, Attachment assay in prefixed cells
shows no significant difference of C. parvum attachment in all conditions.
B, Attachment/invasion assay in nonfixed cells after exposure to C. parvum
sporozoites. No significant change in attachment/invasion rate was found
between nontransfected and transfected cells. Ctrl, control.
C. parvum sporozoite preparation because NF-␬B activation by C.
parvum is limited only to directly infected cells, whereas in the
control experiment, LPS activated NF-␬B in virtually all cells.
Taken together, the data suggest that various downstream effectors
of TLR2 and TLR4 and associated intracellular signals such as
NF-␬B are activated in cholangiocytes upon C. parvum infection.
C. parvum induces expression of IL-8 and HBD-2 in
cholangiocytes via TLR2- and TLR4-mediated NF-␬B activation
To further confirm the role of TLR2 and TLR4 in C. parvum-
induced activation of the NF-␬B pathway, expression and secre-
tion of IL-8, a well-known gene product of NF-␬B-dependent tran-
scription (32), was assessed in cholangiocytes transfected with
DNs of TLR2, TLR4, and MyD88 in response to C. parvum in-
fection. Cells were incubated with C. parvum for 12 h, and ex-
pression of IL-8 mRNA was measured by RT-PCR. An increase of
IL-8 mRNA expression was detected in H69 cells after exposure to
C. parvum. C. parvum-induced IL-8 mRNA expression was sig-
nificantly reduced in cells transfected with TLR2-DN and
TLR4-DN (Fig. 7A), revealing only a slight increase over the
sham-infected control H69 cells, whereas IL-8 mRNA expression
in response to C. parvum was completely inhibited in MyD88-
DN-transfected cells (Fig. 7A). Inhibition of NF-␬B by two selec-
tive functional inhibitors, SN50 and MG-132 (25), also diminished
C. parvum-induced IL-8 mRNA expression in cholangiocytes.
Consequently, when cells were incubated with C. parvum for 12 h,
a significant increase of IL-8 secretion was found in the superna-
tants from cells incubated with C. parvum as measured by ELISA.
7452
FIGURE 5. C. parvum activates TLR2- and TLR4-associated signals in
human cholangiocytes in culture. H69 cells or cells stably transfected with
functional inhibitory DN mutants of TLR2, TLR4, or MyD88 were ex-
posed to C. parvum for 2 h. A, Activation of IRAK as measured by im-
munoprecipitation followed by incubation with [␥-32P]ATP using MBP as
a substrate. IRAK was also blotted by Western blot to confirm an equal
amount of total IRAK used for the assay. The intensity of the radioactive
signals was quantified and expressed as densitometric arbitrary values, rep-
resentative of three distinct experiments. B, Phosphorylation of p-38, JNK,
and ERK1/2 as assessed by immunoblotting using specific Abs. To confirm
equal loading, membranes were reprobed with an actin Ab. C, Quantitative
analysis of phosphorylation of p-38, JNK, and ERK1/2. The intensity of the
signals was quantified using a PhosphorImager and expressed as densito-
metric arbitrary values. Data are representative of three distinct experi-
ments. ⴱ, p ⬍ 0.05, compared with sham-infection control; #, p ⬍ 0.05,
compared C. parvum-infected cells.
A significant decrease of IL-8 release was detected in the super-
natants from cells transfected with TLR2-DN, TLR4-DN, and
MyD88-DN or cells treated with NF-␬B inhibitors (Fig. 7B).
To test the role of TLRs in C. parvum-induced HBD production,
expression of HBD-1–3 was measured in cells after exposure to C.
parvum for 12 h. A constitutive expression of ⌯〉D-1 and ⌯〉D-3
mRNA was found in the sham-infected, C. parvum-infected non-
transfected cells, cells treated with NF-␬B inhibitors, and cells
transfected with TLR2-DN, TLR4-DN, and MyD88-DN (Fig. 8A).
In contrast, a low expression of HBD-2 was found in the sham-
infected cells, and a significant increase of HBD-2 mRNA was
TLRs IN C. parvum INFECTION
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
FIGURE 6. C. parvum activates the NF-␬B pathway in directly infected
cholangiocytes via TLR2 and TLR4 signals. A, Degradation of I␬B␣ as
assessed by quantitative Western blot. H69 cells were exposed to C. par-
vum for 2 h, and I␬B␣ in the cell lysates was determined by Western blot
using an Ab against I␬B␣. Actin was also blotted to confirm an equal
loading. The intensity of the signals was quantified using a PhosphorIm-
ager and expressed as densitometric arbitrary values. Data are representa-
tive of three distinct experiments. B–F and H, Nuclear translocation of p-65
of the NF-␬B complex. Cells were exposed to C. parvum for 2 h followed
by immunofluorescent staining using a mAb against p-65 and a polyclonal
Ab to C. parvum. Nuclear translocation of p-65 was found in directly
infected cells (p-65 in green, nuclear translocation indicated by asterisks;
C. parvum in red by arrowheads in B), but not in bystander noninfected
cells. No nuclear translocation of p-65 was found in both directly infected
(asterisks in C–E) and nondirectly infected cells in the TLR2-DN-, TLR4-
DN-, and MyD88-DN-transfected cells. Whereas nuclear translocation of
p-65 was found in infected cells transfected with a scrambled siRNA (F),
it was absent in directly infected cells (G) transfected with Cy3-tagged
TLR4-siRNA. G and I show merged images of the DAPI and Cy3 channels
of the same field in F and H, respectively. C. parvum was identified with
DAPI staining of its nucleus in blue (arrowheads in G and I). Cells trans-
fected with siRNA were confirmed by positive Cy3 signal in red (asterisks
in G and I). ⴱ, p ⬍ 0.05, compared with sham-infection control; #, p ⬍
0.05, compared C. parvum-infected cells. Bar, 2 ␮m.
The Journal of Immunology
FIGURE 7. C. parvum induces IL-8 release in cholangiocytes via
TLR2- and TLR4-associated activation of NF-␬B. A, Expression of IL-8
mRNA. H69 cells were exposed to C. parvum for 2 h followed by RT-PCR.
18s rRNA was amplified to confirm an equal amount of total mRNA used
for each sample. The intensity of the signals was quantified using a Phos-
phorImager and expressed as densitometric arbitrary values. Data are rep-
resentative of three distinct experiments. B, IL-8 concentration in the su-
pernatants of the cell cultures. H69 cells were exposed to C. parvum for
12 h, and supernatants were collected. IL-8 concentration was determined
by ELISA. Data are expressed as picograms of IL-8 per milligram of total
protein and representative of three distinct experiments. ⴱ, p ⬍ 0.05, com-
pared with sham-infection control; #, p ⬍ 0.05, compared C. parvum-
infected cells.
detected in cells after exposure to C. parvum. C. parvum-induced
HBD-2 mRNA expression was significantly reduced in cells trans-
fected with TLR2-DN, TLR4-DN, and MyD88-DN (Fig. 8A). In-
hibition of NF-␬B by SN50 and MG-132 also diminished C. par-
vum-induced HBD-2 mRNA expression in cholangiocytes (Fig. 8,
A and B). Consistent with mRNA expression of HBD-2, expres-
sion of HBD-2 peptide was detected in infected cholangiocyte cul-
ture by Western blotting (Fig. 8C). A low expression of HBD-2
peptide was detected in the sham-infected cells, and strong expres-
sion was found in cells exposed to the parasite. A decreased ex-
pression of HBD-2 was found in cells transfected with TLR2-DN,
TLR4-DN, and MyD88-DN after exposure to C. parvum. To fur-
ther clarify the relationship between NF-␬B activation and HBD-2
expression induced by C. parvum, we measured HBD-2 expression
in C. parvum-infected cells by immunofluorescent microscopy.
Consistent with nuclear translocation of NF-␬B in directly infected
cells, expression of HBD-2 was found only in cells directly in-
fected by the parasite not in bystander noninfected cells (Fig. 8D).
No obvious HBD-2 expression was found in both directly infected
7453
FIGURE 8. C. parvum induces HBD2 expression in cholangiocytes via
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
TLR2- and TLR4-associated activation of NF-␬B. H69 cells were exposed
to C. parvum for 12 h, and expression of HBDs was determined by RT-
PCR, Western blot, and immunofluorescent microscopy. A, Expression of
mRNA of HBD-1–3 as assessed by RT-PCR. 18s rRNA was amplified to
confirm an equal amount of total mRNA used for each sample. B, Quan-
titative analysis of HBD mRNA signals using a PhosphorImager. C, Ex-
pression of HBD-2 as determined by Western blot using an Ab against
HBD-2. The intensity of the signals was quantified and expressed as
densitometric arbitrary values. D, Expression of HBD-2 in C. parvum
directly infected cells. H69 cells were exposed to C. parvum for 12 h
followed by triple immunofluorescent staining using a polyclonal Ab to
label HBD-2 (in green), a mAb to C. parvum (in red as indicated by
arrowheads), and DAPI to label cell nucleus. ⴱ, p ⬍ 0.05, compared
with sham-infection control; #, p ⬍ 0.05, compared C. parvum-infected
cells. Data are representative of three distinct experiments. Bar, 5 ␮m.
and uninfected cells transfected with TLR2-DN, TLR4-DN, and
MyD88-DN, or cells treated with NF-␬B inhibitors (data not
shown).
Expression of MyD88-DN in cultured cholangiocytes hampers
epithelial defense against C. parvum infection
To test whether TLRs and TLR-associated signals are involved in
cholangiocyte defense responses against C. parvum infection, we
assessed the number of parasites detected over time in H69 cells
stably transfected with a control empty vector or MyD88-DN. Af-
ter incubation with an equal number of C. parvum sporozoites for
2 h, cells were washed with culture medium to remove nonattached
and noninternalized parasites and were then further cultured for up
to 96 h. We then isolated RNA from the cells to measure C. par-
vum infection in cells by quantitative RT-PCR using C. parvum-
specific primers. We found that the number of C. parvum detected
in cells transfected with the control vector gradually but consis-
tently declined over time (Fig. 9, u), consistent with previous stud-
ies (23). We also detected a significantly higher number of para-
sites in MyD88-deficient cells than in cells transfected with the
control vector at 48, 72, and 96 h after initial infection (Fig. 9, f).
Although other interpretations are possible, these data suggest that
cholangiocytes exhibit innate epithelial defense responses to in-
hibit C. parvum infection, and that MyD88 functional inhibition in
cholangiocytes hampers this epithelial defense against C. parvum.
Discussion
In the work described in this study, we demonstrated that normal
human cholangiocytes in vivo and in culture express all known
7454
FIGURE 9. Transfection of cholangiocytes with MyD88-DN hampers
epithelial defense against C. parvum infection. H69 cells stably transfected
with a control empty vector or MyD88-DN construct were exposed to an
equal number of C. parvum for 2 h followed by extensive washing and
continued culture. A significantly greater number of parasites were de-
tected in MyD88 functionally deficient cells compared with the control
cells after exposure to C. parvum for 48 –96 h. Quantitative PCR was
performed using a LightCycler, and data were expressed as copies of
C. parvum 18s vs total 18s.
TLRs. Moreover, C. parvum infection of human cholangiocytes in
culture induces the recruitment of TLR2 and TLR4, but not other
TLRs, to the infection sites. However, whereas neither TLR2 nor
TLR4 appears necessary for C. parvum attachment to or invasion
of cholangiocytes in vitro, the parasite activates several down-
stream effectors of TLR2 and TLR4. More specifically, TLR2- and
TLR4-induced signaling is required for the activation of NF-␬B
induced by C. parvum in directly infected cells. More importantly,
a TLR2- and TLR4-dependent and NF-␬B-associated induction of
HBD-2, but not HBD-1 and HBD-3, was found in C. parvum di-
rectly infected cells. MyD88-deficient cells are more susceptible to
C. parvum infection in vitro. These findings demonstrate that
cholangiocytes express a variety of TLRs, and TLR2 and TLR4
mediate cholangiocyte defense responses to C. parvum via activa-
tion of NF-␬B.
The family of TLRs plays a key role in controlling innate im-
mune responses. Recent studies revealed a broad and regulated
expression of TLRs in human tissues. Most tissues express at least
one TLR, whereas phagocytes and B cells in particular show abun-
dant and constitutive expression of all known TLRs (33–36). In-
testinal epithelial cells normally express very low levels of TLRs
such as TLR2 and TLR4 (37, 38). In contrast, TLR5 is expressed
exclusively on the basolateral surface of the intestinal epithelial
cells (39). The characteristic of TLR expression in intestinal epi-
thelial cells, which are consistently exposed to microbiota includ-
ing commensal bacteria in the intestine, may explain why the com-
mensal bacteria usually do not induce inflammatory responses (38,
40). Although human bile is sterile under physiological conditions,
duodenal microorganisms are believed to be a major source of
bacterial infection in several biliary diseases. In particular, enteric
bacteria, demonstrable in bile, may be responsible for chronic pro-
liferative cholangitis associated with hepatolithiasis (41). Never-
theless, whereas expression of TLR2–5 was recently shown in
normal murine cholangiocytes and in several human cholangiocar-
cinoma cell lines (42), expression of TLRs in the normal human
liver, particularly in cholangiocytes, has never been systemically
examined. Extensive expression and cellular distribution of mul-
tiple TLRs in human cholangiocytes, as suggested by our results,
indicated that TLRs may play a key role in cholangiocyte innate
immune responses. These TLRs participate in a complex pattern-
recognition system (15) and, therefore, provide cholangiocytes the
TLRs IN C. parvum INFECTION
capacity to quickly recognize and respond to microorganisms in
the bile, initiating the first defense machinery in the biliary tree to
keep the bile sterile and maintain the integrity of the biliary epi-
thelial barrier.
TLRs participate in epithelial immune responses to a variety of
invading pathogens including parasites, such as Trypanosoma
cruzi, malaria parasites, and Leishmania (43– 46). Whether TLRs
also play a role in C. parvum infection of any epithelia is unclear.
C. parvum sporozoites attach to and invade host cells, resulting in
the formation of a parasitophorous vacuole via a host-cell actin-
dependent mechanism (23, 47– 49). We previously showed that a
variety of host-cell membrane-associated kinases, e.g., c-Src and
PI3K, and actin-associated proteins, e.g., cortactin, and Arp2/3
complex, are recruited to the infection sites and induce actin re-
modeling and facilitate parasite invasion of host epithelial cells
(10, 23, 29, 30). TLR4 has been reported as a coreceptor for E. coli
P fimbriae attachment to host epithelial cells (50). In this study, we
found that TLR2 and TLR4, but not other TLRs, are recruited to
the infection sites. However, C. parvum attachment to and invasion
of cholangiocytes seems independent of TLRs, because DN mu-
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
tation of TLR2 and TLR4 did not affect parasite attachment and
invasion. Instead, we identified that a set of downstream effectors
of TLR2 and TLR4 are activated in cholangiocytes during C. par-
vum infection, suggesting that parasite host-cell interactions may
trigger cholangiocyte reactivity in response to C. parvum via ac-
tivation of TLR2- and TLR4-mediated intracellular signaling
pathways.
The signaling events following ligation of different TLRs in-
volve the activation of a common set of adaptor proteins (e.g.,
MyD88) and protein kinases (15, 16). Activation of IRAK, an
immediate downstream kinase to MyD88, was detected in cholan-
giocytes upon C. parvum infection. Downstream effectors of IRAK
in epithelia include p-38, JNK, ERK1/2, and I␬B kinase (15, 16).
Phosphorylation of p-38, but not JNK and ERK1/2, and activation
of the NF-␬B signaling pathway were found in cells exposed to C.
parvum, suggesting a differential activation of downstream effec-
tors of IRAK in cholangiocytes during C. parvum infection, sim-
ilar to results of previous studies in respiratory epithelial cells dur-
ing Pneumocystis infection (51) or Pseudomonas aeruginosa
flagella activation (52). We showed previously that C. parvum ac-
tivates the NF-␬B system via degradation of I␬B␣ in directly in-
fected epithelial cells resulting in host-cell secretion of associated
gene products (e.g., IL-8) (12). In this study, we found that C.
parvum-induced degradation of I␬B␣ was blocked in cells trans-
fected with TLR2-DN, TLR4-DN, and MyD88-DN. Nuclear trans-
location of p-65 was inhibited by transfection of cells with TLR2-
DN, TLR4-DN, and MyD88-DN. Activation of NF-␬B by C.
parvum was also inhibited by specific siRNAs to TLR2, TLR4,
and MyD88. Consequently, IL-8 release from cholangiocytes upon
C. parvum infection was inhibited. Moreover, our data suggest that
both TLR2 and TLR4 contribute to C. parvum-induced NF-␬B
activation, because neither TLR2-DN nor TLR4-DN alone could
completely block induced NF-␬B activation and IL-8 release,
whereas transfection with a DN mutant of their common adaptor
protein MyD88 completely inhibited NF-␬B activation. Taken to-
gether, these data indicate the following: 1) that C. parvum acti-
vates TLR2- and TLR4-dependent signal pathways in infected
cholangiocytes; and 2) that both TLR2 and TLR4 are involved in
activation of the NF-␬B signaling pathway in directly infected
cholangiocytes in which the adaptor protein MyD88 plays an es-
sential role. Whether host-cell endosomes and intracellular pattern
recognition receptors, such as nucleotide-binding oligomerization
domain 1 (NOD1) and NOD2 (53, 54), also play a role in host-cell
activation by C. parvum is unclear. Whether C. parvum expresses
The Journal of Immunology
TLR ligands such as LPS and peptidoglycans (55) and why direct
parasite-host-cell interactions are required for TLR activation need
further investigation.
HBDs are key elements of the innate immune system against
invading pathogens in both respiratory and gastrointestinal epithe-
lial cells (17). Whereas HBD-1 is extensively expressed in these
epithelia under physiological conditions, HBD-2 expression is in-
duced by exposure to microbes or cytokines, such as TNF-␣ (17–
20). A constitutive expression of HBD-1 and LPS-induced expres-
sion of HBD-2 has also been reported in human cholangiocytes
(41). The NF-␬B signaling pathway has been implicated in the
expression of HBD-2 in response to various stimuli (56, 57).
Whereas TLR signaling-associated HBD-2 expression has been
demonstrated in tracheobronchial and intestinal epithelial cells (21,
22), the role of TLRs in microbial-induced HBD expression in
cholangiocytes has not been fully characterized. In this study, we
provide substantial evidence supporting the notion that C. parvum
induces expression of HBD-2 in cholangiocytes via TLR-mediated
NF-␬B activation. First, TLR2 and TLR4 are recruited to the par-
asite attachment sites. Secondly, TLR2 and TLR4 are associated
with activation of the NF-␬B signaling pathway induced by C.
parvum, and both nuclear translocation of NF-␬B and expression
of HBD-2 are limited to directly infected cells. More importantly,
DN mutants of TLR2, TLR4, and MyD88, or inhibition of NF-␬B
by specific inhibitors block C. parvum-induced HBD-2 expression.
Both HBD-1 and HBD-2 have anti-C. parvum activity, as evi-
denced by a decrease of C. parvum sporozoite viability after in-
cubation with recombinant HBD-1 or HBD-2 (14). Indeed, we
detected a significantly higher number of parasites in cells trans-
fected with MyD88-DN than in the control cells at 48 –96 h after
initial exposure to an equal number of parasites. Besides HBD-1,
a constitutive expression of HBD-3 was also detected in both C.
parvum-infected and sham-infected cultured cholangiocytes, sug-
gesting that both HBD-1 and HBD-3 may play a general antimi-
crobial role in the defense of the biliary system, similar to that
documented in other epithelia (58). In contrast, TLR-induced ex-
pression of HBD-2, as demonstrated by our results, may provide
epithelial cells (e.g., cholangiocytes) a critical local defense re-
sponse against microbial infection.
In conclusion, our study demonstrated that human cholangio-
cytes normally express TLR1–10. Using an in vitro model of bil-
iary cryptosporidiosis, we found that C. parvum recruits TLR2 and
TLR4, but not other analyzed TLRs, to the host-cell-parasite in-
terface, an event that results in activation of NF-␬B thus triggering
host-cell responses such as cytokine/chemokine release and HBD
expression. Future studies should define the molecular mecha-
nisms by which C. parvum activates host-cell TLRs and investi-
gate the potential synergistic effects of C. parvum and other patho-
gen (e.g., HIV-1) infection in the pathogenesis of biliary disease
via the TLR pathways.
Acknowledgments
We are grateful to Dr. M. Smith for providing the TLR2-DN and
TLR4-DN constructs, Prof. J. Tschopp for the MyD88-DN construct, and
Drs. G. Zhu and J. S. Keithly for the antiserum to C. parvum. We thank
Drs. D. K. Podolsky, H. D. Dong, G. J. Gores, and A. Badley for helpful
and stimulating discussions and D. Hintz for secretarial assistance.
Disclosures
The authors have no financial conflict of interest.
References
1. O’Donoghue, P. J. 1995. Cryptosporidium and cryptosporidiosis in man and an-
imals. Int. J. Parasitol. 25: 139 –195.
2. Chen, X. M., J. S. Keithly, C. V. Paya, and N. F. LaRusso. 2002. Cryptospori-
diosis. N. Engl. J. Med. 346: 1723–1731.
7455
3. Guerrant, R. L. 1997. Cryptosporidiosis: an emerging, highly infectious threat.
Emerg. Infect. Dis. 3: 51–57.
4. Wilcox, C. M., and K. E. Monkemuller. 1998. Hepatobiliary diseases in patients
with AIDS: focus on AIDS cholangiopathy and gallbladder disease. Dig. Dis. 16:
205–213.
5. Manabe, Y. C., D. P. Clark, R. D. Moore, J. A. Lumadue, H. R. Dahlman,
P. C. Belitsos, R. E. Chaisson, and C. L. Sears. 1998. Cryptosporidiosis in pa-
tients with AIDS: correlates of disease and survival. Clin. Infect. Dis. 27:
536 –542.
6. Griffiths, J. K. 1998. Treatment for AIDS-associated cryptosporidiosis. J. Infect.
Dis. 178: 915–916.
7. Clark, D. P. 1999. New insights into human cryptosporidiosis. Clin. Microbiol.
Rev. 12: 554 –563.
8. McDonald, V., R. Smith, H. Robinson, and G. Bancroft. 2000. Host immune
responses against Cryptosporidium. Contrib. Microbiol. 6: 75–91.
9. Huang, B. Q., X. M. Chen, and N. F. LaRusso. 2004. Cryptosporidium parvum
attachment to and internalization by human biliary epithelia in vitro: a morpho-
logic study. J. Parasitol. 90: 212–221.
10. Chen, X. M., B. Q. Huang, P. L. Splinter, H. Cao, G. Zhu, M. A. McNiven, and
N. F. LaRusso. 2003. Cryptosporidium parvum invasion of biliary epithelia re-
quires host cell tyrosine phosphorylation of cortactin via c-Src. Gastroenterology
125: 216 –228.
11. Deng, M., M. S. Rutherford, and M. S. Abrahamsen. 2004. Host intestinal epi-
thelial response to Cryptosporidium parvum. Adv. Drug Delivery Rev. 56:
869 – 884.
12. Chen, X. M., S. A. Levine, P. L. Splinter, P. S. Tietz, A. L. Ganong, C. Jobin,
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
G. J. Gores, C. V. Paya, and N. F. LaRusso. 2001. Cryptosporidium parvum
activates nuclear factor ␬B in biliary epithelia preventing epithelial cell apoptosis.
Gastroenterology 120: 1774 –1783.
13. Laurent, F., L. Eckmann, T. C. Savidge, G. Morgan, C. Theodos, M. Naciri, and
M. F. Kagnoff. 1997. Cryptosporidium parvum infection of human intestinal
epithelial cells induces the polarized secretion of C-X-C chemokines. Infect. Im-
mun. 65: 5067–5073.
14. Zaalouk, T. K., M. Bajaj-Elliott, J. T. George, and V. McDonald. 2004. Differ-
ential regulation of ␤-defensin gene expression during Cryptosporidium parvum
infection. Infect. Immun. 72: 2772–2779.
15. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Im-
munol. 21: 335–376.
16. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev. Immunol.
4: 499 –511.
17. Ganz, T. 2003. Defensins: antimicrobial peptides of innate immunity. Nat. Rev.
Immunol. 3: 710 –720.
18. Yamaguchi, Y., T. Nagase, R. Makita, S. Fukuhara, T. Tomita, T. Tominaga,
H. Kurihara, and Y. Ouchi. 2002. Identification of multiple novel epididymis-
specific ␤-defensin isoforms in humans and mice. J. Immunol. 169: 2516 –2523.
19. O’Neil, D. A., E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz,
and M. F. Kagnoff. 1999. Expression and regulation of the human ␤-defensins
hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163: 6718 – 6724.
20. Tsutsumi-Ishii, Y., and I. Nagaoka. 2003. Modulation of human ␤-defensin-2
transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated
mononuclear phagocytes via proinflammatory cytokine production. J. Immunol.
170: 4226 – 4236.
21. Hertz, C. J., Q. Wu, E. M. Porter, Y. J. Zhang, K. H. Weismuller, P. J. Godowski,
T. Ganz, S. H. Randell, and R. L. Modlin. 2003. Activation of Toll-like receptor
2 on human tracheobronchial epithelial cells induces the antimicrobial peptide
human ␤ defensin-2. J. Immunol. 171: 6820 – 6826.
22. Vora, P., A. Youdim, L. S. Thomas, M. Fukata, S. Y. Tesfay, K. Lukasek, K,
S. Michelsen, A. Wada, T. Hirayama, M. Arditi, and M. T. Abreu. 2004. ␤-De-
fensin-2 expression is regulated by TLR signaling in intestinal epithelial cells.
J. Immunol. 173: 5398 –5405.
23. Chen, X. M., and N. F. LaRusso. 2000. Mechanisms of attachment and internal-
ization of Cryptosporidium parvum to biliary and intestinal epithelial cells. Gas-
troenterology 118: 368 –379.
24. Grubman, S. A., R. D. Perrone, D. W. Lee, S. L. Murray, L. C. Rogers,
L. I. Wolkoff, A. E. Mulberg, V. Cherington, and D. M. Jefferson. 1994. Regu-
lation of intracellular pH by immortalized human intrahepatic biliary epithelial
cell lines. Am. J. Physiol. 266: G1060 –G1070.
25. Lin, Y. Z., S. Y. Yao, R. A. Veach, T. R. Torgerson, and J. Hawiger. 1995.
Inhibition of nuclear translocation of transcription factor NF-␬B by a synthetic
peptide containing a cell membrane-permeable motif and nuclear localization
sequence. J. Biol. Chem. 270: 14255–14258.
26. Becker, M. N., G. Diamond, M. W. Verghese, and S. H. Randell. 2000. CD14-
dependent lipopolysaccharide-induced ␤-defensin-2 expression in human tra-
cheobronchial epithelium. J. Biol. Chem. 275: 29731–29736.
27. Rochelle, P. A., M. M. Marshall, J. R. Mead, A. M. Johnson, D. G. Korich,
J. S. Rosen, and R. De Leon. 2002. Comparison of in vitro cell culture and a
mouse assay for measuring infectivity of Cryptosporidium parvum. Appl. Envi-
ron. Microbiol. 68: 3809 –3817.
28. Splinter, P. L., A. I. Masyuk, and N. F. LaRusso. 2003. Specific inhibition of
AQP1 water channels in isolated rat intrahepatic bile duct units by small inter-
fering RNAs. J. Biol. Chem. 278: 6268 – 6274.
29. Chen, X. M., B. Q. Huang, P. L. Splinter, J. D. Orth, D. D. Billadeau,
M. A. McNiven, and N. F. LaRusso. 2004. Cdc42 and the actin-related protein/
neural Wiskott-Aldrich syndrome protein network mediate cellular invasion by
Cryptosporidium parvum. Infect. Immun. 72: 3011–3021.
7456
30. Chen, X. M., P. L. Splinter, P. S. Tietz, B. Q. Huang, D. D. Billadeau, and
N. F. LaRusso. 2004. Phosphatidylinositol 3-kinase and frabin mediate Crypto-
sporidium parvum cellular invasion via activation of Cdc42. J. Biol. Chem. 279:
31671–31678.
31. Guillot, L., S. Medjane, K. Le-Barillec, V. Balloy, C. Danel, M. Chignard, and
M. Si-Tahar. 2004. Response of human pulmonary epithelial cells to lipopoly-
saccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways:
evidence for an intracellular compartmentalization of TLR4. J. Biol. Chem. 279:
2712–2718.
32. Roebuck, K. A. 1999. Regulation of interleukin-8 gene expression. J. Interferon
Cytokine Res. 19: 429 – 438.
33. Zarember, K. A., and P. J. Godowski. 2002. Tissue expression of human Toll-like
receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in
response to microbes, their products, and cytokines. J. Immunol. 168: 554 –561.
34. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive
immune responses. Nat. Immunol. 5: 987–995.
35. Bourke, E., D. Bosisio, J. Golay, N. Polentarutti, and A. Mantovani. 2003. The
Toll-like receptor repertoire of human B lymphocytes: inducible and selective
expression of TLR9 and TLR10 in normal and transformed cells. Blood 102:
956 –963.
36. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese,
S. Endres, and G. Hartmann. 2002. Quantitative expression of Toll-like receptor
1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and
sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168: 4531– 4537.
37. Cario, E., and D. K. Podolsky. 2000. Differential alteration in intestinal epithelial
cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel
disease. Infect. Immun. 68: 7010 –7017.
38. Melmed, G., L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen,
Y. Zhou, B. Hu, M. Arditi, and M. T. Abreu. 2003. Human intestinal epithelial
cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands:
implications for host-microbial interactions in the gut. J. Immunol. 170:
1406 –1415.
39. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, and J. L. Madara. 2001.
Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce
epithelial proinflammatory gene expression. J. Immunol. 167: 1882–1885.
40. Noverr, M. C., and G. B. Huffnagle. 2004. Does the microbiota regulate immune
responses outside the gut? Trends Microbiol. 12: 562–568.
41. Harada, K., K. Ohba, S. Ozaki, K. Isse, T. Hirayama, A. Wada, and
Y. Nakanuma. 2004. Peptide antibiotic human ␤-defensin-1 and -2 contribute to
antimicrobial defense of the intrahepatic biliary tree. Hepatology 40: 925–932.
42. Harada, K., S. Ohira, K. Isse, S. Ozaki, Y. Zen, Y. Sato, and Y. Nakanuma. 2003.
Lipopolysaccharide activates nuclear factor-␬B through Toll-like receptors and
related molecules in cultured biliary epithelial cells. Lab. Invest. 83: 1657–1667.
43. Pichyangkul, S., K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira,
A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et
al. 2004. Malaria blood stage parasites activate human plasmacytoid dendritic
cells and murine dendritic cells through a Toll-like receptor 9-dependent path-
way. J. Immunol. 172: 4926 – 4933.
44. Kropf, P., M. A. Freudenberg, M. Modolell, H. P. Price, S. Herath, S. Antoniazi,
C. Galanos, D. F. Smith, and I. Muller. 2004. Toll-like receptor 4 contributes to
TLRs IN C. parvum INFECTION
efficient control of infection with the protozoan parasite Leishmania major. In-
fect. Immun. 72: 1920 –1928.
45. De Trez, C., M. Brait, O. Leo, T. Aebischer, F. A. Torrentera, Y. Carlier, and
E. Muraille. 2004. Myd88-dependent in vivo maturation of splenic dendritic cells
induced by Leishmania donovani and other Leishmania species. Infect. Immun.
72: 824 – 832.
46. Campos, M. A., M. Closel, E. P. Valente, J. E. Cardoso, S. Akira,
J. I. Alvarez-Leite, C. Ropert, and R. T. Gazzinelli. 2004. Impaired production of
proinflammatory cytokines and host resistance to acute infection with Trypano-
soma cruzi in mice lacking functional myeloid differentiation factor 88. J. Im-
munol. 172: 1711–1718.
47. Forney, J. R., D. B. DeWald, S. Yang, C. A. Speer, and M. C. Healey. 1999. A
role for host phosphoinositide 3-kinase and cytoskeletal remodeling during Cryp-
tosporidium parvum infection. Infect. Immun. 67: 844 – 852.
48. Elliott, D. A., and D. P. Clark. 2000. Cryptosporidium parvum induces host cell
actin accumulation at the host-parasite interface. Infect. Immun. 68: 2315–2322.
49. Elliott, D. A., D. J. Coleman, M. A. Lane, R. C. May, L. M. Machesky, and
D. P. Clark. 2001. Cryptosporidium parvum infection requires host cell actin
polymerization. Infect. Immun. 69: 5940 –5942.
50. Frendeus, B., C. Wachtler, M. Hedlund, H. Fischer, P. Samuelsson, M. Svensson,
and C. Svanborg. 2001. Escherichia coli P fimbriae utilize the Toll-like receptor
4 pathway for cell activation. Mol. Microbiol. 40: 37–51.
51. Lebron, F., R. Vassallo, V. Puri, and A. H. Limper. 2003. Pneumocystis carinii
cell wall ␤-glucans initiate macrophage inflammatory responses through NF-␬B
activation. J. Biol. Chem. 278: 25001–25008.
52. Adamo, R., S. Sokol, G. Soong, M. I. Gomez, and A. Prince. 2004. Pseudomonas
aeruginosa flagella activate airway epithelial cells through asialoGM1 and Toll-
Downloaded from http://www.jimmunol.org/ by guest on June 9, 2017
like receptor 2 as well as Toll-like receptor 5. Am. J. Respir. Cell Mol. Biol. 30:
627– 634.
53. Kim, J. G., S. J. Lee, and M. F. Kagnoff. 2004. Nod1 is an essential signal
transducer in intestinal epithelial cells infected with bacteria that avoid recogni-
tion by Toll-like receptors. Infect. Immun. 72: 1487–1495.
54. Barnich, N., J. E. Aguirre, H. C. Reinecker, R. Xavier, and D. K. Podolsky. 2005.
Membrane recruitment of NOD2 in intestinal epithelial cells is essential for nu-
clear factor-␬B activation in muramyl dipeptide recognition. J. Cell Biol. 170:
21–26.
55. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning. 1999.
Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-
like receptor 2. J. Biol. Chem. 274: 17406 –17409.
56. Wehkamp, J., J. Harder, K. Wehkamp, B. Wehkamp-von Meissner, M. Schlee,
C. Enders, U. Sonnenborn, S. Nuding, S. Bengmark, K. Fellermann, et al. 2004.
NF-␬B- and AP-1-mediated induction of human ␤ defensin-2 in intestinal epi-
thelial cells by Escherichia coli Nissle 1917: a novel effect of a probiotic bac-
terium. Infect. Immun. 72: 5750 –5758.
57. Kao, C. Y., Y. Chen, P. Thai, S. Wachi, F. Huang, C. Kim, R. W. Harper, and
R. Wu. 2004. IL-17 markedly up-regulates ␤-defensin-2 expression in human
airway epithelium via JAK and NF-␬B signaling pathways. J. Immunol. 173:
3482–3491.
58. Dunsche, A., Y. Acil, H. Dommisch, R. Siebert, J. M. Schroder, and S. Jepsen.
2002. The novel human ␤-defensin-3 is widely expressed in oral tissues. Eur.
J. Oral Sci. 110: 121–124.