FEBS Letters 583 (2009) 1516–1520

journal homepage: www.FEBSLetters.org

Essential role of p53 in TPEN-induced neuronal apoptosis

Hana Ra a, Hyun-Lim Kim a, Han-Woong Lee b, Yang-Hee Kim a,*
a
Department of Molecular Biology, Sejong University, 98 Gunja-Dong Gwangjin-Gu, Seoul 143-747, South Korea
b
Department of Biochemistry, Yonsei University, Seoul 120-749, South Korea

a r t i c l e i n f o a b s t r a c t

Article history: Depletion of intracellular zinc with N,N,N0 ,N0 -tetrakis(2-pyridylmethyl)ethylenediamine (TPEN)
Received 20 January 2009 induces protein synthesis-dependent apoptosis. In this study, we examined the requirement for
Revised 10 March 2009 p53 as an upstream transcription factor in TPEN-induced neuronal apoptosis. Chemical or genetic
Accepted 4 April 2009
blockade of p53 markedly attenuated TPEN-induced neuronal apoptosis, while the stability and
Available online 11 April 2009
activity of p53 were increased by TPEN. In addition, expression of proapoptotic genes, PUMA and
Edited by Barry Halliwell NOXA, and activation of caspase-11 were increased by TPEN in a p53-dependent manner. Inhibition
of p53 blocked cytochrome C release from mitochondria to cytosol and prevented caspase-3 activa-
Keywords:
tion. Therefore, p53 may be an essential regulatory factor for TPEN-induced neuronal apoptosis.
Zinc Ó 2009 Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies.
PUMA
NOXA
Cytochrome C
Caspase-3
Caspase-11

1. Introduction
Zinc is an essential trace element required for the normal func-
tion of many enzymes, structural proteins and zinc-finger tran-
scription factors [1]. In addition, zinc plays a special role in the
central nervous system (CNS) where chelatable zinc accumulates
in synaptic vesicles, is released by stimulus and then enters into
postsynaptic neurons to transmit synaptic activating signals [2].
Due to its essential and diverse roles, the intracellular zinc concen-
tration is tightly regulated at the pM level [3]. Reports have shown
that accumulation of chelatable zinc in neurons can lead to neuro-
nal death after ischemia, epileptic seizures, or traumatic brain in-
jury [4]. In contrast, severe depletion of intracellular zinc can
induce neuronal apoptosis [5,6]. In addition to neurons, many
types of cells including thymocytes, keratinocytes, and various
cancer cells manifest apoptosis in response to zinc depletion [7–9].
Previously, we reported that zinc chelation by N,N,N0 ,N0 -tetra-
kis(2-pyridylmethyl)ethylenediamine (TPEN) induced apoptosis
in mouse cortical neuron cultures [5,6]. TPEN-induced neuronal
apoptosis is absolutely dependent on mRNA or protein synthesis
[5,6]. These results suggest a key role for certain inducible apopto-
Abbreviations: TPEN, N,N,N0 ,N0 -tetrakis(2-pyridylmethyl)ethylenediamine; LDH,
lactate dehydrogenase; PI, propidium iodide; MPT, mitochondrial potential transi-
tion; PUMA, p53-up-regulated modulator of apoptosis
* Corresponding author. Fax: +82 2 3408 4336.
E-mail address: yhkim@sejong.ac.kr (Y.-H. Kim).
genic proteins and their genetic regulation in cell death [5,6]. In a
previous report, we suggested that the initiator caspase, caspase-
11, is a one of the inducible apoptogenic proteins [5]. Chemical
or genetic blockade of caspase-11 markedly attenuated TPEN-in-
duced neuronal apoptosis. The inducible nature of caspase-11
activity in zinc-depleted neuronal death was shown by the require-
ment for increased mRNA and protein expression levels of caspase-
11 [5].
The p53 tumor suppressor protein plays a central role in cell cy-
cle arrest and apoptosis [10]. Furthermore, p53 has dual roles in
apoptosis, transcriptional regulation and direct proapoptotic action
on mitochondrial potential transition (MPT) [11]. As a transcription
factor, p53 increases the expression levels of proapoptotic proteins
such as PUMA (p53-up-regulated modulator of apoptosis) and
NOXA [12]. On the other hand, cytoplasmic p53 directly activates
the proapoptotic Bcl-2 protein, BAX, which then induces MPT
[11]. Normally, cytoplasmic p53 directly binds to Bcl-xL, but initi-
ation of the death signal increases p53-dependent expression of
PUMA. Subsequently, increased PUMA displaces p53 from Bcl-xL
and then released p53 binds to BAX, which induces MPT and cyto-
chrome C release [11].
Recently, it was reported that zinc deficiency impairs neuronal
precursor cell proliferation and survival via p53-mediated mecha-
nisms [13]. Thus, we examined whether p53 has a key role in zinc-
depleted neuronal death and is a critical upstream transcription
factor for caspase-11 induction and TPEN-induced neuronal death
in neuronal cultures.

0014-5793/$36.00 Ó 2009 Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies.
doi:10.1016/j.febslet.2009.04.008
 H. Ra et al. / FEBS Letters 583 (2009) 1516–1520
2. Materials and methods
2.1. Mouse cortical neuronal cultures
Cultures were prepared from embryonic day 14–15 mice as de-
scribed previously [5]. Dissociated cortical cells were plated onto
poly-L-lysine/laminin-coated plates (Nunc, Rochester, NY), 10
hemispheres per 24-well plate, in plating medium [Dulbecco‘s
modified Eagle’s medium (DMEM, GibcoBRL, Rockville, MD) with
20 mM glucose, 38 mM sodium bicarbonate, 2 mM glutamine, 5%
FBS, and 5% horse serum (Cambrex Corp., East Rutherford, HJ)].
Cytosine arabinoside (10 lM) was added at DIV3 to inhibit astrog-
lial proliferation.
2.2. Exposure to TPENs
Cortical neuronal cultures (DIV7) were exposed to TPEN for 12–
24 h (Sigma, St. Louis, MO) in serum-free MEM (Eagle’s minimal
essential medium, GibcoBRL). Before treatment, serum-containing
medium was removed and replaced with serum-free MEM. Sur-
vival of neurons for 24 h was not compromised by switching to ser-
um-free MEM.
2.3. Estimation of cell death
To detect apoptosis in cortical cultures, propidium iodide (PI)
stained cells were examined using fluorescence microscopy
(IX70, Excitation filter BP 510–550/Barrier filter B590; Olympus,
Japan).
After morphological assessments under the microscope, cell
death was quantified by measuring the level of lactate dehydroge-
nase (LDH) released from irreversibly damaged cells into the med-
ium 12–24 h after TPEN exposure (unless specified otherwise) [5].
Each LDH value was scaled to the maximal LDH release (= 100)
after 24-h exposure to 100 lM N-methyl-D-aspartic acid (NMDA)
in control cultures. To confirm apoptotic neuronal death, we per-
formed TdT-mediated-UTP-end nick labeling (TUNEL) assay using
in situ Cell Death Detection Kit according to the manufacture’s pro-
tocol (Roche, Switzerland). Apoptotic cells (TUNEL positive) were
counted and expressed as a percentage of the total number of cells
examined. All experiments were repeated at least three times,
using cultures from different platings.
2.4. RT-PCR
Total RNA was isolated using the High Pure RNA Isolation Kit
(Roche, Switzerland) and reverse-transcribed to cDNA using the
oligo(dT)14 primer (Promega, Madison, WI). PCR was performed
with primer sets specific for puma, noxa or D-glyceraldehyde-3-
phosphate dehydrogenase (gapdh). PCR was carried out for 30
cycles (94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min). Primer
sequences were designed using published cDNA sequences: puma
(CCATTTCTGGGGCTCCAGGA, TCCTCAGCCCTCCCTGTCAC), noxa
(GAACGCGCCAGTGAACCCAA, CTTTGTCTCCAATCCTCCGG), gapdh
(CTACATGGTCTACATGTTCCAGTATG, AGTTGTCATGGATGACCTT-
GG).
2.5. Western blots
Cell lysates were prepared in lysis buffer (HEPES 50 mM, NaCl
150 mM, MgCl2 1.5 mM, EDTA 5 mM, EGTA 2 mM, Triton X-100
1%, SDS 0.5%; pH 7.4). Thirty micrograms total protein was sepa-
rated by SDS–PAGE (10%) under reducing conditions and immuno-
blotted with the appropriate antibody [anti-P-p53 (Ser15), -P-p53
(Ser20), -P-p53 (Ser46), -PUMA, -procaspase-3, or -cleaved cas-
1517
pase-3 (Cell signaling Technology Inc., Beverly, MA), -caspase-11
(Abcam, UK), -p53 or -NOXA (Millipore, Billerica, MA) or actin
(Sigma)]. Actin was used as a loading control.
2.6. Immunocytochemistry and confocal microscopy
Neuronal cultures were fixed in 4% paraformaldehyde at 4 °C for
30 min, then permeabilized with 0.2% Triton X-100. After blocking
with normal serum in PBS, cultures were incubated with an anti-
cytochrome C antibody (BD Bioscience, Franklin Lakes, NJ) at 4 °C
overnight. Cultures were washed then incubated with a FITC-con-
jugated secondary antibody for 2 h. Microscopic images were
observed under a laser scanning microscope (Eclipse TE2000-U, Ni-
kon, Japan).
2.7. Caspase-11. enzymatic activity assay
To detect the enzymatic activity of caspase-11, cleavage of
acVEHD-amc (Peptron, South Korea), the specific substrate for
caspase-11, was measured using a fluorometer (Molecular Devices,
Union City, CA). Protein lysates (750 lg total proteins) were incu-
bated with 100 lM fluorogenic tetrapeptide substrate (acVEHD-
amc) [5]. Each fluorescence value is presented as fold difference
from the mean value of the sham control.
2.8. Statistics
For statistical comparison, two-tailed t-tests with Bonferroni’s
correction for multiple comparisons were used.
3. Results
p53 has been reported to play a key role as a transcription factor
in apoptosis of post-mitotic neurons [14]; thus, we examined the
involvement of p53 in TPEN-induced neuronal apoptosis. Blockade
of p53 by a chemical inhibitor, pifithrin-alpha, or genetic depletion
[11,14] blocked TPEN-induced neuronal cell death in mouse corti-
cal cultures (Fig. 1), indicating that p53 is critical in TPEN-induced
neuronal apoptosis.
Since phosphorylation of p53 impairs the ability of MDM2 to
bind p53, promoting both the accumulation and activation of p53
in response to DNA damage [15], we investigated whether the
phosphorylation and accumulation of p53 is induced by TPEN. Sig-
nificant increases of phosphorylated and normal p53 were de-
tected from 1 to 2 h after TPEN treatment (Fig. 2A and B). These
results indicate that p53 activity is increased in TPEN-induced cell
death.
In cortical neuronal cultures, the apoptotic action of p53 re-
quired only transcriptional activation of PUMA but did not involve
the direct action of p53 in mitochondria/cytosol [14]. Therefore, we
tested whether increased p53 activity leads to the induction of Bcl-
2 homology 3 (BH3)-domain-only proteins such as PUMA and
NOXA, which results in the permeabilization of the outer mito-
chondrial membrane [11] during TPEN-induced neuronal apopto-
sis. RT-PCR results showed that expression of both puma and
noxa were significantly induced by TPEN (Fig. 2C). The induction
of PUMA/NOXA protein expression also was detectable 1 h after
TPEN treatment (Fig. 2D), which was much earlier than MPT induc-
tion or caspase-3 activation after 9 hrs [5]. Furthermore, induction
of PUMA/NOXA by TPEN was not detected in p53-deficient or
cycloheximide (CHX)-treated cortical neuron cultures (Fig. 2E–G),
indicating that the induction of PUMA/NOXA was dependent on
p53-mediated de novo protein synthesis.
Previously, we reported that the induction and activation of cas-
pase-11 by TPEN contribute to caspase-3 activation and result in
1518 H. Ra et al. / FEBS Letters 583 (2009) 1516–1520

Fig. 1. Requirement of p53 for TPEN-induced neuronal apoptosis. (A) LDH release or TUNEL-positive apoptotic cells (mean ± S.E.M., n = 4 cultures) in mouse cortical neuronal
cultures after 24-h exposure to 2 lM TPEN with or without pifithrin. *Denotes statistically significant difference from TPEN-treated cultures (p < 0.05, two-tailed t-test). (B)
LDH release or TUNEL-positive apoptotic cells in p53 wild type (p53+/+) or deficient (p53/) mouse cortical neuronal cultures after 24-h exposure to TPEN. (C and D) Phase-
contrast (upper) or PI-stained (lower) photomicrographs of identical fields of p53+/+ (C) or p53/ cells (D) exposed to sham wash (CTRL) or TPEN for 24 h. Scale bar, 100 lm.

Fig. 2. p53-Mediated PUMA/NOXA induction in TPEN-induced neuronal apoptosis. Western blot analysis over the time-course of p53 phosphorylation (A) and accumulation
(B). Protein samples were prepared from near-pure cortical neuronal cultures at the indicated time points after TPEN treatment. Serine-phosphorylated protein bands of p53
were detected beginning 1 h after TPEN treatment. RT-PCR (C and E) and western blot analysis (D, F, and G) of PUMA and NOXA expression. (C and D) RNA or protein samples
were prepared at the indicated time points after exposure of neuronal cultures to TPEN. (E and F) RNA or protein samples were prepared from p53+/+ or p53/ neuronal
cultures after 6-h exposure to sham wash (CTRL) or TPEN. (G) Protein samples were prepared after 2 h exposure to TPEN with or without CHX (10 lg/ml).
 H. Ra et al. / FEBS Letters 583 (2009) 1516–1520 1519

Fig. 3. Regulation of caspase-11 by p53 in TPEN-induced neuronal apoptosis. Western blot analysis (A) and enzymatic activity (B) of caspase-11. Protein lysates were
obtained from p53+/+ or p53/ neuronal cultures after 6-h (A) or 12-h (B) exposure to sham wash (CTRL) or TPEN. *Denotes statistically significant difference from sham wash
controls (P < 0.05, two-tailed t-test).

Fig. 4. Essential role of p53 as an upstream regulator in TPEN-induced apoptosis. (A) Confocal photomicrographs of p53+/+ or p53/ neuronal cultures showing detection of
cytochrome C release from the mitochondrion to the cytosol by TPEN with or without CHX. Scale bar, 50 lm. Arrows and arrowheads denote cytochrome C release and DNA
fragmentation, respectively. (B) Western blot analysis of caspase-3 activation. Protein samples were prepared from p53+/+ or p53/ neuronal cultures after 12-h exposure to
sham wash (CTRL) or TPEN with or without CHX.

neuronal apoptosis [5]. Since the induction of caspase-11 was nec-
essary for its protease activity and its ability to activate caspase-3,
we next examined the possibility that caspase-11 is another target
protein regulated by p53 in neuronal apoptosis.
Whereas the significant increases in caspase-11 expression
and activity by TPEN were detected in p53 wild type neuronal
cultures (Fig. 3), no significant changes were observed in p53-
deficient neuronal cultures (Fig. 3). This result suggests that
caspase-11 could be another downstream molecule of p53-depen-
dent neuronal apoptosis.
Next, we investigated the effects of p53 on downstream events
of apoptosis by TPEN, cytochrome C release, and caspase-3 activa-
tion. Both cytochrome C release from mitochondria to cytosol and
nuclear condensation induced by TPEN were blocked completely
by CHX or genetic deletion of p53 (Fig. 4A). In addition, TPEN-in-
duced caspase-3 activation was blocked (Fig. 4B), suggesting that
p53-mediated de novo protein synthesis plays an essential role
in TPEN-induced neuronal apoptosis.
4. Discussion
We demonstrated that p53 is essential for TPEN-induced
neuronal apoptosis through the induction of PUMA/NOXA and
caspase-11. In previous reports, we showed that (1) cytochrome
C-mediated caspase-9 activation was not sufficient for caspase-3
activation and subsequent neuronal death [16], and (2) caspase-
11-mediated caspase-3 activation contributed to TPEN-induced
neuronal apoptosis [5]. Since expression of both PUMA/NOXA
and caspase-11 were increased by TPEN in a p53-dependent man-
ner, it is possible that both the mitochondria-mediated and cas-
pase-11-mediated pathways are regulated by p53 in TPEN-
induced neuronal apoptosis. As evidence, genetic depletion of
p53 almost completely blocked TPEN-induced neuronal death,
indicating the essential role of p53 as an upstream regulator in
TPEN-induced neuronal apoptosis.
The p53 tumor suppressor protein is a zinc-binding protein
containing several reactive cysteines [17,18]. The structure, bio-
chemical properties, and DNA-binding of p53 are dependent upon
zinc and redox regulation in vitro [17,18]. Exposure of wild type
p53 to metal chelators such as EDTA or o-phenanthroline results
in a rapid transition to the mutant form of p53, with loss of
DNA-binding activity [17]. However, excess zinc also alters p53
protein structure and down-regulates binding to DNA [17]. In in-
tact cells, intracellular free zinc modulates p53 activity and stabil-
ity [17]. Whereas TPEN causes p53 to accumulate in the ‘‘mutant”
form that is unable to bind DNA, another metal chelator, o-phenan-
1520 H. Ra et al. / FEBS Letters 583 (2009) 1516–1520
throline, increases p53 levels and DNA-binding activity [17]. Fur-
thermore, metallothioneins (MTs), a class of inducible proteins that
can bind up to seven zinc equivalents, can act as regulators of p53
activity, depending on their concentrations [17]. These results indi-
cate that the stability and activity of p53 are regulated by intracel-
lular free zinc. Therefore, zinc depletion by TPEN directly affects
p53 activity and stability, which initiates apoptotic signaling.
Although it is well known that p53 plays a critical role in apop-
tosis, the underlying mechanism remains unclear. Caspase-11 has
been suggested to be a representative effector induced by p53 in
the apoptosis pathway [19,20]. cDNA microarray analyses on
mouse bone marrow tissues after benzene exposure demonstrated
that caspase-11 rather than caspase-9 was greatly increased in a
p53-dependent manner [19]. In a chronic obstructive uropathy
(COU) model, RNase protection assay revealed that mRNA levels
for Bcl family (Bax, Bak, and Bcl-xL) and caspase family (caspase-
1, -11, and -12) were up-regulated in renal cell apoptosis [20]. Fur-
thermore, in p53-null mice, induction of caspase-1, -11, and -12
were markedly attenuated, and caspase-11 was completely unde-
tectable [20]. Consistent with these observations, p53 was required
for caspase-11 induction and activation by TPEN in our study. Our
results provide important insights into the mechanisms of neuro-
nal apoptosis in neurodegenerative diseases.
Acknowledgements
This study was supported by grants from the Korea Science &
Engineering Foundation (KOSEF) (M10412000012-07N1200-
01210 and R01-2006-000-10771-0(2008)).
References
[1] Coleman, J.E. (1992) Zinc proteins: enzymes, storage proteins, transcription
factors, and replication proteins. Annu. Rev. Biochem. 61, 897–946.
[2] Frederickson, C.J. and Bush, A.I. (2001) Synaptically released zinc:
physiological functions and pathological effects. Biometals 14, 353–366.
[3] Bozym, R.A., Thompson, R.B., Stoddard, A.K. and Fierke, C.A. (2006) Measuring
picomolar intracellular exchangeable zinc in PC-12 cells using a ratiometric
fluorescence biosensor. ACS Chem. Biol. 1, 103–111.
[4] Choi, D.W. and Koh, J.Y. (1998) Zinc and brain injury. Annu. Rev. Neurosci. 21,
347–375.
[5] Lee, J.M., Kim, Y.J., Ra, H., Kang, S.J., Han, S., Koh, J.Y. and Kim, Y.H. (2008) The
involvement of caspase-11 in TPEN-induced apoptosis. FEBS Lett. 582, 1871–
1876.
[6] Ahn, Y.H., Kim, Y.H., Hong, S.H. and Koh, J.Y. (1998) Depletion of intracellular
zinc induces protein synthesis-dependent neuronal apoptosis in mouse
cortical culture. Exp. Neurol. 154, 47–56.
[7] McCabe Jr., M.J., Jiang, S.A. and Orrenius, S. (1993) Chelation of intracellular
zinc triggers apoptosis in mature thymocytes. Lab. Invest. 69, 101–110.
[8] Makhov, P., Golovine, K., Uzzo, R.G., Rothman, J., Crispen, P.L., Shaw, T., Scoll,
B.J. and Kolenko, V.M. (2008) Zinc chelation induces rapid depletion of the X-
linked inhibitor of apoptosis and sensitizes prostate cancer cells to TRAIL-
mediated apoptosis. Cell Death Differ. 15, 1745–1751.
[9] Wilson, D., Varigos, G. and Ackland, M.L. (2006) Apoptosis may underlie the
pathology of zinc-deficient skin. Immunol. Cell Biol. 84, 28–37.
[10] Polyak, K., Xia, Y., Zweier, J.L., Kinzler, K.W. and Vogelstein, B. (1997) A model
for p53-induced apoptosis. Nature 389, 300–305.
[11] Chipuk, J.E., Bouchier-Hayes, L., Kuwana, T., Newmeyer, D.D. and Green, D.R.
(2005) PUMA couples the nuclear and cytoplasmic proapoptotic function of
p53. Science 309, 1732–1735.
[12] Villunger, A., Michalak, E.M., Coultas, L., Mullauer, F., Bock, G., Ausserlechner,
M.J., Adams, J.M. and Strasser, A. (2003) P53- and drug-induced apoptotic
responses mediated by BH3-only proteins puma and noxa. Science 302, 1036–
1038.
[13] Corniola, R.S., Tassabehji, N.M., Hare, J., Sharma, G. and Levenson, C.W. (2008)
Zinc deficiency impairs neuronal precursor cell proliferation and induces
apoptosis via p53-mediated mechanisms. Brain Res. 1237, 52–61.
[14] Uo, T., Kinoshita, Y. and Morrison, R.S. (2007) Apoptotic actions of p53 require
transcriptional activation of PUMA and do not involve a direct mitochondrial/
cytoplasmic site of action in postnatal cortical neurons. J. Neurosci. 27, 12198–
12210.
[15] Shieh, S.Y., Ikeda, M., Taya, Y. and Prives, C. (1997) DNA damage-
induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91,
325–334.
[16] Ahn, Y.H., Koh, J.Y. and Hong, S.H. (2000) Protein synthesis-dependent but Bcl-
2-independent cytochrome C release in zinc depletion-induced neuronal
apoptosis. J. Neurosci. Res. 61, 508–514.
[17] Hainaut, P. and Mann, K. (2001) Zinc binding and redox control of p53
structure and function. Antioxid. Redox Signal. 3, 611–623.
[18] Meplan, C., Richard, M.J. and Hainaut, P. (2000) Redox signalling and
transition metals in the control of the p53 pathway. Biochem. Pharmacol.
59, 25–33.
[19] Yoon, B.I. et al. (2003) Mechanisms of benzene-induced hematotoxicity and
leukemogenicity: cDNA microarray analyses using mouse bone marrow
tissue. Environ. Health Perspect. 111, 1411–1420.
[20] Choi, Y.J. et al. (2001) Role of p53-dependent activation of caspases in chronic
obstructive uropathy: evidence from p53 null mutant mice. J. Am. Soc.
Nephrol. 12, 983–992.