Methods in

Molecular Biology 1856

Ramona G. Dumitrescu
Mukesh Verma Editors

Cancer
Epigenetics
for Precision
Medicine
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
Cancer Epigenetics for Precision
Medicine

Methods and Protocols

Edited by

Ramona G. Dumitrescu
Kelly Government Solutions, Bethesda, MD, USA

Mukesh Verma
Division of Cancer Control and Population Sciences,
National Cancer Institute, National Institutes of Health, Bethesda, MD, USA
Editors
Ramona G. Dumitrescu Mukesh Verma
Kelly Government Solutions Division of Cancer Control and Population Sciences,
Bethesda, MD, USA National Cancer Institute, National Institutes of Health
Bethesda, MD, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-8750-4 ISBN 978-1-4939-8751-1 (eBook)
https://doi.org/10.1007/978-1-4939-8751-1
Library of Congress Control Number: 2018951780

© Springer Science+Business Media, LLC, part of Springer Nature 2018

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface

A new era in medical research commenced when President Obama announced the new
initiative in Precision Medicine at the State of the Union Address in January 2015.
“Tonight, I’m launching a new Precision Medicine Initiative to bring us closer to curing
diseases like cancer and diabetes—and to give all of us access to the personalized information we
need to keep ourselves and our families healthier.”
—President Barack Obama, State of the Union Address, January 20, 2015
President Obama’s research initiative aims to accelerate progress toward a targeted
prevention and treatment of many types of cancer and also to generate knowledge and
information that could be used for many other health outcomes and diseases. Epigenetics is
the area of science which can help achieve the aims of the Precision Medicine Initiative.
Epigenetic changes have a crucial role in the normal development and maintenance of
tissue-specific genes expression in humans, but also in the cancer initiation and progression.
These epigenetic modifications can be reversibly modified by numerous external stimuli, like
environmental and behavior factors, and they have become attractive targets for cancer
research in advancing precision medicine efforts. Recent developments in high-throughput
genomic, transcriptomic, proteomic, and epigenomic technologies increased further our
understanding of the molecular changes in different types of cancer. These developments
help us look at variations that could explain genetic susceptibility, clinical outcomes, or drug
responses. Different tumor types exhibit different methylation profiles that shine a light on
our understanding of the mechanisms impaired in those tumors, but also highlight the
possible targets for personalized cancer therapy. Precision oncology has the potential to
revolutionize the health care paradigm by integrating this type of personal molecular
information to strengthen health care, especially when environmental factors contributing
to epigenome changes are taken into account.
This book discusses specific epigenetic changes identified in early carcinogenic lesions
and in different tumor types and several factors that modify the epigenome and epigenetic
profiles, including diet, alcohol, immunity, age, circadian rhythm, and the microbiome. The
methods used to detect the epigenetic modifications are also described.
In conclusion, the assessment and validation of epigenetic changes and epigenetic-based
screening methodology could lead to the identification of potential biomarkers extremely
valuable for the prevention, diagnosis, and prognosis of different cancer types, accelerating
progress in precision medicine.

Bethesda, MD, USA Ramona G. Dumitrescu

Bethesda, MD, USA Mukesh Verma

v
Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

PART I EARLY EPIGENETIC CHANGES AND NEW EPIGENETIC TARGETS

IN DIFFERENT TYPES OF CANCERS

1 Early Epigenetic Markers for Precision Medicine. . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

Ramona G. Dumitrescu
2 Interplay Between Genetic and Epigenetic Changes in Breast
Cancer Subtypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
Ramona G. Dumitrescu
3 Role of Microbiome in Carcinogenesis Process and Epigenetic
Regulation of Colorectal Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Lulu Farhana, Hirendra Nath Banerjee, Mukesh Verma,
and Adhip P.N. Majumdar
4 Epigenome-Based Precision Medicine in Lung Cancer . . . . . . . . . . . . . . . . . . . . . . 57
Dongho Kim and Duk-Hwan Kim
5 Epigenetics in Hematological Malignancies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Nataly Cruz-Rodriguez, Alba L. Combita, and Jovanny Zabaleta
6 MicroRNAs Role in Prostate Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
Ovidiu Balacescu, Ramona G. Dumitrescu, and Catalin Marian

PART II CONTRIBUTING ENVIRONMENTAL FACTORS TO EPIGENETIC

CHANGES LEADING TO CANCER DEVELOPMENT

7 Effects of Dietary Nutrients on Epigenetic Changes in Cancer. . . . . . . . . . . . . . . . 121

Nicoleta Andreescu, Maria Puiu, and Mihai Niculescu
8 Diet, Microbiome, and Epigenetics in the Era of Precision Medicine . . . . . . . . . . 141
Gabriela Riscuta, Dan Xi, Dudith Pierre-Victor,
Pamela Starke-Reed, Jag Khalsa, and Linda Duffy
9 Alcohol-Induced Epigenetic Changes in Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Ramona G. Dumitrescu
10 Epigenetic Basis of Circadian Rhythm Disruption in Cancer . . . . . . . . . . . . . . . . . 173
Edyta Reszka and Shanbeh Zienolddiny
11 Epigenetic Changes of the Immune System with Role in Tumor
Development. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203
Irina Daniela Florea and Christina Karaoulani
12 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies . . . . . . . . . 219
Unhee Lim and Min-Ae Song

vii
viii Contents

13 Challenges and Opportunities in Social Epigenomics and Cancer . . . . . . . . . . . . . 233

Krishna Banaudha, Vineet Kumar, and Mukesh Verma

PART III METHODS USED IN CANCER EPIGENOMICS

14 Epigenetic and Genetic Regulation of PDCD1 Gene in Cancer

Immunology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Alok Mishra and Mukesh Verma
15 Methylation and MicroRNA Profiling to Understand Racial
Disparities of Prostate Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
Hirendra Nath Banerjee, William Kahan, Vineet Kumar, and Mukesh
Verma
16 Analysis of DNA Hypermethylation in Pancreatic Cancer Using
Methylation-Specific PCR and Bisulfite Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . 269
Bin Liu and Christian Pilarsky
17 Pyrosequencing Methylation Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
Matthew Poulin, Jeffrey Y. Zhou, Liying Yan, and Toshi Shioda

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Contributors

NICOLETA ANDREESCU  Medical Genetics Discipline, Center of Genomic Medicine,

University of Medicine and Pharmacy “Victor Babes”, Timisoara, Romania
OVIDIU BALACESCU  Department of Functional Genomics, Proteomics and Experimental
Pathology, The Oncology Institute “Prof. Dr. Ion Chiricuta”, Cluj-Napoca, Romania
KRISHNA BANAUDHA  Department of Biochemistry and Molecular Biology, School of Medicine
and Public Health, George Washington University, Washington, DC, USA
HIRENDRA NATH BANERJEE  Department of Natural, Pharmacy and Health Sciences,
Elizabeth City State University/University of North Carolina, Elizabeth City, NC, USA
ALBA L. COMBITA  Programa de Investigaci
on e Innovaci
on en Leucemias Agudas y
Cr
o nicas (PILAC), Instituto Nacional de Cancerologı́a, Bogotá, Colombia; Grupo de
Investigaci
on en Biologı́a del Cáncer, Instituto Nacional de Cancerologı́a, Bogotá,
Colombia
NATALY CRUZ-RODRIGUEZ  Programa de Investigaci
on e Innovaci
on en Leucemias Agudas y
Cr
o nicas (PILAC), Instituto Nacional de Cancerologı́a, Bogotá, Colombia; Grupo de
Investigaci
on en Biologı́a del Cáncer, Instituto Nacional de Cancerologı́a, Bogotá,
Colombia; Programa de Doctorado en Ciencias Biol
ogicas, Pontificia Universidad
Javeriana, Bogotá, Colombia
LINDA DUFFY  National Center for Complementary and Integrative Health, Bethesda, MD,
USA
RAMONA G. DUMITRESCU  Kelly Government Solutions, Bethesda, MD, USA
LULU FARHANA  Veterans Affairs Medical Center, Research Service, Detroit, MI, USA;
Department of Internal Medicine, Wayne State University, Detroit, MI, USA
IRINA DANIELA FLOREA  Department of Immunology, University of Medicine and Pharmacy,
Iasi, Romania
WILLIAM KAHAN  Department of Natural, Pharmacy and Health Sciences, Elizabeth City
State University/University of North Carolina, Elizabeth City, NC, USA
CHRISTINA KARAOULANI  University of Medicine and Pharmacy, Iasi, Romania
JAG KHALSA  Medical Consequences of Drug Abuse and Co-occurring Infections Branch,
National Institute of Drug Abuse, Rockville, MD, USA
DONGHO KIM  Department of Molecular Cell Biology, Sungkyunkwan University School of
Medicine, Suwon, South Korea
DUK-HWAN KIM  Department of Molecular Cell Biology, Sungkyunkwan University School of
Medicine, Suwon, South Korea; Samsung Medical Center, Research Institute for Future
Medicine, Seoul, South Korea
VINEET KUMAR  Department of Pharmacology, National University of Singapore, Singapore,
Singapore
UNHEE LIM  University of Hawaii Cancer Center, HI, USA
BIN LIU  Department of Surgery, Universit€ a tsklinikum Erlangen, Friedrich-Alexander
Universit€ at Erlangen, Erlangen, Germany
ADHIP P. N. MAJUMDAR  Veterans Affairs Medical Center, Research Service, Detroit, MI,
USA; Department of Internal Medicine, Wayne State University, Detroit, MI, USA;
Karmanos Cancer Institute, Wayne State University-School of Medicine, Detroit, MI, USA

ix
x Contributors

CATALIN MARIAN  Department of Biochemistry and Pharmacology, Victor Babes University of

Medicine and Pharmacy, Timisoara, Romania
ALOK MISHRA  The Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University,
Baltimore, MD, USA
MIHAI NICULESCU  Medical Genetics Discipline, Center of Genomic Medicine, University of
Medicine and Pharmacy “Victor Babes”, Timisoara, Romania; Advanced Nutrigenomics,
Hillsborough, NC, USA
DUDITH PIERRE-VICTOR  Division of Cancer Prevention, National Cancer Institute,
Rockville, MD, USA
CHRISTIAN PILARSKY  Department of Surgery, Universit€ a tsklinikum Erlangen, Friedrich-
Alexander Universit€ a t Erlangen, Erlangen, Germany
MATTHEW POULIN  EpigenDx, Inc., Hopkinton, MA, USA
MARIA PUIU  Medical Genetics Discipline, Center of Genomic Medicine, University of
Medicine and Pharmacy “Victor Babes”, Timisoara, Romania
EDYTA RESZKA  Department of Molecular Genetics and Epigenetics, Nofer Institute of
Occupational Medicine, Lodz, Poland
GABRIELA RISCUTA  Division of Cancer Prevention, National Cancer Institute, Rockville,
MD, USA
TOSHI SHIODA  Massachusetts General Hospital Center for Cancer Research, Harvard
Medical School, Charlestown, MA, USA
MIN-AE SONG  Division of Environmental Health Sciences, College of Public Health,
The Ohio State University, Columbus, OH, USA
PAMELA STARKE-REED  Nutrition, Food Safety and Quality, Agricultural Research Service,
USDA, Beltsville, MD, USA
MUKESH VERMA  Methods and Technologies Branch, Epidemiology and Genomics Research
Program, Division of Cancer Control and Population Sciences, National Cancer Institute,
National Institutes of Health, Bethesda, MD, USA
DAN XI  Division of Cancer Treatment and Diagnosis, National Cancer Institute,
Rockville, MD, USA
LIYING YAN  EpigenDx, Inc., Hopkinton, MA, USA
JOVANNY ZABALETA  Department of Pediatrics, Louisiana State University Health Sciences
Center, New Orleans, LA, USA; Stanley S. Scott Cancer Center, LSUHSC, New Orleans,
LA, USA; Louisiana Cancer Research Center, New Orleans, LA, USA
JEFFREY Y. ZHOU  University of Massachusetts Medical School, Worcester, MA, USA
SHANBEH ZIENOLDDINY  Department of Biological and Chemical Work Environment,
National Institute of Occupational Health, Oslo, Norway
 Part I

Early Epigenetic Changes and New Epigenetic Targets in

Different Types of Cancers
 Chapter 1

Early Epigenetic Markers for Precision Medicine

Ramona G. Dumitrescu

Abstract
Over the last years, epigenetic changes, including DNA methylation and histone modifications detected in
early tumorigenesis and cancer progression, have been proposed as biomarkers for cancer detection, tumor
prognosis, and prediction to treatment response. Importantly for the clinical use of DNA methylation
biomarkers, specific methylation signatures can be detected in many body fluids including serum/plasma
samples. Several of these potential epigenetic biomarkers detected in women’s cancers, colorectal cancers,
prostate, pancreatic, gastric, and lung cancers are discussed. Studies conducted in breast cancer, for
example, found that aberrant methylation detection of several genes in serum DNA and genome-wide
epigenetic change could be used for early breast cancer diagnosis and prediction of breast cancer risk. In
colorectal cancers, numerous studies have been conducted to identify specific methylation markers impor-
tant for CRC detection and in fact clinical assays evaluating the methylation status of SEPT19 gene and
vimentin, became commercially available. Furthermore, some epigenetic changes detected in gastric washes
have been suggested as potential circulating noninvasive biomarkers for the early detection of gastric
cancers. For the early detection of prostate cancer, few epigenetic markers have shown a better sensitivity
and specificity than serum PSA, indicating that the inclusion of these markers together with current
screening tools, could improve early diagnosis and may reduce unnecessary repeat biopsies. Similarly, in
pancreatic cancers, abnormal DNA methylation of several genes including NPTX2, have been suggested as
a diagnostic biomarker. Epigenetic dysregulation was also observed in several tumor suppressor genes and
miRNAs in lung cancer patients, suggesting the important role of these changes in cancer initiation and
progression. In conclusion, epigenetic changes detected in biological fluids could play an essential role in
the early detection of several cancer types and this may have a great impact for the cancer precision medicine
field.

Key words Early epigenetic markers, Women’s cancers, Colorectal cancers, Prostate, Pancreatic,
Gastric and lung cancers, Genome-wide methylation, miRNAs, Screening, Precision medicine

1 Introduction

Over the last years many studies have shown the importance of
epigenetic changes, including DNA methylation and histone mod-
ifications in early tumorigenesis and cancer progression, and pro-
posed to validate these markers for clinical use. There are three
oncology areas that could benefit from the use of DNA methylation

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_1,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

3
4 Ramona G. Dumitrescu

biomarkers, namely cancer detection, tumor prognosis, and predic-

tion of treatment responses, or pharmacoepigenetics [1].
The most frequently described epigenetic change in carcino-
genesis is the DNA promoter hypermethylation. This is especially
relevant when a small proportion of epithelial tumors have tumor
suppressor genes silenced by specific mutations while many more
genes were inactivated through DNA hypermethylation [2].
It has been shown that methylation signatures can be detected
in many body fluids including serum/plasma, nipple fluid aspirate,
vaginal fluid, and urine, importantly for the clinical use of DNA
methylation biomarkers [3, 4]. For example, blood samples can be
easily obtained and determining the concentration of circulating
cell-free DNA (ccfDNA) in the serum, which is higher in cancer
patients, is an important strategy used to evaluate the tumor-
specific DNA methylation. The changes in DNA methylation pat-
terns can be assessed accurately in ccfDNA [4, 5].
It has been considered that the analysis of tumor-specific DNA
methylation biomarkers in serum has several advantages like
improved sensitivity as cfDNA can be amplified by PCR; fewer
false positives, as the methylation patterns of specific gene are
usually conserved; chemical and biological stability, as the methyla-
tion patterns are not affected by the collection and transportation
conditions; detection of the DNA methylation as a positive signal in
cancer patients’ samples; assay design benefits as epigenetic markers
could be easier to identify versus genetic alterations found through-
out a specific gene and these assays could be adapted to commercial
platforms and high-throughput technology [3].

2 DNA Methylation for Early Detection of Women’s Cancers: Breast, Ovarian,

Endometrial, and Cervical

Several methylation markers of diagnosis were suggested for

women’s cancers [3, 6] but very few are on their way to clinical
use. In the past, due to the technical difficulties of conducting
methylation analysis, like nonspecificity, lack of sensitivity, and
labor-intensive methodology, there were a small number of meth-
ylation markers in breast, ovarian, and endometrial cancers. How-
ever, with the advancement of technology and development of
specific statistical analysis tools, some of the methylation biomar-
kers described below could become useful clinical markers for the
early detection of these women’s cancers. Here some of these
methylation markers are described.

2.1 Breast Cancer There are several tools used to diagnose breast cancer at an earlier
stage, including mammography, biopsy of suspicious breast tissue
by fine needle biopsy and histopathological processing [6], but
 Early Epigenetic Markers for Precision Medicine 5

some of these methods are associated with false positive results and
harmful consequences.
Methylation changes were widely described in breast cancer
development [7] and several studies focused on changes that
could be detected in early carcinogenesis of the breast [8].
Most studies that examined early changes in breast cancer
epigenome used either human mammary epithelial cells
(HMECs) or variant HMECs (vHMECs) [8], which are cells
derived from breast tissues surgically removed during the reduction
mammoplasty procedure in healthy women. Some of the early
epigenetic changes observed in these cells include the DNA pro-
moter hypermethylation of p16INK4a tumor suppressor gene, the
transforming growth factor beta (TGFB) gene, leading to silencing
and increase expression of the chromatin methyltransferase EZH2
[9].
Furthermore, differentially methylated regions (DMRs) were
identified in early passages of vHMECs and the DNA hypermethy-
lation of target loci was found to be regulated by key transcriptional
factors like p53, AHR, and E2F family members [10]. This finding
supports the hypothesis that breast cancer develops when there is
epigenetic disruption of the transcription factor binding that could
lead to deregulation of numerous pathways involved in
carcinogenesis.
Over the last few years, it has been suggested that blood-based
DNA methylation markers could be used to assess breast cancer risk
[11, 12].
A study conducted by Uehiro and colleagues found that several
epigenetic changes can differentiate healthy volunteers from breast
cancer patients, with high accuracy [13]. The panel of 12 novel
epigenetic markers, identified after a methylation array analysis was
conducted, has been suggested by the authors for the early detec-
tion of breast cancer as this system is similar to the mammography
screening detection [13].
Similar results were shown by a different study looking at a
panel of 6 genes, reporting a high sensitivity and specificity in breast
cancer diagnosis when compared with healthy and benign disease
controls [13]. These findings suggest that aberrant methylation
detection of several genes in serum DNA could be used for early
breast cancer diagnosis.
In addition, several studies found that epigenome-wide hypo-
methylation is associated with increased breast cancer risk
[12, 14]. Moreover, the decreased average methylation levels
were detected in blood samples, years before breast cancer diagno-
sis, indicating that this genome-wide epigenetic change could be a
useful clinical biomarker, with predictive value for breast cancer
risk [14].
6 Ramona G. Dumitrescu

Thus, conducting more research on these epigenetic alterations

could help develop appropriate epigenetic biomarkers for breast
cancer screening and early detection.

2.2 Ovarian Cancer For the ovarian cancer, the early diagnosis is extremely important
for the treatment and prognosis of this devastating disease. Unfor-
tunately, the current methods of investigation, the pelvic examina-
tion and ultrasound have not achieved early diagnosis very
successfully, most cases being diagnosed at an advanced stage.
Also, markers like CA125 have a low sensitivity and are not very
effective in diagnosing ovarian cancers in earlier stages. Therefore,
the methylation markers could potentially be better tolls for early
detection of ovarian cancers as epigenetic changes are detected in
early stages of carcinogenesis in other cancer types.
A study looking at the promoter methylation status of BRCA1,
RASSF1A, APC, p14 ARF, p16 INK4a, and DAPK in 50 patients
with ovarian or primary peritoneal tumors found that the hyper-
methylation phenotype was detected with an 82% sensitivity and
100% specificity in all histologic cell types, grades, and stages of
ovarian tumors examined. It was concluded that these genes’ pro-
moter hypermethylation is involved in early ovarian tumorigenesis
and can be detected in the serum DNA from patients with stage IA
or B tumors and in cytologically negative peritoneal fluid. This
finding suggests that the analysis of the methylation status of several
genes in serum could help with the early detection of ovarian
cancer [15].

2.3 Endometrial It has been described that there are specific methylation profiles in
Cancer the two types of endometrial cancer [6]. More specifically, in type
1 endometrial cancer, promoter hypermethylation of PTEN,
hMLH1, MGMT, and APC genes is observed more frequently,
while in type 2 endometrial cancer, progesterone receptor hyper-
methylation is more common and reduced expression of DNMT1
and DNMT3B, is associated with global hypomethylation and an
aggressive tumor [6]. In addition, analyzing the methylation status
of CDH13, HSPA2, MLH1, RASSF1A, and SOCS2 genes in
vaginal secretions, a differential methylation was observed with a
high sensitivity and specificity [16].
A DNA methylation profiling on a population-based endome-
trial cancers was conducted to identify early detection methylation
biomarkers, which led to the identification of 114 CpG sites
showing differential methylation between endometrial carcinoma
and normal endometrium [17]. The ADCYAP1, ASCL2, HS3ST2,
HTR1B, MME, NPY, and SOX1 genes were selected for further
validation and it showed that methylation markers could be used to
distinguish women with endometrial carcinoma from the majority
of women without malignancy but abnormal vaginal bleeding [18].
 Early Epigenetic Markers for Precision Medicine 7

Furthermore, additional methylation changes in genes like

RASSF1 and HOXA9 were observed in endometrial cancers versus
benign endometrium. Also, the DNA hypermethylation in tissues
was identified analyzing the DNA collected from vaginal pool
samples [18]. This suggests that the methylation biomarkers
could be identified in different biological samples and be useful
for the early detection of endometrial cancers.

2.4 Cervical Cancer Epigenetic changes were described in cervical cancers in all stages.
Despite the existence of effective screening methods for cervical
cancer by cytology, there is the need to identify women with early
cervical lesions by using molecular biomarkers detection by nonin-
vasive methods.
When the methylation status of several genes was examined in
cervical scrapings, it was found that the promoter methylation of a
panel of four genes, CALCA, DAPK, ESR1, and APC has a com-
parable sensitivity and potentially better specificity than the cyto-
morphological assessment and high-risk-HPV detection
[19]. Furthermore, specific hypermethylated differentially methy-
lated regions (DMRs) have been suggested as potential biomarkers
for the early detection of cervical cancer as they show specific DNA
methylation profiles in high-grade cervical intraepithelial neoplasia
(CIN) lesions [20].
In addition, the methylation-mediated silencing of tumor sup-
pressor miRNAs like hsa-mir-129-2/-935/-3663/-3665 and
-4281 was detected in cervical precancerous lesions and were asso-
ciated with a pathological phenotype. This finding indicates the
importance of these miRNAs’ epigenetic changes during early
stages of carcinogenesis and the potential use of these biomarkers
for early detection [21].
Numerous studies explored the epigenetic changes in early
cervical carcinogenesis, including the methylation of HPV genes
and the potential of these methylation markers for clinical use;
however, slower progress was made toward moving these findings
into clinical practice [22]. Yet it is believed that genome-wide
studies could find the methylation biomarkers that would be most
relevant for clinical practice in the next few years.

3 Colorectal Cancers

Three main pathways were described to be involved in colorectal

(CRC) carcinogenesis [23]. One of these pathways involves the
activation of oncogenes like KRAS and inactivation of tumor sup-
pressor genes like APC, DCC, SMAD4, and TP53 through specific
genes mutations, leading to chromosomal instability and ultimately
to neoplastic transformation. Another mechanism well described in
CRC, involves mutations in genes responsible for the repair of
8 Ramona G. Dumitrescu

errors occurring during DNA replication (MSH2, MLH1, MSH6,

PMS2, MLH3, MSH3, PMS1, and Exo1), leading to microsatellite
instability which is observed in Lynch syndrome and about
15%–20% of the sporadic CRCs [23]. The third pathway that
plays an important role in CRC carcinogenesis, is the abnormal
patterns of DNA methylation. More specifically, DNA promoter
hypermethylation, leading to genes silencing, was frequently
observed in many genes in CRC and this phenotype was called
CpG island methylator phenotype (CIMP). A colorectal tumor
that presents methylation of at least three of the following genes
CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1 is consid-
ered a CIMP-positive tumor [24]. This phenotype was observed in
about 15%–20% of the sporadic CRC and is associated with specific
tumor characteristics important for CRC diagnosis and
treatment [23].
It has been observed that DNA hypermethylation of suppressor
gene promoters is an early event in colorectal carcinogenesis,
making these markers attractive targets for the early detection of
CRCs [25, 26]. For example, a study conducted by Yi JM and
colleagues, showed that promoter DNA hypermethylation of
FBN2 and TCERG1L, was associated with gene silencing in CRC
tumors, suggesting that these epigenetic changes could be good
biomarkers for the early detection of CRC [27]. Also, the methyla-
tion of RUNX3, CRBP1, SLC5A8, CDH13, and SFRP2 genes has
been shown to be associated with normal colonic mucosa
transformation [28].
Furthermore, the abnormal DNA methylation of CRC cells has
been detected in the DNA obtained from blood or feces samples
from patients with colorectal cancer [29]. For instance, a genome-
wide analysis in CRC lead to the identification of a novel methyla-
tion biomarker, SDC2 methylation that was able to detect stage I
tumor with a sensitivity of 92.3% [30]. This finding suggests that
SDC2 methylation could become a blood-based DNA test for early
detection of CRC.
Additionally, it has been observed that DNA methylation of
NEUROG1 could be detected with high sensitivity in the serum
samples of patients with early colorectal cancer [31]. Also, DNA
methylation changes in genes with tumor suppressor role, like
NDRG4, GATA4, and SFRP2 genes, have been studied for their
potential role as fecal-based biomarkers that could help with the
early detection of CRC [32].
Although numerous studies have been conducted to identify
specific methylation markers important for the CRC diagnosis, only
few have completed the clinical trials and have been made commer-
cially available, namely the methylation of SEPT19 gene and
vimentin. One licensed DNA methylation assay is ColoVantage®,
which is blood-based and examines the methylation of the SEPT9
gene. The sensitivity of the SEPT9 methylated DNA assay for early
 Early Epigenetic Markers for Precision Medicine 9

stage CRC (stages 1 and 2) diagnosis was found to be 87%

[33]. Tumors in the cecum, the rectum, and the sigmoid colon
were detected using this assay. Also, it has been shown that detec-
tion of methylated SEPT9 in plasma, reliably identifies both left-
and right-sided colon cancers [34]. There are two other assays
focusing on SEPT9 methylation that are currently used for the
detection of CRC. These are the Epi proColon® 1.0 and Abbott
RealTime mS9.
In addition, there is the ColoSureTM test, which is a clinically
available fecal-based methylation assay, focusing on the methylation
of the vimentin gene [35]. Due to a wide range of sensitivity
observed, the test is recommended along with colonoscopy.
It is considered that if one biomarker like the methylation of
SEPT9 has a high sensitivity, the use of a biomarkers panel could
achieve a higher sensitivity if the appropriate biomarkers are
selected. For example, Lind and colleagues evaluated a methylation
status of a panel of six genes CNIP1, FBN1, INA, SNCA, MAL,
and SPG20 and found that the methylation testing (at least two
positive markers out of six) of this panel achieved a sensitivity of
94% for colorectal cancers and 93% for adenoma samples, with a
specificity of 98% [36]. Several other studies examined the sensitiv-
ity of other biomarkers including the methylated BMP3, NDRG4,
vimentin, and TFPI2, in fecal samples and compared it with the
SEPT9 plasma-based methylation marker and found that fecal-
based biomarkers panel could achieve a higher sensitivity than
SEPT9 assay in plasma [37].
Thus, progress was made in bringing epigenetic markers into
clinical use for the early detection of colorectal cancers. However,
more research is conducted for improving the sensitivity and speci-
ficity of some of these assays.

4 Gastric Cancers

Gastric cancers (GC) are usually diagnosed at later stage and that
affects the 5-year survival rate which is approximately 20%–25%
worldwide [38]. However, if GC is detected at early stage the
survival improves substantially [38], emphasizing the importance
of early diagnosis of GC. Aberrant DNA methylation of tumor
suppressor genes is an early and frequent event in gastric carcino-
genesis. Genes involved in the DNA mismatch repair, cell adhesion,
cell cycle, ubiquitination, nuclear transcription, and cancer signal-
ing pathways were found to be silenced by promoter CpG islands
hypermethylation in gastric cancers [39].
It has been reported that the first-generation tumor markers,
such as CEA, CA19-9, and CA72-4, were not appropriate for the
screening and early detection of GC. In fact, the attention was
directed toward circulating tumor DNA, which contains not only
10 Ramona G. Dumitrescu

tumor-specific genetic information but also information about the

DNA methylation changes, with the hope that DNA methylation
tests in GC patients would facilitate early detection and diagnosis
of GC.
For example, p16 gene, one of the most frequently methylated
genes in GC, has been detected both in cancer tissues and the
corresponding serum from GC patients, suggesting that p16 meth-
ylation is a potential biomarker for the early detection of GC
[39, 40]. Also, aberrant promoter methylation in DAP-kinase,
E-cadherin, and p15 was detected in a substantial proportion of
gastric cancer patients’ serum, while none of the controls’ serum
exhibited aberrant methylation [41]. Moreover, the methylation of
other genes including RUNX3, MGMT, TFPI, RASSF1A, and
SOCS1, detected in patients’ serum were reported to be useful
biomarkers for the early detection of GC [40]. When DNA pro-
moter hypermethylation status of APC, E-cadherin, GSTP1,
hMLH1, MGMT, p15, p16, SOCS1, TIMP3, and TGF-beta
genes was examined, APC, E-cadherin, hMLH1, and TIMP3
genes were significantly methylated in the GC patients compared
with healthy individuals and the methylation of some of these genes
was also detected in the patients’ serum [42]. Other groups identi-
fied DNA methylation of RNF180, SLC19A3, CYP26B1, secreted
frizzled-related protein 2 as potential noninvasive diagnostic mar-
kers for GC [39]. These potential circulating noninvasive biomar-
kers should be further validated in order to be used in clinical
practice for the early detection of gastric cancer patients from
different populations.
In addition, methylation markers were examined in the gastric
washes and it has been suggested that the detection of molecular
markers in gastric washes is a potential noninvasive approach to
screening for GC. For instance, when MINT25, RORA, GDNF,
ADAM23, PRDM5, and MLF1 genes’ methylation status was
analyzed in gastric washes, it has been observed that the methyla-
tion levels of these six genes increases with the progression to early
gastric cancer [43].
Among these genes, MINT25 methylation exhibited the best
sensitivity and specificity in terms of tumor detection in gastric
washes, suggesting that this methylation marker is a sensitive and
specific marker for GC screening. Moreover, gastric wash-based
DNA methylation analysis revealed that the detection of Sox17
methylation could be useful for early detection of GC patients [44].
In summary, detecting aberrant DNA methylation in the
serum/or plasma and gastric washes of gastric cancer patients,
could become important tools in clinical practice.
 Early Epigenetic Markers for Precision Medicine 11

5 Prostate Cancer

Prostate cancer (PC) is the one of the most common cancer diag-
nosed in US men [45]. Currently, the noninvasive method that is
used for prostate cancer screening is the measurement of the serum
prostate-specific antigen (PSA) level. Nevertheless, the sensitivity
and of specificity PSA are pretty low, resulting in unnecessary
biopsies. Therefore, biomarkers for early detection of PC are
needed and epigenetic markers appear to be good targets.
For instance, a recent study conducted by Brait M. and collea-
gues found that DNA promoter methylation of MCAM, ERα and
ERβ genes has better sensitivity and specificity than serum PSA,
suggesting that these epigenetic markers could be used for the early
detection of prostate cancer [46].
Several studies have shown that glutathione S-transferase gene
(GSTP1) hypermethylation in plasma, serum and/or urine samples
could predict PC with much higher specificity than PSA. However,
the sensitivity of GSTP1 was no higher than that of PSA, indicating
that measurement of GSTP1 promoter methylation in body fluids
may complement PSA screening for prostate cancer [47].
Furthermore, it has been observed that the detection of
GSTP1, APC, and RASSF1 genes’ methylation status in initially
negative prostate biopsies had a high negative predictive value
(90%) and had predicted the incidence of PCA independent of
clinicopathologic variables. Thus, including these epigenetic mar-
kers among the screening tools for PC could improve early detec-
tion of prostate cancer and may reduce unnecessary repeat
biopsies [48].

6 Pancreatic Cancer

With the emerging technology that allows for the detection of

epigenetic changes in small amounts of sample including biopsy
sample, small amount of plasma from blood or a formalin-fixed,
paraffin-embedded tissue, epigenetic-based biomarkers have
become potential targets for early detection of cancer [49]. That
is particularly important for pancreatic cancer where there are no
specific and sensitive serological markers for diagnosis. Therefore,
several studies examined the performance of epigenetic biomarkers
for the diagnosis of pancreatic cancers.
For instance, using a high-throughput microarrays platform,
UCHL1, NPTX2, SARP2, CLDN5, LHX1, WNT7A, FOXE1,
TJP2, CDH3, and ST14 genes were found aberrantly methylated
in pancreatic cancer but rarely, in normal pancreatic ductal epithelia
[50]. Furthermore, it was observed that NPTX2 methylation
detected in plasma NPTX2 could distinguish between pancreatic
12 Ramona G. Dumitrescu

cancer and chronic pancreatitis with 80% sensitivity and 76%, speci-
ficity, suggesting that this epigenetic biomarker could become a
diagnostic marker [51].
Another study that used a microarray coupled with methyl-
CpG-targeted transcriptional activation (MeTA-array) found
CSMD2, SLC32A1, and TRH genes hypermethylated in pancre-
atic cancers [52]. Also, epigenetic suppression of SLIT-ROBO
signaling and upregulation of MET and ITGA2 expression were
observed, when genome-wide DNA methylation status was ana-
lyzed in pancreatic ductal adenocarcinoma, indicating the impor-
tance of DNA methylation in pancreatic carcinogenesis [53].
Moreover, when methylation status of cell-free circulating
DNA from healthy controls, chronic pancreatitis patients, and pan-
creatic cancer patients was analyzed, 17 gene promoters important
for differential diagnosis were identified with high specificities [54].
Thus, conducting more research on these epigenetic changes in
pancreatic cancers could lead to epigenetic-based strategies that
may be used for the early detection of pancreatic cancers.

7 Lung Cancer

Lung cancer (LC) is the leading cause of cancer death in both men
and women and accounts for one in four cancer deaths
[55]. Despite advances in chemotherapy, radiation therapy and
surgical management of lung cancer, the survival did not improve
substantially. Therefore, early detection would be extremely impor-
tant in decreasing the burden of lung cancer. Currently, the early
detection relies on an invasive method to collect either pleural fluid
or tissue or on the computed tomography (CT) screening method.
Unfortunately, the CT is expensive, exposes patients to high doses
of radiation and may not detect malignancies very early. Thus, new
methods that would be less invasive and easier to conduct would be
necessary to address lung cancer burden and improve survival. Over
the last years, the analysis of circulating (cell-free) nucleic acids have
been recognized as potential useful tool for cancer screening, prog-
nosis, and treatment as the levels of these nucleic acids change
during cell transformation [56]. In fact, circulating epigenetic bio-
markers were detected in lung malignancies [57].
More specifically, tumor suppressor genes such as p16INK4A,
RARB2, RASSF1A, and SOX17 were found abnormally methy-
lated in the blood samples of lung cancer patients [57]. Also, it
was recently observed that miRNA expression patterns can be used
for lung cancer detection and prognosis prediction. When the
miRNAs expression was studied in lung cancer, it was found that
there are specific miRNA expression profiles of seven upregulated
miRNAs (miR-21, miR-210, miR-182, miR-31, miR-200b,
miR-205, and miR-183) and eight downregulated miRNAs
 Early Epigenetic Markers for Precision Medicine 13

(miR-126-3p, miR-30a, miR-30d, miR-486-5p, miR-451a,

miR-126-5p, miR-148, and miR-145) [58].
Among these miRNAs, miR-21 was reported to be involved in
the development and progression of lung cancer by affecting path-
ways like JAK/STAT, MAPK, Wnt, PPAR signaling pathways and
other pathways [59]. In addition, miR-21 together with members
of the miR-183 family and several miRNAs related to angiogenesis
including miR-126 and miR-155, were found to be associated with
worse prognosis and short survival of lung cancer patients [59–63].
It has been suggested that these serum miRNAs could be
derived from tumor cells so that several panels of circulating miR-
NAs have been proposed to be used in clinical practice, for the early
detection, prognosis, and therapy monitoring of LC [64, 65]. It
has been found that miRNA expression in plasma samples collected
from disease-free smokers enrolled in the screening trial, 1–2 years
before the onset of disease and at the time of diagnosis by CT scan
could be used for the prediction, detection, and prognosis of lung
cancers [64]. Furthermore, a study looking at the lung cancer
detection performance of a noninvasive plasma microRNA signa-
ture classifier (MSC) compared to the low-dose computed tomog-
raphy (LDCT), found that MSC could reduce the false-positive rate
of LDCT, increasing the efficacy of lung cancer screening [65].
Furthermore, it has been found that miRNA let-7a-3 is upre-
gulated in lung adenocarcinoma through hypomethylation, sug-
gesting that the aberrant miRNA gene methylation is involved in
lung carcinogenesis [66]. Several other epigenetic changes of miR-
NAs have been shown to be important for lung cancer prognosis
and treatment [67], indicating that development of miRNA-based
strategies for the diagnosis and treatment of lung cancer could help
in reducing the burden of lung cancer.
Moreover, a recent study found that the methylation of short
stature homeobox 2 gene (SHOX2) and prostaglandin E receptor
4 (PTGER4) genes detected in plasma samples could differentiate
between lung cancers and nonmalignant lung disease [68], indicat-
ing the importance of this DNA methylation marker panel for lung
cancer detection.

8 Conclusion

Thus, it has been shown that the methylation of certain gene-

specific CpG motifs is much higher than genetic defects and
could be easily detectable. In addition, alterations in DNA methyl-
ation occur quite early during the progression of tumor, leading to
gain/loss of function of critical genes that were associated with the
activation of oncogenes and silencing of tumor suppressor genes.
Therefore, the evaluation and validation of epigenetic changes and
epigenetic-based screening strategies could lead to the
14 Ramona G. Dumitrescu

identification of potential diagnostic and prognostic markers

extremely valuable for cancer clinical care.
These discoveries in the field of epigenetics highlighting the
critical role of DNA methylation in tumor development generate
new opportunities to identify epigenetic biomarkers for early detec-
tion and personalized treatment of cancer, the hallmark of precision
medicine.

References
1. Rodriguez-Paredes M, Esteller M (2011) Can-
cer epigenetics reaches mainstream oncology.
Nat Med 17(3):330–339
2. Jones PA, Baylin SB (2007) The epigenomics
of cancer. Cell 128(4):683–692
3. Wittenberger T, Sleigh S, Reisel D, Zikan M,
Wahl B, Alunni-Fabbroni M, Jones A, Evans I,
Koch J, Paprotka T, Lempiainen H, Rujan T,
Rack B, Cibula D, Widschwendter M (2014)
DNA methylation markers for early detection
of women’s cancer: promise and challenges.
Epigenomics 6(3):311–327
4. Dietrich D (2018) DNA methylation analysis
from body fluids. Methods Mol Biol
1655:239–249
5. Gormally E, Caboux E, Vineis P, Hainaut P
(2007) Circulating free DNA in plasma or
serum as biomarker of carcinogenesis: practical
aspects and biological significance. Mutat Res
635(2–3):105–117
6. Jones A, Lechner M, Fourkala EO, Kristeleit R,
Widschwendter M (2010) Emerging promise
of epigenetics and DNA methylation for the
diagnosis and management of women’s can-
cers. Epigenomics 2(1):9–38
7. Baylin SB, Jones PA (2011) A decade of explor-
ing the cancer epigenome - biological and
translational implications. Nat Rev Cancer 11
(10):726–734
8. Locke WJ, Clark SJ (2012) Epigenome remo-
deling in breast cancer: insights from an early
in vitro model of carcinogenesis. Breast Cancer
Res 14(6):215
9. Hinshelwood RA, Huschtscha LI, Melki J,
Stirzaker C, Abdipranoto A, Vissel B,
Ravasi T, Wells CA, Hume DA, Reddel RR,
Clark SJ (2007) Concordant epigenetic silenc-
ing of transforming growth factor-beta signal-
ing pathway genes occurs early in breast
carcinogenesis. Cancer Res 67
(24):11517–11527
10. Locke WJ, Zotenko E, Stirzaker C, Robinson
MD, Hinshelwood RA, Stone A, Reddel RR,
Huschtscha LI, Clark SJ (2015) Coordinated
epigenetic remodelling of transcriptional
networks occurs during early breast carcino-
genesis. Clin Epigenetics 7(1):52
11. Severi G, Southey MC, English DR, Jung CH,
Lonie A, McLean C, Tsimiklis H, Hopper JL,
Giles GG, Baglietto L (2014) Epigenome-wide
methylation in DNA from peripheral blood as a
marker of risk for breast cancer. Breast Cancer
Res Treat 148(3):665–673
12. Tang Q, Cheng J, Cao X, Surowy H, Burwin-
kel B (2016) Blood-based DNA methylation as
biomarker for breast cancer: a systematic
review. Clin Epigenetics 8:115
13. Uehiro N, Sato F, Pu F, Tanaka S,
Kawashima M, Kawaguchi K, Sugimoto M,
Saji S, Toi M (2016) Circulating cell-free
DNA-based epigenetic assay can detect early
breast cancer. Breast Cancer Res 18(1):129
14. van Veldhoven K, Polidoro S, Baglietto L,
Severi G, Sacerdote C, Panico S, Mattiello A,
Palli D, Masala G, Krogh V (2015)
Epigenome-wide association study reveals
decreased average methylation levels years
before breast cancer diagnosis. Clin Epige-
netics 7:67
15. Ibanez de Caceres I, Battagli C, Esteller M,
Herman JG, Dulaimi E, Edelson MI,
Bergman C, Ehya H, Eisenberg BL, Cairns P
(2004) Tumor cell-specific BRCA1 and
RASSF1A hypermethylation in serum, plasma,
and peritoneal fluid from ovarian cancer
patients. Cancer Res 64(18):6476–6481
16. Fiegl H, Gattringer C, Widschwendter A,
Schneitter A, Ramoni A, Sarlay D, Gaugg I,
Goebel G, Müller HM, Mueller-Holzner E,
Marth C, Widschwendter M (2004) Methy-
lated DNA collected by tampons--a new tool
to detect endometrial cancer. Cancer Epide-
miol Biomark Prev 13(5):882–888
17. Wentzensen N, Bakkum-Gamez JN, Killian JK,
Sampson J, Guido R, Glass A, Adams L,
Luhn P, Brinton LA, Rush B, d’Ambrosio L,
Gunja M, Yang HP, Garcia-Closas M, Lacey JV
Jr, Lissowska J, Podratz K, Meltzer P,
Shridhar V, Sherman M (2014) Discovery and
 Early Epigenetic Markers for Precision Medicine
validation of methylation markers for endome-
trial cancer. Int J Cancer 135(8):1860–1868
18. Bakkum-Gamez JN, Wentzensen N, Maurer
MJ, Hawthorne KM, Voss JS, Kroneman TN,
Famuyide AO, Clayton AC, Halling KC, Kerr
SE, Cliby WA, Dowdy SC, Kipp BR, Mariani A,
Oberg AL, Podratz KC, Shridhar V, Sherman
ME (2015) Detection of endometrial cancer
via molecular analysis of DNA collected with
vaginal tampons. Gynecol Oncol 137
(1):14–22
19. Wisman GB, Nijhuis ER, Hoque MO,
Reesink-Peters N, Koning AJ, Volders HH,
Buikema HJ, Boezen HM, Hollema H,
Schuuring E, Sidransky D, van der Zee AG
(2006) Assessment of gene promoter hyper-
methylation for detection of cervical neoplasia.
Int J Cancer 119(8):1908–1914
20. Lendvai A, Johannes F, Grimm C, Eijsink JJ,
Wardenaar R, Volders HH, Klip HG,
Hollema H, Jansen RC, Schuuring E, Wisman
GB, van der Zee AG (2012) Genome-wide
methylation profiling identifies hypermethy-
lated biomarkers in high-grade cervical intrae-
pithelial neoplasia. Epigenetics 7 Jung A, Ofner A, Crispin A, Neumann J,
(11):1268–1278
21. Wilting SM, Miok V, Jaspers A, Boon D,
Sorgard H, Lando M, Snoek BC, van Wierin-
gen WN, Meijer CJ, Lyng H, Snijders PJ,
Steenbergen RD (2016) Aberrant
methylation-mediated silencing of microRNAs
contributes to HPV-induced anchorage inde-
pendence. Oncotarget 7(28):43805–43819
22. Lorincz AT (2016) Virtues and weaknesses of
DNA methylation as a test for cervical cancer
prevention. Acta Cytol 60(6):501–512
23. Binefa G, Rodrı́guez-Moranta F, Teule A,
Medina-Hayas M (2014) Colorectal cancer:
from prevention to personalized medicine.
World J Gastroenterol 20(22):6786–6808
24. Nosho K, Irahara N, Shima K, Kure S, Kirkner
GJ, Schernhammer ES, Hazra A, Hunter DJ,
Quackenbush J, Spiegelman D, Giovannucci
EL, Fuchs CS, Ogino S (2008) Comprehensive
biostatistical analysis of CpG island methylator
phenotype in colorectal cancer using a large
population-based sample. PLoS One 3(11):
e3698
25. Toiyama Y, Okugawa Y, Goel A (2014) DNA
methylation and microRNA biomarkers for
noninvasive detection of gastric and colorectal
cancer. Biochem Biophys Res Commun 455
(1–2):43–57
26. Hashimoto Y, Zumwalt TJ, Goel A (2016)
DNA methylation patterns as noninvasive bio-
markers and targets of epigenetic therapies in
colorectal cancer. Epigenomics 8(5):685–703
15
27. Yi JM, Dhir M, Guzzetta AA, Iacobuzio-
Donahue CA, Heo K, Yang KM, Suzuki H,
Toyota M, Kim HM, Ahuja N (2012) DNA
methylation biomarker candidates for early
detection of colon cancer. Tumour Biol 33
(2):363–372
28. Mahasneh A, Al-Shaheri F, Jamal E (2017)
Molecular biomarkers for an early diagnosis,
effective treatment and prognosis of colorectal
cancer: current updates. Exp Mol Pathol 102
(3):475–483
29. Galanopoulos M, Tsoukalas N, Papanikolaou
IS, Tolia M, Gazouli M, Mantzaris GJ (2017)
Abnormal DNA methylation as a cell-free cir-
culating DNA biomarker for colorectal cancer
detection: a review of literature. World J Gas-
trointest Oncol 9(4):142–152
30. Oh T, Kim N, Moon Y, Kim MS, Hoehn BD,
Park CH, Kim TS, Kim NK, Chung HC, An S
(2013) Genome-wide identification and valida-
tion of a novel methylation biomarker, SDC2,
for blood-based detection of colorectal cancer.
J Mol Diagn 15(4):498–507
31. Herbst A, Rahmig K, Stieber P, Philipp A,
Lamerz R, Kolligs FT (2011) Methylation of
NEUROG1 in serum is a sensitive marker for
the detection of early colorectal cancer. Am J
Gastroenterol 106(6):1110–1118
32. Gyparaki MT, Basdra EK, Papavassiliou AG
(2013) DNA methylation biomarkers as diag-
nostic and prognostic tools in colorectal cancer.
J Mol Med (Berl) 91(11):1249–1256
33. Warren JD, Xiong W, Bunker AM, Vaughn CP,
Furtado LV, Roberts WL, Fang JC, Samowitz
WS, Heichman KA (2011) Septin 9 methylated
DNA is a sensitive and specific blood test for
colorectal cancer. BMC Med 9:133
34. Toth K, Sipos F, Kalmar A, Patai AV,
Wichmann B, Stoehr R, Golcher H,
Schellerer V, Tulassay Z, Molnar B (2012)
Detection of methylated SEPT9 in plasma is a
reliable screening method for both left- and
right-sided colon cancers. PLoS One 7(9):
e46000
35. Ned RM, Melillo S, Marrone M (2011) Fecal
DNA testing for colorectal cancer screening:
the coloSure™ test. PLoS Curr 3:RRN1220
36. Lind GE, Danielsen SA, Ahlquist T, Merok
MA, Andresen K, Skotheim RI, Hektoen M,
Rognum TO, Meling GI, Hoff G,
Bretthauer M, Thiis-Evensen E, Nesbakken A,
Lothe RA (2011) Identification of an epige-
netic biomarker panel with high sensitivity
and specificity for colorectal cancer and adeno-
mas. Mol Cancer 10:85
16 Ramona G. Dumitrescu
37. Ahlquist DA, Taylor WR, Mahoney DW,
Zou H, Domanico M, Thibodeau SN, Board-
man LA, Berger BM, Lidgard GP (2012) The
stool DNA test is more accurate than the
plasma septin 9 test in detecting colorectal neo-
plasia. Clin Gastroenterol Hepatol 10
(3):272–7.e1
38. American Cancer Society (2015) Global facts
and figures. 3rd edn. pp. 28–32. Available at:
https://www.cancer.org/content/dam/can
cer-org/research/cancer-facts-and-statistics/
global-cancer-facts-and-figures/global-cancer-
facts-and-figures-3rd-edition.pdf. Accessed
21 Sep 2017
39. Liu L, Cao L, Gong B, Yu J (2015) Novel
biomarkers for the identification and targeted
therapy of gastric cancer. Expert Rev Gastro-
enterol Hepatol 9(9):1217–1226
40. Nakamura J, Tanaka T, Kitajima Y, Noshiro H,
Miyazaki K (2014) Methylation-mediated gene
silencing as biomarkers of gastric cancer: a
review. World J Gastroenterol 20
(34):11991–12006
41. Lee TL, Leung WK, Chan MW, Ng EK, Tong
JH, Lo KW, Chung SC, Sung JJ, To KF (2002)
Detection of gene promoter hypermethylation
in the tumor and serum of patients with gastric
carcinoma. Clin Cancer Res 8(6):1761–1766
42. Leung WK, To KF, Chu ES, Chan MW, Bai
AH, Ng EK, Chan FK, Sung JJ (2005) Poten-
tial diagnostic and prognostic values of detect-
ing promoter hypermethylation in the serum of
patients with gastric cancer. Br J Cancer 92
(12):2190–2194
43. Watanabe Y, Kim HS, Castoro RJ, Chung W,
Estecio MR, Kondo K, Guo Y, Ahmed SS,
Toyota M, Itoh F, Suk KT, Cho MY, Shen L,
Jelinek J, Issa JP (2009) Sensitive and specific
detection of early gastric cancer with DNA
methylation analysis of gastric washes. Gastro-
enterology 136(7):2149–2158
44. Oishi Y, Watanabe Y, Yoshida Y, Sato Y,
Hiraishi T, Oikawa R, Maehata T, Suzuki H,
Toyota M, Niwa H, Suzuki M, Itoh F (2012)
Hypermethylation of Sox17 gene is useful as a
molecular diagnostic application in early gastric
cancer. Tumour Biol 33(2):383–393
45. American Cancer Society (2017) Global facts
and figures. 3rd edn. p. 10. Available at:
https://www.cancer.org/content/dam/can
cer-org/research/cancer-facts-and-statistics/
annual-cancer-facts-and-figures/2017/cancer-
facts-and-figures-2017.pdf. Accessed 21 Sep
2017
46. Brait M, Banerjee M, Maldonado L, Ooki A,
Loyo M, Guida E, Izumchenko E, Mangold L,
Humphreys E, Rosenbaum E, Partin A,
Sidransky D, Hoque MO (2017) Promoter
methylation of MCAM, ERα and ERβ in
serum of early stage prostate cancer patients.
Oncotarget 8(9):15431–15440
47. Wu T, Giovannucci E, Welge J, Mallick P, Tang
WY, Ho SM (2011) Measurement of GSTP1
promoter methylation in body fluids may com-
plement PSA screening: a meta-analysis. Br J
Cancer 105(1):65–73
48. Stewart GD, Van Neste L, Delvenne P,
Delrée P, Delga A, McNeill SA,
O’Donnell M, Clark J, Van Criekinge W,
Bigley J, Harrison DJ (2013) Clinical utility
of an epigenetic assay to detect occult prostate
cancer in histopathologically negative biopsies:
results of the MATLOC study. J Urol 189
(3):1110–1116
49. Levenson VV, Melnikov AA (2011) The Meth-
Det: a technology for biomarker development.
Expert Rev Mol Diagn 11(8):807–812
50. Sato N, Fukushima N, Maitra A,
Matsubayashi H, Yeo CJ, Cameron JL, Hruban
RH, Goggins M (2003) Discovery of novel
targets for aberrant methylation in pancreatic
carcinoma using high-throughput microarrays.
Cancer Res 63(13):3735–3742
51. Park JK, Ryu JK, Yoon WJ, Lee SH, Lee GY,
Jeong KS, Kim YT, Yoon YB (2012) The role
of quantitative NPTX2 hypermethylation as a
novel serum diagnostic marker in pancreatic
cancer. Pancreas 41(1):95–101
52. Shimizu H, Horii A, Sunamura M, Motoi F,
Egawa S, Unno M, Fukushige S (2011) Iden-
tification of epigenetically silenced genes in
human pancreatic cancer by a novel method
"microarray coupled with methyl-CpG tar-
geted transcriptional activation" (MeTA-
array). Biochem Biophys Res Commun 411
(1):162–167
53. Nones K, Waddell N, Song S, Patch AM,
Miller D, Johns A, Wu J, Kassahn KS,
Wood D, Bailey P, Fink L, Manning S, Christ
AN, Nourse C, Kazakoff S, Taylor D,
Leonard C, Chang DK, Jones MD,
Thomas M, Watson C, Pinese M, Cowley M,
Rooman I, Pajic M, Butturini G, Malpaga A,
Corbo V, Crippa S, Falconi M, Zamboni G,
Castelli P, Lawlor RT, Gill AJ, Scarpa A, Pear-
son JV, Biankin AV, Grimmond SM, APGI
(2014) Genome-wide DNA methylation pat-
terns in pancreatic ductal adenocarcinoma
reveal epigenetic deregulation of SLIT-
ROBO, ITGA2 and MET signaling. Int J Can-
cer 135(5):1110–1118
54. Liggett T, Melnikov A, Yi QL, Replogle C,
Brand R, Kaul K, Talamonti M, Abrams RA,
Levenson V (2010) Differential methylation of
cell-free circulating DNA among patients with
 Early Epigenetic Markers for Precision Medicine
pancreatic cancer versus chronic pancreatitis.
Cancer 116(7):1674–1680
55. American Cancer Society (2017) Cancer facts
and figures 2017. p. 18. Available at: https://
www.cancer.org/content/dam/cancer-org/
research/cancer-facts-and-statistics/annual-
cancer-facts-and-figures/2017/cancer-facts-
and-figures-2017.pdf. Accessed 21 Sep 2017
56. Schwarzenbach H, Hoon DS, Pantel K (2011)
Cell-free nucleic acids as biomarkers in cancer
patients. Nat Rev Cancer 11(6):426–437
57. Tomasetti M, Amati M, Neuzil J, Santarelli L
(2017) Circulating epigenetic biomarkers in
lung malignancies: from early diagnosis to ther-
apy. Lung Cancer 107:65–72
58. Vosa U, Vooder T, Kolde R, Vilo J,
Metspalu A, Annilo T (2013) Meta-analysis of
microRNA expression in lung cancer. Int J
Cancer 132(12):2884–2893
59. Gao W, Xu J, Liu L, Shen H, Zeng H, Shu Y
(2012) A systematic-analysis of predicted
miR-21 targets identifies a signature for lung
cancer. Biomed Pharmacother 66(1):21–28
60. Gao W, Shen H, Liu L, Xu J, Xu J, Shu Y
(2011) MiR-21 overexpression in human pri-
mary squamous cell lung carcinoma is asso-
ciated with poor patient prognosis. J Cancer
Res Clin Oncol 137(4):557–566
61. Zhu W, Liu X, He J, Chen D, Hunag Y, Zhang
YK (2011) Overexpression of members of the
microRNA-183 family is a risk factor for lung
cancer: a case control study. BMC Cancer
11:393
62. Donnem T, Fenton CG, Lonvik K, Berg T,
Eklo K, Andersen S, Stenvold H, Al-Shibli K,
Al-Saad S, Bremnes RM, Busund LT (2012)
MicroRNA signatures in tumor tissue related
17
to angiogenesis in non-small cell lung cancer.
PLoS One 7(1):e29671
63. Joshi P, Middleton J, Jeon YJ, Garofalo M
(2014) MicroRNAs in lung cancer. World J
Methodol 4(2):59–72
64. Boeri M, Verri C, Conte D, Roz L, Modena P,
Facchinetti F, Calabro E, Croce CM,
Pastorino U, Sozzi G (2011) MicroRNA sig-
natures in tissues and plasma predict develop-
ment and prognosis of computed tomography
detected lung cancer. Proc Natl Acad Sci U S A
108(9):3713–3718
65. Sozzi G, Boeri M, Rossi M, Verri C, Suatoni P,
Bravi F, Roz L, Conte D, Grassi M,
Sverzellati N, Marchiano A, Negri E, La
Vecchia C, Pastorino U (2014) Clinical utility
of a plasma-based miRNA signature classifier
within computed tomography lung cancer
screening: a correlative MILD trial study. J
Clin Oncol 32(8):768–773
66. Brueckner B, Stresemann C, Kuner R,
Mund C, Musch T, Meister M, Sültmann H,
Lyko F (2007) The human let-7a-3 locus con-
tains an epigenetically regulated microRNA
gene with oncogenic function. Cancer Res 67
(4):1419–1423
67. Brzezianska E, Dutkowska A, Antczak A
(2013) The significance of epigenetic altera-
tions in lung carcinogenesis. Mol Biol Rep 40
(1):309–325
68. Weiss G, Schlegel A, Kottwitz D, König T,
Tetzner R (2017) Validation of the SHOX2/
PTGER4 DNA methylation marker panel for
plasma-based discrimination between patients
with malignant and nonmalignant lung disease.
J Thorac Oncol 12(1):77–84
 Chapter 2

Interplay Between Genetic and Epigenetic Changes

in Breast Cancer Subtypes
Ramona G. Dumitrescu

Abstract
Breast cancer is the most common cancer among women and represents one of the top five leading causes of
cancer-related mortality. Inherited and acquired genetic mutations as well as epigenetic aberrations are
known to be important contributors to the development and progression of breast cancer. Recent devel-
opments in high-throughput technologies have increased our understanding of the molecular changes in
breast cancer, leading to the identification of distinctive genetic and epigenetic modifications in different
breast cancer molecular subtypes. These genetic and epigenetic changes in luminal A, luminal B, ERBB2/
HER2-enriched, basal-like, and normal-like breast cancer subtypes are discussed in this chapter. Further-
more, recent epigenome studies provided more information about further stratification of breast cancer
subtypes, with essential role in the appropriate diagnosis and treatment of breast cancer. Thus, the inclusion
of both genetic and epigenetic information in breast cancer clinical care could provide critical scientific base
for precision medicine in breast cancer.

Key words Breast cancer, Genetic mutations, Epigenetic changes, Luminal A, Luminal B, ERBB2/
HER2-enriched, Basal-like and normal-like breast cancer subtypes, Epigenome studies, Precision
medicine

1 Introduction

Female breast cancer represents 15.0% of all new cancer cases in the
USA, and there is an estimated of 252,710 new cases in 2017
[1]. Even if mortality from breast cancer declined over the years
[1], breast cancer burden is a significant clinical problem, so that a
comprehensive understanding of the risk and best treatment
options is imperative.
Not all individuals have the same susceptibility to develop
breast cancer and not all respond equally to cancer therapies. Preci-
sion medicine in breast cancer has the potential to revolutionized
health care paradigm by integrating personal genetic information
or protein profiles to strengthen clinical care. Recent developments
in high-throughput genomic, transcriptomic, and proteomic

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_2,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

19
20 Ramona G. Dumitrescu

technologies increased further our understanding of the molecular

changes in breast cancer and helped in looking at variations that
could explain genetic susceptibility, clinical outcomes, or drug
responses [2]. This increasing understanding of patient-to-patient
variability at the molecular level in breast cancer is moving the
clinical care forward in guiding the appropriate treatment to the
appropriate patient at the appropriate time, which is a hallmark of
the precision cancer medicine. However, it has been acknowledged
for a while that disturbance of the epigenetic mechanisms plays a
critical role in carcinogenesis [3] and that evaluating both genetic
and epigenetic aberrations could provide a more accurate estimate
of the risk as well as a more efficient therapeutic scheme.
In fact, Esteller M. and collaborators showed in 2001 that
DNA promoter hypermethylation of genes important in breast
carcinogenesis, such as BRCA1, hMLH1, APC, LKB1, CDH1,
p16(INK4a), p14(ARF), MGMT, GSTP1, and RARbeta2 and
global hypomethylation in hereditary breast tumors mimic DNA
methylation patterns observed in the sporadic breast tumors
[4]. Since than many more studies examined DNA methylation
phenotypes in different breast cancer subtypes and showed their
importance for precision cancer medicine. The interplay between
genetic and epigenetic changes in these tumor subtypes will be
discussed in more detail in the following sections.

2 Interplay Between Genetic and Epigenetic Changes in Breast Cancer

The first genes associated with breast cancer susceptibility were

BRCA1 and/or BRCA2 genes [5, 6]. Since then, many other
mutations were described in breast cancer patients and it has been
suggested that once the DNA repair capacity is impaired, genetic
instability is induced [7]. As BRCA1 and BRCA2 mutations were
first discovered to be associated with familial breast cancer cases, it
is well recognized now that for BRCA1 and BRCA2 mutations
carriers, the inactivation of the second allele is believed to be a
significant event leading to breast cancer initiation and develop-
ment [8, 9], in both hereditary and sporadic tumors.
In order to quantify breast cancer genetic risk for both heredi-
tary breast cancers and sporadic breast cancers, Rebbeck and his
collaborators examined more than 31,000 women with BRCA1/
2 mutations from 33 countries, looking at the risk of breast and
ovarian cancer based on mutation type and position in the gene
[10]. They found that different BRCA1/2 mutations are associated
with different risks of breast and ovarian cancer based on the type
and location of the mutations within the genes [10]. More specifi-
cally, mutations located near the ends of the BRCA1 coding
sequence were associated with a greater risk for breast cancer,
while mutations located near the middle of the gene were
Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes 21

associated with a higher risk of ovarian cancer [10]. These findings

may have great implications for breast cancer prevention strategies
for high-risk women.
Furthermore, in a recent case-control study, researchers
assessed the value of using 77 breast cancer-associated common
variants for breast cancer risk stratification, generating a genetic risk
score based on the combinations of variants [11]. The study
showed that the lifetime risk of breast cancer was 5.2% and 16.6%
for women without family history in the lowest and highest quin-
tiles of the risk score and 8.6% and 24.4% for women with a first-
degree family history of breast cancer in the lowest and highest
quintiles respectively. Women in the highest percent of the genetic
risk score had a three times higher risk of developing breast cancer,
compared with women in the middle range [11]. The authors
suggested that in addition to examining lifestyle risk factors that
were not evaluated in this study, the observed level of risk discrimi-
nation could inform screening and prevention strategies in different
populations, including women with BRCA1/2 mutations but also
in women without this genetic susceptibility [11].
As breast cancer is such a heterogeneous disease that is driven
by both genetic and epigenetic changes, it is also very important to
look at these epigenetic changes in the different breast cancer
subtypes.
Unlike DNA sequences changes or gene mutations, the epige-
netic changes, defined as covalent modifications of the DNA and
chromatin alterations, affect DNA function but the DNA sequence
remains the same. The most commonly epigenetic change in cancer
is CpG islands promoter hypermethylation, which has been shown
to be influenced by genetic factors and also by aging [12] and
environmental factors like, smoking, alcohol and dietary
intake [13].
It been shown that CpG island hypermethylation of the
BRCA1 gene promoter region occurs in approximately 10–15% of
all sporadic breast cancers and is involved in breast cancer develop-
ment [14]. The phenotypic effects of BRCA1-hypermethylation in
sporadic tumors are similar to those of breast cancers arising in
BRCA1 mutation carriers, suggesting that the wild-type and
unmethylated allele will acquire the mutations as the second hit
[14]. It has been observed that breast tumors with BRCA1 gene
defects, caused by either inherited mutation or by acquired CpG
island promoter hypermethylation, are poorly differentiated and are
associated with RB/p16 deregulation observed in the basal/triple-
negative breast cancer type [15]. Thus, the understanding how
mutations arise and lead to cancer initiation and progression,
involves the study of epigenetic modifications and their determi-
nants. It has been found that frequently mutated genes in breast
tumors such as CDKN2A (p16), ER, RARB2, FZR1, GSTP1,
22 Ramona G. Dumitrescu

cyclin2, RASSF1A, TWIST, and HIN1 show DNA promoter meth-

ylation [16, 17].
Furthermore, it has been shown that a histone methyltransfer-
ase EZH2, a key component of the Polycomb PRC2 complex, is
involved in breast carcinogenesis by downregulation of RAD51 and
RAD51 paralog proteins, with important role in the homologous
recombination (HR) repair of DNA double-strand breaks
[18]. Animal studies found that EZH2 overexpression is associated
with changes in ductal morphology and epithelial hyperplasia
[19]. Moreover, EZH2 expression is associated with activation of
RAF1-β-catenin signaling, which is involved in promoting expan-
sion of breast tumor initiating cells [20], suggesting the importance
of this event in early breast carcinogenesis.
There have been a number of studies looking at the DNA
methylation in breast tumors and breast cancer specific character-
istics, risk factors and prognosis. Some of these studies describing
the genetic and epigenetic profiles of several breast cancer subtypes
will be presented in the following section.

3 Breast Cancer Subtypes and Their Molecular Profiles

Gene-expression analyses of ER-positive and ER-negative breast

tumors reveal that these breast cancers have different molecular
characteristics [21], like distinct diseases and understanding their
complex molecular profiles has important implications for breast
cancer prognosis. It has been described that there are two
ER-positive intrinsic molecular subtypes, namely luminal A and
luminal B and two mainly ER-negative intrinsic subtypes, HER2-
enriched and basal-like. This classification is mostly based on the
expression of genes involved in luminal epithelial differentiation,
the ER and PR genes, in cellular proliferation, like Ki67 gene, in
human epidermal growth factor receptor 2 pathway, like HER2
gene, and in basal differentiation [22–24]. In fact, when the molec-
ular profiles of breast tumors were analyzed on multiple genomic
platforms, it was reported that these profiles are conserved across
microarray platforms and the breast tumors were grouped into
luminal A (LumA), luminal B (LumB), basal-like, HER2+/ER ,
and normal breast-like tumor subtypes [24]. These specific sub-
types had significant differences in relapse-free and overall survival.
They were identified in both carcinomas in situ and invasive breast
cancers [25] and within different racial and ethnic groups [26, 27].
Also, it has been shown that these breast cancer subtypes
exhibit different methylation patterns [28] that could be very
important for further stratification of these tumors essential for
breast cancer treatment. DNA methylation arrays conducted in
TCGA breast tumors, identified five distinct DNA methylation
groups. Among these groups, group 3 presented a
 Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes 23

hypermethylated phenotype, significantly enriched for luminal B

tumors and showed fewer mutations in PIK3CA and MAP3K1/
MAP2K4 genes. The lowest level of DNA methylation was repre-
sented by group 5 and was observed in basal-like tumors, which
also exhibited a high frequency of TP53 mutations. HER2 enriched
tumors had a modest association with the methylation groups [28].

3.1 Luminal A Breast Luminal breast cancers are the most heterogeneous subtypes, with
Cancer Subtype the luminal A tumors characterized by the high expression of
luminal epithelial genes, low expression of the Ki67, and a better
prognosis [28, 29]. Further analysis of luminal A breast tumors
revealed four major subtypes defined by distinct copy-number and
mutation profiles [29]. Three of these subtypes were driven by
aberrations of chromosomes 1, 8, and 16, together with
PIK3CA, GATA3, AKT1, and MAP3K1 mutations. The fourth
luminal A breast cancer subtype is atypical and it is characterized
by high genomic instability, TP53 mutations and increased Aurora
kinase signaling with worse clinical prognosis [29].
Furthermore, a study conducting an analysis of the DNA meth-
ylation of over 900 CpG sites in breast tumors from a population-
based study, named Carolina Breast Cancer Study, identified four
methylation clusters, which differ in HR status, intrinsic subtype
(luminal versus basal-like), and p53 mutation status [30]. The
study found that FABP3, FGF2, FZD9, GAS7, HDAC9,
HOXA11, MME, PAX6, POMC, PTGS2, RASSF1, RBP1, and
SCGB3A1 genes were hypermethylated in luminal A breast cancers
as well as HR+ and p53 wild-type breast cancers [30].
When the expression and methylation profiles of the luminal-A
tumors were analyzed, two biologically distinct subgroups were
observed exhibiting different immune-related genes expression and
risk for five-year recurrence. Analysis of methylation in the luminal-A
tumors identified a cluster of patients with poorer survival, present-
ing distinct hypermethylation of developmental genes [31].
A comprehensive analysis of the luminal A tumors identified
forty-one genes differentially methylated between the two methyla-
tion clusters of this type of breast tumors [32]. The genes were
ADAMTS12, ASCL2, BIRC4, BMP3, BMP6, CD40, CDKN1C,
COL1A2, DES, DKC1, DLK1, EGFR, ESR2, ETS1, ETV1, FES,
FLT4, HBII-52, HOXA11, ICAM1, IRAK3, KIT, KRT13, LYN,
MAS1, MKRN3, MYBL2, PALM2-AKAP2, PAX6, PCDH1,
PDGFRB, PEG10, PITX2, SFRP1, TERT, TMEFF1,
TNFRSF10C, TNFSF8, TPEF, WNT1, and WT1 and represent
the DNA methylation signature SAM40 [32]. This DNA methyla-
tion signature segregates luminal A patients based on prognosis,
identifying two groups of prognosis. The ability to separate luminal
A patients based on this DNA methylation signature, could benefit
both groups, one getting a more aggressive treatment than what is
given today, and importantly, the other subgroup may benefit from
less treatment [32].
24 Ramona G. Dumitrescu

3.2 Luminal B Breast The difference between the luminal A and luminal B gene patterns
Cancer Subtype is less distinct than the difference between the luminal A and basal-
like subtypes [33, 34]. More specifically, when compared with
luminal A subtype, the luminal B subtype breast tumors are more
likely to show a higher expression of proliferation/cell cycle-related
genes like Ki67 and AURKA, a lower expression of several luminal-
related genes like progesterone receptor (PR) and FOXA1 [35, 36]
and worse recurrence-free survival at 5 years and 10 years [36]. At
5-year follow-up, luminal B tumors have a better survival then
basal-like tumors, however at around 10-year follow-up, the sur-
vival curves of luminal B tumors tend to cross those of basal-like
tumors. Thus, stratification of luminal tumors, together with the
tumor size and nodal status, help in deciding the length of endo-
crine treatment and in predicting the endocrine therapy [36].
When CpGs methylation frequencies were evaluated in differ-
ent molecular breast cancer subtypes, it was found that the CpGs
were more frequently methylated in luminal B tumors and less
methylated in basal-like tumors [37]. Also, targets of the polycomb
repressor complex were found more methylated in luminal B
tumors than in other tumor subtypes [37].
It has been shown that DNA methylation stratifies luminal B
tumors in two groups with distinct clinical characteristics [38]. One
subgroup of luminal B samples exhibited a methylator phenotype
and clustered with the luminal B-HER tumors, while the other
presented less methylation, and clustered with the luminal A
tumors. More specifically, a 3 CpG marker panel enables the strati-
fication of luminal B tumors and this could have clinical implica-
tions for patients with luminal B breast cancer subtype [38].
Furthermore, Gao and colleagues studied the epigenomic-
transcriptomic landscape of ER positive breast cancers and
observed that WNT and BMP signaling pathways are important
epigenetically deregulated pathways in luminal ER+ breast cancers,
especially in luminal-B breast cancers [39].

3.3 ERBB2 or HER2- The ERBB2 or HER2-enriched (HER2E) subtype shows a gene
Enriched Breast signature that is closer to the luminal subtypes than basal-like
Cancer Subtype cancers [40]. These tumors show a high number of mutations,
with a high percent of them exhibiting TP53 and PIK3CA muta-
tions and ERBB2/HER2 overexpression/amplification. In addi-
tion, the HER2-enriched subtype was linked with high frequency
of APOBEC3B-associated mutations, which were found to be
involved in many cancer types [41, 42]. This breast cancer subtype
is characterized by the high expression of proliferation-related
genes like GRB7, intermediate expression of luminal-related
genes like ESR1 and PGR, and low expression of basal-related
genes like keratin 5 and FOXC1 genes [36]. It is believed that
HER2 cell surface expression play an important role in regulating
the luminal cancer stem cell population [43, 44].
 Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes 25

The study conducted by Holm K. and colleagues looking at

EZH2 and the epigenetic gene silencing mark, the trimethylation
of lysine 27 on histone 3 (H3K27me3) in breast cancer subtypes,
found high abundance of EZH2 and H3K27me3 in HER2-
enriched tumors [45].
As described above, even if the HER2-enriched tumors do not
have a strong association with the methylation phenotype, still the
DNA methylation reported in several genes was linked to impor-
tant clinical outcomes. For instance, high levels of Vimentin meth-
ylation that negatively correlated with gene expression was
observed in the HER2-enriched breast tumors. Importantly, this
methylation phenotype was strongly associated with poor overall
survival independent of race, subtype, stage, nodal status, or meta-
static disease [46].
Moreover, when the Alu and LINE-1 methylation status was
evaluated in breast cancer subtypes, it was found that there was a
significant difference between breast cancer subtypes, the HER2
enriched subtype having the lowest methylation levels. The low Alu
methylation status was linked with poor disease-free survival [47].
Also, the DNA methylation of specific long noncoding (lnc)
RNAs associated with breast cancer subtypes was examined and it
was observed that for the HER2E tumors, 10% of hypermethylated
probes are located in lncRNA exons and 60% are located in lncRNA
introns [48], suggesting that differentially methylated lncRNA sites
are important in different breast cancer subtypes.

3.4 Basal-Like The basal-like subtype breast tumors have a unique genomic signa-
Breast Cancer Subtype ture [21, 49] closer to lung squamous cell carcinomas and high-
grade serous ovarian carcinomas than to other subtypes of breast
cancer [50, 51].
The basal-like tumors show the second highest number of
mutations after the HER-enriched tumors, with many presenting
TP53 and PIK3CA mutations. The BRCA1-mutated breast cancers
show basal-like disease characteristics [52]. Basal-like tumors also
include the triple-negative breast cancers and special histopatholo-
gical subtypes such as medullary and adenoid cystic tumors [28, 53,
54]. The basal-like tumors are characterized by the high expression
of proliferation-related genes like MKI67 and keratins 5, 14, and
17 usually expressed by the basal layer of the skin, intermediate
expression of HER2-related genes, and very low expression of
luminal-related genes [36].
As mentioned before, these subtypes of breast cancer show the
lowest levels of methylation [28, 55]. However, several epigenetic
events were descried to play an important role in basal-like tumor
development and prognosis.
The study conducted by Park looked at the patterns of CpG
island methylation in each breast cancer subtype and their associa-
tion with the cancer stem cell phenotype characterized by CD44+/
26 Ramona G. Dumitrescu

CD24 and ALDH1 expression and found that the CD44+/

CD24 and ALDH1+ phenotype was most enhanced in the
basal-like subtype [55].
Furthermore, lost expression of E-cadherin due to promoter
DNA hypermethylation was found to contribute to the metastatic
advantage of the basal-like breast cancer [56]. The mechanism
linked to E-cadherin methylation was found to be the interaction
between the Snail and Suv39H1 (suppressor of variegation 3–9
homolog 1), a methyltransferase in charge of H3K9me3-involved
methylation [56]. This finding could be important in developing
targeted therapy for basal-like cancer patients.
Also, Caveolin-1 (Cav1), which was found consistently upre-
gulated and associated with increased cell proliferation, anchorage-
independent growth, and migration and invasion in basal-like
tumors, showed a specific methylation pattern [57]. It was found
that breast cancer aggressiveness linked to Cav1 is correlated with
CGI shore methylation levels and that overall survival rates of
patients with estrogen receptor α negative (ERα ) is inversely
correlated with Cav1 expression [57].
Another study looking at the DNA methylation status of breast
cancer-related genes in different molecular subtypes, found that the
secreted frizzled-related protein 1 (SFRP1) gene exhibited lower
levels of methylation in the basal-like subtype when compared with
the other subtypes [58].
In addition, BRCA1 methylation has been shown to be corre-
lated with basal-like breast cancer subtype and be a predictor of
overall and disease free survival in the triple-negative breast cancer/
basal-like breast cancer, with potential prognosis value in these
tumor types [52, 59].
When the role of microRNA dysregulation of the mechanisms
involved in DNMT3b overexpression in breast cancers with altera-
tions in DNA methylation patterns, it was discovered that one
characteristic of the basal-like breast cancers, is the reduced expres-
sion of miR-29c [59, 60]. In addition, the miRNAs and DNA
methylation patterns were able to stratify the basal-like breast can-
cers in two subgroups. The subgroup with reduced expression of
multiple regulatory miRNAs presented aberrant DNA hypermethy-
lation [60, 61].
Furthermore, it was observed that there are differences in CpG
island (CpGI) shore methylation and mutation patterns in breast
cancer subtypes. The basal-like tumors for example, presents dis-
tinct CpGI shore hypomethylation patterns that were linked to
gene expression regulation [62].

3.5 Normal-Like It has been suggested that normal-like breast tumors do not cluster
Breast Cancer Subtype together based on a genomic profiling [37, 63]. Methylation anal-
ysis of breast cancer subtypes found that normal-like tumors are
found in all clusters even if most of them were found in the two
 Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes 27

LumA-associated clusters. Similar to HER2-enriched molecular

subtype, normal-like tumors did not present distinct methylation
profiles [37]. Interestingly, a study by Holm K found that normal-
like tumors exhibit high expression of H3K27me3, which was
associated with better survival [45].

4 Epigenome Studies in Breast Cancers

In recent years, genome-wide analyses of epigenetic marks, includ-

ing DNA methylation and histone modifications, improved our
understanding of breast cancer heterogeneity and provided poten-
tial new tools for cancer diagnosis, prognosis, and therapy. Several
genome-wide technologies used in breast cancer epigenomic
research were described in detail by Davalos V and
collaborators [64].
For example, in the Sister Study, DNA methylation was profiled
using the Illumina Infinium HumanMethylation27 array examin-
ing over 27 thousands CpG sites around promoter region. The
study found that cells acquire methylation at specific sites, related to
age, and these cells are more susceptible to malignant transforma-
tion [12]. It has been shown that there is increased methylation
with age among age-related CpGs (arCpGs) in island regions and
decreased methylation of arCpGs in nonisland regions. Those
increasingly methylated arCpGs were found overmethylated in dif-
ferent types of tumors, and presented repressive H3K27me3 his-
tone modification. These findings could explain the increased
cancer incidence, associated with older age [12].
Furthermore, in the same cohort, Sister Study, 250 differen-
tially methylated CpGs were identified to be important in predict-
ing breast cancer, distinguishing women who later develop breast
cancer from those who did not. The finding suggests that methyla-
tion profiling in blood could be used for early breast cancer detec-
tion and risk prediction [65].
Using an array-based platform with 807 cancer-related genes,
breast cancer molecular subtypes, particularly basal-like, luminal A,
and luminal B tumors, harbor specific methylation profiles
[37]. The methylation frequencies were significantly different
between these subtypes, luminal B tumors being most frequently
methylated and basal-like tumors being least frequently methy-
lated, as it was described above [37]. Additionally, luminal B
tumors presented more methylation of the targets of the Polycomb
repressor complex than other evaluated breast tumors. A high
degree of methylation was also observed in breast tumor harboring
BRCA2 mutations. When gene expression was examined, it was
observed that those genes associated with subtype-specific expres-
sion can be regulated by DNA methylation [37].
28 Ramona G. Dumitrescu

Fackler and colleagues conducting a genome-wide methylation

array analysis found that estrogen and/or progesterone receptor-
positive (ER+/PR+) tumors exhibited more hypermethylated loci
than estrogen receptor negative (ER ) tumors but the hyper-
methylated loci in ER tumors were grouped closer to the tran-
scriptional start site, when they were compared with those in the
ER+ tumors. In addition, a differential methylation profile of about
40 CpG loci was observed between the ER+ and ER and
100 methylated loci were significantly associated with disease pro-
gression, especially for the ER breast tumors [66].
Moreover, a recently conducted genome-wide methylation
analysis using Illumina platform looked at differences in DNA
methylation patterns in the ER+ and ER breast tumors from
African-American and European-American women. The study
found almost twice as many differentially methylated loci in ER
than in ER+ tumors [68]. Further, there were more differentially
methylated loci by race among breast cancer patients with ER
tumors than those with ER+ breast tumors. This suggests that the
etiology of ER breast tumors could be different in African-
American women and European-American women [67].
Another study looking at the epigenetic alterations of noncod-
ing RNAs (ncRNAs), namely long ncRNAs and miRNAs in breast
cancer, reported aberrant methylation in the promoters of ncRNAs,
more frequent than that observed in protein-coding genes
[68]. Aberrant ncRNA promoter methylation occurred not only
in the CpG islands but also in regions surrounding the CpG islands
and in the promoters lacking CpG islands and these changes were
associated with transcriptional changes, important in breast cancer
development and progression [68].
When genome-wide hypomethylation among breast cancer
cases compared with matched controls, from a nested case-control
study, was analyzed in several cohorts using the Illumina 450 k
array and whole-genome bisulfite sequencing (WGBS), hypo-
methylation was observed in cases compared with controls, espe-
cially in gene body probes but not in gene promoters
[69]. Importantly, this study highlighted some other factors that
can influence genome-wide methylation, such as age, weight and
height, menopausal status, smoking status, and folate levels. Thus,
the study suggests that genome-wide hypomethylation measured in
prediagnostic blood samples could predict breast cancer risk [69].
Furthermore, Holm and colleagues identified seven
DNA-methylation epigenetic subgroups or epitypes by studying
whole-genome DNA-methylation profiles in breast tumors by
using Illumina Infinium HumanMethylation450 BeadChip arrays.
It was found that one epitype displayed a methylation profile similar
to normal epithelial cells, while another epitype was associated with
basal-like tumors and with BRCA1 mutations and another epitype
was associated with ERBB2-amplified tumors with multiple
Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes 29

additional amplifications. The remaining four epitypes have been

associated with luminal tumors that show differences in promoter
hypermethylation, global hypomethylation, proliferative rates, and
genomic instability. These epitypes were also associated with clini-
copathologic features and patient outcomes. Also, the authors
reported that DNA hypermethylation in basal-like and luminal
tumors occurs in different chromatin states, contributing distinc-
tively to tumor progression [70].
Stirzaker et al. performed a whole-genome methylation
sequencing analysis of triple-negative breast cancer (TNBC) and
identified differentially methylated regions (DMRs), associated
with transcription factor binding sites and DNA hypersensitive
sites [71]. Based on the differentially methylated regions, the
authors were able to stratify TNBCs into three distinct methylation
clusters associated with better or worse prognosis. Importantly, the
study described 17 individual differentially methylated regions,
essential for the stratification of TNBC patients into good and
poor prognosis groups [71].
In addition to DNA methylation, high-throughput strategies
have also transformed the way histone modifications are assessed
and led to a better understanding of the epigenetic machinery in
different breast cancer subtypes. For example, ChIP-seq technol-
ogy contributed majorly to epigenome mapping. In breast cancer
research, histone-modification profiles, including mapping of
H3K4 acetylation and H3K4 trimethylation, H3K9 acetylation,
and H3K27 methylation, have been used for the classification and
characterization of breast cancer subtypes and have been shown to
be critical players in breast carcinogenesis [72, 73]. For instance,
H3K4 acetylation has been described as an epigenetic hallmark of
cellular transformation in breast cancer, being associated with
breast cancer progression, estrogen response, and epithelial–me-
senchymal transition [72]. The finding suggests that this epigenetic
marker could be a predictor of epigenetic changes associated with
early stages of transformation and an indicator of progression to an
aggressive phenotype, with potential therapeutic implications.
Additionally, it has been found that there are reductions in
histones H3K9me2 and H3K9me3, and gradual increases in the
demethylases for H3K9me1 and H3K9me2 (KDM3A, or
JMJD1A) during cancer transformation and these changes are
involved in breast carcinogenesis [74].
Moreover, when the contribution of histone modificationsto
the development of biologically distinct breast cancer subtypes was
analyzed, looking at genome-wide binding patterns of H3K4me3
and H3K27me3, it was observed that there are unique histone
mark features associated with subtype-specific expression patterns.
Importantly, subtype classifications based on histone modifications
were significantly associated with relapse-free survival outcomes in
breast cancer patients [75].
30 Ramona G. Dumitrescu
5 Conclusion
The review of the genetic and epigenetic modifications in different
breast cancer subtypes revealed potential significant targets for a
more appropriate breast cancer diagnosis and therapy and shed
some light on the importance of including these changes in all
future research endeavors in precision medicine in breast cancer.
References
1. SEER cancer statistics factsheets: breast cancer.
National Cancer Institute, 2017. https://seer.
cancer.gov/statfacts/html/breast.html.
Accessed 20 Sep 2017
2. Stover DG, Wagle N (2015) Precision medi-
cine in breast cancer: genes, genomes, and the
future of genomically driven treatments. Curr
Oncol Rep 17(4):15
3. Langevin SM, Kelsey KT (2013) The fate is not
always written in the genes: epigenomics in
epidemiologic studies. Environ Mol Mutagen
54(7):533–541
4. Esteller M, Fraga MF, Guo M, Garcia-
Foncillas J, Hedenfalk I, Godwin AK,
Trojan J, Vaurs-Barrière C, Bignon YJ,
Ramus S, Benitez J, Caldes T, Akiyama Y,
Yuasa Y, Launonen V, Canal MJ,
Rodriguez R, Capella G, Peinado MA,
Borg A, Aaltonen LA, Ponder BA, Baylin SB,
Herman JG (2001) DNA methylation patterns
in hereditary human cancers mimic sporadic
tumorigenesis. Hum Mol Genet 10
(26):3001–3007
5. Miki Y, Swensen J, Shattuck-Eidens D, Futreal
PA, Harshman K, Tavtigian S, Liu Q,
Cochran C, Bennett LM, Ding W et al (1994)
A strong candidate for the breast and ovarian
cancer susceptibility gene BRCA1. Science 266
(5182):66–71
6. Wooster R, Neuhausen SL, Mangion J,
Quirk Y, Ford D, Collins N, Nguyen K,
Seal S, Tran T, Averill D et al (1994) Localiza-
tion of a breast cancer susceptibility gene,
BRCA2, to chromosome 13q12-13. Science
265(5181):2088–2090
7. Teschendorff AE, Caldas C (2009) The breast
cancer somatic ’muta-ome’: tackling the com-
plexity. Breast Cancer Res 11(2):301
8. Collins N, McManus R, Wooster R,
Mangion J, Seal S, Lakhani SR, Ormiston W,
Daly PA, Ford D, Easton DF et al (1995)
Consistent loss of the wild type allele in breast
cancers from a family linked to the BRCA2
gene on chromosome 13q12-13. Oncogene
10:1673–1675
9. Smith SA, Easton DF, Evans DG, Ponder BA
(1992) Allele losses in the region 17q12-21 in
familial breast and ovarian cancer involve the
wild-type chromosome. Nat Genet 2:128–131
10. Rebbeck TR, Mitra N, Wan F, Sinilnikova OM,
Healey S, McGuffog L, Mazoyer S, Chenevix-
Trench G, Easton DF, Antoniou AC et al
(2015) Association of type and location of
BRCA1 and BRCA2 mutations with risk of
breast and ovarian cancer. JAMA 313
(13):1347–1361
11. Mavaddat N, Pharoah PD, Michailidou K,
Tyrer J, Brook MN, Bolla M, Wang Q,
Dennis J, Dunning AM, Shah M et al (2015)
Prediction of breast cancer risk based on
profiling with common genetic variants. J
Natl Cancer Inst 107(5):djv036
12. Xu Z, Taylor JA (2014) Genome-wide age-re-
lated DNA methylation changes in blood and
other tissues relate to histone modification,
expression and cancer. Carcinogenesis 35
(2):356–364
13. Ambrosone CB, Hong CC, Goodwin PJ
(2015) Host factors and risk of breast cancer
recurrence: genetic, epigenetic and biologic
factors and breast cancer outcomes. Adv Exp
Med Biol 862:143–153
14. Esteller M, Silva JM, Dominguez G, Bonilla F,
Matias-Guiu X, Lerma E, Bussaglia E, Prat J,
Harkes IC, Repasky EA, Gabrielson E,
Schutte M, Baylin SB, Herman JG (2000) Pro-
moter hypermethylation and BRCA1 inactiva-
tion in sporadic breast and ovarian tumors. J
Natl Cancer Inst 92(7):564–569
15. Stefansson OA, Jonasson JG, Olafsdottir K,
Hilmarsdottir H, Olafsdottir G, Esteller M,
Johannsson OT, Eyfjord JE (2011) CpG island
hypermethylation of BRCA1 and loss of pRb as
co-occurring events in basal/triple-negative
breast cancer. Epigenetics 6(5):638–649
16. Widschwendter M, Jones PA (2002) DNA
methylation and breast carcinogenesis. Onco-
gene 21(35):5462–5482
 Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes
17. Stefansson OA, Esteller M (2013) Epigenetic
modifications in breast cancer and their role in
personalized medicine. Am J Pathol 183
(4):1052–1063
18. Zeidler M, Varambally S, Cao Q, Chinnaiyan
AM, Ferguson DO, Merajver SD, Kleer CG
(2005) The Polycomb group protein EZH2
impairs DNA repair in breast epithelial cells.
Neoplasia 7(11):1011–1019
19. Li X, Gonzalez ME, Toy K, Filzen T, Merajver
SD, Kleer CG (2009) Targeted overexpression
of EZH2 in the mammary gland disrupts duc-
tal morphogenesis and causes epithelial hyper-
plasia. Am J Pathol 175(3):1246–1254
20. Chang CJ, Yang JY, Xia W, Chen CT, Xie X,
Chao CH, Woodward WA, Hsu JM, Hortoba-
gyi GN, Hung MC (2011) EZH2 promotes
expansion of breast tumor initiating cells
through activation of RAF1-β-catenin signal-
ing. Cancer Cell 19(1):86–100
21. Reis-Filho JS, Pusztai L (2011) Gene expres-
sion profiling in breast cancer: classification,
prognostication, and prediction. Lancet 378
(9805):1812–1823
22. Perou CM, Sorlie T, Eisen MB, van de Rijn M,
Jeffrey SS, Rees CA, Pollack JR, Ross DT,
Johnsen H, Akslen LA, Fluge O,
Pergamenschikov A, Williams C, Zhu SX, Lon-
ning PE, Børresen-Dale AL, Brown PO, Bot-
stein D (2000) Molecular portraits of human
breast tumours. Nature 406(6797):747–752
23. Sorlie T, Tibshirani R, Parker J, Hastie T, Mar-
ron JS, Nobel A, Deng S, Johnsen H, Pesich R,
Geisler S, Demeter J, Perou CM, Lonning PE,
Brown PO, Borresen-Dale AL, Botstein D
(2003) Repeated observation of breast tumor
subtypes in independent gene expression data
sets. Proc Natl Acad Sci U S A 100
(14):8418–8423
24. Hu Z, Fan C, Oh DS, Marron JS, He X, Qaqish
BF, Livasy C, Carey LA, Reynolds E,
Dressler L, Nobel A, Parker J, Ewend MG,
Sawyer LR, Wu J, Liu Y, Nanda R,
Tretiakova M, Ruiz Orrico A, Dreher D,
Palazzo JP, Perreard L, Nelson E, Mone M,
Hansen H, Mullins M, Quackenbush JF, Ellis
MJ, Olopade OI, Bernard PS, Perou CM
(2006) The molecular portraits of breast
tumors are conserved across microarray plat-
forms. BMC Genomics 7:96
25. Tamimi RM, Baer HJ, Marotti J, Galan M,
Galaburda L, Fu Y, Deitz AC, Connolly JL,
Schnitt SJ, Colditz GA, Collins LC (2008)
Comparison of molecular phenotypes of ductal
carcinoma in situ and invasive breast cancer.
Breast Cancer Res 10(4):R67
26. Yu K, Lee CH, Tan PH, Tan P (2004) Conser-
vation of breast cancer molecular subtypes and
31
transcriptional patterns of tumor progression
across distinct ethnic populations. Clin Cancer
Res 10(16):5508–5517
27. Ihemelandu CU, Leffall LD Jr, Dewitty RL,
Naab TJ, Mezghebe HM, Makambi KH,
Adams-Campbell L, Frederick WA (2007)
Molecular breast cancer subtypes in premeno-
pausal and postmenopausal African-American
women: age-specific prevalence and survival. J
Surg Res 143(1):109–118
28. Cancer Genome Atlas Network (2012) Com-
prehensive molecular portraits of human breast
tumours. Nature 490(7418):61–70
29. Ciriello G, Sinha R, Hoadley KA, Jacobsen AS,
Reva B, Perou CM, Sander C, Schultz N
(2013) The molecular diversity of luminal a
breast tumors. Breast Cancer Res Treat 141
(3):409–420
30. Conway K, Edmiston SN, May R, Kuan PF,
Chu H, Bryant C, Tse CK, Swift-Scanlan T,
Geradts J, Troester MA, Millikan RC (2014)
DNA methylation profiling in the Carolina
breast cancer study defines cancer subclasses
differing in clinicopathologic characteristics
and survival. Breast Cancer Res 16(5):450
31. Netanely D, Avraham A, Ben-Baruch A,
Evron E, Shamir R (2016) Expression and
methylation patterns partition luminal-a breast
tumors into distinct prognostic subgroups.
Breast Cancer Res 18(1):74
32. Fleischer T, Klajic J, Aure MR, Louhimo R,
Pladsen AV, Ottestad L, Touleimat N,
Laakso M, Halvorsen AR, Grenaker Alnæs GI,
Riis ML, Helland A, Hautaniemi S, Lonning
PE, Naume B, Børresen-Dale AL, Tost J, Kris-
tensen VN (2017) DNA methylation signature
(SAM40) identifies subgroups of the luminal a
breast cancer samples with distinct survival.
Oncotarget 8(1):1074–1082
33. Millikan RC, Newman B, Tse CK, Moorman
PG, Conway K, Dressler LG, Smith LV, Lab-
bok MH, Geradts J, Bensen JT, Jackson S,
Nyante S, Livasy C, Carey L, Earp HS, Perou
CM (2008) Epidemiology of basal-like breast
cancer. Breast Cancer Res Treat 109
(1):123–139
34. Perou CM (2010) Molecular stratification of
triple-negative breast cancers. Oncologist 15
(Suppl 5):39–48
35. Sorlie T, Perou CM, Tibshirani R, Aas T,
Geisler S, Johnsen H, Hastie T, Eisen MB,
van de Rijn M, Jeffrey SS, Thorsen T,
Quist H, Matese JC, Brown PO, Botstein D,
Lonning PE, Borresen-Dale AL (2001) Gene
expression patterns of breast carcinomas distin-
guish tumor subclasses with clinical implica-
tions. Proc Natl Acad Sci U S A 98
(19):10869–10874
32 Ramona G. Dumitrescu
36. Prat A, Pineda E, Adamo B, Galvan P,
Fernandez A, Gaba L, Dı́ez M, Viladot M,
Arance A, Muñoz M (2015) Clinical implica-
tions of the intrinsic molecular subtypes of
breast cancer. Breast 24(Suppl 2):S26–S35
37. Holm K, Hegardt C, Staaf J, Vallon-
Christersson J, Jonsson G, Olsson H, Borg A,
Ringner M (2010) Molecular subtypes of
breast cancer are associated with characteristic
DNA methylation patterns. Breast Cancer Res
12(3):R36
38. Bediaga NG, Beristain E, Calvo B, Viguri MA,
Gutierrez-Corres B, Rezola R, Ruiz-Diaz I,
Guerra I, de Pancorbo MM (2016) Luminal
B breast cancer subtype displays a dicotomic
epigenetic pattern. Springerplus 5:623.
https://doi.org/10.1186/s40064-016-2235-
0 CM, Sherman ME (2014) How many etiolog-
39. Gao Y, Jones A, Fasching PA, Ruebner M,
Beckmann MW, Widschwendter M, Teschen-
dorff AE (2015) The integrative epigenomic-
transcriptomic landscape of ER positive breast
cancer. Clin Epigenetics 7:126
40. Prat A, Parker JS, Fan C, Perou CM (2012)
PAM50 assay and the three-gene model for
identifying the major and clinically relevant
molecular subtypes of breast cancer. Breast
Cancer Res Treat 135(1):301–306
41. Roberts SA, Lawrence MS, Klimczak LJ,
Grimm SA, Fargo D, Stojanov P, Kiezun A,
Kryukov GV, Carter SL, Saksena G, Harris S,
Shah RR, Resnick MA, Getz G, Gordenin DA
(2013) An APOBEC cytidine deaminase muta-
genesis pattern is widespread in human cancers.
Nat Genet 45(9):970–976
42. Kuong KJ, Loeb LA (2013) APOBEC3B
mutagenesis in cancer. Nat Genet 45
(9):964–965
43. Ithimakin S, Day KC, Malik F, Zen Q, Dawsey
SJ, Bersano-Begey TF, Quraishi AA, Ignatoski
KW, Daignault S, Davis A, Hall CL,
Palanisamy N, Heath AN, Tawakkol N, Luther
TK, Clouthier SG, Chadwick WA, Day ML,
Kleer CG, Thomas DG, Hayes DF,
Korkaya H, Wicha MS (2013) HER2 drives
luminal breast cancer stem cells in the absence
of HER2 amplification: implications for effi-
cacy of adjuvant trastuzumab. Cancer Res 73
(5):1635–1646
44. Korkaya H, Wicha MS (2013) HER2 and
breast cancer stem cells: more than meets the
eye. Cancer Res 73(12):3489–3493
45. Holm K, Grabau D, Lovgren K, Aradottir S,
Gruvberger-Saal S, Howlin J, Saal LH, Ethier
SP, Bendahl PO, Stal O, Malmström P,
Ferno M, Ryden L, Hegardt C, Borg A, Ring-
ner M (2012) Global H3K27 trimethylation
and EZH2 abundance in breast tumor sub-
types. Mol Oncol 6(5):494–506
46. Ulirsch J, Fan C, Knafl G, Wu MJ, Coleman B,
Perou CM, Swift-Scanlan T (2013) Vimentin
DNA methylation predicts survival in breast
cancer. Breast Cancer Res Treat 137
(2):383–396
47. Park SY, Seo AN, Jung HY, Gwak JM, Jung N,
Cho NY, Kang GH (2014) Alu and LINE-1
hypomethylation is associated with HER2
enriched subtype of breast cancer. PLoS One
9(6):e100429
48. Ma X, Yu L, Wang P, Yang X (2017) Discover-
ing DNA methylation patterns for long
non-coding RNAs associated with cancer sub-
types. Comput Biol Chem 69:164–170
49. Anderson WF, Rosenberg PS, Prat A, Perou
ical subtypes of breast cancer: two, three, four,
or more? J Natl Cancer Inst 106(8):dju165
50. Prat A, Adamo B, Fan C, Peg V, Vidal M,
Galvan P, Vivancos A, Nuciforo P, Palmer
HG, Dawood S, Rodon J, Ramon y Cajal S,
Del Campo JM, Felip E, Tabernero J, Cortes J
(2013) Genomic analyses across six cancer
types identify basal-like breast cancer as a
unique molecular entity. Sci Rep 3:3544
51. Hoadley KA, Yau C, Wolf DM, Cherniack AD,
Tamborero D, Ng S, Leiserson MD, Niu B,
McLellan MD, Uzunangelov V, Zhang J,
Kandoth C, Akbani R, Shen H, Omberg L,
Chu A, Margolin AA, Van’t Veer LJ, Lopez-
Bigas N, Laird PW, Raphael BJ, Ding L,
Robertson AG, Byers LA, Mills GB, Weinstein
JN, Van Waes C, Chen Z, Collisson EA, Benz
CC, Perou CM, Stuart JM, Cancer Genome
Atlas Research Network (2014) Multiplatform
analysis of 12 cancer types reveals molecular
classification within and across tissues of origin.
Cell 158(4):929–944
52. Prat A, Cruz C, Hoadley KA, Dı́ez O, Perou
CM, Balmana J (2014) Molecular features of
the basal-like breast cancer subtype based on
BRCA1 mutation status. Breast Cancer Res
Treat 147(1):185–191
53. Ghabach B, Anderson WF, Curtis RE, Huycke
MM, Lavigne JA, Dores GM (2010) Adenoid
cystic carcinoma of the breast in the United
States (1977 to 2006): a population-based
cohort study. Breast Cancer Res 12(4):R54
54. Prat A, Adamo B, Cheang MC, Anders CK,
Carey LA, Perou CM (2013) Molecular char-
acterization of basal-like and non-basal-like
triple-negative breast cancer. Oncologist 18
(2):123–133
55. Park SY, Kwon HJ, Choi Y, Lee HE, Kim SW,
Kim JH, Kim IA, Jung N, Cho NY, Kang GH
 Interplay Between Genetic and Epigenetic Changes in Breast Cancer Subtypes
(2012) Distinct patterns of promoter CpG
island methylation of breast cancer subtypes
are associated with stem cell phenotypes. Mod
Pathol 25(2):185–196
56. Dong C, Wu Y, Wang Y, Wang C, Kang T,
Rychahou PG, Chi YI, Evers BM, Zhou BP
(2013) Interaction with Suv39H1 is critical
for snail-mediated E-cadherin repression in
breast cancer. Oncogene 32(11):1351–1362
57. Rao X, Evans J, Chae H, Pilrose J, Kim S,
Yan P, Huang RL, Lai HC, Lin H, Liu Y,
Miller D, Rhee JK, Huang YW, Gu F, Gray
JW, Huang TM, Nephew KP (2013) CpG
island shore methylation regulates caveolin-1
expression in breast cancer. Oncogene 32
(38):4519–4528
58. Jeong YJ, Jeong HY, Bong JG, Park SH, Oh
HK (2013) Low methylation levels of the
SFRP1 gene are associated with the basal-like
subtype of breast cancer. Oncol Rep 29
(5):1946–1954
59. Zhu X, Shan L, Wang F, Wang J, Wang F,
Shen G, Liu X, Wang B, Yuan Y, Ying J, Yang
H (2015) Hypermethylation of BRCA1 gene:
implication for prognostic biomarker and ther-
apeutic target in sporadic primary triple-
negative breast cancer. Breast Cancer Res
Treat 150(3):479–486
60. Sandhu R, Rivenbark AG, Mackler RM, Livasy
CA, Coleman WB (2014) Dysregulation of
microRNA expression drives aberrant DNA
hypermethylation in basal-like breast cancer.
Int J Oncol 44(2):563–572
61. Poli E, Zhang J, Nwachukwu C, Zheng Y,
Adedokun B, Olopade OI, Han YJ (2015)
Molecular subtype-specific expression of
MicroRNA-29c in breast cancer is associated
with CpG dinucleotide methylation of the pro-
moter. PLoS One 10(11):e0142224
62. Chae H, Lee S, Nephew KP, Kim S (2016)
Subtype-specific CpG island shore methylation
and mutation patterns in 30 breast cancer cell
lines. BMC Syst Biol 10(Suppl 4):116
63. Chin K, DeVries S, Fridlyand J, Spellman PT,
Roydasgupta R, Kuo WL, Lapuk A, Neve RM,
Qian Z, Ryder T, Chen F, Feiler H,
Tokuyasu T, Kingsley C, Dairkee S, Meng Z,
Chew K, Pinkel D, Jain A, Ljung BM,
Esserman L, Albertson DG, Waldman FM,
Gray JW (2006) Genomic and transcriptional
aberrations linked to breast cancer pathophy-
siologies. Cancer Cell 10(6):529–541
64. Davalos V, Martinez-Cardus A, Esteller M
(2017) The epigenomic revolution in breast
cancer: from single-gene to genome-wide
next-generation approaches. Am J Pathol 187
(10):2163–2174
33
65. Xu Z, Bolick SC, DeRoo LA, Weinberg CR,
Sandler DP, Taylor JA (2013) Epigenome-
wide association study of breast cancer using
prospectively collected sister study samples. J
Natl Cancer Inst 105(10):694–700
66. Fackler MJ, Umbricht CB, Williams D,
Argani P, Cruz LA, Merino VF, Teo WW,
Zhang Z, Huang P, Visvananthan K, Marks J,
Ethier S, Gray JW, Wolff AC, Cope LM, Suku-
mar S (2011) Genome-wide methylation anal-
ysis identifies genes specific to breast cancer
hormone receptor status and risk of recurrence.
Cancer Res 71(19):6195–6207
67. Ambrosone CB, Young AC, Sucheston LE,
Wang D, Yan L, Liu S, Tang L, Hu Q, Freu-
denheim JL, Shields PG, Morrison CD,
Demissie K, Higgins MJ (2014) Genome-
wide methylation patterns provide insight into
differences in breast tumor biology between
American women of African and European
ancestry. Oncotarget 5(1):237–248
68. Li Y, Zhang Y, Li S, Lu J, Chen J, Wang Y, Li Y,
Xu J, Li X (2015) Genome-wide DNA methy-
lome analysis reveals epigenetically dysregu-
lated non-coding RNAs in human breast
cancer. Sci Rep 5:8790
69. van Veldhoven K, Polidoro S, Baglietto L,
Severi G, Sacerdote C, Panico S, Mattiello A,
Palli D, Masala G, Krogh V, Agnoli C,
Tumino R, Frasca G, Flower K, Curry E,
Orr N, Tomczyk K, Jones ME, Ashworth A,
Swerdlow A, Chadeau-Hyam M, Lund E,
Garcia-Closas M, Sandanger TM, Flanagan
JM, Vineis P (2015) Epigenome-wide associa-
tion study reveals decreased average methyla-
tion levels years before breast cancer diagnosis.
Clin Epigenetics 7(1):67
70. Holm K, Staaf J, Lauss M, Aine M,
Lindgren D, Bendahl PO, Vallon-
Christersson J, Barkardottir RB, Hoglund M,
Borg A, Jonsson G, Ringner M (2016) An
integrated genomics analysis of epigenetic sub-
types in human breast tumors links DNA meth-
ylation patterns to chromatin states in normal
mammary cells. Breast Cancer Res 18(1):27
71. Stirzaker C, Zotenko E, Song JZ, Qu W, Nair
SS, Locke WJ, Stone A, Armstong NJ, Robin-
son MD, Dobrovic A, Avery-Kiejda KA, Peters
KM, French JD, Stein S, Korbie DJ, Trau M,
Forbes JF, Scott RJ, Brown MA, Francis GD,
Clark SJ (2015) Methylome sequencing in
triple-negative breast cancer reveals distinct
methylation clusters with prognostic value.
Nat Commun 6:5899
72. Messier TL, Gordon JA, Boyd JR, Tye CE,
Browne G, Stein JL, Lian JB, Stein GS (2016)
Histone H3 lysine 4 acetylation and
34 Ramona G. Dumitrescu
methylation dynamics define breast cancer sub-
types. Oncotarget 7(5):5094–5109
73. Judes G, Dagdemir A, Karsli-Ceppioglu S,
Lebert A, Echegut M, Ngollo M, Bignon YJ,
Penault-Llorca F, Bernard-Gallon D (2016)
H3K4 acetylation, H3K9 acetylation and
H3K27 methylation in breast tumor molecular
subtypes. Epigenomics 8(7):909–924
74. Zhao QY, Lei PJ, Zhang X, Zheng JY, Wang
HY, Zhao J, Li YM, Ye M, Li L, Wei G, Wu M
(2016) Global histone modification profiling
reveals the epigenomic dynamics during malig-
nant transformation in a four-stage breast can-
cer model. Clin Epigenetics 8:34. https://doi.
org/10.1186/s13148-016-0201-x eCollec-
tion 2016
75. Chen X, Hu H, He L, Yu X, Liu X, Zhong R,
Shu M (2016) A novel subtype classification
and risk of breast cancer by histone modifica-
tion profiling. Breast Cancer Res Treat 157
(2):267–279
 Chapter 3

Role of Microbiome in Carcinogenesis Process

and Epigenetic Regulation of Colorectal Cancer
Lulu Farhana, Hirendra Nath Banerjee, Mukesh Verma,
and Adhip P. N. Majumdar

Abstract
Epigenetic changes during the development of colorectal cancer (CRC) play a significant role. Along with
factors such as diet, lifestyle, and genetics, oncogenic infection, bacteria alone or whole microbiome, has
been associated with this tumor type. How gut microbiome contributes to CRC pathogenesis in the host is
not fully understood. Most of the epigenetic studies in CRC have been conducted in populations infected
with Helicobacter pylori. In the current review, we summarize how the gut microbiota contributes in colon
carcinogenesis and the potential role of epigenetic mechanism in gene regulation. We discuss microbiota-
mediated initiation and progression of colon tumorigenesis and have also touched upon the role of
microbial metabolites as an initiator or an inhibitor for procarcinogenic or antioncogenic activities. The
hypothesis of gut microbiota associated CRC revealed the dynamic and complexity of microbial interaction
in initiating the development of CRC. In the multifaceted processes of colonic carcinogenesis, gradual
alteration of microbiota along with their microenvironment and the potential oncopathogenic microbes
mediated modulation of cancer therapy and other factors involved in microbiome dysbiosis leading to the
CRC have also been discussed. This review provides a comprehensive summary of the mechanisms of CRC
development, the role of microbiome or single bacterial infection in regulating the processes of carcino-
genesis, and the intervention by novel therapeutics. Epigenetic mechanism involved in CRC is also
discussed.

Key words Bacteria, Colorectal cancer, Epigenetics, Methylation, Microbiome, Virus

1 Introduction

The incidence and mortality of colorectal cancer (CRC) is the third

most common cancer in both men and women, the second leading
cause of cancer-related deaths in the USA, and the fourth leading
cause of cancer-related deaths worldwide with a 5-year survival of
50% (National Cancer Institute, SEER program [1–3]. In the USA,
CRC incidence rates are highest in Alaska Natives and blacks, and
lowest in Asian and Pacific Islanders (API), and the incidence is
more in men than women [2]. Globally, however, the Southeast

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_3,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

35
36 Lulu Farhana et al.

Asian incidence rate is lower than that of any other race/ethnicity

[4]. The estimated new cases and deaths from colon and rectal
cancer (colorectal cancer) in the USA in 2017 are as follows:
95,520 new cases of colon cancer, 39,910 cases of rectal cancer
with an estimated death of 50,260 [5].
Remarkably, the incidence rates of CRC in younger than
50 continue to rise, increasing to 22% from 2000 to 2013, while
the incidence rates of CRC continue to decline in people 50 and
older, being reduced by 32% since 2001. The reasons for the
increased incidence of CRC could be due to excessive body weight,
unhealthy dietary pattern (like increased red and processed meat
intake or decreased dietary fiber, fruits and vegetables, vitamin D)
and physical inactivity [5–11]. However, improved longevity in
developed countries could be attributed to advanced diagnostic
and prognostic technology [12].
The International Agency for Research on Cancer (IARC)
estimated that approximately 1.2 million new cases of CRC were
diagnosed in 2008 (9.8%) making CRC the fourth most common
cancer worldwide and CRC mortality counted for over 600,000 of
the 7.6 million; large variations and the lack of data on the CRC in
sub-Saharan Africa and SEA (Southeast Asia) could be due to
limitation of regular monitoring as well as lack of well-connected
systematic process [4, 13]. CRC is the fourth most common cancer
in SEA according to the estimated cancer registries in the 2008
GLOBOCAN database [14]. The Southeast Asia (SEA) region
includes 11 countries, according to World Health Organization
(WHO) classification (Bangladesh, Bhutan, Korea, India, Indone-
sia, Maldives, Myanmar, Nepal, Sri Lanka, Thailand, and Timor-
Leste).
During this time span, the incidence rate in non-Hispanic black
(NHBs) was found to be about 20% higher than those in
non-Hispanic whites (NHWs) and 50% higher than those in Asian
Americans/Pacific Islanders (APIs) (Table 1). During 2010
through 2014, CRC death rates in NHBs were 40% higher than
those in NHWs and twice those in API [2].

2 Colon Carcinogenesis

Colorectal cancer is an age-related disease, a multifaceted sequential

process of carcinogenesis resulting from accumulation of mutations
during progression from normal epithelium to adenoma to carci-
noma [15–19], the latter reviewed and investigated by others
[20]. The development of CRC from normal colonic epithelia
requires a sequence of genetic changes and inflammatory-
immunological factors to facilitate and shape a tumorigenic
microenvironment.
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 37

Table 1
CRC incidence (2009–2013) and mortality (2010–2014) rates in different races

Incidence rates per 100,000 Mortality rates per 100,000

Ethnicity (Male + Female) (Male + Female) Reference
Non-Hispanic black 101 42.8 [5]
Non-Hispanic white 81.3 29.6 [5]
Hispanic 72.6 24.2 [5]
American Indian (AI)/ 92.6 33.5 [5]
Alaska Native (AN)
Asian American/Pacific 65.6 21.2 [5]
Islander (APIs)
Southeast Asian 6.95 0.078 [4]

The initial phenotypic appearance of polyps or nonmalignant

adenoma occur in response to genomic instability due to the loss of
tumor suppressor gene like adenomatous polyposis coli (APC)
(mutation over 80% in CRC); adenomas can invade into submucosa
and develop cancer. APC, a component of the oncogenic
Wnt/β-catenin signaling pathway, is important for key cellular
functions during development including proliferation, differentia-
tion, migration, genetic stability, and apoptosis [21–23]. Mutation
in APC inactivates the β-catenin destruction complex (the main
components of this destruction complex are APC, Axin, casein
kinase1, and glycogen synthase 3β) in sporadic CRC
[19, 24]. These mutations occur within the crypt base stem cells
and acted upon by other agents to ultimately transform the epithe-
lium to adenocarcinoma [25]. The APC mutation is present in
approximately 5% of aberrant crypt focus, 50% of sporadic adeno-
mas, and 75% of sporadic colorectal cancer [26]. The vast majority
of pathways preferentially are mutated in CRC and the effects of
constitutive activation of Wnt signaling is depicted to be one of the
leading causes of CRC [19, 27].
The oncogenic multistep progression requires a number of
genetic alterations during indefinite years and each step in CRC
tumor progression results from well-defined alterations in the
genome [20]. Colorectal cancer is approximately 90% sporadic,
triggered by somatic mutations resulted in the progression of inva-
sive carcinoma [28, 29]. In one CRC model, mutations in APC
gene often occur early and trigger hyperproliferation and formation
of adenoma of class I; constitutive K-ras activation promotes tumor
cells proliferation of adenoma class II; loss of tumor suppressor
genes, deleted in colorectal cancer (DCC) results in class III and
then p53 mutation are associated with invasive cancer [29]. Another
CRC model is based on “microsatellite instability” (MSI) that
38 Lulu Farhana et al.

causes mutations in DNA mismatch repair genes leading to accu-

mulation of uncorrected replication errors resulting in hyper prolif-
eration and eventually carcinoma [30]. Advanced tumors, however,
possess mutation and/or deletion in a number of oncogenes and
tumor suppressor genes not seen in the early adenoma [31].

3 Human Microbiome and Progression of CRC

Emerging evidence suggests that the intestinal microbiota is one of

the important factors in the development of CRC. How colon
microbiome contributes to the pathogenesis of sporadic human
CRC is not yet well understood as well as the molecular mechan-
isms by which microbiota mediates chronic inflammation followed
by CRC development.
The gut microbes are thought to play a symbiotic interaction to
uphold the gut homeostasis by shifting microbiomes through diet,
lifestyle, or genetic traits. The human body harbors as many micro-
bial cells as all human cells; an estimated 40 trillion microbes
composed of at least 1000 species of which the vast majority are
present in the colon with a ratio closer to 1:1 [32]. However, the
collective genome of microbiota in microbiome encodes approxi-
mately 100-fold more proteins than the human genome
[33]. Human genetic variation and the gut microbiome can both
influence the composition of an individual’s microbiome and
impact host metabolism [34]. The gut microbiota that influence
cancer predisposition is thought to exert their influence through
their metabolic activity and their profound influence on immune
cell function [35].
A growing body of evidence suggests that imbalance in normal
intestinal microbiota can promote inflammatory conditions by pro-
ducing carcinogenic secondary metabolites that lead to neoplasia
[36]. Host diet and metabolism can cause microbiota to get
involved in modifying cancer susceptibility. The potential procarci-
nogenic roles of bacterial products, including toxins, hydrogen
sulphide, ployamines, secondary bile acids, and reactive oxygen
species (ROS) have been linked to diet with rich saturated fats
and lack of dietary fibers and their products are also associated
with CRC risk [37]. Elevated levels of several of these proinflam-
matory and procarcinogenic factors such as bile acids produced by
the liver and enzymatic biotransformation of primary bile acids to
secondary bile acids (SBA), specifically lithocholic acid (LCA) and
deoxycholic acid (DCA) is initiated by a few species of gut anaero-
bic bacteria in the Clostridium genus [38]. Thus, a combination of
increased proinflammatory fatty acids, high sugar, and low dietary
fiber would lead to alterations in the composition of microbiota in
the gut that could increase the risk of CRC [39]. The potential of
the metabolites secreted by the gut microbiota, some of which
Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 39

could be connected to prevent CRC, has been discussed

[39]. Notable, among them are short chain fatty acids (SCFA)
(acetate, n-propionate, and n-butyrate), the end products of bacte-
rial anaerobic fermentation of dietary fiber. Phyla Bacteroidestes
and Firmicutes bacteria are known to secrete SCFA [37, 40], which
are known to possess anti-inflammatory properties and can induce
abundance of colonic Treg (Regulatory T cell) pool and thus
protect against colitis in mice [41].
Human clostridia species from Cluster IV, XIVa, and XVIII
enhance Treg cell abundance with increase in the production of
potent anti-inflammatory molecules such as cytokine IL-10 in mice
[42]. In addition, the beneficial effect of omega-3, poly unsaturated
fatty acids (PUFAs, docosahexaenoic acid and eicosapentaenoic
acid) as chemopreventive and anti-inflammatory agents that inhibit
colon carcinogenesis is now well established [43].
Interestingly, consumption of Omega-3 fatty acids has been
found to enrich lactobacillus species in the gut of mice [44]. We
also noted a similar change in gut microbiota when we analyzed the
feces from mice fed a diet containing 5% Omega-3 fatty acids,
enriched with eicosapentaenoic acid (EPA; one of the ω-3 PUFA),
as shown in Fig. 1.
The gut microbiota alterations that are associated with CRC
development can have detrimental effects on epithelial cell function
and genetics resulting in changes in oncogenes. Based on the
increasing evidence of the relationship between changes in intesti-
nal microbiota and CRC [45], five different models on changes in
gut microbiome and development of CRC were delineated; they
are (1) the alpha bug, (2) driver–passenger, (3) biofilms effect,
(4) the intestinal microbiota adaptation, and (5) bystander effect.
The alpha bug and keystone pathogen models suggested that
CRC carcinogenesis is driven primarily by the low abundance of

Fig. 1 Microbiome distribution can be altered by diet. Mice were fed on a diet
containing 5% fish oil [enriched with eicosapentaenoic acid (EPA)]. Feces were
collected after 2 months; DNA was isolated using QIAamp DNA stool mini kit
(Qiagen), PCR was performed using 16S rRNA-specific primers. Data show an
increase in Bifidobacteria and Lactobacillus acidophilus and a decrease in
Clostridium XIV and IV
40 Lulu Farhana et al.

certain microbiota (pathogens) that produces toxins/or metabo-

lites to modulate host cells into inflammatory state and also incites
remodeling in the composition of colonic microbiota such as
microbial dysbiosis [46]. Alpha-bugs model is based on studies
with pathogenic bacteria, Bacteroides fragilis, that are capable of
remodeling mucosal immune response; that secrets metalloprotease
enterogenic toxin (EBFT), named fragilysin, implicated in CRC
initiation through stimulating the cleavage of tumor suppressor
protein E-cadherin in epithelial cells and enhance cell proliferation
and permeabilization of intestinal barrier [47]. EBFT is also able to
induce T helper type 17 (Th17)-dependent inflammatory
responses, crucial for pathogenesis [48].
The selection and remodeling of local microbiota composition
at the site of damage through inflammation occur either through
recruitment of other pro-oncogenic species or by diminishing pro-
tective species against CRC. During oncogenic transformation
from normal epithelium to a neoplastic lesion, alpha bug pathogen
disappears due to out-competition by opportunistic bacteria which
are better adapted in tumor microenvironment during CRC
progression [49].
The driver–passenger model suggests that bacterial drivers and
passengers have distinct sequential association with CRC tissue and
major CRC-promoting factors come from colonization by passen-
ger microbes that can settle within a niche prepared them for the
driver species [50]. The bacterial drivers, such as procarcinogenic
Enterococcus faecalis produces superoxide and then converted to
hydrogen peroxide to cause DNA damage in colonic epithelial cells.
Other stains, certain adherent-invasive Escherichia coli produces
genotoxin, colibactin that induce double-strand DNA breaks,
which then lead to activation of DNA damage in cells [51]. The
driver pathogen might initially colonize the intestinal mucosa and
afterward induce a Th17—immune response that resulted in
increase in intestinal epithelium proliferation through nonfunc-
tional or mutated tumor suppressor genes, such as APC. The
altered microenvironment might then allow passenger pathogens
such as Fusobacterium spp. and Streptococcus spp. to colonize the
mucosa and thus promoting CRC [50]. This hypothesis gained
more strength from several metagenomic and meta-transcriptomic
studies and these studies have demonstrated the association
between CRC tissue and Fusobacterium nucleatum [49, 52].
The biofilm effect model indicates that certain colonizing
microbes, particularly in the proximal colon to the hepatic flexure
can form aggregates, resulting in dense and higher order mucosal
microbial communities structure termed as biofilm that are able to
persist in the niche and potentiate CRC development [53]. This
polymicrobial biofilms tended to invade the normal colonic mucus
layer and are associated with initiation of procarcinogenic tissue
inflammation and the CRC development [54]. The microbiome
Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 41

profiles from normal mucosa and tumor exhibited the differences

and lack of taxa in microbial biofilm communities [53]. Early bio-
film formation can facilitate reduction in E-cadherin in colonic
epithelial cells and enhance pro-inflammatory cytokine IL-6 with
activation of transcription factor Stat3 which is involved in the
induction of cell proliferation and angiogenesis and thus, contri-
butes to CRC development [55].
The gut microbial ecosystem exists in a dynamic state of balance
that is influenced directly by its surroundings and the gut micro-
biota is in continuous state of adaptation to its environment
[45]. In the intestinal microbiota adaptations model, both exoge-
nous and endogenous factors such as diet, infection, antibiotic
exposure, immune systems function, and driving forces that shape
the overall balance between cancer-promoting versus cancer-
protective microbiota compositions are evident [56, 57].
Finally, commensal-driven bystander effect model is usually
associated with the ionizing radiation and is recognized to activate
the release of diffusible mutagenic agents or clastogens (such as
4-HNE, trans-4-hydroxy-2-nonenal) by host cells, which can dam-
age genomic DNA, leading to chromosomal instability, cell cycle
arrest, and aneuploidy, and can directly contribute to oncogenesis
[45]. Superoxides produced by metabolisms of certain microbial
species can stimulate stromal macrophages to produce
cyclooxygenase-2, which acts as a clastogen and directs carcino-
genic effect on host cells [58]. Certain commensal species like
Entercoccus faecalis produces extracellular superoxide which drives
DNA damage in colonic epithelial cells and that has been found to
be higher in patients with CRC than healthy controls [59].
Enormous phylogenetic diversity of intestinal microbiota and
thousand species-level phylotype in human population has been
estimated; the prevalence of more than 160 species per individual
was detected in metagenomics survey [60]. While phylogenetic
diversity is high at the species level, two predominant bacterial
phyla, Bacteroides and Firmicutes contribute to 95% of the total
GI ecosystem and are associated with adenomas and CRC
[61]. Members of Actinobacteria, Proteobacteria, Fusobacteria,
Verrucomicrobia, Spirochaetes, and Lentisphaerae are regularly
present but scarce (<1%–15%) [62]. The microbial diversity was
observed between races, the taxonomic phylogenetic tree showing
differences in microbiota composition between African Americans
(AA) and Caucasian Americans (CA), revealed that the abundance
of taxon was higher in CA than AA (Farhana et al., unpublished
observation).
42 Lulu Farhana et al.

4 Microbiota, Immunity, and Anticancer Effects

Microbiota is an important component for the development of a

healthy immune system for proper immune functions and protec-
tion; microbes and the host mutualistic relationship and their inter-
actions affect host innate and adaptive immunity [63]. Failed
immune-surveillance as well as systemic immunosuppressive effects
is associated with microbial alteration in the gut that led to CRC
development [64]. Remarkably, the mucosal microbiome composi-
tion is largely consistent within a healthy adult. The abundance and
diversity of fecal microbiota is more than the mucosal microbiota
and also not all mucosal species in an individual are necessarily
detected in stool [60].
Autoimmune immunopathology and chronic inflammation in
host results in perturbation of the commensal symbiosis between
intestinal microbiota and the host [65]. The composition of the gut
microbiota can also influence the immunostimulatory capability of
cancer therapies [66].
Growing evidence demonstrates that the gut microbiota
enhances the immune T-cell responses indicating the role of anti-
tumor immune responses to checkpoint inhibitors against the cyto-
toxic T lymphocytes antigen 4 (CTLA-4) and the programmed
T-cell death 1 receptor (PD-1), which may result in tumor regres-
sions [67, 68]. The immune check point inhibitors lost the thera-
peutic efficacy in patients treated with antibiotic due to change of
bacterial composition and its functional capacity [69]. Gut micro-
biota Bacteroides spp. and Burkholderiales facilitated efficacy of
CTLA-4 anticancer immunotherapy by enhancing tumor control
in mice [70].
Antioncogenic gut microbiota, Bifidobacterium species was
associated with antitumor T-cell responses in mice [71]. In CRC
tissues, the major butyrate-producing intestinal bacteria Coriobac-
teriia, Roseburia, Fusobacteria, and Faecalibacterium are more
abundant in tumors [36]. The colonic microbiota, dependent on
diets and intake of normal balanced diet, predominantly produces
all three SCFAs and they exert anti-inflammatory and antiprolifera-
tive properties [72]. Butyrate protective mechanisms against CRC
are caused by inducing p21-dependent cell cycle arrest, resulting in
increased apoptosis of carcinogenic cells [73]. The human com-
mensal and immune modulatory microbiota Bacteroides fragilis
stimulates production of the anti-inflammatory cytokines IL-10
by Foxp3+ regulatory CD4+ Treg cells, thus facilitating coloniza-
tion and suppressing mucosal inflammation in the intestine [74].
Consumption of an unbalanced diet rich in meat and low fiber
increases fermentation of protein and produces toxic metabolites,
ammonia, heterocyclic amines, phenols, sulfides, and branched
fatty acids, which are proinflammatory and have carcinogenic
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 43

properties [75, 76]. The oncogenic compound TAMO (trimethy-

lamine N-oxide), a microbial metabolite of red meat and fat is
genetically linked with CRC and cardiovascular diseases [77]. The
Bacteroides fragilis toxin (BFT) exists in an enterotoxin-producing
form which induces inflammatory bowel disease and colorectal
cancer [78].

5 Epigenetic Regulation of CRC

Epigenetic marks include DNA methylation, histone tail modifica-

tions, noncoding RNA processing, and chromatin remodeling pro-
cesses. Epigenetic biomarkers that can be used for the diagnosis of
CRC have been identified [79, 80]. In the last decade, many gene
expression studies reported mediation by conceding RNAs, espe-
cially micro-RNAs (miRNAs) and now these alterations are recog-
nized as epigenetic changes [81–83]. Among all epigenetic
changes, the DNA methylation has been studied the most in
CRC [84]. Aberrant DNA methylation is induced in driver genes
during CRC development [82, 83, 85, 86]. Histone modifications
also contribute to CRC development [87, 88]. Circulating nucleo-
somes carry CRC associated histone marks, for example,
H3K9me3, H4K20me3, and H3K27me3 [89]. Trimethylation of
histones H3K4, H3K9, and H4K20 was associated with CRC
survival and recurrence [90]. A few selected potential CRC bio-
markers are shown in Table 2. These biomarkers might be useful in
the risk assessment, detection, diagnosis, and prognosis of CRC.
A few selected genes which get hypermethylated in CRC
include APC, MGM2, RAAS F2A, RUNX3, HLTF, ALX4,
SOX2, p14, p16, DLCK1, WIF1, and NDRG4 [94]. The left
side of colon shows different characteristics than right side in
terms of the level of methylation of different genes, microsatellite
instability (MSI), types of mutations, and response to treatment.
The term CpG Island Methylator Phenotype or CIMP was used for
CRC stratification based on the methylation status [98, 99]. Aber-
rant hMLH1 promoter methylation occurs in the majority of spo-
radic CRC with high MSI [91].
MiRNAs (also represented as miRs) and other noncoding
RNAs are part of the epigenetic machinery that regulates gene
expression at the posttranscriptional level, and it is estimated that
they regulate translation of more than 60% genes [130, 131]. The
size of miRNAs ranges from 21 to 25 nucleotides, whereas non-
coding RNAs are more than 200 nucleotides long. miRNAs are
synthesized in the nucleus much longer which are then processed
for smaller size and transported to the cytoplasm [131]. During this
process, a protein Drosha and its cofactor DGCR8 bind to the
precursor miRNA which is finally bind to RNAse III enzyme
Dicer resulting in the mature miRNAs, which are incorporated
44 Lulu Farhana et al.
Table 2
Selected potential epigenetic biomarkers of CRC detection, diagnosis, and prognosis
Biomarkers
hMHL1 methylation
Ten gene methylation profile (SFRP1, Multiplexing of ten gene hypermethylation is a biomarker
SST, BNC1, MAL, SLIT2, SFRP2,
SLIT3, ALDH1A3, TMEFF2, and WIF1)
PPP1R3C and EFHD1 methylation
H1F1A and EPAS1 methylation
APC and MGMT methylation
P53 and K-ras methylation
P16(INK4a) methylation
CDH1 hypermethylation
CpG Island Methylator phenotype
of CIMP
Histone H3 modifications affecting
CAV1 gene
Circulating nucleosomes (H3K9me3,
Hk24me3, H3K27me3)
Histone modifications of clusterin gene
(H3K927 and H3K4me3)
Trimethylation of histones H3, K4,
H3K9, and H4K20
Histone demethylase
miR-34 and miR-150
miR-20a-5p
miR-200c
miRs-31, -223
miRs-105, -549, -1269, -1827,
-3144-3p, -3177, -3180-3p, -4326
miR-1
miR-92a
Comments
Aberrant hMLH1 promoter methylation occurs in CRC
with high MSI [91]
of adenocarcinoma and carcinoma [92]
CRC diagnostic markers in plasma samples [84]
Methylation biomarkers of CRC affecting transcription in
CRC [93]
Early stage regulation of CRC development [94]
Inactivation due to hypermethylation in CRC [95]
Gene loss due to hypermethylation is a biomarker of CRC
survival [96]
Involved in CRC development [97]
CpG Island Methylator phenotype of CIMP was used for
CRC stratification based on the methylation status
[98, 99].
Signaling in CRC [87]
Carry CRC associated histone marks [89].
CRC development [88]
CRC survival and recurrence biomarkers [90].
Higher levels of histone demethylases reflect CRC
regression [100]
Biomarkers for CRC progression [101]
Associated with CRC survival [102].
Involved in epithelial-to-mesenchymal transition [103]
Overexpressed in CRC of patients with hereditary
non-polyposis colorectal cancer syndrome (Lynch
syndrome) [104]
Upregulated in CRC [105]
Underexpressed [106]; inhibits cell proliferation and
viability [107]
Downregulation in CRC [108]
(continued)
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 45

Table 2
(continued)

Biomarkers Comments
miR-122, miR-214, miR-372, Differentially expressed and affect p53 pathway [109]
miR-15b, let-7e, let-17
miR-195 Downregulated in CRC and correlates with lymph node
metastasis and poor prognosis [110]
miRs-15b, -181b, -191, -200c Overexpressed [111]
miR-499 Underexpressed [112]
miR-9-1 Expression is inversely associated with its promoter
methylation; associated with lymph node metastasis
[113]
miR-21 Acts as an oncomiR; inflammation-mediator in CRC
[114]; interacts with PTEN/PI-3 K/Akt signaling
pathway [115]; overexpressed in high-risk stage II CRC
patients [116]
miRs-34a, -34b/c Inactivation due to promoter methylation [117]; in
Wnt-signaling [118]; regulate Axl receptor expression
[119]
miR-92 Higher levels in adenomas and carcinomas than other
miR-17-92 cluster members (miR-17, miR-18a,
miR-19a, miR-19b, miR-92a) [120]
miRs-192, -215, -26b, -143, -145, Underexpressed in CRC [104]
-191, -196a, -16, let-7a
miRs-31, -183, -17-5p, -18a, Overexpressed in CRC [121]
-20a, -92
miR-135b Correlated with the degree of malignancy [122]
miR-126 Underexpressed in CRC [123]
miR-129 Regulates cell proliferation; interacts with Cdk6 [124]
miRs-17-92 cluster, miRs-21, -135 Could be detected in exfoliated colonocytes isolated from
feces for CRC screening; upregulated in CRC [125];
interaction of miR-135 with APC expression and Wnt
pathway [126]
miRs-182, -17, -106a, -93, -200c, Upregulated in CRC [127]
-92a, let-7a, -20a
miRs-215, -375, -378, -422a Decreased in CRC [128]
miRs-127-3p, -92a, -486-3p, -378 Downregulated in KRAS mutation positive samples [129]
46 Lulu Farhana et al.

into the RNA-induced silencing complex (RISC). These RNAs act

as endogenous suppressor of gene expression by binding to the
30 -untranslated region (30 -UTR) of target mRNAs and inducing
mostly mRNA degradation or sometime translational repression,
depending on the structure of the target mRNA.
More than 1500 miRNAs have been identified and depending
on the disease state of a person, these miRNAs go to specific organ
sites to perform specific functions. Therefore, a group of miRNAs
may work in one organ at one time and another organ at a different
time. Currently, technologies are available to determine the
profiling of all miRNAs in real time [102]. Single nucleotide poly-
morphisms (SNPs) have been reported in genes coding for miR-
NAs which can be used for cancer risk assessment to help identify
individuals or populations at high risk of developing cancer [132].
Regarding their mode of action, miRNAs function as endoge-
nous suppressor of gene expression by binding of RISC to the
30 -UTR of target mRNAs and degrading them [133]. miRNAs
can function either to induce or suppress cancer development. A
few examples are described below. miR-503 is reported for early
cancer development and poor prognosis of CRC [134]. miR-34a
and miR-150 are involved in progression of CRC [101]. miR-122,
miR-214, miR-372, miR-15b, let-7e, and let-17 control differen-
tiation of CRC mediated by p53 pathway [109]. One biomarker,
miR-20a-5p, has been reported to be associated with CRC survival
[102]. Down regulation of miR-92a is also reported to be involved
in CRC development [108]. MiR-143 is a prognosticator and a
promising drug target in CRC patients with K-ras mutations under-
going EGFR targeted therapy [135]. The clinical implication of
determining the profiling of miRNAs and/or polymorphism in
miRNA coding genes is tremendous because miRNAs are present
in biofluids, such as plasma and serum [108].
Infection by Helicobacter (H.) pylori has been reported in CRC
and it has been shown to induce changes in the methylation of host
genes, especially genes involved in inflammatory pathway
[136]. Examples of these genes include II1b, Nos2, and Tnf
[136]. Total aberrant methylation corresponds to the CRC risk in
H. pylori infected individuals. H. pylori has been detected in colo-
rectal malignant tissues although its direct role in carcinogenesis has
not very well understood [137, 138]. H. pylori infection targets the
normal gastric mucosa causing nonatrophic gastritis [85]. One
study suggested that infection with virulent strain of H. pylori that
express CagA gene is proposed to CRC carcinogenesis by inducing
IL8 synthesis [139].
Analysis of epigenetic and clinical data from The Cancer
Genome Atlas (TCGA) indicated subgroups of patients with dis-
tinct clinical features and a list of genes and pathways involved in
CRC development [140]. Presence of John Cunningham Virus
(JC virus) in CRC has been reported, and it is expected that
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . . 47

infection may play a role in carcinogenesis and may be involved in

the late stages of CRC development [140–144]. In spite of our
understanding the epigenetic mechanism in single infections, the
involvement of epigenetic mechanism in microbiome mediated
CRC is largely unknown.

6 Prevention and Microbial Modulation for Treating CRC

Microbiota and intestinal epithelial cells are in dynamic complex

microbiome ecosystem and host immunity interaction influence the
oncogenesis and also anticancer treatment therapy [65]. Develop-
ment of drugs targeting microbial metabolites to improve human
health remains a huge challenge [145]. However, the possibility
that the effect of microbial agents or their products could be used as
therapeutics for treatment of cancer has been the subject of many
discussions [64].
It is important to understand that the production of microbial
secretory products is quite dynamic and in most cases bacterial
metabolites such as short chain fatty acids, secondary bile acids,
and trimethylamine N-oxide (TAMO) are produced in greater
amounts after ingestion of a meal [146]. For cancer prevention,
high intake of dietary fiber and complex carbohydrates that increase
healthy gut microbiota and modulate host metabolisms are
thought to reduce the risk of colon cancer by improving immunity
[147]. Butyrate, a fermentation product of dietary fiber in lumen
by gut bacteria, mainly clostridia clusters, particularly Cluster IV,
which are estimated to be 7%–24% of total bacteria [148], is
thought to play a beneficial role in protecting against CRC
[147, 149].
Since the type of food can be a risk factor for CRC, probiotics
or prebiotics can be, used as a dietary supplement to modulate the
balance of microbiota in the gut ecosystem. Consumption of pro-
biotics that may confer a health benefit to the host (WHO) and
prebiotics [150] has increased rapidly in the USA; a fourfold
increase from 2007 to 2015 [151]. Different strains in the same
species along with other factors can produce heterogeneous clinical
results of probiotics [152]. However, strains are rarely specified on
most probiotic foods and supplements, and this kind of heteroge-
neity often results in discrepancies between clinical
outcomes [153].
A summary of the selected potential epigenetic biomarkers for
the CRC detection, diagnosis, and prognosis are listed in Table 2
[92, 93, 95–97, 100, 103–107, 110–129].
48 Lulu Farhana et al.

7 Conclusion

Overall, studies discussed in this chapter provide an indispensable

insight into the role of gut microbiome in CRC and emphasize that
certain microbiota are associated with CRC. The review highlights
the highly dynamic and complex host–pathogen relationship and
tumorigenesis, demonstrating microbial inflammatory and procar-
cinogenic roles as well as beneficial protective roles against CRC.
The stability of gut ecosystem is a function of its flexibility and the
ability to contribute to continue performing fundamental functions
against CRC risk factors. Future studies in patients will be required
to understand the risk factors associated with the complexity of
microbiome alterations that result in increased abundance of cancer
causing microbiota to promote CRC along with microbiome
related diagnostic tools for CRC and to identify the novel targets
for therapeutic intervention. Epigenetic mechanism, especially
altered methylation, probably contributes to CRC development
by inducing inflammation pathway and making cells susceptible to
transformation. Exploitation of epigenetic inhibitors, either alone
or in combination with other anticancer agents, in CRC treatment
should also be evaluated.

Acknowledgments

A part of the work presented in this chapter has been supported by

grants to Dr. Majumdar by NIH/NCI (1R21CA175916), the
Department of Veteran Affairs (I101BX001927), and the Metro-
politan Detroit Research and Education Fund (MDREF). The
funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.

References
1. Siegel R, Naishadham D, Jemal A (2012)
Cancer statistics, 2012. CA Cancer J Clin 62
(1):10–29
2. Siegel RL, Fedewa SA, Anderson WF, Miller
KD, Ma J, Rosenberg PS, Jemal A (2017)
Colorectal cancer incidence patterns in the
United States, 1974–2013. J Natl Cancer
Inst 109(8). https://doi.org/10.1093/jnci/
djw322
3. El-Shami K, Oeffinger KC, Erb NL, Willis A,
Bretsch JK, Pratt-Chapman ML, Cannady RS,
Wong SL, Rose J, Barbour AL, Stein KD,
Sharpe KB, Brooks DD, Cowens-Alvarado
RL (2015) American cancer society colorectal
cancer survivorship care guidelines. CA Can-
cer J Clin 65(6):428–455
4. Kokki I, Papana A, Campbell H, Theodoratou
E (2013) Estimating the incidence of colorec-
tal cancer in South East Asia. Croat Med J 54
(6):532–540
5. Siegel RL, Miller KD, Fedewa SA, Ahnen DJ,
Meester RGS, Barzi A, Jemal A (2017) Colo-
rectal cancer statistics, 2017. CA Cancer J
Clin 67(3):177–193
6. Theodoratou E, Montazeri Z, Hawken S,
Allum GC, Gong J, Tait V, Kirac I,
Tazari M, Farrington SM, Demarsh A,
Zgaga L, Landry D, Benson HE, Read SH,
Rudan I, Tenesa A, Dunlop MG,
Campbell H, Little J (2012) Systematic
meta-analyses and field synopsis of genetic
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . .
association studies in colorectal cancer. J Natl
Cancer Inst 104(19):1433–1457
7. Chan DS, Lau R, Aune D, Vieira R, Green-
wood DC, Kampman E, Norat T (2011) Red
and processed meat and colorectal cancer inci-
dence: meta-analysis of prospective studies.
PLoS One 6(6):e20456
8. Mai V, McCrary QM, Sinha R, Glei M (2009)
Associations between dietary habits and body
mass index with gut microbiota composition
and fecal water genotoxicity: an observational
study in African American and Caucasian
American volunteers. Nutr J 8:49
9. Satia-Abouta J, Galanko JA, Martin CF, Pot-
ter JD, Ammerman A, Sandler RS (2003)
Associations of micronutrients with colon
cancer risk in African Americans and whites:
results from the North Carolina colon cancer
study. Cancer Epidemiol Biomark Prev 12
(8):747–754
10. Butler LM, Sinha R, Millikan RC, Martin CF,
Newman B, Gammon MD, Ammerman AS,
Sandler RS (2003) Heterocyclic amines, meat
intake, and association with colon cancer in a
population-based study. Am J Epidemiol 157
(5):434–445
11. Giovannucci E (2009) Vitamin D and cancer
incidence in the Harvard cohorts. Ann Epide-
miol 19(2):84–88
12. Center MM, Jemal A, Smith RA, Ward E
(2009) Worldwide variations in colorectal
cancer. CA Cancer J Clin 59(6):366–378
13. Ferlay J, Parkin DM, Steliarova-Foucher E
(2010) Estimates of cancer incidence and
mortality in Europe in 2008. Eur J Cancer
46(4):765–781
14. Ferlay J, Shin HR, Bray F, Forman D,
Mathers C, Parkin DM (2010) Estimates of
worldwide burden of cancer in 2008: GLO-
BOCAN 2008. Int J Cancer 127
(12):2893–2917
15. Fearon ER, Vogelstein B (1990) A genetic
model for colorectal tumorigenesis. Cell 61
(5):759–767
16. Lane DP (1992) Cancer. p53, guardian of the
genome. Nature 358(6381):15–16
17. Kaufmann WK, Paules RS (1996) DNA dam-
age and cell cycle checkpoints. FASEB J 10
(2):238–247
18. Niida H, Nakanishi M (2006) DNA damage
checkpoints in mammals. Mutagenesis 21
(1):3–9
19. Wood LD, Parsons DW, Jones S, Lin J,
Sjöblom T, Leary RJ, Shen D, Boca SM,
Barber T, Ptak J, Silliman N, Szabo S,
Dezso Z, Ustyanksky V, Nikolskaya T,
Nikolsky Y, Karchin R, Wilson PA, Kaminker
JS, Zhang Z, Croshaw R, Willis J, Dawson D,
49
Shipitsin M, Willson JK, Sukumar S, Polyak K,
Park BH, Pethiyagoda CL, Pant PV, Ballinger
DG, Sparks AB, Hartigan J, Smith DR, Suh E,
Papadopoulos N, Buckhaults P, Markowitz
SD, Parmigiani G, Kinzler KW, Velculescu
VE, Vogelstein B (2007) The genomic land-
scapes of human breast and colorectal cancers.
Science 318(5853):1108–1113
20. Todaro M, Iovino F, Eterno V, Cammareri P,
Gambara G, Espina V, Gulotta G, Dieli F,
Giordano S, De Maria R, Stassi G (2010)
Tumorigenic and metastatic activity of
human thyroid cancer stem cells. Cancer Res
70(21):8874–8885
21. Fu C, Liang X, Cui W, Ober-Blöbaum J,
Vazzana J, Shrikant PA, Lee KP, Clausen BE,
Mellman I, Jiang A (2015) Beta-catenin in
dendritic cells exerts opposite functions in
cross-priming and maintenance of CD8+ T
cells through regulation of IL-10. Proc Natl
Acad Sci U S A 112(9):2823–2828
22. Spranger S, Gajewski TF (2015) A new para-
digm for tumor immune escape: beta-catenin-
driven immune exclusion. J Immunother
Cancer 3:43
23. Pai SG, Carneiro BA, Mota JM, Costa R,
Leite CA, Barroso-Sousa R, Kaplan JB, Chae
YK, Giles FJ (2017) Wnt/beta-catenin path-
way: modulating anticancer immune
response. J Hematol Oncol 10(1):101
24. Network CGA (2012) Comprehensive
molecular characterization of human colon
and rectal cancer. Nature 487
(7407):330–337
25. Barker N, Ridgway RA, van Es JH, van de
Wetering M, Begthel H, van den Born M,
Danenberg E, Clarke AR, Sansom OJ, Clevers
H (2009) Crypt stem cells as the cells-of-ori-
gin of intestinal cancer. Nature 457
(7229):608–611
26. Kanwar SS, Nautiyal J, Majumdar AP (2010)
EGFR(S) inhibitors in the treatment of
gastro-intestinal cancers: what’s new? Curr
Drug Targets 11(6):682–698
27. Todaro M, Francipane MG, Medema JP,
Stassi G (2010) Colon cancer stem cells:
promise of targeted therapy. Gastroenterol-
ogy 138(6):2151–2162
28. Vogelstein B, Papadopoulos N, Velculescu
VE, Zhou S, Diaz LA Jr, Kinzler KW (2013)
Cancer genome landscapes. Science 339
(6127):1546–1558
29. Vogelstein B, Fearon ER, Hamilton SR, Kern
SE, Preisinger AC, Leppert M, Nakamura Y,
White R, Smits AM, Bos JL (1988) Genetic
alterations during colorectal-tumor develop-
ment. N Engl J Med 319(9):525–532
50 Lulu Farhana et al.
30. Robbins DH, Itzkowitz SH (2002) The
molecular and genetic basis of colon cancer.
Med Clin North Am 86(6):1467–1495
31. Brennan CA, Garrett WS (2016) Gut micro-
biota, inflammation, and colorectal cancer.
Annu Rev Microbiol 70:395–411
32. Sender R, Fuchs S, Milo R (2016) Are we
really vastly outnumbered? Revisiting the
ratio of bacterial to host cells in humans. Cell
164(3):337–340
33. Savage DC (1977) Microbial ecology of the
gastrointestinal tract. Annu Rev Microbiol
31:107–133
34. Goodrich JK, Waters JL, Poole AC, Sutter JL,
Koren O, Blekhman R, Beaumont M, Van
Treuren W, Knight R, Bell JT, Spector TD,
Clark AG, Ley RE (2014) Human genetics
shape the gut microbiome. Cell 159
(4):789–799
35. Bhatt AP, Redinbo MR, Bultman SJ (2017)
The role of the microbiome in cancer devel-
opment and therapy. CA Cancer J Clin 67
(4):326–344
36. Marchesi JR, Dutilh BE, Hall N, Peters WH,
Roelofs R, Boleij A, Tjalsma H (2011)
Towards the human colorectal cancer micro-
biome. PLoS One 6(5):e20447
37. Louis P, Hold GL, Flint HJ (2014) Flint, the
gut microbiota, bacterial metabolites and
colorectal cancer. Nat Rev Microbiol 12
(10):661–672
38. Sears CL, Garrett WS (2014) Microbes,
microbiota, and colon cancer. Cell Host
Microbe 15(3):317–328
39. Drewes JL, Housseau F, Sears CL (2016)
Sporadic colorectal cancer: microbial contri-
butors to disease prevention, development
and therapy. Br J Cancer 115(3):273–280
40. Louis P, Flint HJ (2009) Diversity, metabo-
lism and microbial ecology of butyrate-
producing bacteria from the human large
intestine. FEMS Microbiol Lett 294(1):1–8
41. Arpaia N, Campbell C, Fan X, Dikiy S, van der
Veeken J, deRoos P, Liu H, Cross JR,
Pfeffer K, Coffer PJ, Rudensky AY (2013)
Metabolites produced by commensal bacteria
promote peripheral regulatory T-cell genera-
tion. Nature 504(7480):451–455
42. Atarashi K, Tanoue T, Shima T, Imaoka A,
Kuwahara T, Momose Y, Cheng G,
Yamasaki S, Saito T, Ohba Y, Taniguchi T,
Takeda K, Hori S, Ivanov II, Umesaki Y,
Itoh K, Honda K (2011) Induction of colonic
regulatory T cells by indigenous clostridium
species. Science 331(6015):337–341
43. Rose DP, Connolly JM (1999) Omega-3 fatty
acids as cancer chemopreventive agents. Phar-
macol Ther 83(3):217–244
44. Piazzi G, D’Argenio G, Prossomariti A,
Lembo V, Mazzone G, Candela M, Biagi E,
Brigidi P, Vitaglione P, Fogliano V,
D’Angelo L, Fazio C, Munarini A,
Belluzzi A, Ceccarelli C, Chieco P, Balbi T,
Loadman PM, Hull MA, Romano M,
Bazzoli F, Ricciardiello L (2014) Eicosapen-
taenoic acid free fatty acid prevents and sup-
presses colonic neoplasia in colitis-associated
colorectal cancer acting on notch signaling
and gut microbiota. Int J Cancer 135
(9):2004–2013
45. Van Raay T, Allen-Vercoe E (2017) Microbial
interactions and interventions in colorectal
cancer. Microbiol Spectr 5(3). https://doi.
org/10.1128/microbiolspec.BAD-0004-
2016
46. Sears CL, Pardoll DM (2011) Pardoll, per-
spective: alpha-bugs, their microbial partners,
and the link to colon cancer. J Infect Dis 203
(3):306–311
47. Wu S, Rhee KJ, Zhang M, Franco A, Sears CL
(2007) Bacteroides fragilis toxin stimulates
intestinal epithelial cell shedding and
gamma-secretase-dependent E-cadherin
cleavage. J Cell Sci 120(Pt 11):1944–1952
48. Sears CL, Islam S, Saha A, Arjumand M, Alam
NH, Faruque AS, Salam MA, Shin J,
Hecht D, Weintraub A, Sack RB, Qadri F
(2008) Association of enterotoxigenic Bacter-
oides fragilis infection with inflammatory diar-
rhea. Clin Infect Dis 47(6):797–803
49. Castellarin M, Warren RL, Freeman JD,
Dreolini L, Krzywinski M, Strauss J,
Barnes R, Watson P, Allen-Vercoe E, Moore
RA, Holt RA (2012) Fusobacterium nuclea-
tum infection is prevalent in human colorectal
carcinoma. Genome Res 22(2):299–306
50. Tjalsma H, Boleij A, Marchesi JR, Dutilh BE
(2012) A bacterial driver-passenger model for
colorectal cancer: beyond the usual suspects.
Nat Rev Microbiol 10(8):575–582
51. Nougayrede JP, Homburg S, Taieb F,
Boury M, Brzuszkiewicz E, Gottschalk G,
Buchrieser C, Hacker J, Dobrindt U, Oswald
E (2006) Escherichia coli induces DNA
double-strand breaks in eukaryotic cells. Sci-
ence 313(5788):848–851
52. Tahara T, Yamamoto E, Suzuki H,
Maruyama R, Chung W, Garriga J, Jelinek J,
Yamano HO, Sugai T, An B, Shureiqi I,
Toyota M, Kondo Y, Estécio MR, Issa JP
(2014) Fusobacterium in colonic flora and
molecular features of colorectal carcinoma.
Cancer Res 74(5):1311–1318
53. Dejea CM, Wick EC, Hechenbleikner EM,
White JR, Mark Welch JL, Rossetti BJ, Peter-
son SN, Snesrud EC, Borisy GG, Lazarev M,
Stein E, Vadivelu J, Roslani AC, Malik AA,
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . .
Wanyiri JW, Goh KL, Thevambiga I, Fu K,
Wan F, Llosa N, Housseau F, Romans K,
Wu X, McAllister FM, Wu S, Vogelstein B,
Kinzler KW, Pardoll DM, Sears CL (2014)
Microbiota organization is a distinct feature
of proximal colorectal cancers. Proc Natl Acad
Sci U S A 111(51):18321–18326
54. Li S, Peng C, Wang C, Zheng J, Hu Y, Li D
(2017) Microbial succession and nitrogen
cycling in cultured biofilms as affected by the
inorganic nitrogen availability. Microb Ecol
73(1):1–15
55. Bromberg J, Wang TC (2009) Inflammation
and cancer: IL-6 and STAT3 complete the
link. Cancer Cell 15(2):79–80
56. Vipperla K, O’Keefe SJ (2016) Diet, micro-
biota, and dysbiosis: a ’recipe’ for colorectal
cancer. Food Funct 7(4):1731–1740
57. Hooper LV, Littman DR, Macpherson AJ
(2012) Interactions between the microbiota
and the immune system. Science 336
(6086):1268–1273
58. Emerit I, Garban F, Vassy J, Levy A, Filipe P,
Freitas J (1996) Superoxide-mediated clasto-
genesis and anticlastogenic effects of exoge-
nous superoxide dismutase. Proc Natl Acad
Sci U S A 93(23):12799–12804
59. Huycke MM, Moore D, Joyce W, Wise P,
Shepard L, Kotake Y, Gilmore MS (2001)
Extracellular superoxide production by
enterococcus faecalis requires demethylmena-
quinone and is attenuated by functional ter-
minal quinol oxidases. Mol Microbiol 42
(3):729–740
60. Eckburg PB, Bik EM, Bernstein CN,
Purdom E, Dethlefsen L, Sargent M, Gill
SR, Nelson KE, Relman DA (2005) Diversity
of the human intestinal microbial flora. Sci-
ence 308(5728):1635–1638
61. Allen-Vercoe E, Jobin C (2014) Fusobacter-
ium and Enterobacteriaceae: important
players for CRC? Immunol Lett 162(2 Pt
A):54–61
62. Human Microbiome Project Consortium
(2012) Structure, function and diversity of
the healthy human microbiome. Nature 486
(7402):207–214
63. Ivanov II, Honda K (2012) Intestinal com-
mensal microbes as immune modulators. Cell
Host Microbe 12(4):496–508
64. Zitvogel L, Daillère R, Roberti MP, Routy B,
Kroemer G (2017) Anticancer effects of the
microbiome and its products. Nat Rev Micro-
biol 15(8):465–478
65. Zitvogel L, Galluzzi L, Viaud S, Vétizou M,
Daillère R, Merad M, Kroemer G (2015)
Cancer and the gut microbiota: an unex-
pected link. Sci Transl Med 7(271):271ps1
51
66. Viaud S, Saccheri F, Mignot G, Yamazaki T,
Daillère R, Hannani D, Enot DP, Pfirschke C,
Engblom C, Pittet MJ, Schlitzer A,
Ginhoux F, Apetoh L, Chachaty E, Woerther
PL, Eberl G, Bérard M, Ecobichon C,
Clermont D, Bizet C, Gaboriau-Routhiau V,
Cerf-Bensussan N, Opolon P, Yessaad N,
Vivier E, Ryffel B, Elson CO, Doré J,
Kroemer G, Lepage P, Boneca IG,
Ghiringhelli F, Zitvogel L (2013) The intesti-
nal microbiota modulates the anticancer
immune effects of cyclophosphamide. Science
342(6161):971–976
67. Vétizou M, Pitt JM, Daillère R, Lepage P,
Waldschmitt N, Flament C, Rusakiewicz S,
Routy B, Roberti MP, Duong CP, Poirier-
Colame V, Roux A, Becharef S, Formenti S,
Golden E, Cording S, Eberl G, Schlitzer A,
Ginhoux F, Mani S, Yamazaki T, Jacquelot N,
Enot DP, Bérard M, Nigou J, Opolon P,
Eggermont A, Woerther PL, Chachaty E,
Chaput N, Robert C, Mateus C, Kroemer G,
Raoult D, Boneca IG, Carbonnel F,
Chamaillard M, Zitvogel L (2015) Anticancer
immunotherapy by CTLA-4 blockade relies
on the gut microbiota. Science 350
(6264):1079–1084
68. Sivan A, Corrales L, Hubert N, Williams JB,
Aquino-Michaels K, Earley ZM, Benyamin
FW, Lei YM, Jabri B, Alegre ML, Chang EB,
Gajewski TF (2015) Commensal Bifidobac-
terium promotes antitumor immunity and
facilitates anti-PD-L1 efficacy. Science 350
(6264):1084–1089
69. Modi SR, Collins JJ, Relman DA (2014) Rel-
man, antibiotics and the gut microbiota. J
Clin Invest 124(10):4212–4218
70. Pitt JM, Vétizou M, Gomperts Boneca I,
Lepage P, Chamaillard M, Zitvogel L (2016)
Enhancing the clinical coverage and antican-
cer efficacy of immune checkpoint blockade
through manipulation of the gut microbiota.
Oncoimmunology 6(1):e1132137
71. Kawahara T, Takahashi T, Oishi K, Tanaka H,
Masuda M, Takahashi S, Takano M,
Kawakami T, Fukushima K, Kanazawa H,
Suzuki T (2015) Consecutive oral administra-
tion of Bifidobacterium longum MM-2
improves the defense system against influenza
virus infection by enhancing natural killer cell
activity in a murine model. Microbiol Immu-
nol 59(1):1–12
72. Ou J, Carbonero F, Zoetendal EG, DeLany
JP, Wang M, Newton K, Gaskins HR,
O’Keefe SJ (2013) Diet, microbiota, and
microbial metabolites in colon cancer risk in
rural Africans and African Americans. Am J
Clin Nutr 98(1):111–120
52 Lulu Farhana et al.
73. Bordonaro M, Lazarova DL, Sartorelli AC
(2008) Butyrate and Wnt signaling: a possible
solution to the puzzle of dietary fiber and
colon cancer risk? Cell Cycle 7(9):1178–1183
74. Donaldson GP, Lee SM, Mazmanian SK
(2016) Gut biogeography of the bacterial
microbiota. Nat Rev Microbiol 14(1):20–32
75. Windey K, De Preter V, Verbeke K (2012)
Relevance of protein fermentation to gut
health. Mol Nutr Food Res 56(1):184–196
76. Toden S, Bird AR, Topping DL, Conlon MA
(2007) High red meat diets induce greater
numbers of colonic DNA double-strand
breaks than white meat in rats: attenuation
by high-amylose maize starch. Carcinogenesis
28(11):2355–2362
77. Xu R, Wang Q, Li L (2015) A genome-wide
systems analysis reveals strong link between
colorectal cancer and trimethylamine
N-oxide (TMAO), a gut microbial metabolite
of dietary meat and fat. BMC Genomics 16
(Suppl 7):S4
78. Toprak NU, Yagci A, Gulluoglu BM, Akin
ML, Demirkalem P, Celenk T, Soyletir G
(2006) A possible role of Bacteroides fragilis
enterotoxin in the aetiology of colorectal can-
cer. Clin Microbiol Infect 12(8):782–786
79. Draht MX, Riedl RR, Niessen H, Carvalho B,
Meijer GA, Herman JG, van Engeland M,
Melotte V, Smits KM (2012) Promoter CpG
island methylation markers in colorectal can-
cer: the road ahead. Epigenomics 4
(2):179–194
80. Lee S, Oh T, Chung H, Rha S, Kim C,
Moon Y, Hoehn BD, Jeong D, Lee S,
Kim N, Park C, Yoo M, An S (2012) Identifi-
cation of GABRA1 and LAMA2 as new DNA
methylation markers in colorectal cancer. Int J
Oncol 40(3):889–898
81. You JS, Jones PA (2012) Cancer genetics and
epigenetics: two sides of the same coin? Can-
cer Cell 22(1):9–20
82. Khare S, Verma M (2012) Epigenetics of
colon cancer. Methods Mol Biol
863:177–185
83. Verma M (2015) Cancer epigenetics: risk
assessment, diagnosis, treatment, and prog-
nosis. Preface. Methods Mol Biol 1238:v–vi
84. Takane K, Midorikawa Y, Yagi K, Sakai A,
Aburatani H, Takayama T, Kaneda A (2014)
Aberrant promoter methylation of PPP1R3C
and EFHD1 in plasma of colorectal cancer
patients. Cancer Med 3(5):1235–1245
85. Valenzuela MA, Canales J, Corvalán AH,
Quest AF (2015) Helicobacter pylori-induced
inflammation and epigenetic changes during
gastric carcinogenesis. World J Gastroenterol
21(45):12742–12756
86. Kumar D, Verma M (2009) Methods in can-
cer epigenetics and epidemiology. Methods
Mol Biol 471:273–288
87. Deb M, Sengupta D, Kar S, Rath SK, Roy S,
Das G, Patra SK (2016) Epigenetic drift
towards histone modifications regulates
CAV1 gene expression in colon cancer. Gene
581(1):75–84
88. Deb M, Sengupta D, Rath SK, Kar S,
Parbin S, Shilpi A, Pradhan N, Bhutia SK,
Roy S, Patra SK (2015) Clusterin gene is pre-
dominantly regulated by histone modifica-
tions in human colon cancer and ectopic
expression of the nuclear isoform induces cell
death. Biochim Biophys Acta 1852
(8):1630–1645
89. Gezer U, Yörüker EE, Keskin M, Kulle CB,
Dharuman Y, Holdenrieder S (2015) Histone
methylation marks on circulating nucleo-
somes as novel blood-based biomarker in
colorectal cancer. Int J Mol Sci 16
(12):29654–29662
90. Benard A, Goossens-Beumer IJ, van Hoesel
AQ, de Graaf W, Horati H, Putter H, Zees-
traten EC, van de Velde CJ, Kuppen PJ
(2014) Histone trimethylation at H3K4,
H3K9 and H4K20 correlates with patient sur-
vival and tumor recurrence in early-stage
colon cancer. BMC Cancer 14:531
91. Li H, Myeroff L, Kasturi L, Krumroy L,
Schwartz S, Willson JK, Stanbridge E,
Casey G, Markowitz S (2002) Chromosomal
autonomy of hMLH1 methylation in colon
cancer. Oncogene 21(9):1443–1449
92. Patai ÁV, Valcz G, Hollósi P, Kalmár A,
Péterfia B, Patai Á, Wichmann B, Spisák S,
Barták BK, Leiszter K, Tóth K, Sipos F,
Kovalszky I, Péter Z, Miheller P, Tulassay Z,
Molnár B (2015) Comprehensive DNA
methylation analysis reveals a common
ten-gene methylation signature in colorectal
adenomas and carcinomas. PLoS One 10(8):
e0133836
93. Rawłuszko-Wieczorek AA, Horbacka K,
Krokowicz P, Misztal M, Jagodziński PP
(2014) Prognostic potential of DNA methyl-
ation and transcript levels of HIF1A and
EPAS1 in colorectal cancer. Mol Cancer Res
12(8):1112–1127
94. Chen SP, Chiu SC, Wu CC, Lin SZ, Kang JC,
Chen YL, Lin PC, Pang CY, Harn HJ (2009)
The association of methylation in the pro-
moter of APC and MGMT and the prognosis
of Taiwanese CRC patients. Genet Test Mol
Biomarkers 13(1):67–71
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . .
95. Ines C, Donia O, Rahma B, Ben Ammar A,
Sameh A, Khalfallah T, Abdelmajid BH,
Sabeh M, Saadia B (2014) Implication of
K-ras and p53 in colorectal cancer carcinogen-
esis in Tunisian population cohort. Tumour
Biol 35(7):7163–7175
96. Knösel T, Altendorf-Hofmann A, Lindner L,
Issels R, Hermeking H, Schuebbe G, Gibis S,
Siemens H, Kampmann E, Kirchner T (2014)
Loss of p16(INK4a) is associated with
reduced patient survival in soft tissue
tumours, and indicates a senescence barrier. J
Clin Pathol 67(7):592–598
97. Li YX, Lu Y, Li CY, Yuan P, Lin SS (2014)
Role of CDH1 promoter methylation in colo-
rectal carcinogenesis: a meta-analysis. DNA
Cell Biol 33(7):455–462
98. Nazemalhosseini Mojarad E, Kuppen PJ,
Aghdaei HA, Zali MR (2013) The CpG island
methylator phenotype (CIMP) in colorectal
cancer. Gastroenterol Hepatol Bed Bench 6
(3):120–128
99. Ogino S, Cantor M, Kawasaki T,
Brahmandam M, Kirkner GJ, Weisenberger
DJ, Campan M, Laird PW, Loda M, Fuchs
CS (2006) CpG island methylator phenotype
(CIMP) of colorectal cancer is best charac-
terised by quantitative DNA methylation
analysis and prospective cohort studies. Gut
55(7):1000–1006
100. Paul S, Ramalingam S, Subramaniam D,
Baranda J, Anant S, Dhar A (2014) Histone
demethylases in colon cancer. Curr Colorectal
Cancer Rep 10(4):417–424
101. Aherne ST, Madden SF, Hughes DJ,
Pardini B, Naccarati A, Levy M, Vodicka P,
Neary P, Dowling P, Clynes M (2015) Circu-
lating miRNAs miR-34a and miR-150 asso-
ciated with colorectal cancer progression.
BMC Cancer 15:329
102. Chen X, Shi K, Wang Y, Song M, Zhou W,
Tu H, Lin Z (2015) Clinical value of
integrated-signature miRNAs in colorectal
cancer: miRNA expression profiling analysis
and experimental validation. Oncotarget 6
(35):37544–37556
103. Hur K, Toiyama Y, Takahashi M, Balaguer F,
Nagasaka T, Koike J, Hemmi H, Koi M,
Boland CR, Goel A (2013) MicroRNA-200c
modulates epithelial-to-mesenchymal transi-
tion (EMT) in human colorectal cancer
metastasis. Gut 62(9):1315–1326
104. Earle JS, Luthra R, Romans A, Abraham R,
Ensor J, Yao H, Hamilton SR (2010) Associ-
ation of microRNA expression with microsat-
ellite instability status in colorectal
adenocarcinoma. J Mol Diagn 12
(4):433–440
53
105. Hamfjord J, Stangeland AM, Hughes T,
Skrede ML, Tveit KM, Ikdahl T, Kure EH
(2012) Differential expression of miRNAs in
colorectal cancer: comparison of paired tumor
tissue and adjacent normal mucosa using
high-throughput sequencing. PLoS One 7
(4):e34150
106. Migliore C, Martin V, Leoni VP, Restivo A,
Atzori L, Petrelli A, Isella C, Zorcolo L,
Sarotto I, Casula G, Comoglio PM,
Columbano A, Giordano S (2012) MiR-1
downregulation cooperates with MACC1 in
promoting MET overexpression in human
colon cancer. Clin Cancer Res 18(3):737–747
107. Anton R, Chatterjee SS, Simundza J,
Cowin P, Dasgupta R (2011) A systematic
screen for micro-RNAs regulating the canon-
ical Wnt pathway. PLoS One 6(10):e26257
108. ElSharawy A, Röder C, Becker T, Habermann
JK, Schreiber S, Rosenstiel P, Kalthoff H
(2016) Concentration of circulating
miRNA-containing particles in serum
enhances miRNA detection and reflects CRC
tissue-related deregulations. Oncotarget 7
(46):75353–75365
109. Kanaan Z, Rai SN, Eichenberger MR,
Barnes C, Dworkin AM, Weller C, Cohen E,
Roberts H, Keskey B, Petras RE, Crawford
NP, Galandiuk S (2012) Differential micro-
RNA expression tracks neoplastic progression
in inflammatory bowel disease-associated
colorectal cancer. Hum Mutat 33
(3):551–560
110. Wang X, Wang J, Ma H, Zhang J, Zhou X
(2012) Downregulation of miR-195 corre-
lates with lymph node metastasis and poor
prognosis in colorectal cancer. Med Oncol
29(2):919–927
111. Xi Y, Formentini A, Chien M, Weir DB,
Russo JJ, Ju J, Kornmann M, Ju J (2006)
Prognostic values of microRNAs in colorectal
cancer. Biomark Insights 2:113–121
112. Vinci S, Gelmini S, Mancini I, Malentacchi F,
Pazzagli M, Beltrami C, Pinzani P, Orlando C
(2013) Genetic and epigenetic factors in reg-
ulation of microRNA in colorectal cancers.
Methods 59(1):138–146
113. Bandres E, Agirre X, Bitarte N, Ramirez N,
Zarate R, Roman-Gomez J, Prosper F,
Garcia-Foncillas J (2009) Epigenetic regula-
tion of microRNA expression in colorectal
cancer. Int J Cancer 125(11):2737–2743
114. Okayama H, Schetter AJ, Harris CC (2012)
MicroRNAs and inflammation in the patho-
genesis and progression of colon cancer. Dig
Dis 30(Suppl 2):9–15
54 Lulu Farhana et al.
115. Xiong B, Cheng Y, Ma L, Zhang C (2013)
MiR-21 regulates biological behavior
through the PTEN/PI-3 K/Akt signaling
pathway in human colorectal cancer cells. Int
J Oncol 42(1):219–228
116. Kjaer-Frifeldt S, Hansen TF, Nielsen BS,
Joergensen S, Lindebjerg J, Soerensen FB,
dePont Christensen R, Jakobsen A, Danish
Colorectal Cancer Group (2012) The prog-
nostic importance of miR-21 in stage II colon
cancer: a population-based study. Br J Cancer
107(7):1169–1174
117. Vogt M, Munding J, Grüner M, Liffers ST,
Verdoodt B, Hauk J, Steinstraesser L,
Tannapfel A, Hermeking H (2011) Frequent
concomitant inactivation of miR-34a and
miR-34b/c by CpG methylation in colorec-
tal, pancreatic, mammary, ovarian, urothelial,
and renal cell carcinomas and soft tissue sar-
comas. Virchows Arch 458(3):313–322
118. Kim NH, Kim HS, Kim NG, Lee I, Choi HS,
Li XY, Kang SE, Cha SY, Ryu JK, Na JM,
Park C, Kim K, Lee S, Gumbiner BM, Yook
JI, Weiss SJ (2011) p53 and microRNA-34
are suppressors of canonical Wnt signaling.
Sci Signal 4(197):ra71
119. Mudduluru G, Ceppi P, Kumarswamy R, Sca-
gliotti GV, Papotti M, Allgayer H (2011)
Regulation of Axl receptor tyrosine kinase
expression by miR-34a and miR-199a/b in
solid cancer. Oncogene 30(25):2888–2899
120. Tsuchida A, Ohno S, Wu W, Borjigin N,
Fujita K, Aoki T, Ueda S, Takanashi M, Kur-
oda M (2011) miR-92 is a key oncogenic
component of the miR-17-92 cluster in
colon cancer. Cancer Sci 102(12):2264–2271
121. Motoyama K, Inoue H, Takatsuno Y,
Tanaka F, Mimori K, Uetake H, Sugihara K,
Mori M (2009) Over- and under-expressed
microRNAs in human colorectal cancer. Int J
Oncol 34(4):1069–1075
122. Xu XM, Qian JC, Deng ZL, Cai Z, Tang T,
Wang P, Zhang KH, Cai JP (2012) Expres-
sion of miR-21, miR-31, miR-96 and
miR-135b is correlated with the clinical para-
meters of colorectal cancer. Oncol Lett 4
(2):339–345
123. Li XM, Wang AM, Zhang J, Yi H (2011)
Down-regulation of miR-126 expression in
colorectal cancer and its clinical significance.
Med Oncol 28(4):1054–1057
124. Wu J, Qian J, Li C, Kwok L, Cheng F, Liu P,
Perdomo C, Kotton D, Vaziri C,
Anderlind C, Spira A, Cardoso WV, Lü J
(2010) miR-129 regulates cell proliferation
by downregulating Cdk6 expression. Cell
Cycle 9(9):1809–1818
125. Koga Y, Yasunaga M, Takahashi A, Kuroda J,
Moriya Y, Akasu T, Fujita S, Yamamoto S,
Baba H, Matsumura Y (2010) MicroRNA
expression profiling of exfoliated colonocytes
isolated from feces for colorectal cancer
screening. Cancer Prev Res (Phila) 3
(11):1435–1442
126. Nagel R, le Sage C, Diosdado B, van der
Waal M, Oude Vrielink JA, Bolijn A, Meijer
GA, Agami R (2008) Regulation of the ade-
nomatous polyposis coli gene by the miR-135
family in colorectal cancer. Cancer Res 68
(14):5795–5802
127. Ma Q, Yang L, Wang C, Yu YY, Zhou B,
Zhou ZG (2011) Differential expression of
colon cancer microRNA in microarray study.
Sichuan Da Xue Xue Bao Yi Xue Ban 42
(3):344–348
128. Faltejskova P, Svoboda M, Srutova K,
Mlcochova J, Besse A, Nekvindova J,
Radova L, Fabian P, Slaba K, Kiss I,
Vyzula R, Slaby O (2012) Identification and
functional screening of microRNAs highly
deregulated in colorectal cancer. J Cell Mol
Med 16(11):2655–2666
129. Mosakhani N, Sarhadi VK, Borze I,
Karjalainen-Lindsberg ML, Sundström J,
Ristam€aki R, Osterlund P, Knuutila S (2012)
MicroRNA profiling differentiates colorectal
cancer according to KRAS status. Genes
Chromosomes Cancer 51(1):1–9
130. Singh U, Malik MA, Goswami S, Shukla S,
Kaur J (2016) Epigenetic regulation of
human retinoblastoma. Tumour Biol 37
(11):14427–14441
131. Wu P, Cao Z, Wu S (2016) New progress of
epigenetic biomarkers in urological cancer.
Dis Markers 2016:9864047
132. Wu Y, Hao X, Feng Z, Liu Y (2015) Genetic
polymorphisms in miRNAs and susceptibility
to colorectal cancer. Cell Biochem Biophys 71
(1):271–278
133. Slattery ML, Herrick JS, Pellatt DF, Mullany
LE, Stevens JR, Wolff E, Hoffman MD, Wolff
RK, Samowitz W (2016) Site-specific associa-
tions between miRNA expression and survival
in colorectal cancer cases. Oncotarget 7
(37):60193–60205
134. Noguchi T, Toiyama Y, Kitajima T,
Imaoka H, Hiro J, Saigusa S, Tanaka K,
Inoue Y, Mohri Y, Toden S, Kusunoki M
(2016) miRNA-503 promotes tumor pro-
gression and is associated with early recur-
rence and poor prognosis in human
colorectal cancer. Oncology 90(4):221–231
135. Pichler M, Winter E, Stotz M, Eberhard K,
Samonigg H, Lax S, Hoefler G (2012) Down-
 Role of Microbiome in Carcinogenesis Process and Epigenetic Regulation of. . .
regulation of KRAS-interacting miRNA-143
predicts poor prognosis but not response to
EGFR-targeted agents in colorectal cancer. Br
J Cancer 106(11):1826–1832
136. Zhang Y, Zhang XR, Park JL, Kim JH,
Zhang L, Ma JL, Liu WD, Deng DJ, You
WC, Kim YS, Pan KF (2016) Genome-wide
DNA methylation profiles altered by helico-
bacter pylori in gastric mucosa and blood leu-
kocyte DNA. Oncotarget 7 acid concentrations and pH. Am J Clin Nutr
(24):37132–37144
137. Papastergiou V, Karatapanis S, Georgopoulos
SD (2016) Helicobacter pylori and colorectal
neoplasia: is there a causal link? World J Gas-
troenterol 22(2):649–658
138. Shmuely H, Melzer E, Braverman M,
Domniz N, Yahav J (2014) Helicobacter
pylori infection is associated with advanced
colorectal neoplasia. Scand J Gastroenterol
49(4):516–517
139. Brew R, Erikson JS, West DC, Kinsella AR,
Slavin J, Christmas SE (2000) Interleukin-
8 as an autocrine growth factor for human
colon carcinoma cells in vitro. Cytokine 12
(1):78–85
140. Choi W, Lee J, Lee JY, Lee SM, Kim DW, Kim
YJ (2016) Classification of colon cancer
patients based on the methylation patterns of
promoters. Genomics Inform 14(2):46–52
141. Laghi L, Randolph AE, Chauhan DP,
Marra G, Major EO, Neel JV, Boland CR
(1999) JC virus DNA is present in the mucosa
of the human colon and in colorectal cancers.
Proc Natl Acad Sci U S A 96(13):7484–7489
142. Lin PY, Fung CY, Chang FP, Huang WS,
Chen WC, Wang JY, Chang D (2008) Preva-
lence and genotype identification of human
JC virus in colon cancer in Taiwan. J Med
Virol 80(10):1828–1834
143. Sinagra E, Raimondo D, Gallo E, Stella M,
Cottone M, Orlando A, Rossi F, Orlando E,
Messina M, Tomasello G, Lo Monte AI, La
Rocca E, Rizzo AG (2014) Could JC virus
provoke metastasis in colon cancer? World J
Gastroenterol 20(42):15745–15749
144. Theodoropoulos G, Panoussopoulos D,
Papaconstantinou I, Gazouli M, Perdiki M,
Bramis J, Lazaris AC (2005) Assessment of
55
JC polyoma virus in colon neoplasms. Dis
Colon Rectum 48(1):86–91
145. Brown JM, Hazen SL (2017) Targeting of
microbe-derived metabolites to improve
human health: the next frontier for drug dis-
covery. J Biol Chem 292(21):8560–8568
146. Fleming SE, Fitch MD, Chansler MW (1989)
High-fiber diets: influence on characteristics
of cecal digesta including short-chain fatty
50(1):93–99
147. Kaczmarczyk MM, Miller MJ, Freund GG
(2012) The health benefits of dietary fiber:
beyond the usual suspects of type 2 diabetes
mellitus, cardiovascular disease and colon can-
cer. Metabolism 61(8):1058–1066
148. Barcenilla A, Pryde SE, Martin JC, Duncan
SH, Stewart CS, Henderson C, Flint HJ
(2000) Phylogenetic relationships of
butyrate-producing bacteria from the human
gut. Appl Environ Microbiol 66
(4):1654–1661
149. Peters U, Sinha R, Chatterjee N, Subar AF,
Ziegler RG, Kulldorff M, Bresalier R, Weiss-
feld JL, Flood A, Schatzkin A, Hayes RB,
Prostate, Lung, Colorectal, and Ovarian Can-
cer Screening Trial Project Team (2003) Die-
tary fibre and colorectal adenoma in a
colorectal cancer early detection programme.
Lancet 361(9368):1491–1495
150. Gibson GR, Probert HM, Loo JV, Rastall RA,
Roberfroid MB (2004) Dietary modulation
of the human colonic microbiota: updating
the concept of prebiotics. Nutr Res Rev 17
(2):259–275
151. Clarke TC, Black LI, Stussman BJ, Barnes
PM, Nahin RL (2015) Trends in the use of
complementary health approaches among
adults: United States, 2002-2012. Natl
Health Stat Report 79:1–16
152. Sanders ME (2008) Probiotics: definition,
sources, selection, and uses. Clin Infect Dis
46(Suppl 2):S58–S61 discussion S144-51
153. Parker EA, Roy T, D’Adamo CR, Wieland LS
(2018) Probiotics and gastrointestinal condi-
tions: an overview of evidence from the
Cochrane collaboration. Nutrition
45:125–134.e11
 Chapter 4

Epigenome-Based Precision Medicine in Lung Cancer

Dongho Kim and Duk-Hwan Kim

Abstract
Lung cancer is the leading cause of cancer-related deaths in the world. Despite significant advances in the
early detection and treatment of the disease, the prognosis remains poor, with an overall 5-year survival rate
ranging from 15% to 20%. This poor prognosis results largely from early micrometastatic spread of cancer
cells to nearby lymph nodes or tissues and partially from early recurrence after curative surgical resection.
Recently, precision medicines that target potential oncogenic driver mutations have been approved to treat
lung cancer. However, some lung cancer patients do not have targetable mutations, and many patients
develop resistance to targeted therapy. Tumor heterogeneity and mutational density are also challenges in
treating lung cancer, which underscores the need for developing alternative therapeutic strategies for
treating lung cancer. Epigenetic therapy may circumvent the problems of tumor heterogeneity and drug
resistance by affecting the expression of several hundred target genes. This review highlights precision
medicine using an innovative approach of epigenetic priming prior to conventional standard therapy or
targeted cancer therapy in lung cancer.

Key words Non-small cell lung cancer, Epidermal growth factor receptor, Overall response rate,
Overall survival, Histone deacetylase, DNA methyltransferase, MicroRNA

Abbreviations

5-Aza-dC 5-Aza-20 -deoxycytidine

DNMT DNA methyltransferase
EGFR Epidermal growth factor receptor
EMT Epithelial–mesenchymal transition
HDAC Histone deacetylase
miRNA MicroRNA
NSCLC Non-small cell lung cancer
ORR Overall response rate
OS Overall survival
PFS Progression-free survival

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_4,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

57
58 Dongho Kim and Duk-Hwan Kim

1 Introduction

Lung cancer is the second most common cancer in the world,

comprises 14% of all new cancer diagnoses, and accounts for 1 in
4 cancer deaths [1]. The average 5-year survival rate of lung cancer
has not improved greatly over the past decades and is currently
lower than 20% [2], suggesting the need for novel diagnostic and
therapeutic options. Screening high-risk populations for lung can-
cer with low-dose computed tomography (CT) reduces risk for
lung cancer mortality by 20% in high-risk smokers (those aged
55–74 years with 30 pack-years of smoking) [3], but the cost-
effectiveness and diagnostic accuracy of the screening remain
controversial [4].
While a number of drugs have been approved by the FDA for
the first-line treatment of patients with lung cancer, the patients
have suffered from a high rate of acquired drug resistance and a
limited clinical applicability. Platinum-based cytotoxic chemother-
apy, specifically cisplatin and carboplatin, has increased the 5-year
survival rate over the last 40 years, but its usefulness had reached its
limit in the treatment of lung cancer. Targeted cancer therapies
using agents that interfere with specific molecules involved in
tumorigenesis has come to the forefront as a major advance in the
treatment of lung cancer over the past several years. Although the
drugs that target tyrosine kinase receptors such as epidermal
growth factor receptor (EGFR), anaplastic lymphoma kinase
(ALK), and insulin-like growth-factor receptor (IGFR) have
shown great promise for the treatment of lung cancer, the median
overall survival extends by only a few months [5, 6]. In addition,
approximately 50% of non-small cell lung cancer (NSCLC) cases do
not have targetable mutations, and a very high incidence of relapse
results from resistance, suggesting the need for developing alterna-
tive therapeutic approaches for lung cancer.
Over the past decade, epigenetic changes have been increas-
ingly studied in lung cancer.
Epigenetic changes involve DNA methylation, histone modifi-
cations, nucleosome remodeling, and microRNA alteration. These
changes are observed frequently in lung cancer, and they correlate
with tumor suppressor gene silencing and oncogene activation.
Epigenetic modifications are potentially reversible and are therefore
being aggressively pursued as therapeutic targets. Alterations in
epigenetic machinery have recently become a major focus for tar-
geted cancer therapies. Epigenetic therapies using DNA methyl-
transferase inhibitors or histone deacetylase inhibitors may
circumvent the problem of tumor cell heterogeneity by inducing
the expression of silenced tumor suppressor genes, and they may
provide more effective therapy for lung cancer relapses that follow
conventional treatment [7, 8]. In addition, there is growing
 Epigenome-Based Precision Medicine in Lung Cancer 59

emphasis on using epigenetic therapies to reprogram neoplastic

cells prior to other anticancer therapies. Many agents that target
the epigenome have been under development and entered clinical
trials. In this review, we highlight the promise that epigenetic
therapy in combination with standard chemotherapy or targeted
therapy will become an improved tool for the treatment of lung
cancer.

2 Epigenetic Alterations in Lung Cancer

2.1 DNA Methylation DNA methylation in mammalian genomes occurs at the carbon
5 position of cytosine residues, predominantly in CpG dinucleo-
tides. DNA methylation is regulated by DNA methyltransferases
(DNMTs), which consist of DNMT1, DNMT3a, and DNMT3b.
Levels of all three DNMTs are known to be upregulated in cancer
cells compared with normal cells. Hypermethylation of CpG islands
at the promoter regions of tumor suppressor genes results in tran-
scriptional repression [9, 10]. More than 700 differentially methy-
lated genes have been identified by genome-wide DNA
methylation analysis in lung cancer. These genes are critical in
regulating cell differentiation and cell cycles, epithelial to mesen-
chymal transition (EMT), and RAS and WNT signaling pathways;
p16 [11, 12], PTEN [13], RASSF1A [14], MGMT [15], MLH1
[16], DAPK [17], RUNX3 [18], E-cadherin [19], H-cadherin
[20], RAR-β [21], SHOX2 [22], and APC [23] are frequently
hypermethylated in lung cancer. Approximately one-third of
genes with abnormal DNA methylation have functional conse-
quence, and matched mRNAs are concomitantly upregulated or
downregulated [24].

2.2 Histone Histones are proteins that package DNA into nucleosome, a struc-
Modification tural unit of chromatin. Histone tails are post-translationally mod-
ified by several mechanisms: acetylation at the ε-amino groups of
lysine residues occurs by histone acetyltransferases (HACs) and
converts chromatin to an open or transcriptionally active state;
deacetylation is regulated by histone deacetylases (HDACs) and
changes chromatin to a more condensed or transcriptionally repres-
sive state. Methylation and demethylation are regulated by histone
methyltransferases (HMTs) and by histone demethylases (HDMs),
they either activate or repress gene transcription depending on the
site of action. For example, methylation of lysine 4 on H3 (H3K4),
lysine 36 on H3 (H3K36), or lysine 79 on H3 (H3K79) is asso-
ciated with transcription activation, whereas methylation of lysine
9 on H3 (H3K9), lysine 27 on H3 (H3K27), and lysine 20 on H4
(H4K20) is associated with transcriptional repression. A variety of
histone modifications as well as their clinical significance have been
reported in lung cancer.
60 Dongho Kim and Duk-Hwan Kim

Global levels of H3K4me2 or H3K18ac have been analyzed in

lung cancer, and patients with these low levels had significantly
poorer survival rates than did those who had high levels
[25]. H3K4me2, H2AK5ac, H2BK12ac, H3K9ac, and H4K8ac
expression varies in NSCLCs, and less H3K4me2 or more H3K9Ac
have been associated with worse survival rates in patients with stage
I NSCLC [26]. In another study, variable staining scores for
H3K9me3, H3K9ac, and H4K16ac were detected in 408 NSCLCs,
and there was an inverse correlation between expression levels of
these histones and disease recurrence [27].
Recently, the map of histone modification with DNA loci in
lung cancer cells was investigated, and the chromatin statuses of
26 lung cancer cell lines were examined using ChIP-Seq assay for
seven histone modifications (H3K4me1, H3K4me3, H3K9me3,
H3K9/14ac, H3K27ac, H3K27me3, and H3K36me3) and RNA
polymerase II [28]. H3K4me3 was in an average of 12,239 (59%)
genes per cell line, and H3K27me3 and H3K9me3 markers were
expressed in an average of 2835 (14%) genes. More frequent his-
tone modifications appeared in promoters than gene bodies in the
cancer-related genes such as EGFR, KRAS, NRAS, MYC, ERBB2,
and MET. In addition, there were significant correlations of RNA
polymerase II with H3K4me3, H3K9/14ac, and H3K27ac, sug-
gesting that these histone markers may play an active role in gene
transcription in lung cancer cells.

2.3 MicroRNA A microRNA (miRNA) is a small, single-stranded, noncoding RNA

Alteration of 20–22 nucleotides that plays a key role in regulating expression
in a sequence-specific manner. More than 1000 miRNAs have been
identified in the human genome according to miRBase (http://
www.mirbase.org/). MiRNAs regulate gene expression at the post-
transcriptional and translational levels by targeting the 3-
0
-untranslated region (UTR) or 5’-UTR of messenger RNAs
(mRNAs) at least one-third of protein-coding genes. MiRNAs are
estimated to regulate 30–60% of human genes. Each miRNA can
regulate hundreds of target mRNAs, and thus silencing miRNAs by
hypermethylation can have a profound effect in modulating tumor
development and progression. More than 50% of miRNA genes are
located in cancer-associated genomic regions in human cancers,
suggesting an important role in cancer cell proliferation, differenti-
ation, apoptosis, and metastasis [29, 30]. Deviations from normal
miRNA expression patterns play roles in human cancer. MiRNAs
are also known to play an important role in modulating sensitivity
and resistance to anticancer drugs.
The recent discovery that miRNAs are involved in modulating
key signaling pathways of tumorigenesis has led to their evaluation
as potential therapeutic agents for the treatment of lung cancer.
Dysregulation of a number of miRNAs is associated with the onset
and progression of lung cancer. The most frequently upregulated
 Epigenome-Based Precision Medicine in Lung Cancer 61

miRNAs in lung cancer are miR-17-92, miR-21, miR-31,

miR-155, miR-182, miR-183, miR-200b, miR-205, and
miR-210. In contrast, let-7, miR-30a, miR-30d, miR-34,
miR-126, miR-143, miR-145, miR-195, miR-200, miR-451, and
miR-486-5p are known to be downregulated in lung cancer
[31, 32]. In this section, some miRNAs involved in tumor suppres-
sor and oncogenic pathways are introduced with suggestions on
their potential utility in the treatment of lung cancer.

2.3.1 Let-7 The 21-nucleotide let-7 is one of the earliest identified miRNAs in
lung cancer. It functions as a tumor suppressor gene by negative
regulating the expression of oncogenes involved in cell proliferation
such as RAS and MYC [33, 34]. Let-7 is also involved in apoptosis
by forming a regulatory network with miR-203 that plays an
important role in promoting it [35]. Downregulation of let-7 was
associated with poor prognosis of lung cancer, and overexpression
of exogenous let-7 in A549 lung cancer cells suppressed the growth
of lung cancer cells in vitro, suggesting that let-7 replacement may
provide a therapeutic strategy for lung cancer [36].

2.3.2 miR-29a The expression of the miR-29 family (miR-29a, -29b, and -29c) is
downregulated in NSCLCs [37, 38]. The miR-29 family is involved
in lung tumorigenesis by several mechanisms; exogenous expres-
sion of miR-29s in lung cancer cells reverted aberrant methylation
and induced reexpression of methylation-silenced tumor suppres-
sor genes by targeting DNMT3A and DNMT3B [39]. MiR-29s
positively regulate WIF-1 expression by suppressing Wnt signaling
in NSCLC [40]. The downregulation of miR-29b by c-Myc is
responsible for FHIT-loss mediated tumor aggressiveness in
NSCLC, and low miR-29b levels are associated with shorter overall
survival and recurrence-free survival [41].
B7-H3, also known as CDC276, belongs to a family of
immune modulators that includes PD-L1 (also known as B7-H1
or CD274) and reduces the antitumor activity mediated by
T-lymphocytes and NK cells. MiR-29 plays a role as the modulator
of tumor immune response by directly targeting the 3’-UTR of
B7-H3 mRNA [42]. Accordingly, therapeutic delivery of miR-29
mimics may improve outcomes in NSCLC patients with aberrant
expression of DNMT3A, DNMT3B, c-Myc, Wnt signaling, or
B7-H3.

2.3.3 miR-34 The miR-34 family is composed of three tumor-suppressive miR-

NAs (miR-34a, miR-34b, and miR-34c), and its reduced expres-
sion has been reported in NSCLC. NSCLC patients with low
miR-34a levels had high probability of relapse, and low miR-34a
expression levels were associated with miR-34a hypermethylation
[43]. The hypermethylation of miR-34b/c was found at higher
frequency in SCLC than in NSCLC [44].
62 Dongho Kim and Duk-Hwan Kim

MiR-34 is directly transcribed by TP53, which is induced in

response to DNA damage and oncogenic stress, and decreased
expression of miR-34 in NSCLC induces upregulation of miR-34
target genes, such as BCL2 and MET. In addition, miR-34 med-
iates tumor suppression by forming positive feedback with p53
through the repression of HDM4, a potent negative regulator of
p53 [45]. MiR-34 is known to downregulate PD-L1 by binding to
3’-UTR region of PD-L1 in models of NSCLC, suggesting that
tumor immune evasion is regulated by p53 and miR-34a via PD-L1
[46]. MiR-34 also inhibited tumorigenesis through PDGFR-α/β
downregulation and enhanced TRAIL-induced apoptosis in lung
cancer [47].

2.3.4 miR-195 MiR-195 consists of a group of miRNAs (miR-195, miR-15a,

miR-15b, miR-16-1, and miR-16-2) and acts as a tumor suppressor
in several cancers including lung cancer. MiR-195 suppressed cell
growth, invasion, and metastasis in lung cancer cells by targeting
the 30 -UTR of CHEK1 [48], insulin-like growth factor 1 receptor
(IGF1R) [49], or MYB [50] mRNA. The expression levels of
miR-195 were significantly lower in tumor tissues of NSCLC
than in adjacent nontumor tissues, and high expression of
miR-195 was associated with better overall survival in lung cancer
[48]. Therefore, miR-195 has a therapeutic potential for the treat-
ment of lung cancer.

2.3.5 miR-200 The miR-200 family of miRNAs accounts for five members
(miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and
plays a central role in the process of epithelial–mesenchymal transi-
tion (EMT). Exogenous introduction of miR-200c into invasive
NSCLC cells inhibited in vitro cell invasion and in vivo metastasis
and restored the sensitivity of resistant NCI-H1299 cells to cis-
platin and cetuximab [51]. ZEB1 plays a role in cancer progression
as a master EMT gene. Epigenetic regulation of the miR-200/ZEB
axis was responsible for EMT induction by TGF-β1 in NSCLC
cells, and decitabine reversed TGF-β1-induced EMT in NSCLC
cells via miR-200 [52].

2.3.6 miR-17-92 The miR-17-92 cluster comprises seven miRNAs (miR-17-3p,

miR-17-5p, miR-18a, miR-19a, miR-19b-1, miR-20a, and
miR-92) and resides in an intron 3 of the C13orf25 gene at chro-
mosome 13q31.3 [53]. The miR-17-92 cluster with occasional
gene amplification was overexpressed preferentially in aggressive
small cell lung cancer, and introducing an expression construct of
the miR-17-92 cluster into lung cancer cells enhanced cell growth
and tumor development [53]. Inhibiting miR-17-5p and miR-20a
with antisense oligonucleotides induced apoptosis in lung cancer
cells that overexpressed miR-17-92 [54]. In addition, FLI1, an Ets
 Epigenome-Based Precision Medicine in Lung Cancer 63

transcription factor family member, promoted the cell growth of

small cell lung cancer through the miR-17-92 pathway, suggesting
that miR-17-92 may be a promising therapeutic target to improve
the treatment of SCLCs [55].

3 Epigenetic Therapy

While oncogenic mutations in human cancer cells are fixed, epige-

netic alterations are potentially reversible, and this reversibility
makes them attractive therapeutic targets. To date, DNMT inhibi-
tors and HDAC inhibitors alone or in combination with cytotoxic
agents and targeted therapies have been clinically tested in lung
cancer. Epigenetic drugs under study in human cancer are listed in
Table 1.

3.1 DNA DNA methylation is introduced by the interaction of DNA methyl-

Methyltransferase transferases (DNMT1, DNMT3a, and DNMT3b) that mediate the
Inhibitors transfer of a methyl group from S-adenosyl-L-methionine onto the
5-carbon of cytosine. Overexpression of DNMTs has been reported
in many human cancers, including lung cancer. A highly coordinate
expression of DNMT1, DNMT3a and DNMT3b proteins was found
in lung cancers, especially in smokers [56]. The average number of
methylated genes during lung carcinogenesis correlated with the
protein expression levels of DNMT1 and DNMT3a [57]. The
mRNA levels of DNMT1 and DNMT3b were elevated in NSCLCs,
and DNMT1 upregulation was associated with the hypermethylation
of p16 promoter [58]. DNMT3a was reported to be highly expressed
in 58.5% (79 of 135) of lung adenocarcinomas [59].
In addition, the tobacco-specific carcinogen nitrosamine
4-(methylnitro-samino)-1-(3-pyridyl)-1-butanone (NNK) is
known to prolong DNMT1 protein stability by activating AKT
signaling, enhancing the heterogeneous nuclear ribonucleoprotein
U (hnRNP-U)/β-transducin repeat-containing protein (βTrCP)
translocation to the cytoplasm and then inhibiting GSK3β/β-trans-
ducin repeat-containing protein-mediated DNMT1 degradation
[60]. These observations suggest that DNMTs are molecular tar-
gets for lung cancer therapy.
The most widely used DNMT inhibitors are 5-Aza-cytidine
(azacytidine), 5-Aza-20 -deoxycytidine (decitabine), 1-β-D-arabino-
furanosil-5-azacytosine (fazarabine), and 1-β-D-ribofuranosyl-
2 (1H)-pyrimidinone (zebularine). 5-Aza-cytidine inhibits
DNMT1’s ability to transfer methyl groups to hemimethylated
DNA strands, whereas 5-Aza-20 -deoxycytidine, an analog of deox-
ycytidine, is activated by deoxycytidine kinase phosphorylation
[61], and its phosphorylated form inhibits DNMT1 by incorporat-
ing into DNA. Over 200 genes were upregulated by inhibiting
DNA methylation with the azacytidine in NSCLC cell lines.
64 Dongho Kim and Duk-Hwan Kim

Table 1
Epigenetic drugs for cancer therapy

Inhibitor Category Compound

DNA Nucleoside Azacytidine, CP-4200, decitadine, nanomycin A, RG-108,
methyltransferase analogs RX-3117, SGI-110, SGI-1027, zebularine
inhibitor Nonnucleoside Polyphenols, hydralazine, MG98
analogs
Histone deacetylase Hydroxamic acid Abexinostat, givinostat, panobinostat, pracinostat,
inhibitor derivatives resminostat, vorinostat (SAHA), CUDC-101, belinostat
(Beleodaq)
Benzamide Entinostat (MS-275), mocetinostat
derivatives
Cyclin peptides Romidepsin (FK228, depsipeptide),
Short chain Valproic acid, phenylbutyrate
aliphatic acids
Histone SMYD2 A-893, BIX-01294, LLY-507
methyltransferase inhibitor
inhibitor G9a inhibitor A-336, UNC0638
EZH2 inhibitor AZ505, EPZ005687, EPZ-6438
DOT1L DZNeP, EPZ004777, EPZ-5676
inhibitor
Histone demethylase LSD1 inhibitor Bisguanidines, HCI-2509, 8-hydroxy quinolines, namoline,
inhibitor pargyline, phenelzine analog, polyamine analogu,
tranylcypromine analog
JmjC domain Pyridine dicarboxylates
inhibitor
Histone P300 inhibitor Anacardic acid, C646
acetyltransferase Tip60 inhibitor 6-alkyl salicylates
inhibitor Pyridoisothiazole PU139, PU141

Genes such as NNAT, MT3, CST6, and RASGRP2 were signifi-

cantly upregulated by treatment with azacytidine [62].
Depletion of DNMT1 or DNMT3b in A549 lung cancer cells
resulted in a dramatic induction of a variety of genes known to
modulate cellular response to genomic stress such as GADD45A,
TNFAIP3, SESN2, EGR1, GADD45B, and AXUD1, but
RASSF1A, p16, and TFPI-2 were modestly affected [63]. Further-
more, in a study of tobacco carcinogen-induced lung cancer mouse
model, decitabine decreased the incidence of neoplasm by
30% [64].
However, despite remarkable chemotherapeutic potential of
decitabine in preclinical studies, clinical trials using low-dose deci-
tabine as a single agent unfortunately were not very effective against
NSCLC [65, 66]. Although some patients showed an apparent
induction of NY-ESO-1 (38%), MAGE-3 (30%), and p16 (18%)
in their lung cancer tissues in response to decitabine, no objective
 Epigenome-Based Precision Medicine in Lung Cancer 65

clinical responses were observed in a phase I trial [65]. In a phase

I/II trial, continuous infusion of decitabine over 8 h at intense
doses of 200–660 mg/m2 showed promising result in one of nine
patients with metastatic NSCLC, but at low doses of 50 mg/m2, no
objective response was found [66]. These findings support the need
for further clinical evaluation of DNMT inhibitors alone or in
combination with other anti-tumor agents for the treatment of
lung cancer.

3.2 Histone The balance between histone acetylation and deacetylation plays a
Deacetylase Inhibitors crucial role in regulating chromatin structure and gene expression.
Histone acetylation induced by histone acetyl transferases (HATs)
activates transcription, whereas histone deacetylation induced by
histone deacetylases (HDACs) suppresses gene expression [67].
The level of histone acetylation in a cell is preserved by the balance
of opposing activities of HAT and HDAC. HDACs remove acetyl
groups from specific histone residues, lead to tightly packed DNA,
and inhibit access of transcription factors to genes’ promoter
regions. It is widely accepted that genome-wide changes in acetyla-
tion patterns of histone tails are associated with the development of
cancer and aberrant activities of HDACs are more likely to link to
oncogenic events.
There are 18 human HDAC isoforms, and these are divided
into four classes: class I comprises HDAC1–3 and 8; class II com-
prises HDAC4–7, 9, and 10; class III NAD+-dependent HDACs
comprise SIRT1–7; and class IV comprises HDAC11 [68].
HDAC1 overexpression has been documented in lung cancer:
HDAC1 mRNA levels were higher in advanced lung cancer [69],
and stronger HDAC1 expression was associated with poor disease-
free survival in patients with adenocarcinoma of the lung
[70]. HDAC2 inactivation resulted in regression of cell prolifera-
tion by inducing p21WAF1/CIP1 expression and activated cellular
apoptosis by activating p53 and Bax in lung cancer cells [71].
HDAC class II enzymes were reported to be downregulated result-
ing in poor prognosis in lung cancer [72]. Expression of the class
III genes, SIRT1 and SIRT2 was higher in lung primary tumors
than in normal tissues, and the combination of high SIRT1 and
SIRT2 expression was associated with poor recurrence-free survival
in NSCLC [73]. Thus, HDACs are among the potential therapeu-
tic targets for lung cancer.
HDAC inhibitors are grouped into four classes based on their
chemical structure: hydroxamic acids, cyclic tetrapeptides, benza-
mides, and short chain aliphatic acids [74]. HDAC inhibitors act by
binding to the catalytic pocket of HDACs and chelating the zinc
ion required for catalytic action of the class I, II, and IV HDACs
[75]. The class III HDACs are not zinc dependent. The hydro-
xamic acids represent the largest class of HDAC inhibitors and
include belinostat, panobinostat, and vorinostat, all of which are
66 Dongho Kim and Duk-Hwan Kim

pan-HDAC inhibitors. Romidepsin and entinostat are class I

HDAC-specific cyclic tetrapeptides and benzamides, respectively.
The short-chain aliphatic acids, such as valproic acid, butyrate, and
phenlybutyrate are relatively weak HDAC inhibitors. Vorinostat
and romidepsin are currently approved by the FDA for treating
T-cell lymphoma but not for lung cancer [76, 77]. Vorinostat sup-
pressed cell growth in cultured lung cancer cells by increasing
histone acetylation and inducing expression of p21WAF1
[78]. FLIP is known to block the extrinsic apoptotic pathway by
inhibiting caspase-8 activation, and its overexpression was reported
in NSCLC [79]. Treating A549 or H460 NSCLC cell lines with
vorinostat or panobinostat downregulated FLIP expression and
induced apoptosis by regulating death receptor- and caspase-8-
dependent pathways [79]. Acetylation of nonhistone proteins
such as p53, STAT3, and HSP90 is also affected by HDAC inhibi-
tors [80]. Depsipeptide induces p21WAF1 expression through p53
acetylation at K373 and K382 in lung cancer cells, which recruited
p300 to the p21 promoter [81].
Despite these anti-cancer effects in vitro, clinical trials that
employ HDAC inhibitor alone have shown somewhat disappoint-
ing results in lung cancer. A multicenter, open-label clinical phase II
trial of oral vorinostat has not demonstrated any favorable outcome
in lung cancer and most patients had severe drug-related side effects
[82]. No objective antitumor activity of vorinostat was also
detected in patients with relapsed NSCLC [83]. In addition,
some of patients discontinued due to clinical adverse experiences.
The most common adverse reactions were anorexia (81%), fatigue
(62%), nausea (62%), diarrhea (56%), vomiting (56%), thrombocy-
topenia (50%), and weight loss (50%). Based on these reports,
further studies in NSCLC will need to focus on the combination
of HDAC inhibitors with other antitumor agents.

3.3 Histone Although many methylated lysine residues are found in H1, H2A,
Methyltransferase and H2B, the most extensively studied histone lysine methylation
Inhibitors sites are H3K4, H3K9, H3K27, H3K36, H3K79, and H4K20.
While some lysine methylation markers are preferentially associated
with euchromatin (like H3K4, H3K36, and H3K79) or with het-
erochromatin (H3K9, H3K27, and H4K20) [84], the final effect
on chromatin is influenced by the interplay of several histone
modifications together (“histone crosstalk”) [85].
More than 50 lysine methyltransferases (e.g., EZH1, EZH2,
G9a) and lysine demethylases (KDMs) (e.g., LSD1, JARID1A)
have been reported to date [86]. Preliminary in vitro data with
several compounds targeting histone modifying enzymes have
shown promising antitumor activity in lung cancer cells, and the
potential therapeutic compounds need to be tested in prospective
clinical trial.
 Epigenome-Based Precision Medicine in Lung Cancer 67

3.3.1 SMYD2 Inhibitors The proteins MLL1-5, SET1A, SET1B, SMYD1-3, and SET7/9
are involved in methylating histone H3 lysine 4. Among them, SET
and MYND domain-containing protein 2 (SMYD2) is a lysine
methyltransferase that specifically methylates histone H3 lysine
4 (H3K4me) and dimethylates histone H3 lysine 36 (H3K36me2).
SMYD2 functions as an oncogene in NSCLC by methylating lysine
residues 1451, 1455, and 1610 in ALK protein [87]. SMYD2 also
mono-methylates lysine 370 in p53, which is repressive to
p53-mediated transcriptional regulation [88]. SMYD2 is highly
expressed in esophageal squamous cell carcinoma and pediatric
acute lymphoblastic leukemia, and its overexpression significantly
correlates with a poor prognosis [89, 90]. A-893, a potent and
selective SMYD2 inhibitor, reduced methylation levels of p53 at
lysine 370 by 42% in A549 lung cancer cells [91].

3.3.2 G9a Inhibitors Histone H3 lysine 9 methylation is catalyzed by the methyltrans-

ferases SUV39H1-2, G9a, GLP, SETDB1-2, and RIZ1; the meth-
ylation occurs at the ε amino group of lysine residues and is globally
distributed throughout the heterochromatic regions, such as cen-
tromeres and telomeres. Among them, G9a is known to catalyze
the methylation of histone H3 at lysines 9 and 27 and to play an
important role in the progression of lung cancer. Targeted disrup-
tion of G9a gene in a mouse germ line revealed that G9a is specifi-
cally involved in H3K9 dimethylation. G9a was expressed
significantly higher in tumors than in normal tissues in lung cancer,
and higher levels of G9a in lung cancer were associated with
reduced overall and disease-free survival [92]. G9a promoted
lung cancer invasion and metastasis by inducing the dimethylation
of H3K9 at Ep-CAM promoter and increasing the recruitment of
the transcriptional cofactors HP1, DNMT1, and HDAC1 to the
Ep-CAM promoter [92].
DNMT or HDAC inhibitors are known to modulate the
expression of miRNAs in cancer cells. The change in expression
level of miRNAs upon inhibition of G9a activity was investigated in
invasive H1299 lung cancer cells. BIX01294, a potent chemical
inhibitor of G9a, downregulated miR-106b-3p and miR-151a-3p
in lung cancer cells, suggesting that histone H3 methylation reg-
ulates miRNA expression in lung cancer cells [93].

3.3.3 EZH2 Inhibitors Enhancer of zeste homolog 2 (EZH2), the catalytic subunit of
polycomb repressive complex 2 (PRC2), mediates trimethylation
of lysine 27 on histone H3 (H3K27) in the promoters of target
genes, which suppresses gene expression. EZH2 overexpression
was reported in NSCLCs and correlated with poor prognosis
[94–96]; this effect is also significant when the analysis is restricted
in Asian populations and lung adenocarcinoma and stage I patients,
but not among Caucasians [97]. EZH2 is among the potential
68 Dongho Kim and Duk-Hwan Kim

epigenetic targets for NSCLC, and several EZH2 inhibitors have

been studied preclinically.
EZH2 drove acquired resistance to chemotherapy in small cell
lung cancer (SCLC), and an EZH2 inhibitor prevented emergence
of acquired resistance through reexpression of SLFN11, an EZH2
target gene, and augmented chemotherapeutic efficacy in SCLC
[98]. JQEZ5, which targets EZH2, showed antitumor efficacy in
murine and human lung adenocarcinoma models that expressed
high levels of EZH2 [99]. JQEZ5 also promoted regression of
murine lung cancers with high EZH2 expression and low levels of
phosphorylated AKT and ERK [100].
Another selective EZH2 inhibitor, curcumin, inhibited the
expression of EZH2 through microRNA (miR)-let 7c and
miR-101 and decreased expression of NOTCH1 by inhibiting
EZH2 [101]. GSK126 suppressed cancer cell migration and angio-
genesis via downregulating VEGF-A in lung adenocarcinomal
A549 cells [102]. Additionally, 3-Deazaneplanocin A (DZNep), a
S-adenosyl-l-homocysteine hydrolase inhibitor, was found to mod-
ulate polycomb function through EZH2 downregulation. DZNeP
induced apoptosis and G1 cell cycle arrest in NSCLC cells partly
through cyclin A decrease and p27(Kip1) accumulation [103].

3.4 Histone Two classes of histone demethylase (KDM) inhibitors have been
Demethylase identified: lysine specific demethylase 1 (LSD1) inhibitor and
Inhibitors Jumonji C (JmjC) domain-containing inhibitor. To date, no inhi-
bitors of JmjC KDKs are available in lung cancer, but a few existing
compounds inhibit LSD1. Phenelzine, tranylcypromine, and par-
gyline were amongst the first compounds reported to inhibit LSD1.
LSD1 was transactivated in lung cancer, and RNAi-mediated
knockdown LSD1 knockdown resulted in suppression of cell pro-
liferation in lung cancer lines A549, LC319, and SBC5
[104]. Overexpression of LSD1 was associated with poor prognosis
in NSCLC, and inhibiting LSD1 using a chemical inhibitor, pargy-
line, suppressed proliferation, migration, and invasion of A549,
H460, and 293T cells [105].
Small-molecule amidoximes resulted in a significant increase in
global H3K4me1 and H3K4me2 levels and in cellular levels of
secreted frizzle-related protein 2, H-cadherin and transcription
factor GATA4 [106]. Bizine derived from phenelzine reduced mul-
tiplication rate by modulating H3K4 methylation in lung cancer
cells [107]. In addition, derivatives of (bis)guanidines and (bis)
biguanides exhibited increase in H3K4 markers by inhibiting
LSD1 in Calu-6 lung cancer cells and resulted in reexpression of
aberrantly silenced tumor suppressor genes [108]. However, all
these inhibitors described so far have only been evaluated in pre-
clinical models and additional clinical trials of developed LSD1
inhibitors are required to fully understand their effectiveness.
 Epigenome-Based Precision Medicine in Lung Cancer 69

3.5 MicroRNA The miRNAs are classified as oncomiRs or tumor-suppressor miR-

Mimics NAs. Although the expression of miRNA target genes is different
and Antagomirs according to cancer types, dysregulation of miRNAs leads to drug
resistance in human cancers, and correction of these miRNAs using
miRNA mimics or antagomiRs can normalize gene regulatory net-
work and sensitize cancerous cells to anticancer agents. The ability
of miRNAs to regulate multiple mRNAs makes miRNA-based gene
therapy more powerful than therapeutic tools that target a single
gene. miRNA-based therapeutics are being developed, both alone
and in combination with targeted therapies. There have been some
potential therapeutic miRNAs for lung cancer treatment.
Intranasal replacement therapy with let-7 was effective in
reducing the growth of lung cancer cell xenografts in immunode-
ficient mice [109]. MiR-9 regulated NSCLC cell invasion and
migration by targeting eukaryotic translation initiation factor 5A2
(eIF5A2), and a miR-9 mimic significantly reduced the invasive and
metastatic ability of NSCLC cells [110]. Liposomal delivery of
miR-7 significantly inhibited growth of lung cancer cells harboring
EGFR T790 M mutation leading to resistance to EGFR inhibitor
[111]. Cationic lipoplexes containing miR-29b reduced cell
growth and clonogenicity of A549 cells by targeting CDK6,
DNMT3B, and myeloid cell leukemia sequence 1 (MCL1) [112].
MiR-145 reduced cancer stem-like properties, inhibited epithe-
lial–mesenchymal transdifferentiation and metastatic potential,
and improved chemo-radioresistance by directly targeting Oct4/
Sox2/Fascin 1 in lung adenocarcinoma [113]. Recently, many
studies have also reported effects of miRNA in sensitization to
chemotherapy, radiotherapy and immunotherapy. Delivering these
candidate miRNAs as synthetic miRNA mimics or miRNA inhibi-
tors will be a promising therapeutic approach to treating lung
cancer.

4 Combination Therapy

4.1 DNMT Inhibitors The combination of DNA methyltransferase inhibitors and HDAC
and HDAC Inhibitors inhibitors has shown significant synergistic growth inhibition and
apoptosis induction in NSCLC cell lines. Silenced tumor suppres-
sor genes were transcriptionally reactivated by combining low-dose
5-Aza-dC with trichostatin A or phenylbutyrate but not by
5-Aza-dC or TSA alone [114]. Depsipeptide FR901228 enhanced
the induction of cancer testis antigen NY-ESO-1 in lung cancer
cells exposed to 5-Aza-dC [115]. 5-Aza-dC combined with phe-
nylbutyrate resulted in greater inhibition of DNA synthesis and
greater reduction of clonogenicity than with either agent alone in
A549 and Calu-6 lung cancer cell lines [116].
Additionally, 5-Aza-dC and HDAC inhibitors (LBH589 or
MGCD0103) synergistically reduced the proliferation of SCLC
70 Dongho Kim and Duk-Hwan Kim

cells [117]. The combination of 5-Aza-dC and HDAC inhibitors

(valproic acid and CI-994) sensitized SCLC cells to TRAIL-
induced apoptosis by restoring caspase-8 expression [118]. Sequen-
tial treatment of lung cancer cells with 5-Aza-dC and the HDAC
inhibitors depsipeptide or trichostatin A enhanced HDAC
inhibitor-induced apoptosis [119], and the combination of
5-Aza-dC and sodium phenylbutyrate significantly reduced the
incidence of murine lung cancer by 50% [64]. SGI-100 in combi-
nation with entinostat reduced tumor burden in rats engrafted with
K- /p53 mutant lung cancer cells and caused epigenetic repro-
gramming of EZH2-target genes [120].
Despite the encouraging results of combined epigenetic agents
in vitro, initial clinical trials using the combined approach failed to
show a statistically significant survival advantage in patients with
lung cancer. The combination of 5-Aza-dC 5-15 mg/m2 and
valproic acid (10–20 mg/kg/day) in patients with advanced stage
IV NSCLC was limited by neurological toxicity such as disorienta-
tion and ataxia [121]. 5-azacytidine in combination with sodium
phenlybutyrate did not show any real evidence of clinical benefit in
patients age 18 or older with refractory solid tumor [122]. How-
ever, a recent phase I/II trial of low-dose 5-azacitidine and entino-
stat in 45 patients with heavily pretreated refractory advanced
NSCLC improved patient survival without unacceptable toxicity:
the median progression-free survival and the median overall sur-
vival in the entire cohort were 1.9 months and 6.4 months, respec-
tively [123]. Based on these observations, combining DNMT and
HDAC inhibitors may result in therapeutic synergism in lung can-
cer patients, but additional clinical trials are required to understand
the synergism.
The major underlying mechanisms of the combination
approach have been reported by several groups. 5-Aza-dC may
incorporate into DNA and covalently links with DNMT, causing
DNA damage either by structural instability at its incorporation site
or by obstructing DNA synthesis [124, 125]. HDAC inhibitors
may suppress the removal of the incorporated 5-Aza-dC from DNA
and significantly increase DNA damage induced by 5-Aza-dC
[126]. HDAC inhibitor–induced DNA damage may also occur
through changes in chromatin structure and be associated with
the acetylation of histone proteins. It is also possible that reactivat-
ing tumor suppressor genes with an epigenetic drug may make lung
cancer cells more sensitive to the other type of epigenetic therapy.

4.2 Combination Combinatorial miRNA therapy may be an effective approach to

of Biologically target lung cancer. Both miR-34 and let-7 function as tumor
Relevant miRNAs suppressors in lung cancer: miR-34 is a direct transcriptional target
of p53, and let-7 inhibits the expression of oncogenes such as MYC
and RAS. Combinatorial treatment of miR-34 and let-7 synergisti-
cally decreased the levels of key oncogenes in NSCLC cells, and
 Epigenome-Based Precision Medicine in Lung Cancer 71

systemic nano-delivery of both miRNAs in combination showed

superior anti-tumor effect in NSCLC mouse model in vivo than
treatment of individual miRNA [127]. It is expected that miRNA
combination would prevent acquired drug resistance through
modulation of multiple biological targets in lung cancer.

4.3 Epigenetic The use of epigenetic agents with chemotherapy or radiotherapy

Agents and Standard has been based on the rationale that an epigenetic agent-induced
Therapy alteration in gene expression may increase sensitivity to chemother-
apy or radiotherapy and reverse resistance to the treatment, and
4.3.1 Chemotherapy combining them has shown encouraging results against lung can-
cer. For example, low-dose vorinostat enhanced the sensitivity of
NSCLC cells to 5-fluorouracil or S-1, a novel oral fluorouracil, by
upregulating p21WAF1 and downregulating thymidylate synthase
expression [128]. Vorinostat added to carboplatin or paclitaxel
resulted in greater growth inhibition than chemotherapy alone in
NSCLC cells [129]: Vorinostat enhanced carboplatin induction of
gamma-H2AX (a DNA damage marker) as well as alpha-tubulin
acetylation (a marker for stabilized microtubules) in A549 cells.
Belinostat and romidepsin reduced survival of SCLC cells synergis-
tically with cisplatin or etoposide (VP-16) [130], and adding vor-
inostat to first-line paclitaxel and carboplatin in a randomized
placebo-controlled phase II trial produced response in 34% of
previously untreated stage IIIB or IV NSCLC patients compared
with the 12.5% response rate of placebo [131]. Although the
mechanisms by which epigenetic agents increase the cytotoxicity
of carboplatin and paclitaxel in NSCLC cells is not clear, treating
cells with carboplatin may lead to the formation of platinum-DNA
adducts and then triggers cell cycle arrest and induces apoptosis
[132]. Alternatively, epigenetic agents may increase the cytotoxicity
of carboplatin by relaxing the structure of chromatin and increasing
the access of carboplatin to its DNA target [133].
A number of groups have also reported that miRNA mimics or
antagomirs can correct dysregulated signaling pathways and sensi-
tize cancerous cells to chemotherapy. miRNA-196a is highly upre-
gulated in NSCLC tissues and promotes the proliferation and
invasion of NSCLC cells [134]. Downregulation of miRNA-196a
using locked nucleic acid (LAN)-anti-miRNA-196a sensitized
NSCLC cells to cisplatin in vivo and in vitro through the induction
of apoptosis by targeting homeobox A5 (HOXA5) [134]. Treat-
ment of let-7b and miR-34a, individually or in combination, to
NSCLC cell lines bearing mutations in RAS and TP53 synergisti-
cally potentiated the anti-proliferative effects of erlotinib
[135]. Ectopic expression of miR-451 also increased cisplatin sen-
sitivity of NSCLC cells [136].
72 Dongho Kim and Duk-Hwan Kim

4.3.2 Radiotherapy Despite the important role of radiotherapy in the management of

lung cancer, there is an increasing need for further development of
new treatment strategies to increase its therapeutic efficacy. Epige-
netic drugs have been studied in combination with radiotherapy in
lung cancer cells. Lung cancer cells were pretreated with vorinostat
for 2 h and then were irradiated with γ-IR, which synergistically
triggered cell death through acetyl p53-mediated c-myc
downregulation [137].
LAQ824 (NVP-LAQ824, Dacinostat), a derivative of
4-aminomethylcinnamic hydroxamic acid, is a potent HDAC
inhibitor. In an in-vivo xenograft model of human lung cancer,
LAQ825 sensitized NSCLC to the cytotoxic effects of radiation
through the persistence of DNA double-strand breaks and apopto-
tic cell death both in vitro and in vivo [138]. Abexinostat, a pan
HDAC inhibitor, radiosensitized NSCLC cells in vitro in normoxia
and hypoxia and increased irradiation-induced apoptosis in a
caspase-dependent manner [139].
Further Abexinostat potentiates tumor growth delay and
increased radiation-induced persistent DNA double strand breaks
(DSBs). Therapeutic delivery of miR-34a–loaded liposomes plus
radiotherapy promoted CD8+ cell numbers and reduced
CD8+PD1+ cells in vivo more than either therapy alone. In addi-
tion, miR-34a reduced the numbers of radiation-induced macro-
phages and T-regulatory cells [46]. Thus, epigenetic agents may be
effective in enhancing the cytotoxic effects of radiation by attenu-
ating DNA repair and inducing apoptosis in NSCLC cells. Cur-
rently, there are clinical trials using radiotherapy in combination
with epigenetic drugs in NSCLC patients.

4.4 Epigenetic Targeted cancer therapies use agents that block the growth, pro-
Agents and Targeted gression, and spread of cancer by acting on specific molecular
Therapy targets. These therapies include signal transduction inhibitors, pro-
teasome inhibitors, apoptosis inducers, angiogenesis inhibitors, and
immunotherapies. Many targeted cancer therapies have been
approved by the Food and Drug Administration (FDA) to treat
lung cancer, and some are being tested in clinical trials or preclini-
cally. Some clinical trials of targeted therapies in combination with
epigenetic agents in lung cancer are listed in Table 2.

4.4.1 Signal The epidermal growth factor receptor (EGFR) tyrosine kinase
Transduction Inhibitors inhibitors have shown success in treating NSCLCs harboring
EGFR mutations in the EGFR TK domain, but some patients
who initially show good response to tyrosine kinase inhibitors
often develop resistance through various mechanisms. Combining
epigenetic drugs with signal transduction inhibitors was tested in
lung cancer patients with EGFR-activating mutations, but no
promising results were observed in combination with the tyrosine
kinase inhibitors. For example, erlotinib (Tarceva®) blocks tumor
 Epigenome-Based Precision Medicine in Lung Cancer 73

Table 2
Selected clinical trials of targeted therapies in combination with epigenetic drugs in lung cancer

Targeted ORR Median PFS Median OS

therapies Regimen Phase #pt (%) (month) (month) Refs.
Signal Entinostat þ erlotinib II 132 3 1.9 8.9 [140]
transduction
inhibitor
Vorinostat þ erlotinib I/II 33 0 2 10.3 [142]
Vorinostat þ gefitinib I/II 52 51 3.2 19.0 [141]
Proteasome Vorinostat þ marizomib I 22 0 [152]
inhibitor
Vorinostat þ bortezomib II 18 0 1.43 4.7 [151]
Immunotherapy 5-Aza-dC/ II Ongoing
entinostat þ nivolumab
Abbreviations: ORR overall response rate, PFS progression-free survival, OS overall survival, Refs references

cell growth by targeting the EGFR and is approved for treating

second- and third-line advanced NSCLC. Erlotinib combined with
entinostat was used to treat patients with stage IIIB/IV NSLCS,
but outcomes were not better when compared with erlotinib
monotherapy [140]. Gefitinib (Iressa®) is also approved by the
FDA to treat advanced non-small cell lung cancer and targets the
EGFR. Treating 52 NSCLC patients with gefitinib and vorinostat
did not improve the median progression-free survival [141]. In
another study, no meaningful activity was noted after patients
were treated with vorinostat plus erlotinib in a phase I/II trial
with 33 NSCLC patients [142].
However, NSCLC cells are known to be effectively sensitized
to signal transduction inhibitors by supplementation of tumor
suppressor miRNAs, which may play roles in overcoming the
acquired resistance to tyrosine kinase inhibitors. Overexpression
of miR-30a-5p significantly induced cell apoptosis by regulating
PI3K/AKT signaling pathway in gefinitib-resistant NSCLC cell
lines [143]. MiR-223 enhanced the sensitivity of NSCLC cells to
erlotinib by downregulating the insulin-like growth factor-1 recep-
tor and inhibiting the activation of Akt/S6 [144]. MiR-200c over-
expression regulated epithelial to mesenchymal transition by
regulating PI3K/AKT and MEK/ERK pathways and regained the
sensitivity of gefitinib in the EGFR wild-type NSCLC cells
[145]. In addition, among advanced NSCLC patients who received
gefitinib or erlotinib, those with wild-type EGFR and miR-200c
overexpression had longer overall survival compared with low
miR-200c expression. These studies suggest that epigenetic agents
may improve therapeutic efficacy of signal transduction inhibitors.
74 Dongho Kim and Duk-Hwan Kim

4.4.2 Proteasome The ubiquitin-proteasome pathway plays an essential role in the

Inhibitors degradation of intracellular proteins in eukaryotic cells and is
involved in regulating growth of neoplastic cells and metastasis.
Preclinical studies suggest that proteasome is a potential therapeu-
tic target in lung cancer. The first generation proteasome inhibitor
bortezomib (PS-341, Velcade®) had a unique pattern of growth
inhibition and cytotoxicity [146] and induced apoptosis by induc-
ing Bcl-2 phosphorylation and cleavage that were mediated by
caspases in NSCLC cells [147]. A phase I trial of bortezomib
showed a dose-related inhibition of 20S proteasome activity with-
out dose-limiting hematological toxicity in 43 patients with refrac-
tory solid tumors [148], but a phase II study did not show objective
responses in patients with advanced NSCLC [149]. Synergistic
anti-tumor effects of bortezomib were reported in preclinical mod-
els of NSCLC in combination with HDAC inhibitors. Combining
vorinostat and bortezomib synergistically induced more apoptosis
and generated greater reactive oxygen species than either drug
alone in NSCLC cells, suggesting that proteasome inhibition sen-
sitizes NSCLC cells to HDAC inhibitor-induced apoptosis
[150]. However, bortezomib and vorinostat displayed minimal
anti-tumor activity in a phase II trial for recurrent/metastatic
NSCLC [151].
Several second generation proteasome inhibitors (Marizomib,
Carfilzomib, Ixazomib, Delanzomib, and Oprozomib) have been
developed, and some are tested in lung cancer in vitro and in vitro.
Combined treatment of vorinostat and marizomab resulted in a
highly synergistic antitumor activity in tumor cell lines including
NSCLC, and 61% of 22 patients with advanced solid tumors
showed stable disease in a phase I trial [152]. In addition, combi-
nation of carfilzomib and vorinostat synergistically increased cell
death and the cleavage of caspase-3 in NSCLC cells and upregu-
lated endoplasmic reticulum (ER) stress-regulated proteins such as
activating transcription factor 4, GrP78/BiP, and C/EBP
[153]. However, given no observable clinical activity of vorinostat
and bortezomib in patients with advanced NSCLC [151], further
clinical studies are needed to clearly understand the combined
effect of HDCA inhibitors and proteasome inhibitors in NSCLC.

4.4.3 Immunotherapy Immune checkpoints are parts of immune pathways that use mole-
cules that either activate or deactivate an immune response. Many
cancers protect themselves from the immune system by inhibiting
the T cell signal. Programmed cell death protein 1 (PD-1) is a cell
surface receptor expressed on T and B cells, natural killer cells, and
monocytes. PD-1 negatively regulates antigen receptor signaling by
binding two ligands, PD-L1 and PD-L2, and PD-L1 expression on
tumor cells inhibits anti-tumor activity by engaging PD-1 on effec-
tor anti-tumor T cells. Cytotoxic T-lymphocyte-associated protein
 Epigenome-Based Precision Medicine in Lung Cancer 75

4 (CTLA-4) is a protein receptor that functions as an immune

checkpoint. Because CTLA-4 also negatively regulates anti-tumor
immune responses, CTLA-4 and PD-1/PD-L1 can be molecular
targets for immunotherapy. Recently, a growing body of studies
have reported that epigenetic pretreatment (“epigenetic priming”)
may reprogram cancer cells and sensitize patients with NSCLC to
subsequent immune checkpoint blocking agents.
Cancer-testis antigens (CTA), such as NY-ESO-1, MAGE-A1,
and MAGE-A3, are immunogenic proteins and are expressed in
various types of cancers. Repression of CTAs was associated with
DNA hypermethylation and histone modifications, and knock-
down of histone methyltransferases or histone demethylases that
modulate histone lysine methylation significantly enhanced
deoxyazacytidine-mediated activation of the CTAs in lung cancer
cells [154]. NSCLC cell lines treated with azacytidine were found
to be significantly upregulated in genes related to both innate and
adaptive immunity, including increased PD-L1 expression
[155]. In addition, advanced refractory NSCLC patients who
received subsequent immunotherapy that targeted the PD-1/PD-
L1 immune tolerance checkpoint after receiving low-dose azacyti-
dine therapy showed better objective responses than did the
patients in the same trial who did not receive prior azacytidine
therapy [123, 155]. All five patients who received immunotherapy
after azacytidine therapy passed the 24-week point without pro-
gression. Although the mechanisms that underlie epigenetic sensi-
tization to immune therapy are not clear, combining demethylating
agents with immunotherapy may provide new therapeutic options
for treating lung cancer.
MiRNAs also play an important role in the negative regulation
of immune responses in lung cancer cells. Novel microRNAs
involved in immune response have been reported to enhance the
efficacy of current immunotherapy. Intercellular cell adhesion mol-
ecule (ICAM)-1 is essential for activating cytotoxic T-lymphocytes
(CTLs), and ICAM-1 upregulation is associated with enhanced
susceptibility to CTL-mediated cytosis. MiR-222 and miR-339
are expressed in cancer cells and promote cancer cell resistance to
CTLs by negatively downregulating ICAM-1 by directly interact-
ing with its 3’-UTR [156]. B7-H3 is a surface immunomodulatory
glycoprotein that reduces antitumor activity by sending an inhibitor
signal to natural killer cells and T cells, and miR-29 downregulated
B7-H3 by directly targeting its 30 -untranslated region [42].
MiR-23a that was upregulated in tumor-infiltrating CTLs was
identified as a functional repressor of the transcription factor
BLIMP-1, which promotes CTL cytotoxicity [157]. Collectively,
these findings demonstrate that miRNA-targeted therapy may also
play roles in promoting cancer cell cytosis by modulating tumor
immune response.
76 Dongho Kim and Duk-Hwan Kim

Fig. 1 Epigenome-based approach for the precision medicine of lung cancer

5 Concluding Remarks

Epigenetic alterations are potentially reversible, unlike oncogenic

mutations, and play an important role in the development and
progression of lung cancer, and this reversibility makes them poten-
tial therapeutic targets. Although clinical outcomes were disap-
pointing in earlier studies that used only epigenetic therapy,
recent studies have reported that epigenetic priming agents may
render lung cancer cells more susceptible to cytotoxic chemother-
apy and molecular targeted therapy including immunotherapy. Pre-
treatment with epigenetic drugs prior to immune checkpoint
modulators such as CTLA-4, PD-1, and PD-L1 inhibitors have
shown observable responses in lung cancer patients, and cytotoxic
chemotherapy after epigenetic therapy have also shown remarkable
responses in lung cancer. These results are highly promising and
may provide novel therapeutic options for treating lung cancer.
When epigenetic agents in combination with cytotoxic therapy or
targeted therapy are used based on predictive biomarkers, it is
hoped that precision medicine improves clinical outcomes for
patients with lung cancer (Fig. 1). Accordingly, more studies are
needed to identify clinically relevant pharmacodynamic and predic-
tive response biomarkers and to determine the dose, treatment
duration, and delivery sequences of epigenetic agents in conjunc-
tion with other antitumor agents.

References

1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-
Tieulent J, Jemal A (2015) Global cancer sta-
tistics, 2012. CA Cancer J Clin 65(2):87–108
2. Siegel RL, Miller KD, Jemal A (2016) Cancer
statistics, 2016. CA Cancer J Clin 66(1):7–30
3. Aberle DR, Adams AM, Berg CD, Black WC,
Clapp JD, Fagerstrom RM, Gareen IF,
Gatsonis C, Marcus PM, Sicks JD, National
Lung Screening Trial Research Team (2011)
Reduced lung-cancer mortality with low-dose
computed tomographic screening. N Engl J
Med 365(5):395–409
4. Black WC, Gareen IF, Soneji SS, Sicks JD,
Keeler EB, Aberle DR, Naeim A, Church
TR, Silvestri GA, Gorelick J, Gatsonis C,
National Lung Screening Trial Research
Team (2014) Cost-effectiveness of CT screen-
ing in the National Lung Screening Trial. N
Engl J Med 371(19):1793–1802
5. Sechler M, Cizmic AD, Avasarala S, Van
Scoyk M, Brzezinski C, Kelley N, Bikkavilli
RK, Winn RA (2013) Non-small-cell lung
cancer: molecular targeted therapy and perso-
nalized medicine–drug resistance,
 Epigenome-Based Precision Medicine in Lung Cancer
mechanisms, and strategies. Pharmgenomics
Pers Med 6:25–36
6. Chan BA, Hughes BG (2015) Targeted ther-
apy for non-small cell lung cancer: current
standards and the promise of the future.
Transl Lung Cancer Res 4(1):36–54
7. Langevin SM, Kratzke RA, Kelsey KT (2015)
Epigenetics of lung cancer. Transl Res 165
(1):74–90
8. Ansari J, Shackelford RE, El-Osta H (2016)
Epigenetics in non-small cell lung cancer:
from basics to therapeutics. Transl Lung Can-
cer Res 5(2):155–171
9. Belinsky SA (2004) Gene-promoter hyper-
methylation as a biomarker in lung cancer.
Nat Rev Cancer 4(9):707–717
10. Heyn H, Esteller M (2012) DNA methylation
profiling in the clinic: applications and chal-
lenges. Nat Rev Genet 13(10):679–692
11. Kim DH, Nelson HH, Wiencke JK, Zheng S,
Christiani DC, Wain JC, Mark EJ, Kelsey KT
(2001) p16(INK4a) and histology-specific
methylation of CpG islands by exposure to
tobacco smoke in non-small cell lung cancer.
Cancer Res 61(8):3419–3424
12. Liu Y, Lan Q, Siegfried JM, Luketich JD,
Keohavong P (2006) Aberrant promoter
methylation of p16 and MGMT genes in
lung tumors from smoking and never-
smoking lung cancer patients. Neoplasia 8
(1):46–51
13. Soria JC, Lee HY, Lee JI, Wang L, Issa JP,
Kemp BL, Liu DD, Kurie JM, Mao L, Khuri
FR (2002) Lack of PTEN expression in
non-small cell lung cancer could be related
to promoter methylation. Clin Cancer Res 8
(5):1178–1184
14. Kim DH, Kim JS, Ji YI, Shim YM, Kim H,
Han J, Park J (2003) Hypermethylation of
RASSF1A promoter is associated with the
age at starting smoking and a poor prognosis
in primary non-small cell lung cancer. Cancer
Res 63(13):3743–3746
15. Brabender J, Usadel H, Metzger R, Schneider
PM, Park J, Salonga D, Tsao-Wei DD,
Groshen S, Lord RV, Takebe N, Schneider S,
Hölscher AH, Danenberg KD, Danenberg
PV (2003) Quantitative O(6)-methylguanine
DNA methyltransferase methylation analysis
in curatively resected non-small cell lung can-
cer: associations with clinical outcome. Clin
Cancer Res 9(1):223–227
16. Seng TJ, Currey N, Cooper WA, Lee CS,
Chan C, Horvath L, Sutherland RL,
Kennedy C, McCaughan B, Kohonen-Corish
MR (2008) DLEC1 and MLH1 promoter
methylation are associated with poor
77
prognosis in non-small cell lung carcinoma.
Br J Cancer 99(2):375–382
17. Zochbauer-Muller S, Fong KM, Virmani AK,
Geradts J, Gazdar AF, Minna JD (2001)
Aberrant promoter methylation of multiple
genes in non-small cell lung cancers. Cancer
Res 61(1):249–255
18. Li QL, Kim HR, Kim WJ, Choi JK, Lee YH,
Kim HM, Li LS, Kim H, Chang J, Ito Y, Youl
Lee K, Bae SC (2004) Transcriptional silenc-
ing of the RUNX3 gene by CpG hypermethy-
lation is associated with lung cancer. Biochem
Biophys Res Commun 314(1):223–228
19. Nakata S, Sugio K, Uramoto H, Oyama T,
Hanagiri T, Morita M, Yasumoto K (2006)
The methylation status and protein expression
of CDH1, p16(INK4A), and fragile histidine
triad in nonsmall cell lung carcinoma: epige-
netic silencing, clinical features, and prognos-
tic significance. Cancer 106(10):2190–2199
20. Toyooka KO, Toyooka S, Virmani AK,
Sathyanarayana UG, Euhus DM,
Gilcrease M, Minna JD, Gazdar AF (2001)
Loss of expression and aberrant methylation
of the CDH13 (H-cadherin) gene in breast
and lung carcinomas. Cancer Res 61
(11):4556–4560
21. Virmani AK, Rathi A, Zochbauer-Muller S,
Sacchi N, Fukuyama Y, Bryant D, Maitra A,
Heda S, Fong KM, Thunnissen F, Minna JD,
Gazdar AF (2000) Promoter methylation and
silencing of the retinoic acid receptor-beta
gene in lung carcinomas. J Natl Cancer Inst
92(16):1303–1307
22. Schneider KU, Dietrich D, Fleischhacker M,
Leschber G, Merk J, Schaper F, Stapert HR,
Vossenaar ER, Weickmann S, Liebenberg V,
Kneip C, Seegebarth A, Erdogan F,
Rappold G, Schmidt B (2011) Correlation
of SHOX2 gene amplification and DNA
methylation in lung cancer tumors. BMC
Cancer 11:102
23. Usadel H, Brabender J, Danenberg KD,
Jeronimo C, Harden S, Engles J, Danenberg
PV, Yang S, Sidransky D (2002) Quantitative
adenomatous polyposis coli promoter methyl-
ation analysis in tumor tissue, serum, and
plasma DNA of patients with lung cancer.
Cancer Res 62(2):371–375
24. Selamat SA, Chung BS, Girard L, Zhang W,
Zhang Y, Campan M, Siegmund KD, Koss
MN, Hagen JA, Lam WL, Lam S, Gazdar
AF, Laird-Offringa IA (2012) Genome-scale
analysis of DNA methylation in lung adeno-
carcinoma and integration with mRNA
expression. Genome Res 22(7):1197–1211
25. Seligson DB, Horvath S, McBrian MA,
Mah V, Yu H, Tze S, Wang Q, Chia D,
78 Dongho Kim and Duk-Hwan Kim
Goodglick L, Kurdistani SK (2009) Global
levels of histone modifications predict prog-
nosis in different cancers. Am J Pathol 174
(5):1619–1628
26. Barlesi F, Giaccone G, Gallegos-Ruiz MI,
Loundou A, Span SW, Lefesvre P, Kruyt FA,
Rodriguez JA (2007) Global histone modifi-
cations predict prognosis of resected non
small-cell lung cancer. J Clin Oncol 25
(28):4358–4364
27. Song JS, Kim YS, Kim DK, Park SI, Jang SJ
(2012) Global histone modification pattern
associated with recurrence and disease-free
survival in non-small cell lung cancer patients.
Pathol Int 62(3):182–190
28. Suzuki A, Makinoshima H, Wakaguri H,
Esumi H, Sugano S, Kohno T, Tsuchihara K,
Suzuki Y (2014) Aberrant transcriptional reg-
ulations in cancers: genome, transcriptome
and epigenome analysis of lung adenocarci-
noma cell lines. Nucleic Acids Res 42
(22):13557–13572
29. Calin GA, Sevignani C, Dumitru CD,
Hyslop T, Noch E, Yendamuri S,
Shimizu M, Rattan S, Bullrich F, Negrini M,
Croce CM (2004) Human microRNA genes
are frequently located at fragile sites and geno-
mic regions involved in cancers. Proc Natl
Acad Sci U S A 101:2999–3004
30. Melo SA, Esteller M (2011) Dysregulation of
microRNAs in cancer: playing with fire. FEBS
Lett 585(13):2087–2099
31. Guan P, Yin Z, Li X, Wu W, Zhou B (2012)
Meta-analysis of human lung cancer micro-
RNA expression profiling studies comparing
cancer tissues with normal tissues. J Exp Clin
Cancer Res 31:54
32. Vosa U, Vooder T, Kolde R, Vilo J,
Metspalu A, Annilo T (2013) Meta-analysis
of microRNA expression in lung cancer. Int J
Cancer 132(12):2884–2893
33. Johnson CD, Esquela-Kerscher A, Stefani G,
Byrom M, Kelnar K, Ovcharenko D,
Wilson M, Wang X, Shelton J, Shingara J,
Chin L, Brown D, Slack FJ (2007) The let-7
microRNA represses cell proliferation path-
ways in human cells. Cancer Res 67
(16):7713–7722
34. Sampson VB, Rong NH, Han J, Yang Q,
Aris V, Soteropoulos P, Petrelli NJ, Dunn SP,
Krueger LJ (2007) MicroRNA let-7a down-
regulates MYC and reverts MYC-induced
growth in Burkitt lymphoma cells. Cancer
Res 67(20):9762–9770
35. Zhou Y, Liang H, Liao Z, Wang Y, Hu X,
Chen X, Xu L, Hu Z (2017) miR-203
enhances let-7 biogenesis by targeting
LIN28B to suppress tumor growth in lung
cancer. Sci Rep 7:42680
36. Takamizawa J, Konishi H, Yanagisawa K,
Tomida S, Osada H, Endoh H, Harano T,
Yatabe Y, Nagino M, Nimura Y,
Mitsudomi T, Takahashi T (2004) Reduced
expression of the let-7 microRNAs in human
lung cancers in association with shortened
postoperative survival. Cancer Res 64
(11):3753–3756
37. Volinia S, Calin GA, Liu CG, Ambs S,
Cimmino A, Petrocca F, Visone R, Iorio M,
Roldo C, Ferracin M, Prueitt RL,
Yanaihara N, Lanza G, Scarpa A,
Vecchione A, Negrini M, Harris CC, Croce
CM (2006) A microRNA expression signa-
ture of human solid tumors defines cancer
gene targets. Proc Natl Acad Sci U S A 103
(7):2257–2261
38. Yanaihara N, Caplen N, Bowman E, Seike M,
Kumamoto K, Yi M, Stephens RM,
Okamoto A, Yokota J, Tanaka T, Calin GA,
Liu CG, Croce CM, Harris CC (2006)
Unique microRNA molecular profiles in
lung cancer diagnosis and prognosis. Cancer
Cell 9(3):189–198
39. Fabbri M, Garzon R, Cimmino A, Liu Z,
Zanesi N, Callegari E, Liu S, Alder H,
Costinean S, Fernandez-Cymering C,
Volinia S, Guler G, Morrison CD, Chan KK,
Marcucci G, Calin GA, Huebner K, Croce
CM (2007) MicroRNA-29 family reverts
aberrant methylation in lung cancer by target-
ing DNA methyltransferases 3A and 3B. Proc
Natl Acad Sci U S A 104(40):15805–15810
40. Tan M, Wu J, Cai Y (2013) Suppression of
Wnt signaling by the miR-29 family is
mediated by demethylation of WIF-1 in
non-small-cell lung cancer. Biochem Biophys
Res Commun 438(4):673–679
41. Wu DW, Hsu NY, Wang YC, Lee MC, Cheng
YW, Chen CY, Lee H (2015) C-Myc sup-
presses microRNA-29b to promote tumor
aggressiveness and poor outcomes in
non-small cell lung cancer by targeting
FHIT. Oncogene 34(16):2072–2082
42. Xu H, Cheung IY, Guo HF, Cheung NK
(2009) MicroRNA miR-29 modulates expres-
sion of immunoinhibitory molecule B7-H3:
potential implications for immune based ther-
apy of human solid tumors. Cancer Res 69
(15):6275–6281
43. Gallardo E, Navarro A, Viñolas N, Marrades
RM, Diaz T, Gel B, Quera A, Bandres E,
Garcia-Foncillas J, Ramirez J, Monzo M
(2009) miR-34a as a prognostic marker of
relapse in surgically resected non-small-cell
 Epigenome-Based Precision Medicine in Lung Cancer
lung cancer. Carcinogenesis 30
(11):1903–1909
44. Tanaka N, Toyooka S, Soh J, Kubo T,
Yamamoto H, Maki Y, Muraoka T, Shien K,
Furukawa M, Ueno T, Asano H, Tsukuda K,
Aoe K, Miyoshi S (2012) Frequent methyla-
tion and oncogenic role of microRNA-34b/c
in small-cell lung cancer. Lung Cancer 76
(1):32–38
45. Okada N, Lin CP, Ribeiro MC, Biton A,
Lai G, He X, Bu P, Vogel H, Jablons DM,
Keller AC, Wilkinson JE, He B, Speed TP, He
L (2014) A positive feedback between p53
and miR-34 miRNAs mediates tumor sup-
pression. Genes Dev 28(5):438–450
46. Cortez MA, Ivan C, Valdecanas D, Wang X,
Peltier HJ, Ye Y, Araujo L, Carbone DP,
Shilo K, Giri DK, Kelnar K, Martin D,
Komaki R, Gomez DR, Krishnan S, Calin
GA, Bader AG, Welsh JW (2015) PDL1 reg-
ulation by p53 via miR-34. J Natl Cancer Inst
108(1):djv303
47. Garofalo M, Jeon YJ, Nuovo GJ, Middleton J,
Secchiero P, Joshi P, Alder H, Nazaryan N, Di
Leva G, Romano G, Crawford M, Nana-
Sinkam P, Croce CM (2013) MiR-34a/c-
dependent PDGFR-α/β Downregulation
inhibits tumorigenesis and enhances TRAIL-
induced apoptosis in lung cancer. PLoS One 8
(6):e67581
48. Liu B, Qu J, Xu F, Guo Y, Wang Y, Yu H,
Qian B (2015) MiR-195 suppresses
non-small cell lung cancer by targeting
CHEK1. Oncotarget 6:9445–9456
49. Wang X, Wang Y, Lan H, Li J (2014)
MiR-195 inhibits the growth and metastasis
of NSCLC cells by targeting IGF1R. Tumour
Biol 35(9):8765–8770
50. Yongchun Z, Linwei T, Xicai W, Lianhua Y,
Guangqiang Z, Ming Y, Guanjian L, Yujie L,
Yunchao H (2014) MicroRNA-195 inhibits
non-small cell lung cancer cell proliferation,
migration and invasion by targeting MYB.
Cancer Lett 347(1):65–74
51. Ceppi P, Mudduluru G, Kumarswamy R,
Rapa I, Scagliotti GV, Papotti M, Allgayer H
(2010) Loss of miR-200c expression induces
an aggressive, invasive, and chemoresistant
phenotype in non-small cell lung cancer. Mol
Cancer Res 8(9):1207–1216
52. Zhang N, Liu Y, Wang Y, Zhao M, Tu L, Luo
F (2017) Decitabine reverses TGF-beta1-
induced epithelial-mesenchymal transition in
non-small-cell lung cancer by regulating
miR-200/ZEB axis. Drug Des Devel Ther
11:969–983
79
53. Hayashita Y, Osada H, Tatematsu Y,
Yamada H, Yanagisawa K, Tomida S,
Yatabe Y, Kawahara K, Sekido Y, Takahashi
T (2005) A polycistronic microRNA cluster,
miR-17-92, is overexpressed in human lung
cancers and enhances cell proliferation. Can-
cer Res 65(21):9628–9632
54. Mastubara H, Takeuchi T, Nishikawa E,
Yanagisawa K, Hayashita Y, Ebi H,
Yamada H, Suzuki M, Nagino M, Nimura Y,
Osada H, Takahashi T (2007) Apoptosis
induction by antisense oligonucleotides
against miR-17–5p and miR-20a in lung can-
cers overexpressing miR-17-92. Oncogene
26:6099–6105
55. LingyuLi SW, Yan X, Li A, Zhang X, Li W,
Zhou XWL, Yu D, Hu JF, Cui J (2017)
Friend leukemia virus integration 1 promotes
tumorigenesis of small cell lung cancer cells by
activating the miR-17-92 pathway. Oncotar-
get 8(26):41975–41987. https://doi.org/
10.18632/oncotarget.16715
56. Lin RK, Hsu HS, Chang JW, Chen CY, Chen
JT, Wang YC (2007) Alteration of DNA
methyltransferases contributes to 5’CpG
methylation and poor prognosis in lung can-
cer. Lung Cancer 55(2):205–213
57. Liu WB, Cui ZH, Ao L, Zhou ZY, Zhou YH,
Yuan XY, Xiang YL, Liu JY, Cao J (2011)
Aberrant methylation accounts for cell
adhesion-related gene silencing during
3-methylcholanthrene and diethylnitrosamine
induced multistep rat lung carcinogenesis
associated with overexpression of DNA
methyltransferases 1 and 3a. Toxicol Appl
Pharmacol 251(1):70–78
58. Kim H, Kwon YM, Kim JS, Han J, Shim YM,
Park J, Kim DH (2006) Elevated mRNA
levels of DNA methyltransferase-1 as an inde-
pendent prognostic factor in primary non-
small cell lung cancer. Cancer 107
(5):1042–1049
59. Husni RE, Shiba-Ishii A, Iiyama S,
Shiozawa T, Kim Y, Nakagawa T, Sato T,
Kano J, Minami Y, Noguchi M (2016)
DNMT3a expression pattern and its prognos-
tic value in lung adenocarcinoma. Lung Can-
cer 97:59–65
60. Lin RK, Hsieh YS, Lin P, Hsu HS, Chen CY,
Tang YA, Lee CF, Wang YC (2010) The
tobacco-specific carcinogen NNK induces
DNA methyltransferase 1 accumulation and
tumor suppressor gene hypermethylation in
mice and lung cancer patients. J Clin Invest
120(2):521–532
61. Momparler RL (2005) Pharmacology of
5-Aza-20 -deoxycytidine (decitabine). Semin
Hematol 42(3 Suppl 2):S9–s16
80 Dongho Kim and Duk-Hwan Kim
62. Zhong S, Fields CR, Su N, Pan YX, Robert-
son KD (2007) Pharmacologic inhibition of
epigenetic modifications, coupled with gene
expression profiling, reveals novel targets of
aberrant DNA methylation and histone dea-
cetylation in lung cancer. Oncogene 26
(18):2621–2634
63. Kassis ES, Zhao M, Hong JA, Chen GA,
Nguyen DM, Schrump DS (2006) Depletion
of DNA methyltransferase 1 and/or DNA
methyltransferase 3b mediates growth arrest
and apoptosis in lung and esophageal cancer
and malignant pleural mesothelioma cells. J
Thorac Cardiovasc Surg 131(2):298–306
64. Belinsky SA, Klinge DM, Stidley CA, Issa JP,
Herman JG, March TH, Baylin SB (2003)
Inhibition of DNA methylation and histone
deacetylation prevents murine lung cancer.
Cancer Res 63(21):7089–7093
65. Schrump DS, Fischette MR, Nguyen DM,
Zhao M, Li X, Kunst TF, Hancox A, Hong
JA, Chen GA, Pishchik V, Figg WD, Murgo
AJ, Steinberg SM (2006) Phase I study of
decitabine-mediated gene expression in
patients with cancers involving the lungs,
esophagus, or pleura. Clin Cancer Res 12
(19):5777–5785
66. Momparler RL (2013) Epigenetic therapy of
non-small cell lung cancer using decitabine
(5-aza-20 -deoxycytidine). Front Oncol 3:188
67. Glozak MA, Seto E (2007) Histone deacety-
lases and cancer. Oncogene 26
(37):5420–5432
68. Gregoretti IV, Lee YM, Goodson HV (2004)
Molecular evolution of the histone deacety-
lase family: functional implications of phylo-
genetic analysis. J Mol Biol 338(1):17–31
69. Sasaki H, Moriyama S, Nakashima Y,
Kobayashi Y, Kiriyama M, Fukai I,
Yamakawa Y, Fujii Y (2004) Histone deacety-
lase 1 mRNA expression in lung cancer. Lung
Cancer 46(2):171–178
70. Minamiya Y, Ono T, Saito H, Takahashi N,
Ito M, Mitsui M, Motoyama S, Ogawa J
(2011) Expression of histone deacetylase
1 correlates with a poor prognosis in patients
with adenocarcinoma of the lung. Lung Can-
cer 74:300–304
71. Jung KH, Noh JH, Kim JK, Eun JW, Bae HJ,
Xie HJ, Chang YG, Kim MG, Park H, Lee JY,
Nam SW (2012) HDAC2 overexpression
confers oncogenic potential to human lung
cancer cells by deregulating expression of apo-
ptosis and cell cycle proteins. J Cell Biochem
113(6):2167–2177
72. Osada H, Tatematsu Y, Saito H, Yatabe Y,
Mitsudomi T, Takahashi T (2004) Reduced
expression of class II histone deacetylase genes
is associated with poor prognosis in lung can-
cer patients. Int J Cancer 112(1):26–32
73. Grbesa I, Pajares MJ, Martinez-Terroba E,
Agorreta J, Mikecin AM, Larrayoz M, Idoate
MA, Gall-Troselj K, Pio R, Montuenga LM
(2015) Expression of sirtuin 1 and 2 is asso-
ciated with poor prognosis in non-small cell
lung cancer patients. PLoS One 10(4):
e0124670
74. Kim HJ, Bae SC (2011) Histone deacetylase
inhibitors: molecular mechanisms of action
and clinical trials as anti-cancer drugs. Am J
Transl Res 3(2):166–179
75. Lane AA, Chabner BA (2009) Histone deace-
tylase inhibitors in cancer therapy. J Clin
Oncol 27(32):5459–5468
76. Duvic M, Talpur R, Ni X, Zhang C,
Hazarika P, Kelly C, Chiao JH, Reilly JF,
Ricker JL, Richon VM, Frankel SR (2007)
Phase 2 trial of oral vorinostat (suberoylani-
lide hydroxamic acid, SAHA) for refractory
cutaneous T-cell lymphoma (CTCL). Blood
109(1):31–39
77. Rangwala S, Zhang C, Duvic M (2012)
HDAC inhibitors for the treatment of cuta-
neous T-cell lymphomas. Future Med Chem 4
(4):471–486
78. Komatsu N, Kawamata N, Takeuchi S, Yin D,
Chien W, Miller CW, Koeffler HP (2006)
SAHA, a HDAC inhibitor, has profound
anti-growth activity against non-small cell
lung cancer cells. Oncol Rep 15(1):187–191
79. Riley JS, Hutchinson R, McArt DG,
Crawford N, Holohan C, Paul I, Van
Schaeybroeck S, Salto-Tellez M, Johnston
PG, Fennell DA, Gately K, O’Byrne K,
Cummins R, Kay E, Hamilton P, Stasik I,
Longley DB (2013) Prognostic and therapeu-
tic relevance of FLIP and procaspase-8-
overexpression in non-small cell lung cancer.
Cell Death Dis 4:e951
80. Minucci S, Pelicci PG (2006) Histone deace-
tylase inhibitors and the promise of epigenetic
(and more) treatments for cancer. Nat Rev
Cancer 6(1):38–51
81. Zhao Y, Lu S, Wu L, Chai G, Wang H,
Chen Y, Sun J, Yu Y, Zhou W, Zheng Q,
Wu M, Otterson GA, Zhu WG (2006) Acety-
lation of p53 at lysine 373/382 by the histone
deacetylase inhibitor depsipeptide induces
expression of p21(Waf1/Cip1). Mol Cell
Biol 26(7):2782–2790
82. Vansteenkiste J, Van Cutsem E, Dumez H,
Chen C, Ricker JL, Randolph SS, Schöffski P
(2008) Early phase II trial of oral vorinostat in
relapsed or refractory breast, colorectal, or
 Epigenome-Based Precision Medicine in Lung Cancer
non-small cell lung cancer. Investig New
Drugs 26(5):483–488
83. Traynor AM, Dubey S, Eickhoff JC, Kolesar
JM, Schell K, Huie MS, Groteluschen DL,
Marcotte SM, Hallahan CM, Weeks HR,
Wilding G, Espinoza-Delgado I, Schiller JH
(2009) Vorinostat (NSC# 701852) in
patients with relapsed non-small cell lung can-
cer: a Wisconsin Oncology Network phase II
study. J Thorac Oncol 4(4):522–526
84. Barski A, Cuddapah S, Cui KR, Roh TY,
Schones DE, Wang ZB, Wei G, Chepelev I,
Zhao K (2007) High-resolution profiling of
histone methylations in the human genome.
Cell 129:823–837
85. Lee JS, Smith E, Shilatifard A (2010) The
language of histone crosstalk. Cell
142:682–685
86. Morera L, Lubbert M, Jung M (2016) Tar-
geting histone methyltransferases and
demethylases in clinical trials for cancer ther-
apy. Clin Epigenetics 8:57
87. Wang R, Deng X, Yoshioka Y,
Vougiouklakis T, Park JH, Suzuki T,
Dohmae N, Ueda K, Hamamoto R, Naka-
mura Y (2017) Effects of SMYD2-mediated
EML4-ALK methylation on the signaling
pathway and growth in non-small cell lung
cancer cells. Cancer Sci 108(6):1203–1209.
https://doi.org/10.1111/cas.13245
88. Huang J, Perez-Burgos L, Placek BJ,
Sengupta R, Richter M, Dorsey JA,
Kubicek S, Opravil S, Jenuwein T, Berger SL
(2006) Repression of p53 activity by Smyd2-
mediated methylation. Nature 444
(7119):629–632
89. Komatsu S, Imoto I, Tsuda H, Kozaki KI,
Muramatsu T, Shimada Y, Aiko S,
Yoshizumi Y, Ichikawa D, Otsuji E, Inazawa
J (2009) Overexpression of SMYD2 relates to
tumor cell proliferation and malignant out-
come of esophageal squamous cell carcinoma.
Carcinogenesis 30(7):1139–1146
90. Sakamoto LH, Andrade RV, Felipe MS,
Motoyama AB, Pittella Silva F (2014)
SMYD2 is highly expressed in pediatric acute
lymphoblastic leukemia and constitutes a bad
prognostic factor. Leuk Res 38(4):496–502
91. Sweis RF, Wang Z, Algire M, Arrowsmith
CH, Brown PJ, Chiang GG, Guo J, Jakob
CG, Kennedy S, Li F, Maag D, Shaw B, Soni
NB, Vedadi M, Pappano WN (2015) Discov-
ery of A-893, a new cell-active benzoxazinone
inhibitor of lysine methyltransferase SYMD2.
ACS Med Chem Lett 6(6):695–700
92. Chen MW, Hua KT, Kao HJ, Chi CC, Wei
LH, Johansson G, Shiah SG, Chen PS, Jeng
81
YM, Cheng TY, Lai TC, Chang JS, Jan YH,
Chien MH, Yang CJ, Huang MS, Hsiao M,
Kuo ML (2010) H3K9 histone methyltrans-
ferase G9a promotes lung cancer invasion and
metastasis by silencing the cell adhesion mol-
ecule Ep-CAM. Cancer Res 70
(20):7830–7840
93. Pang AL, Title AC, Rennert OM (2014)
Modulation of microRNA expression in
human lung cancer cells by the G9a histone
methyltransferase inhibitor BIX01294. Oncol
Lett 7(6):1819–1825
94. Kikuchi J, Kinoshita I, Shimizu Y, Kikuchi E,
Konishi J, Oizumi S, Kaga K, Matsuno Y,
Nishimura M, Dosaka-Akita H (2010) Dis-
tinctive expression of the polycomb group
proteins Bmi1 polycomb ring finger onco-
gene and enhancer of zeste homolog 2 in
nonsmall cell lung cancers and their clinical
and clinicopathologic significance. Cancer
116:3015–3024
95. Huqun IR, Zhang J, Miyazawa H, Goto Y,
Shimizu Y, Hagiwara K, Koyama N (2012)
Enhancer of zeste homolog 2 is a novel prog-
nostic biomarker in nonsmall cell lung cancer.
Cancer 118:1599–1606
96. Behrens C, Solis LM, Lin H, Yuan P, Tang X,
Kadara H, Riquelme E, Galindo H, Moran
CA, Kalhor N, Swisher SG, Simon GR, Stew-
art DJ, Lee JJ, Wistuba II (2013) EZH2 pro-
tein expression associates with the early
pathogenesis, tumor progression, and prog-
nosis of non-small cell lung carcinoma. Clin
Cancer Res 19(23):6556–6565
97. Wang X, Zhao H, Lv L, Bao L, Wang X, Han
S (2016) Prognostic significance of EZH2
expression in non-small cell lung cancer: a
meta-analysis. Sci Rep 6:19239
98. Gardner EE, Lok BH, Schneeberger VE,
Desmeules P, Miles LA, Arnold PK, Ni A,
Khodos I, de Stanchina E, Nguyen T, Sage J,
Campbell JE, Ribich S, Rekhtman N,
Dowlati A, Massion PP, Rudin CM, Poirier
JT (2017) Chemosensitive relapse in small cell
lung cancer proceeds through an EZH2-
SLFN11 Axis. Cancer Cell 31(2):286–299
99. Frankel AE, Liu X, Minna JD (2016) Devel-
oping EZH2-targeted therapy for lung can-
cer. Cancer Discov 6(9):949–952
100. Zhang H, Qi J, Reyes JM, Li L, Rao PK, Li F,
Lin CY, Perry JA, Lawlor MA, Federation A,
De Raedt T, Li YY, Liu Y, Duarte MA,
Zhang Y, Herter-Sprie GS, Kikuchi E,
Carretero J, Perou CM, Reibel JB, Paulk J,
Bronson RT, Watanabe H, Brainson CF, Kim
CF, Hammerman PS, Brown M,
Cichowski K, Long H, Bradner JE, Wong
KK (2016) Oncogenic deregulation of
82 Dongho Kim and Duk-Hwan Kim
EZH2 as an opportunity for targeted therapy
in lung cancer. Cancer Discov 6
(9):1006–1021
101. Wu GQ, Chai KQ, Zhu XM, Jiang H,
Wang X, Xue Q, Zheng AH, Zhou HY,
Chen Y, Chen XC, Xiao JY, Ying XH, Wang
FW, Rui T, Liao YJ, Xie D, Lu LQ, Huang DS
(2016) Anti-cancer effects of curcumin on
lung cancer through the inhibition of EZH2
and NOTCH1. Oncotarget 7 9:478–488
(18):26535–26550
102. Chen YT, Zhu F, Lin WR, Ying RB, Yang YP,
Zeng LH (2016) The novel EZH2 inhibitor,
GSK126, suppresses cell migration and angio-
genesis via down-regulating VEGF-A. Cancer
Chemother Pharmacol 77(4):757–765
103. Kikuchi J, Takashina T, Kinoshita I,
Kikuchi E, Shimizu Y, Sakakibara-Konishi J,
Oizumi S, Marquez VE, Nishimura M,
Dosaka-Akita H (2012) Epigenetic therapy
with 3-deazaneplanocin a, an inhibitor of the
histone methyltransferase EZH2, inhibits
growth of non-small cell lung cancer cells.
Lung Cancer 78(2):138–143
104. Hayami S, Kelly JD, Cho HS, Yoshimatsu M,
Unoki M, Tsunoda T, Field HI, Neal DE,
Yamaue H, Ponder BA, Nakamura Y, Hama-
moto R (2011) Overexpression of LSD1 con-
tributes to human carcinogenesis through
chromatin regulation in various cancers. Int
J Cancer 128(3):574–586
105. Lv T, Yuan D, Miao X, Lv Y, Zhan P, Shen X,
Song Y (2012) Over-expression of LSD1 pro-
motes proliferation, migration and invasion in
non-small cell lung cancer. PLoS One 7(4):
e35065
106. Hazeldine S, Pachaiyappan B, Steinbergs N,
Nowotarski S, Hanson AS, Casero RA Jr,
Woster PM (2012) Low molecular weight
amidoximes that act as potent inhibitors of
lysine-specific demethylase 1. J Med Chem
55(17):7378–7391
107. Prusevich P, Kalin JH, Ming SA, Basso M,
Givens J, Li X, Hu J, Taylor MS, Cieniewicz
AM, Hsiao PY, Huang R, Roberson H,
Adejola N, Avery LB, Casero RA Jr, Taverna
SD, Qian J, Tackett AJ, Ratan RR, McDonald
OG, Feinberg AP, Cole PA (2014) A selective
phenelzine analogue inhibitor of histone
demethylase LSD1. ACS Chem Biol 9
(6):1284–1293
108. Sharma SK, Wu Y, Steinbergs N, Crowley
ML, Hanson AS, Casero RA, Woster PM
(2010) (Bis)urea and (bis)thiourea inhibitors
of lysine-specific demethylase 1 as epigenetic
modulators. J Med Chem 53(14):5197–5212
109. Esquela-Kerscher A, Trang P, Wiggins JF,
Patrawala L, Cheng A, Ford L, Weidhaas JB,
Brown D, Bader AG, Slack FJ (2008) Sup-
pression of non-small cell lung tumor devel-
opment by the let-7 microRNA family. Cell
Cycle 7(6):759–764
110. Xu G, Shao G, Pan Q, Sun L, Zheng D, Li M,
Li N, Shi H, Ni Y (2017) MicroRNA-9 reg-
ulates non-small cell lung cancer cell invasion
and migration by targeting eukaryotic trans-
lation initiation factor 5A2. Am J Transl Res
111. Rai K, Takigawa N, Ito S, Kashihara H,
Ichihara E, Yasuda T, Shimizu K,
Tanimoto M, Kiura K (2011) Liposomal
delivery of microRNA-7-expressing plasmid
overcomes epidermal growth factor receptor
tyrosine kinase inhibitor-resistance in lung
cancer cells. Mol Cancer Ther 10:1720–1727
112. Wu Y, Crawford M, Mao Y, Lee RJ, Davis IC,
Elton TS, Lee LJ, Nana-Sinkam SP (2013)
Therapeutic delivery of microRNA-29b by
cationic lipoplexes for lung cancer. Mol Ther
Nucleic Acids 2:e84
113. Chiou GY, Cherng JY, Hsu HS, Wang ML,
Tsai CM, Lu KH, Chien Y, Hung SC, Chen
YW, Wong CI, Tseng LM, Huang PI, Yu CC,
Hsu WH, Chiou SH (2012) Cationic
polyurethanes-short branch PEI-mediated
delivery of mir145 inhibited epithelial-
mesenchymal transdifferentiation and cancer
stem-like properties and in lung adenocarci-
noma. J Control Release 159:240–250
114. Cameron EE, Bachman KE, Myöh€anen S,
Herman JG, Baylin SB (1999) Synergy of
demethylation and histone deacetylase inhibi-
tion in the re-expression of genes silenced in
cancer. Nat Genet 21(1):103–107
115. Weiser TS, Guo ZS, Ohnmacht GA, Par-
khurst ML, Tong-On P, Marincola FM,
Fischette MR, Yu X, Chen GA, Hong JA,
Stewart JH, Nguyen DM, Rosenberg SA,
Schrump DS (2001) Sequential 5-Aza-2
deoxycytidine-depsipeptide FR901228 treat-
ment induces apoptosis preferentially in can-
cer cells and facilitates their recognition by
cytolytic T lymphocytes specific for
NY-ESO-1. J Immunother 24(2):151–161
116. Boivin AJ, Momparler LF, Hurtubise A,
Momparler RL (2002) Antineoplastic action
of 5-aza-20 -deoxycytidine and phenylbutyrate
on human lung carcinoma cells. Anti-Cancer
Drugs 13(8):869–874
117. Luszczek W, Cheriyath V, Mekhail TM, Bor-
den EC (2010) Combinations of DNA
methyltransferase and histone deacetylase
inhibitors induce DNA damage in small cell
lung cancer cells: correlation of resistance
with IFN-stimulated gene expression. Mol
Cancer Ther 9(8):2309–2321
 Epigenome-Based Precision Medicine in Lung Cancer
118. Kaminskyy VO, Surova OV, Vaculova A, Zhi-
votovsky B (2011) Combined inhibition of
DNA methyltransferase and histone deacety-
lase restores caspase-8 expression and sensi-
tizes SCLC cells to TRAIL. Carcinogenesis
32(10):1450–1458
119. Zhu WG, Lakshmanan RR, Beal MD, Otter-
son GA (2001) DNA methyltransferase inhi-
bition enhances apoptosis induced by histone
deacetylase inhibitors. Cancer Res 61
(4):1327–1333
120. Tellez CS, Grimes MJ, Picchi MA, Liu Y,
March TH, Reed MD, Oganesian A,
Taverna P, Belinsky SA (2014) SGI-110 and
entinostat therapy reduces lung tumor bur-
den and reprograms the epigenome. Int J
Cancer 135(9):2223–2231
121. Chu BF, Karpenko MJ, Liu Z, Aimiuwu J,
Villalona-Calero MA, Chan KK, Grever MR,
Otterson GA (2013) Phase I study of 5-aza-2-
0 (3):743–755
-deoxycytidine in combination with valproic
acid in non-small-cell lung cancer. Cancer
Chemother Pharmacol 71(1):115–121
122. Lin J, Gilbert J, Rudek MA, Zwiebel JA,
Gore S, Jiemjit A, Zhao M, Baker SD, Ambin-
der RF, Herman JG, Donehower RC, Car-
ducci MA (2009) A phase I dose-finding
study of 5-azacytidine in combination with
sodium phenylbutyrate in patients with
refractory solid tumors. Clin Cancer Res 15
(19):6241–6249
123. Juergens RA, Wrangle J, Vendetti FP, Murphy
SC, Zhao M, Coleman B, Sebree R,
Rodgers K, Hooker CM, Franco N, Lee B,
Tsai S, Delgado IE, Rudek MA, Belinsky SA,
Herman JG, Baylin SB, Brock MV, Rudin CM
(2011) Combination epigenetic therapy has
efficacy in patients with refractory advanced
non-small cell lung cancer. Cancer Discov 1
(7):598–607
124. Sampath D, Rao VA, Plunkett W (2003)
Mechanisms of apoptosis induction by nucle-
oside analogs. Oncogene 22(56):9063–9074
125. Jung Y, Park J, Kim TY, Park JH, Jong HS,
Im SA, Robertson KD, Bang YJ, Kim TY
(2007) Potential advantages of DNA methyl-
transferase 1 (DNMT1)-targeted inhibition
for cancer therapy. J Mol Med (Berl) 85
(10):1137–1148
126. Chai G, Li L, Zhou W, Wu L, Zhao Y,
Wang D, McNutt MA, Hu YG, Chen Y,
Yang Y, Wu X, Otterson GA, Zhu WG
(2008) HDAC inhibitors act with 5-aza-2-
0
-deoxycytidine to inhibit cell proliferation
by suppressing removal of incorporated
abases in lung cancer cells. PLoS One 3(6):
e2445
83
127. Kasinski AL, Kelnar K, Stahlhut C,
Orellana E, Zhao J, Shimer E, Dysart S,
Chen X, Bader AG, Slack FJ (2015) A combi-
natorial microRNA therapeutics approach to
suppressing non-small cell lung cancer. Onco-
gene 34(27):3547–3555
128. Noro R, Miyanaga A, Minegishi Y, Okano T,
Seike M, Soeno C, Kataoka K, Matsuda K,
Yoshimura A, Gemma A (2010) Histone dea-
cetylase inhibitor enhances sensitivity of non-
small-cell lung cancer cells to 5-FU/S-1 via
down-regulation of thymidylate synthase
expression and up-regulation of p21(waf1/
cip1) expression. Cancer Sci 101
(6):1424–1430
129. Owonikoko TK, Ramalingam SS,
Kanterewicz B, Balius TE, Belani CP, Hersh-
berger PA (2010) Vorinostat increases carbo-
platin and paclitaxel activity in non-small-cell
lung cancer cells. Int J Cancer 126
130. Luchenko VL, Salcido CD, Zhang Y,
Agama K, Komlodi-Pasztor E, Murphy RF,
Giaccone G, Pommier Y, Bates SE, Varticov-
ski L (2011) Schedule-dependent synergy of
histone deacetylase inhibitors with DNA
damaging agents in small cell lung cancer.
Cell Cycle 10(18):3119–3128
131. Ramalingam SS, Maitland ML, Frankel P,
Argiris AE, Koczywas M, Gitlitz B,
Thomas S, Espinoza-Delgado I, Vokes EE,
Gandara DR (2010) Carboplatin and pacli-
taxel in combination with either vorinostat
or placebo for first-line therapy of advanced
non-small-cell lung cancer. J Clin Oncol 28
(1):56–62
132. Wang D, Lippard SJ (2005) Cellular proces-
sing of platinum anticancer drugs. Nat Rev
Drug Discov 4(4):307–320
133. Kim MS, Blake M, Baek JH, Kohlhagen G,
Pommier Y, Carrier F (2003) Inhibition of
histone deacetylase increases cytotoxicity to
anticancer drugs targeting DNA. Cancer Res
63(21):7291–7300
134. Liu XH, , Lu KH, Wang KM, Sun M, Zhang
EB, Yang JS, Yin DD, Liu ZL, Zhou J, Liu ZJ,
De W, Wang ZX (2012) MicroRNA-196a
promotes non-small cell lung cancer cell pro-
liferation and invasion through targeting
HOXA5. BMC Cancer 12:34
135. Stahlhut C, Slack FJ (2015) Combinatorial
action of MicroRNAs let-7 and miR-34 effec-
tively synergizes with erlotinib to suppress
non-small cell lung cancer cell proliferation.
Cell Cycle 14(13):2171–2180
136. Bian HB, Pan X, Yang JS, Wang ZX, De W
(2011) Upregulation of microRNA-451
84 Dongho Kim and Duk-Hwan Kim
increases cispaltin sensitivity of non-small cell
lung cancer cell line (A549). J Exp Clin Can-
cer Res 30:20
137. Seo SK, Jin HO, Woo SH, Kim YS, An S, Lee
JH, Hong SI, Lee KH, Choe TB, Park IC
(2011) Histone deacetylase inhibitors sensi-
tize human non-small cell lung cancer cells to
ionizing radiation through acetyl
p53-mediated c-myc down-regulation. J
Thorac Oncol 6(8):1313–1319
138. Cuneo KC, Fu A, Osusky K, Huamani J, Hal-
lahan DE, Geng L (2007) Histone deacety-
lase inhibitor NVP-LAQ824 sensitizes
human nonsmall cell lung cancer to the cyto-
toxic effects of ionizing radiation. Anti-
Cancer Drugs 18(7):793–800
139. Rivera S, Leteur C, Mégnin F, Law F,
Martins I, Kloos I, Depil S, Modjtahedi N,
Perfettini JL, Hennequin C, Deutsch E
(2017) Time dependent modulation of
tumor radiosensitivity by a pan HDAC inhib-
itor: abexinostat. Oncotarget 8 arrest and apoptosis. Mol Cancer Ther 1
(34):56210–56227. https://doi.org/10.
18632/oncotarget.14813
140. Witta SE, Jotte RM, Konduri K, Neubauer
MA, Spira AI, Ruxer RL, Varella-Garcia M,
Bunn PA Jr, Hirsch FR (2012) Randomized
phase II trial of erlotinib with and without
entinostat in patients with advanced non-
small-cell lung cancer who progressed on
prior chemotherapy. J Clin Oncol 30
(18):2248–2255
141. Han JY, Lee SH, Lee GK, Yun T, Lee YJ,
Hwang KH, Kim JY, Kim HT (2015) Phase
I/II study of gefitinib (Iressa((R))) and vor-
inostat (IVORI) in previously treated patients
with advanced non-small cell lung cancer.
Cancer Chemother Pharmacol 75
(3):475–483
142. Reguart N, Rosell R, Cardenal F, Cardona
AF, Isla D, Palmero R, Moran T, Rolfo C,
Pallarès MC, Insa A, Carcereny E,
Majem M, De Castro J, Queralt C, Molina
MA, Taron M (2014) Phase I/II trial of vor-
inostat (SAHA) and erlotinib for non-small
cell lung cancer (NSCLC) patients with epi-
dermal growth factor receptor (EGFR) muta-
tions after erlotinib progression. Lung Cancer
84(2):161–167
143. Meng F, Wang F, Wang L, Wong SC, Cho
WC, Chan LW (2016) MiR-30a-5p overex-
pression may overcome EGFR inhibitor resis-
tance through regulating PI3K?AKT
signaling pathway in non-small cell lung can-
cer cell lines. Front Genet 7:197
144. Zhao FY, Han J, Chen XW, Wang J, Wang
XD, Sun JG, Chen ZT (2016) miR-223
enhances the sensitivity of non-small cell
lung cancer cells to erlotinib by targeting the
insulin-like growth factor-1 receptor. Int J
Mol Med 38(1):183–191
145. Li J, Li X, Ren S, Chen X, Zhang Y, Zhou F,
Zhao M, Zhao C, Chen X, Cheng N, Zhao Y,
Zhou C, Hirsch FR (2014) miR-200c over-
expression is associated with better efficacy of
EGFR-TKIs in non-small cell lung cancer
patients with EGFR wild-type. Oncotarget 5
(17):7902–7916
146. Adams J, Palombella VJ, Sausville EA,
Johnson J, Destree A, Lazarus DD, Maas J,
Pien CS, Prakash S, Elliott PJ (1999) Protea-
some inhibitors: a novel class of potent and
effective antitumor agents. Cancer Res 59
(11):2615–2622
147. Ling YH, Liebes L, Ng B, Buckley M, Elliott
PJ, Adams J, Jiang JD, Muggia FM, Perez-
Soler R (2002) PS-341, a novel proteasome
inhibitor, induces Bcl-2 phosphorylation and
cleavage in association with G2-M phase
(10):841–849
148. Aghajanian C, Soignet S, Dizon DS, Pien CS,
Adams J, Elliott PJ, Sabbatini P, Miller V,
Hensley ML, Pezzulli S, Canales C, Daud A,
Spriggs DR (2002) A phase I trial of the novel
proteasome inhibitor PS341 in advanced solid
tumor malignancies. Clin Cancer Res 8
(8):2505–2511
149. Li T, Ho L, Piperdi B, Elrafei T, Camacho FJ,
Rigas JR, Perez-Soler R, Gucalp R (2010)
Phase II study of the proteasome inhibitor
bortezomib (PS-341, Velcade) in chemother-
apy-naı̈ve patients with advanced stage
non-small cell lung cancer (NSCLC). Lung
Cancer 68(1):89–93
150. Delinger CE, Rundall BK, Jones DR (2004)
Proteasome inhibition sensitizes non-small
cell lung cancer to histone deacetylase
inhibitor-induced apoptosis through the gen-
eration of reactive oxygen species. J Thorac
Cardiovasc Surg 128(5):740–748
151. Hoang T, Campbell TC, Zhang C, Kim K,
Kolesar JM, Oettel KR, Blank JH, Robinson
EG, Ahuja HG, Kirschling RJ, Johnson PH,
Huie MS, Wims ME, Larson MM, Hernan
HR, Traynor AM (2014) Vorinostat and bor-
tezomib as third-line therapy in patients with
advanced non-small cell lung cancer: a Wis-
consin oncology network phase II study.
Investig New Drugs 32(1):195–199
152. Millward M, Price T, Townsend A,
Sweeney C, Spencer A, Sukumaran S,
Longenecker A, Lee L, Lay A, Sharma G,
Gemmill RM, Drabkin HA, Lloyd GK, Neu-
teboom ST, McConkey DJ, Palladino MA,
Spear MA (2012) Phase 1 clinical trial of the
 Epigenome-Based Precision Medicine in Lung Cancer
novel proteasome inhibitor marizomib with
the histone deacetylase inhibitor vorinostat
in patients with melanoma, pancreatic and
lung cancer based on in vitro assessments of
the combination. Investig New Drugs 30
(6):2303–2317
153. Hanke NT, Garland LL, Baker AF (2016)
Carfilzomib combined with suberanilohy-
droxamic acid (SAHA) synergistically pro-
motes endoplasmic reticulum stress in
non-small cell lung cancer cell lines. J Cancer
Res Clin Oncol 142(3):549–560
154. Rao M, Chinnasamy N, Hong JA, Zhang Y,
Zhang M, Xi S, Liu F, Marquez VE, Morgan
RA, Schrump DS (2011) Inhibition of his-
tone lysine methylation enhances cancer-testis
antigen expression in lung cancer cells: impli-
cations for adoptive immunotherapy of can-
cer. Cancer Res 71(12):4192–4204
155. Wrangle J, Wang W, Koch A, Easwaran H,
Mohammad HP, Vendetti F,
Vancriekinge W, Demeyer T, Du Z,
Parsana P, Rodgers K, Yen RW, Zahnow CA,
85
Taube JM, Brahmer JR, Tykodi SS, Easton K,
Carvajal RD, Jones PA, Laird PW, Weisenber-
ger DJ, Tsai S, Juergens RA, Topalian SL,
Rudin CM, Brock MV, Pardoll D, Baylin SB
(2013) Alterations of immune response of
non-small cell lung cancer with azacytidine.
Oncotarget 4(11):2067–2079
156. Ueda R, , Kohanbash G, Sasaki K, Fujita M,
Zhu X, Kastenhuber ER, McDonald HA,
Potter DM, Hamilton RL, Lotze MT, Khan
SA, Sobol RW, Okada H (2009) Dicer-
regulated microRNAs 222 and 339 promote
resistance of cancer cells to cytotoxic
T-lymphocytes by down-regulation of
ICAM-1. Proc Natl Acad Sci U S A
106:10746–10751
157. Lin R, Chen L, Chen G, Hu C, Jiang S,
Sevilla J, Wan Y, Sampson JH, Zhu B, Li QJ
(2014) Targeting miR-23a in CD8þ cyto-
toxic T lymphocytes prevents tumor-
dependent immunosuppression. J Clin Invest
124(12):5352–5367
 Chapter 5

Epigenetics in Hematological Malignancies

Nataly Cruz-Rodriguez, Alba L. Combita, and Jovanny Zabaleta

Abstract
Acute leukemias are hematologic malignancies with aggressive behavior especially in adult population. With
the introduction of new gene expression and sequencing technologies there have been advances in the
knowledge of the genetic landscape of acute leukemias. A more detailed analysis allows for the identification
of additional alterations in epigenetic regulators that have a profound impact in cellular biology without
changes in DNA sequence. These epigenetic alterations disturb the physiological balance between gene
activation and gene repression and contribute to aberrant gene expression, contributing significantly to the
leukemic pathogenesis and maintenance. We review epigenetic changes in acute leukemia in relation to what
is known about their mechanism of action, their prognostic role and their potential use as therapeutic
targets, with important implications for precision medicine.

Key words Acute leukemia, Epigenetics, Regulation, Hematopoiesis

1 Introduction

Acute leukemias are hematologic malignancies involving the bone

marrow and other organs due to uncontrolled proliferation of
immature cells that are characterized by a progressive loss of the
ability of differentiation and an inability of the bone marrow to
produce sufficient levels of mature blood cells [1, 2]. Acute leuke-
mias are more common in children under 15 years of age than in
adults; however, in adults the disease has a more aggressive behav-
ior than in children [3, 4]. Currently, about 90% of individuals
younger than 15 years achieve complete remission and 70% are
cured of the disease [3], while in adults, only 75% reach complete
remission and disease-free survival (DFS) does not exceed 30%
[5–7].
Molecular characterization is useful for the classification of
acute leukemias and for the identification of prognostic factors.
The correct assignment of patients into risk groups is crucial for
the proper planning of treatment strategies and the optimal results
of therapy. The tool most widely used for understanding the

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_5,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

87
88 Nataly Cruz-Rodriguez et al.

pathogenesis and cell biology of acute leukemias is the detection of

chromosomal rearrangements trough conventional karyotyping or
molecular techniques such as FISH or real-time PCR (RT-PCR).
Various studies have shown that cytogenetic alterations (such as
chromosomal translocations, and loss or gain of genetic material)
compared with other molecular markers, can determine the prog-
nosis of the disease more accurately [7, 8]. However, in approxi-
mately 50% of acute lymphoblastic leukemia (ALL) cases these
chromosomal abnormalities are not observed, suggesting that addi-
tional submicroscopic genetic alterations contribute to leukemo-
genesis [9]. In addition, many isolated chromosomal
rearrangements are not able to induce leukemia in experimental
models on their own [9].
Advancements in sequencing and gene expression methodolo-
gies in the last decade have revealed disease heterogeneity showing
complex patterns of combinations of different genetic aberrations.
With the development of new techniques for the evaluation of gene
expression like cDNA microarrays, great advances have been made
in diagnosis, classification, and prognosis of cancer in both hema-
tological malignancies and solid tumors [1, 10–13]. Other altera-
tions with prognostic potential in these new acute leukemia
patterns are mutations in genes that regulate epigenetic patterns.
Different regulator genes such as NPM1, FLT3, CEBPA,
DNMT3A, TET2, IDH1/2, and ASXL1 have exhibited prognostic
potential, but their role as clinically useful markers awaits to be
proven [14].
Despite the recent technologies and advancements in the
understanding of the mechanisms of transformation and behavior
of malignant cells, acute leukemia remains a disease with a low cure
rate and poor survival and the mechanism of relapse is still not fully
understood. Further studies including the identification and use of
the epigenetic landscape as a possible therapeutic target may explain
how leukemia patients with normal genotype have different out-
comes and survival.

2 Epigenetic Regulation of Gene Expression

In the last decade, attention has turned to epigenetic changes in

different tumor models. These epigenetic modifications are defined
as regulatory mechanisms of gene expression that is not associated
with a change in the actual DNA sequence itself [15]. Epigenetic
changes are inheritable by cell division and unlike genetic muta-
tions, epigenetic alterations have potential reversibility, making
them possible therapeutic targets due to the opportunity to revert
a malignant cell population to a normal state [16].
Although the etiology of acute leukemia has not been fully
elucidated, epigenetic alterations have been shown to play a crucial
 Epigenetics in Hematological Malignancies 89

role in the hematopoiesis and leukemogenesis process and has been

associated with risk of relapse and different clinical outcomes
[15, 17–19]. Epigenetic modifications include different mechan-
isms such as aberrant DNA methylation, posttranslational histone
tail modifications, noncoding RNAs, mutations in epigenetically
regulating genes and different processes more recently described
such as dysregulation of enhancers, DNA-looping 3D chromo-
somal topology, and RNA splicing.

2.1 Aberrant DNA DNA methylation occurs when a methyl group from
Methylation S-adenosylmethionine is added to a cytosine nucleotide adjacent
in Hematological to a guanine nucleotide [19]. This process occurs usually in regions
Malignancies of the DNA with a high frequency of CpG sites known as CpG
islands, which are found in approximately 40% of the promoters in
mammals and are usually unmethylated in normal genes, resulting
in normal gene expression [20]. Promoter hypermethylation plays
the role of a gene silencer through a family of proteins called DNA
methyltransferases (DNMTs) composed by at least three different
members: DNMT1, DNMT3A, and DNMT3B. DNMTs methyl-
ate cytosine residues in CG dinucleotides [21]. In normal hemato-
poiesis process, DNMTs are essential for hematopoietic stem cell
(HSC) self-renewal, niche retention, and multilineage hematopoie-
tic differentiation [21, 22].
Differentiation of HSCs and their downstream blood lineages
are characterized by changes in DNA methylation tightly con-
trolled by a number of mechanisms that include transcription fac-
tors, signal transduction pathways, and niche factors which act in
concert with DNA methylation to ensure hematopoietic homeo-
stasis and production of different blood lineages [18]. Changes in
DNA methylation also influence gene expression patterns during
adult hematopoiesis, and are often associated with aberrant specifi-
cation of blood cells and hematologic pathologies.
Cancer is now recognized as an epigenetic disease [18] because
the cancer cell genome undergoes dramatic shifts in the pattern of
genomic methylation, including genome-wide hypomethylation in
conjunction with local areas of hypermethylation. Some disruptive
mechanisms in cancer are the silencing of tumor suppressor genes
and others involved in important cellular processes as DNA repair,
apoptosis, and drug detoxification. On the other hand, other
imbalance process includes hypermethylation and the concomitant
underexpression of transcription regulators, regulators of apopto-
sis, and cell signaling genes [23].
Development of some techniques as high-throughput RNA
sequencing and bisulfite sequencing have enabled the identification
of some changes in DNA methylation responsible for leukemia
development and progression [24, 25]. Diverse studies have
described some changes in gene promoter methylation associated
with relapse in T-cell acute lymphoblastic leukemia—T-cell
90 Nataly Cruz-Rodriguez et al.

precursor acute lymphoblastic leukemia (T-ALL). Some of these

methylated genes in T-ALL are TAL1, ERHV-3, CDKN2A,
CALCA, p15, IDH1/2, and p53 [26–30]. Most of these genes are
transcription factors or tumor suppressor genes involved in hema-
topoietic development and cell cycle regulation whose promoter
methylation may result in impaired hematopoietic differentiation
and proliferation contributing to leukemogenic transformation and
prognosis of leukemia [19]. Additionally, recent studies have
reported aberrant methylation patterns that predict survival in
many hematologic malignancies [31–33]. This reveals the signifi-
cance of DNA methylation measured before treatment in predict-
ing clinical responses.

2.2 Posttranslational Histones are highly conserved proteins that provide the packaging
Histone Modification and order of our genome forming the nucleosome structure along
with the DNA where histones acting as spools around DNA
strands. Histones play a key role in regulating transcriptional events
through compacting DNA and regulating chromatin structure by
responding to multiple signals. In addition to DNA methylation,
now it has been described that post-translational modifications of
histones represent an epigenetic modification involved in tumor
development. Different histone posttranslational modifications
(PTMs) such as phosphorylation, methylation, ubiquitination,
and acetylation have been identified and are frequently deregulated
in acute leukemias [17, 34].
Histone acetylation is the well-studied PTM that plays a key
role in chromatin remodeling regulated by the activity of histone
acetyl transferases (HATs) and histone deacetylases (HDACs)
[35]. HATs and HDACs deposit and remove acetyl moiety on the
lysine residues of histones respectively, resulting in chromatin
decompaction or compaction and thus allowing for gene expression
or gene repression [35].
Histone modifications have been identified to be involved in
many cellular events such as gene expression regulation, replication,
and DNA repair [35, 36], and many types of cancer are associated
with dysregulated levels of histone modifications and mutations in
genes involved in histone lysine acetylation [37]. One of these
genes is the product of the histone acetyltransferase CREBBP that
can acetylate various residues in several histones and it has been
reported frequently mutated in lymphoid leukemia [38, 39]. These
mutations or deletions in CREBBP were shown to be very common
in relapsed and in high hyperdiploid B-cell precursor acute lympho-
blastic leukemia (B-ALL) patients, possibly due to loss of HAT
activity and transcriptional dysregulation, suggesting a role in resis-
tance to chemotherapy [38, 40, 41].
Differential expression of genes involved in histone deacetylation
was demonstrated to be important for survival of ALL patients
[42]. Overexpression of HDAC1, HDAC2, and HDAC8 is
 Epigenetics in Hematological Malignancies 91

associated with unfavorable prognostic factors including treatment

failure [43]. Other authors have reported also that leukemic cells
from ALL patients show increased histone deacetylation activity as
compared to normal cells, which suggests an oncogenic role of
hypoacetylation in acute leukemia [44].
Like histone acetylation, the phosphorylation and methylation
of histones are processes that regulate the gene expression by
changing the chromatin structure. Less is known regarding the
roles of these modifications in leukemia, but several histone methyl-
transferases have been reported to be implicated in B-ALL patho-
genesis, including MLL1, EZH2, NSD1, and SET7/9 which are
frequently disrupted in hematologic malignancies [45, 46]. Muta-
tions and alterations in expression of these genes are believed to be
associated with aberrant histone methylation and overexpression of
target genes. Histone phosphorylation plays a major regulatory role
in transcription, chromatin condensation, mitosis, apoptosis, and
DNA replication controlled by kinases and phosphatases that add
and remove the modification, respectively [36].

2.3 Noncoding RNAs MicroRNAs (miRNAs) are short noncoding RNAs that act as
important epigenetic regulators of gene expression that target spe-
cific cellular mRNA to modulate gene expression patterns and
cellular signaling pathways. They are encoded within intergenic
regions or within the introns or exons of protein-coding genes of
the genome and exert its function by posttranscriptional gene
silencing regulating other epigenetic regulators and by modulating
expression of protein-coding genes. miRNAs are involved in a wide
range of biological processes and are frequently deregulated in
human cancers and there is increased evidence that miRNA expres-
sion varies between healthy and disease state, suggesting disease
specific methylation patterns [47, 48].
It has been described that miRNAs express differentially in
distinct stages of lymphopoiesis and influence the direction of
lymphoid precursor maturation. For example, miRNA-150 and
miRNA-155 have a role in the differentiation of B and T cells,
and alterations in its expression result in blocked transition from
immature to mature cells in hematopoiesis [49]. miRNA-17,
miRNA-18a, miRNA-19a, miRNA-20a, miRNA-19b-1, and
miRNA-92-1 are expressed in B and T lymphoid precursors and
absence of expression leads to increased levels of the proapoptotic
protein BIM which is the target of these miRNAs [50, 51].
Therefore, there is aberrant expression of miRNAs involved in
different tumor processes and different miRNAs alterations have
been reported that can be used for differential diagnosis, classifica-
tion, prognosis and therapy in ALL [49, 52]. Some authors have
identified differential expression of miRNAs in ALL subtypes
describing that miRNA-708 is highly expressed in TEL-AML1,
BCR-ABL, E2A-PBX1, hyperdiploid, and other B-cell
92 Nataly Cruz-Rodriguez et al.

malignancies in comparison to MLL-rearranged and T-ALL,

demonstrating unique miRNA signatures of each subtype [53, 54].
miRNA signatures can be used not only in the diagnosis of the
ALL; several miRNAs influence the prognosis of acute leukemia
patients by regulation of cell proliferation and apoptosis. High
expression of miRNA-92a and miRNA-16 was found increased in
acute leukemias compared with cells from healthy donors [55],
while higher expression of miR-9, miR-33, miR-92a, miR-142-
3p, miR-146a, miR-181a/c, miR-210, miR-215, miR-369-5p,
miR-335, miR-454, miR-496, miR-518d, and miR-599 is asso-
ciated with high risk clinical features and poor prognoses including
shorter disease-free survival (DFS) in patients with high expression
of these miRNAs [55–58]. Downregulation of miR-124a result in
the phosphorylation of retinoblastoma (Rb) and increased cell
proliferation, leading to a higher the mortality rate and poor sur-
vival in ALL patients [52]. Higher expression of miR-128b at
diagnosis, predicted a better prognosis and prednisolone response
in children with ALL [59]. In addition, different reports showed
that expression of miR-10a, miR-134, miR-214, miR-221,
miR-128b, miR-484, miR-572, miR-580, miR-624, and
miR-627 was significantly correlated with a favorable clinical out-
come [54, 56, 59].

2.4 Mutations Mutations in different epigenetic modifiers have been recently

in Epigenetically detected. Altered functions of these epigenetic modifiers disturb
Regulated Genes the physiological balance between gene activation and gene repres-
sion and contribute to aberrant gene expression regulation in acute
leukemias [60]. The most common mutations in acute leukemias
are those in genes implicated in normal HSCs self-renewal and
differentiation such as DNMT3A and TET2. Mutations that confer
reduction in the expression of DNMT3A and TET2 cause a higher
self-renewal capacity and reduced differentiation, resulting in an
accumulation of HSC in the bone marrow and thus allowing for
leukemia initiation and conferring adverse risk of disease [61–63].
DNMT3A -mutated cells were recently described as preleuke-
mic HSCs because they arise early in acute myeloid leukemia
(AML) evolution, probably in HSCs, leading to a clonally
expanded pool of preleukemic HSCs from which AML
evolves [64].
Mutations in the transcription factor encoded by the zinc finger
DNA-binding protein Wilms’ tumor 1 (WT1) are associated with
chemoresistant disease and a lower survival rate in AML patients
[65, 66]. Mutations in the isocitrate dehydrogenases genes (IDH1)
and IDH2, encoding enzymes that catalyze the conversion of iso-
citrate to 2-ketoglutarate within the citric acid cycle, are also asso-
ciated with worst outcome in acute leukemias [67].
Another frequently altered gene is MLL1, encoding a tran-
scriptional coactivator that plays an essential role in regulating
 Epigenetics in Hematological Malignancies 93

gene expression during early development and hematopoiesis,

essential for maintaining hematopoietic stem cells [68]. The his-
tone methyltransferase activity of MLL1 is dispensable for hemato-
poiesis and leukemogenesis [68]. Chromosomal translocation of
MLL1 has been identified in ALL and AML and it has been
described that MLL-AF9 fusion oncoprotein is dispensable for
maintaining HSCs and supporting leukemogenesis [68]. Together,
these alterations contribute to epigenetic dysregulation of leukemic
cells and confer key properties for transformation and gene expres-
sion reprogramming required for initiation and maintaining of
leukemic clones.

3 Emerging Modes of Epigenetic Regulation in Leukemia: Dysregulation

of Enhancers and DNA-Looping 3D Chromosomal Topology

In addition to the epigenetic alterations in hematological malig-

nancies mentioned above, in the recent years there has been
emerging evidence of additional epigenetic regulation including
dysregulation of enhancers, alterations in the 3D conformation of
chromatin, and spliceosomal gene mutations as molecular changes
that occur during malignant transformation.
Enhancer elements function as genetic regulators by integrat-
ing extracellular signals with intracellular cell fate information to
generate cell type-specific transcriptional responses. These regu-
latory elements enhance the rate of transcription of target genes
in a coordinated fashion. Mutations occurring in cancer transfor-
mation often affect the activity of the enhancer, its target gene
specificity, or epigenetic regulators that control the enhancer’s
activity [69]. Active gene enhancers are closely related to some
posttranslational modifications in the Histone proteins such as
monomethylation of lysine 4 on the tail of histone protein
3 (H3K4me1) as well as acetylation of lysine 27 on the tail of the
same histone protein (H3K27ac). Additionally, open chromatin or
nucleosome-free DNA allowing transcription factors to bind DNA
at these regions are associated with active enhancers [70, 71]. Anal-
ysis of these chromatin marks has revealed interactions between
enhancer on 3q21 and the promoter of the proto-oncogenic tran-
scription factor EV1 whose expression is linked to myeloid leuke-
mogenesis [72, 73]. In addition, it has been described that in
patients with T-ALL, mutations in the proto-oncogenic transcrip-
tion factor TAL1 creates a superenhancer that generate a mono-
allelic overexpression of TAL1 and creates a novel binding motif for
the transcription factor c-Myb and a broad domain of H3K27Ac
[74]. Other authors have identified enhancers in the proto-
oncogene MYC in patients with T-ALL [75, 76]. These processes
that can generate enhancer reprogramming results in activation and
94 Nataly Cruz-Rodriguez et al.

suppression of specific transcriptional state that drives the uncon-

trolled proliferation, survival and other characteristics of leukemic
cells.
Other epigenetic alterations in cancer cells are those implied in
abnormal nuclear architecture. Alterations in DNA elements that
regulate the 3D organization of chromatin itself have been sug-
gested to cause aberrant promoter–enhancer interactions to pro-
mote cancer development [77]. Mutations in cohesin, a
chromosome-associated multisubunit protein complex which facil-
itates spindle attachment onto chromosomes during mitosis, have
been reported in many cancer models [78]. Mutations in genes
encoding members of cohesion complex such as STAG2, SMC1A,
SMC3 and RAD21 have been implicated in widespread alterations
in chromatin accessibility [79, 80] and increased accessibility at
specific binding sites for critical regulators of hematopoietic and
leukemic stem cells including GATA-2 and RUNX1 [79].

4 Epigenetically Directed Therapies

Taking into account that epigenetic modifications are frequently

reversible, this kind of dysregulation offers potential opportunities
for targeted treatment using specific inhibitors of histone-
modifying proteins or proteins driving or maintaining DNA meth-
ylation. Among compounds that function as inhibitors of DNA
methyltransferases (DNMTi), approved for clinical use in myeloid
malignancies are 5-azacytidine (azacitidine) and its deoxy analog
5-aza-29-deoxycytidine (decitabine). Generally, Azacitidine is
metabolized to decitabine and the triphosphorylated product
(i.e., Decitabine triphosphate) is incorporated into DNA during
the S-phase and subsequently binds to DNMT covalently at the C-6
position, targeting them for proteasomal degradation [81].
Azacitidine itself is predominantly incorporated into RNA
interfering with protein synthesis. Both are pyrimidine analogs,
whose incorporation results in cytotoxicity at high concentrations,
while at lower concentrations the predominant effect appears to be
depletion of DNMTs with subsequent loss of DNA methylation
following DNA replication and therapeutic epigenetic modulation.
Both drugs have been approved for the treatment of myelodysplas-
tic syndrome (MDS) as well as for AML with low blast count.
There are several clinical trials of DNMT inhibitors in AML
patients that compare azacitidine or decitabine to conventional care
regimens [82]. These studies have shown that azacitidine prolongs
overall survival and significantly improves several patient morbidity
measures compared with conventional care regimens in older adult
patients with low bone marrow blast count AML [83]. More
recently, a meta-analysis of randomized trials in patients with
MDS or AML shows that DNMT treatment was associated with
 Epigenetics in Hematological Malignancies 95

treatment response and survival benefit, although the initial treat-

ment response failed to translate into survival benefit in patients
treated with Decitabine. Together, these results suggest that azaci-
tidine may be the best therapeutic option in high risk MDS or AML
patients who are not eligible for allogeneic SCT (stem cell trans-
plantation) regardless of cytogenetic risk or degree of bone marrow
involvement [82].
There are currently no established biomarkers that predict the
response to these drugs, although it would be likely that not all
patients are equally susceptible. It is established that approximately
only 50% of patients treated with DNMTi show a hematological
improvement associated with a survival benefit [84]. Additionally,
few alternative treatments exist for patients who fail to respond to
DNMTi, and their prognosis is extremely poor. Therefore, one
critical aspect has been to identify molecular profiles associated
with sensitivity and resistance to DNMTi in order to improve risk
stratification strategies as well as shed light on the mechanisms of
resistance.
Using methylation profiles, an epigenetic classifier that accu-
rately predicted DAC response at the time of diagnosis has been
developed. Transcriptional analysis revealed differences in gene
expression at diagnosis between responders and nonresponders.
In responders, the upregulated genes included those that are asso-
ciated with cell cycle, potentially contributing to effective decita-
bine incorporation. Treatment with CXCL4 and CXCL7, which
were overexpressed in nonresponders, blocked DAC effects in
isolated normal CD34+ and primary CMML cells, suggesting
that their upregulation contributes to primary DAC resistance
[85]. In MDS, particular gene mutations, such as those in TET2
and DNMT3A, may predict for better responsiveness to treatment
with inhibitors of DNMTs [86].
Taking into account that histones play a role in the epigenetic
regulation of gene expression through their effects on the compact
chromatin structure, another group of drugs currently investigated
is the HDAC inhibitors. HDAC inhibitors were among the first
epigenetics drugs developed and over the recent years, HDACs
have become promising therapeutic targets with the potential to
reverse the aberrant epigenetic states associated with cancer
[42]. HDAC inhibitors have the potential to disrupt multiple
signaling pathways to inhibit tumor growth and induce apoptosis.
HDAC inhibitors can not only target histones but have the ability
to influence a variety of processes such as cell cycle arrest, angio-
genesis, immune modulation, and apoptosis by targeting nonhis-
tone proteins [87]. Several nonhistone proteins have been
identified as HDAC substrates with diverse biological functions
including transcription factors (E2F, p53, c-Myc, NF-κB),
hypoxia-inducible factor 1 alpha (HIF-1α), estrogen receptor
(ERα), androgen receptor (AR), MyoD, chaperones (HSP90),
96 Nataly Cruz-Rodriguez et al.

signaling mediators (Stat3, Smad7), DNA repair proteins (Ku70),

α-tubulin, β-catenin, retinoblastoma protein (pRb), and many
others [87].
Several clinical trials have been conducted with HDAC inhibi-
tors in patients with MDS and AML. In general, single-agent
HDAC inhibitor therapy has been associated with low response
rates, usually in the range of 10–20%. Based on in vitro studies,
revealing HDAC inhibitors and DNMT inhibitors act synergisti-
cally to induce reexpression of silenced genes in cancer cells, clinical
trials have been conducted to use HDAC inhibitors in combination
with other agents, such as DNMT inhibitors and conventional
chemotherapeutic agents [88].
To date, three HDAC inhibitors have been approved for cancer
therapy by the US Food and Drug Administration (FDA): vorino-
stat (SAHA, Zolina), romidepsin (Istodax, FK228, FR901228,
Depsipeptide), and belinostat (Beleodaq, PXD-101). Besides vor-
inostat and belinostat, some of the novel hydroxamic acid-based
HDACi that are in different stages of clinical studies are abexinostat
(PCI-24781), pracinostat (SB939), resminostat (RAS2410,
4SC-201), givinostat (ITF2357), quisinostat (JNJ-26481585),
Panobinostat (LBH589), and CUDC-101 [89].

5 Conclusions

Even though many advances in the understanding of genetic and

epigenetic landscape of leukemia have been made, the disease is still
one of the malignancies with the highest mortality rates worldwide
in adult population. With the development of different technolo-
gies as DNA and RNA sequencing to analyze epigenetic processes
such as DNA methylation gene- or region-specific techniques
through bisulfite methylation and chromatin immunoprecipitation
(ChIP)-based protocols, different alterations in epigenetic modi-
fiers have now been identified as common genetic defects in acute
leukemia and have facilitated the understanding of the role of
epigenetics in leukemogenesis. With this knowledge, epigenetic
mechanisms are now promising biomarkers and targets of disease.
The emerging therapies that target epigenetic regulation in leuke-
mia provide an important opportunity to improve the treatment
regimens currently used that might be insufficient, taking into
account the aggressiveness of the disease.

References
1. Cruz-Rodriguez N, Combita AL, Enciso LJ,
Quijano SM, Pinzon PL, Lozano OC, Castillo
JS, Li L, Bareno J, Cardozo C, Solano J, Her-
rera MV, Cudris J, Zabaleta J (2016) High
expression of ID family and IGJ genes signa-
ture as predictor of low induction treatment
response and worst survival in adult Hispanic
 Epigenetics in Hematological Malignancies
patients with B-acute lymphoblastic leukemia.
J Exp Clin Cancer Res 35:64
2. Eriksson A, Lennartsson A, Lehmann S (2015)
Epigenetic aberrations in acute myeloid leuke-
mia: early key events during leukemogenesis.
Exp Hematol 43(8):609–624
3. Robison LL (2011) Late effects of acute lym-
phoblastic Leukemia therapy in patients diag-
nosed at 0-20 years of age. Hematology
2011:238–242
4. Koh H, Nakamae H, Hagihara K, Nakane T,
Manabe M, Hayashi Y, Nishimoto M,
Umemoto Y, Nakamae M, Hirose A, Inoue E,
Inoue A, Yoshida M, Bingo M, Okamura H,
Aimoto R, Aimoto M, Terada Y, Koh KR,
Yamane T, Ohsawa M, Hino M (2011) Factors
that contribute to long-term survival in
patients with leukemia not in remission at allo-
geneic hematopoietic cell transplantation. J
Exp Clin Cancer Res 30:36
5. Gokbuget N, Hoelzer D, Arnold R, Bohme A,
Bartram CR, Freund M, Ganser A, Kneba M,
Langer W, Lipp T, Ludwig WD,
Maschmeyer G, Rieder H, Thiel E, Weiss A,
Messerer D (2000) Treatment of adult ALL
according to protocols of the German Multi-
center study Group for Adult ALL (GMALL).
Hematol Oncol Clin North Am 14
(6):1307–1325
6. Okamoto R, Ogawa S, Nowak D,
Kawamata N, Akagi T, Kato M, Sanada M,
Weiss T, Haferlach C, Dugas M, Ruckert C,
Haferlach T, Koeffler HP (2010) Genomic
profiling of adult acute lymphoblastic leukemia
by single nucleotide polymorphism oligonucle-
otide microarray and comparison to pediatric
acute lymphoblastic leukemia. Haematologica
95(9):1481–1488
7. Radford JE, Burns CP, Jones MP, Gingrich
RD, Kemp JD, Edwards RW, McFadden DB,
Dick FR, Wen BC (1989) Adult acute lympho-
blastic leukemia: results of the Iowa HOP-L
protocol. J Clin Oncol 7(1):58–66
8. Kantarjian HM, O’Brien S, Smith TL, Cortes J,
Giles FJ, Beran M, Pierce S, Huh Y,
Andreeff M, Koller C, Ha CS, Keating MJ,
Murphy S, Freireich EJ (2000) Results of treat-
ment with hyper-CVAD, a dose-intensive regi-
men, in adult acute lymphocytic leukemia. J
Clin Oncol 18(3):547–561
9. Kantarjian H, Thomas D, O’Brien S, Cortes J,
Giles F, Jeha S, Bueso-Ramos CE, Pierce S,
Shan J, Koller C, Beran M, Keating M, Freir-
eich EJ (2004) Long-term follow-up results of
hyperfractionated cyclophosphamide, vincris-
tine, doxorubicin, and dexamethasone (hyper-
CVAD), a dose-intensive regimen, in adult
97
acute lymphocytic leukemia. Cancer 101
(12):2788–2801
10. Gerber JM, Gucwa JL, Esopi D, Gurel M,
Haffner MC, Vala M, Nelson WG, Jones RJ,
Yegnasubramanian S (2013) Genome-wide
comparison of the transcriptomes of highly
enriched normal and chronic myeloid leukemia
stem and progenitor cell populations. Oncotar-
get 4(5):715–728
11. Zhang H, Teng X, Liu Z, Zhang L, Liu Z
(2015) Gene expression profile analyze the
molecular mechanism of CXCR7 regulating
papillary thyroid carcinoma growth and metas-
tasis. J Exp Clin Cancer Res 34:16
12. Yin ZQ, Liu JJ, Xu YC, Yu J, Ding GH, Yang F,
Tang L, Liu BH, Ma Y, Xia YW, Lin XL, Wang
HX (2014) A 41-gene signature derived from
breast cancer stem cells as a predictor of sur-
vival. J Exp Clin Cancer Res 33:49
13. Cruz-Rodriguez N, Combita AL, Enciso LJ,
Raney LF, Pinzon PL, Lozano OC, Campos
AM, Peñaloza N, Solano J, Herrera MV,
Zabaleta J, Quijano S (2017) Prognostic strati-
fication improvement by integrating
ID1/ID3/IGJ gene expression signature and
immunophenotypic profile in adult patients
with B-ALL. J Exp Clin Cancer Res 36(1):37
14. Marcucci G, Haferlach T, Dohner H (2011)
Molecular genetics of adult acute myeloid Leu-
kemia: prognostic and therapeutic implica-
tions. J Clin Oncol 29(5):475–486
15. Kim KT, Gore SD, Zeidan AM (2015) Epige-
netic therapy in acute myeloid Leukemia: cur-
rent and future directions. Semin Hematol 52
(3):172–183
16. Egger G, Liang G, Aparicio A, Jones PA (2004)
Epigenetics in human disease and prospects for
epigenetic therapy. Nature 429
(6990):457–463
17. Wouters BJ, Delwel R (2016) Epigenetics and
approaches to targeted epigenetic therapy in
acute myeloid leukemia. Blood 127(1):42–52
18. Gore AV, Weinstein BM (2016) DNA methyl-
ation in hematopoietic development and dis-
ease. Exp Hematol 44(9):783–790
19. Hale V, Hale GA, Brown PA, Amankwah EK
(2017) A review of DNA methylation and
microRNA expression in recurrent Pediatric
acute Leukemia. Oncology 92(2):61–67
20. Esteller M (2008) Epigenetics in cancer. N
Engl J Med 358(11):1148–1159
21. Celik H, Kramer A, Challen GA (2016) DNA
methylation in normal and malignant hemato-
poiesis. Int J Hematol 103(6):617–626
22. Sashida G, Iwama A (2012) Epigenetic regula-
tion of hematopoiesis. Int J Hematol 96
(4):405–412
98 Nataly Cruz-Rodriguez et al.
23. Timms JA, Relton CL, Rankin J, Strathdee G,
McKay JA (2016) DNA methylation as a
potential mediator of environmental risks in
the development of childhood acute lympho-
blastic leukemia. Epigenomics 8(4):519–536
24. Jeong M, Sun D, Luo M, Huang Y, Challen
GA, Rodriguez B, Zhang X, Chavez L,
Wang H, Hannah R, Kim SB, Yang L, Ko M,
Chen R, Gottgens B, Lee JS, Gunaratne P,
Godley LA, Darlington GJ, Rao A, Li W,
Goodell MA (2014) Large conserved domains
of low DNA methylation maintained by
Dnmt3a. Nat Genet 46(1):17–23
25. Challen GA, Sun D, Jeong M, Luo M,
Jelinek J, Berg JS, Bock C, Vasanthakumar A,
Gu H, Xi Y, Liang S, Lu Y, Darlington GJ,
Meissner A, Issa JP, Godley LA, Li W, Goodell
MA (2011) Dnmt3a is essential for hemato-
poietic stem cell differentiation. Nat Genet 44
(1):23–31
26. Nordlund J, Backlin CL, Wahlberg P,
Busche S, Berglund EC, Eloranta ML,
Flaegstad T, Forestier E, Frost BM, Harila-
Saari A, Heyman M, Jonsson OG, Larsson R,
Palle J, Ronnblom L, Schmiegelow K,
Sinnett D, Soderhall S, Pastinen T, Gustafsson
MG, Lonnerholm G, Syvanen AC (2013)
Genome-wide signatu res of differential DNA
methylation in pediatric acute lymphoblastic
leukemia. Genome Biol 14(9):r105
27. Hogan LE, Meyer JA, Yang J, Wang J,
Wong N, Yang W, Condos G, Hunger SP,
Raetz E, Saffery R, Relling MV, Bhojwani D,
Morrison DJ, Carroll WL (2011) Integrated
genomic analysis of relapsed childhood acute
lymphoblastic leukemia reveals therapeutic
strategies. Blood 118(19):5218–5226
28. Ismail EAR, El-Mogy MI, Mohamed DS,
El-Farrash RAH (2011) Methylation pattern
of calcitonin (CALCA) gene in pediatric acute
leukemia. J Pediatr Hematol Oncol 33
(7):534–542
29. Batova A, Diccianni MB, Yu JC, Nobori T,
Link MP, Pullen J, Yu AL (1997) Frequent
and selective methylation of p15 and deletion
of both p15 and p16 in T-cell acute lympho-
blastic leukemia. Cancer Res 57(5):832–836
30. Figueroa ME, Abdel-Wahab O, Lu C, Ward
PS, Patel J, Shih A, Li Y, Bhagwat N,
Vasanthakumar A, Fernandez HF, Tallman
MS, Sun Z, Wolniak K, Peeters JK, Liu W,
Choe SE, Fantin VR, Paietta E, Löwenberg B,
Licht JD, Godley LA, Delwel R, Valk PJ,
Thompson CB, Levine RL, Melnick A (2010)
Leukemic IDH1 and IDH2 mutations result in
a hypermethylation phenotype, disrupt TET2
function, and impair hematopoietic differenti-
ation. Cancer Cell 18(6):553–567
31. Toyota M, Kopecky KJ, Toyota MO, Jair KW,
Willman CL, Issa JP (2001) Methylation
profiling in acute myeloid leukemia. Blood 97
(9):2823–2829
32. Issa JP (2004) CpG island methylator pheno-
type in cancer. Nat Rev Cancer 4(12):988–993
33. Shen L, Kantarjian H, Guo Y, Lin E, Shan J,
Huang X, Berry D, Ahmed S, Zhu W, Pierce S,
Kondo Y, Oki Y, Jelinek J, Saba H, Estey E, Issa
JP (2010) DNA methylation predicts survival
and response to therapy in patients with Mye-
lodysplastic syndromes. J Clin Oncol 28
(4):605–613
34. Greenblatt SM, Nimer SD (2014) Chromatin
modifiers and the promise of epigenetic ther-
apy in acute leukemia. Leukemia 28
(7):1396–1406
35. Kurdistani SK, Grunstein M (2003) Histone
acetylation and deacetylation in yeast. Nat Rev
Mol Cell Biol 4(4):276–284
36. Bannister AJ, Kouzarides T (2011) Regulation
of chromatin by histone modifications. Cell
Res 21(3):381–395
37. Janczar S, Janczar K, Pastorczak A, Harb H,
Paige AJ, Zalewska-Szewczyk B,
Danilewicz M, Mlynarski W (2017) The role
of histone protein modifications and mutations
in histone modifiers in Pediatric B-cell progen-
itor acute lymphoblastic Leukemia. Cancer 9
(1):E2
38. Mullighan CG, Zhang J, Kasper LH, Lerach S,
Payne-Turner D, Phillips LA, Heatley SL,
Holmfeldt L, Collins-Underwood JR, Ma J,
Buetow KH, Pui CH, Baker SD, Brindle PK,
Downing JR (2011) CREBBP mutations in
relapsed acute lymphoblastic leukaemia.
Nature 471(7337):235–239
39. Pasqualucci L, Dominguez-Sola D,
Chiarenza A, Fabbri G, Grunn A, Trifonov V,
Kasper LH, Lerach S, Tang H, Ma J, Rossi D,
Chadburn A, Murty VV, Mullighan CG,
Gaidano G, Rabadan R, Brindle PK, Dalla-
Favera R (2011) Inactivating mutations of
acetyltransferase genes in B-cell lymphoma.
Nature 471(7337):189–195
40. Inthal A, Zeitlhofer P, Zeginigg M, Morak M,
Grausenburger R, Fronkova E, Fahrner B,
Mann G, Haas OA, Panzer-Grumayer R
(2012) CREBBP HAT domain mutations pre-
vail in relapse cases of high hyperdiploid child-
hood acute lymphoblastic leukemia. Leukemia
26(8):1797–1803
41. Malinowska-Ozdowy K, Frech C,
Schonegger A, Eckert C, Cazzaniga G,
Stanulla M, zur Stadt U, Mecklenbrauker A,
Schuster M, Kneidinger D, von Stackelberg A,
Locatelli F, Schrappe M, Horstmann MA,
 Epigenetics in Hematological Malignancies
Attarbaschi A, Bock C, Mann G, Haas OA,
Panzer-Grumayer R (2015) KRAS and
CREBBP mutations: a relapse-linked malicious
liaison in childhood high hyperdiploid acute
lymphoblastic leukemia. Leukemia 29
(8):1656–1667
42. Moreno DA, Scrideli CA, Cortez MA, de Paula
Queiroz R, Valera ET, da Silva Silveira V, Yunes
JA, Brandalise SR, Tone LG (2010) Differen-
tial expression of HDAC3, HDAC7 and
HDAC9 is associated with prognosis and sur-
vival in childhood acute lymphoblastic leukae-
mia. Br J Haematol 150(6):665–673
43. Gruhn B, Naumann T, Gruner D, Walther M,
Wittig S, Becker S, Beck JF, Sonnemann J
(2013) The expression of histone deacetylase
4 is associated with prednisone poor-response
in childhood acute lymphoblastic leukemia.
Leuk Res 37(10):1200–1207
44. Sonnemann J, Gruhn B, Wittig S, Becker S,
Beck JF (2012) Increased activity of histone
deacetylases in childhood acute lymphoblastic
leukaemia and acute myeloid leukaemia: sup-
port for histone deacetylase inhibitors as antil-
eukaemic agents. Br J Haematol 158
(5):664–666
45. Vu LP, Luciani L, Nimer SD (2013) Histone-
modifying enzymes: their role in the pathogen-
esis of acute leukemia and their therapeutic
potential. Int J Hematol 97(2):198–209
46. Bernt KM, Armstrong SA (2011) Targeting
epigenetic programs in MLL-rearranged leuke-
mias. Hematology Am Soc Hematol Educ Pro-
gram 2011:354–360
47. Van den Hove DL, Kompotis K, Lardenoije R,
Kenis G, Mill J, Steinbusch HW, Lesch KP,
Fitzsimons CP, De Strooper B, Rutten BP
(2014) Epigenetically regulated microRNAs
in Alzheimer’s disease. Neurobiol Aging 35
(4):731–745
48. Piletic K, Kunej T (2016) MicroRNA epige-
netic signatures in human disease. Arch Toxicol
90(10):2405–2419
49. Luan C, Yang Z, Chen B (2015) The func-
tional role of microRNA in acute lymphoblastic
leukemia: relevance for diagnosis, differential
diagnosis, prognosis, and therapy. Onco Tar-
gets Ther 8:2903–2914
50. Havelange V, Garzon R (2010) Micrornas:
emerging key regulators of hematopoiesis. Am
J Hematol 85(12):935–942
51. Ventura A, Young AG, Winslow MM,
Lintault L, Meissner A, Erkeland SJ,
Newman J, Bronson RT, Crowley D, Stone
JR, Jaenisch R, Sharp PA, Jacks T (2008) Tar-
geted deletion reveals essential and overlapping
99
functions of the miR-17 through 92 family of
miRNA clusters. Cell 132(5):875–886
52. Yeh CH, Moles R, Nicot C (2016) Clinical
significance of microRNAs in chronic and
acute human leukemia. Mol Cancer 15(1):37
53. Schotte D, Chau JC, Sylvester G, Liu G,
Chen C, van der Velden VH, Broekhuis MJ,
Peters TC, Pieters R, den Boer ML (2009)
Identification of new microRNA genes and
aberrant microRNA profiles in childhood
acute lymphoblastic leukemia. Leukemia 23
(2):313–322
54. Schotte D, De Menezes RX, Akbari
Moqadam F, Khankahdani LM, Lange-
Turenhout E, Chen C, Pieters R, Den Boer
ML (2011) MicroRNA characterize genetic
diversity and drug resistance in pediatric acute
lymphoblastic leukemia. Haematologica 96
(5):703–711
55. Ohyashiki JH, Umezu T, Kobayashi C, Hama-
mura RS, Tanaka M, Kuroda M, Ohyashiki K
(2010) Impact on cell to plasma ratio of
miR-92a in patients with acute leukemia:
in vivo assessment of cell to plasma ratio of
miR-92a. BMC Res Notes 3:347
56. Wang Y, Li Z, He C, Wang D, Yuan X, Chen J,
Jin J (2010) MicroRNAs expression signatures
are associated with lineage and survival in acute
leukemias. Blood Cells Mol Dis 44
(3):191–197
57. Sugita F, Maki K, Nakamura Y, Sasaki K,
Mitani K (2014) Overexpression of MIR9 indi-
cates poor prognosis in acute lymphoblastic
leukemia. Leuk Lymphoma 55(1):78–86
58. Yan J, Jiang N, Huang G, Tay JL, Lin B, Bi C,
Koh GS, Li Z, Tan J, Chung TH, Lu Y,
Ariffin H, Kham SK, Yeoh AE, Chng WJ
(2013) Deregulated MIR335 that targets
MAPK1 is implicated in poor outcome of pae-
diatric acute lymphoblastic leukaemia. Br J
Haematol 163(1):93–103
59. Nemes K, Csoka M, Nagy N, Mark A,
Varadi Z, Danko T, Kovacs G, Kopper L,
Sebestyen A (2015) Expression of certain leu-
kemia/lymphoma related microRNAs and its
correlation with prognosis in childhood acute
lymphoblastic leukemia. Pathol Oncol Res 21
(3):597–604
60. Pastore F, Levine RL (2016) Epigenetic regu-
lators and their impact on therapy in acute
myeloid leukemia. Haematologica 101
(3):269–278
61. Marcucci G, Metzeler KH, Schwind S,
Becker H, Maharry K, Mrozek K, Radmacher
MD, Kohlschmidt J, Nicolet D, Whitman SP,
Wu YZ, Powell BL, Carter TH, Kolitz JE,
100 Nataly Cruz-Rodriguez et al.
Wetzler M, Carroll AJ, Baer MR, Moore JO,
Caligiuri MA, Larson RA, Bloomfield CD
(2012) Age-related prognostic impact of dif-
ferent types of DNMT3A mutations in adults
with primary cytogenetically normal acute
myeloid leukemia. J Clin Oncol 30
(7):742–750
62. Ribeiro AF, Pratcorona M, Erpelinck-
Verschueren C, Rockova V, Sanders M,
Abbas S, Figueroa ME, Zeilemaker A,
Melnick A, Lowenberg B, Valk PJ, Delwel R
(2012) Mutant DNMT3A: a marker of poor
prognosis in acute myeloid leukemia. Blood
119(24):5824–5831
63. Ko M, Huang Y, Jankowska AM, Pape UJ,
Tahiliani M, Bandukwala HS, An J, Lamperti
ED, Koh KP, Ganetzky R, Liu XS, Aravind L,
Agarwal S, Maciejewski JP, Rao A (2010)
Impaired hydroxylation of 5-methylcytosine
in myeloid cancers with mutant TET2. Nature
468(7325):839–843
64. Shlush LI, Zandi S, Mitchell A, Chen WC,
Brandwein JM, Gupta V, Kennedy JA, Schim-
mer AD, Schuh AC, Yee KW, JL ML,
Doedens M, Medeiros JJ, Marke R, Kim HJ,
Lee K, JD MP, Hudson TJ, HALT
Pan-Leukemia Gene Panel Consortium,
Brown AM, Yousif F, Trinh QM, Stein LD,
Minden MD, Wang JC, Dick JE (2014) Iden-
tification of pre-leukaemic haematopoietic
stem cells in acute leukaemia. Nature 506
(7488):328–333
65. Virappane P, Gale R, Hills R, Kakkas I,
Summers K, Stevens J, Allen C, Green C,
Quentmeier H, Drexler H, Burnett A,
Linch D, Bonnet D, Lister TA, Fitzgibbon J
(2008) Mutation of the Wilms’ tumor 1 gene is
a poor prognostic factor associated with che-
motherapy resistance in normal karyotype
acute myeloid leukemia: the United Kingdom
Medical Research Council adult leukaemia
working party. J Clin Oncol 26
(33):5429–5435
66. Gaidzik VI, Schlenk RF, Moschny S, Becker A,
Bullinger L, Corbacioglu A, Krauter J,
Schlegelberger B, Ganser A, Dohner H,
Dohner K, German-Austrian AML Study
Group (2009) Prognostic impact of WT1
mutations in cytogenetically normal acute mye-
loid leukemia: a study of the German-Austrian
AML study group. Blood 113(19):4505–4511
67. Green CL, Evans CM, Zhao L, Hills RK, Bur-
nett AK, Linch DC, Gale RE (2011) The prog-
nostic significance of IDH2 mutations in AML
depends on the location of the mutation.
Blood 118(2):409–412
68. Mishra BP, Zaffuto KM, Artinger EL, Org T,
Mikkola HK, Cheng C, Djabali M, Ernst P
(2014) The histone methyltransferase activity
of MLL1 is dispensable for hematopoiesis and
leukemogenesis. Cell Rep 7(4):1239–1247
69. Sur I, Taipale J (2016) The role of enhancers in
cancer. Nat Rev Cancer 16(8):483–493
70. Heintzman ND, Hon GC, Hawkins RD,
Kheradpour P, Stark A, Harp LF, Ye Z, Lee
LK, Stuart RK, Ching CW, Ching KA,
Antosiewicz-Bourget JE, Liu H, Zhang X,
Green RD, Lobanenkov VV, Stewart R, Thom-
son JA, Crawford GE, Kellis M, Ren B (2009)
Histone modifications at human enhancers
reflect global cell-type-specific gene expression.
Nature 459(7243):108–112
71. Ito S, D’Alessio AC, Taranova OV, Hong K,
Sowers LC, Zhang Y (2010) Role of Tet pro-
teins in 5mC to 5hmC conversion, ES-cell self-
renewal and inner cell mass specification.
Nature 466(7310):1129–1133
72. Groschel S, Sanders MA, Hoogenboezem R,
de Wit E, Bouwman BAM, Erpelinck C, van
der Velden VHJ, Havermans M, Avellino R,
van Lom K, Rombouts EJ, van Duin M,
Dohner K, Beverloo HB, Bradner JE,
Dohner H, Lowenberg B, Valk PJM, Bindels
EMJ, de Laat W, Delwel R (2014) A single
oncogenic enhancer rearrangement causes con-
comitant EVI1 and GATA2 deregulation in
leukemia. Cell 157(2):369–381
73. Ntziachristos P, Abdel-Wahab O, Aifantis I
(2016) Emerging concepts of epigenetic dysre-
gulation in hematological malignancies. Nat
Immunol 17(9):1016–1024
74. Mansour MR, Abraham BJ, Anders L,
Berezovskaya A, Gutierrez A, Durbin AD,
Etchin J, Lawton L, Sallan SE, Silverman LB,
Loh ML, Hunger SP, Sanda T, Young RA,
Look AT (2014) Oncogene regulation. An
oncogenic super-enhancer formed through
somatic mutation of a noncoding intergenic
element. Science 346(6215):1373–1377
75. Herranz D, Ambesi-Impiombato A,
Palomero T, Schnell SA, Belver L, Wendorff
AA, Xu L, Castillo-Martin M, Llobet-Navas D,
Cordon-Cardo C, Clappier E, Soulier J, Fer-
rando AA (2014) A NOTCH1-driven MYC
enhancer promotes T cell development, trans-
formation and acute lymphoblastic leukemia.
Nat Med 20(10):1130–1137
76. Wang H, Zang C, Taing L, Arnett KL, Wong
YJ, Pear WS, Blacklow SC, Liu XS, Aster JC
(2014) NOTCH1-RBPJ complexes drive tar-
get gene expression through dynamic interac-
tions with superenhancers. Proc Natl Acad Sci
U S A 111(2):705–710
77. Dekker J, Mirny L (2016) The 3D genome as
moderator of chromosomal communication.
Cell 164(6):1110–1121
 Epigenetics in Hematological Malignancies
78. Thota S, Viny AD, Makishima H, Spitzer B,
Radivoyevitch T, Przychodzen B, Sekeres MA,
Levine RL, Maciejewski JP (2014) Genetic
alterations of the cohesin complex genes in
myeloid malignancies. Blood 124
(11):1790–1798
79. Mazumdar C, Shen Y, Xavy S, Zhao F,
Reinisch A, Li R, Corces MR, Flynn RA, Buen-
rostro JD, Chan SM, Thomas D, Koenig JL,
Hong WJ, Chang HY, Majeti R (2015)
Leukemia-associated Cohesin mutants domi-
nantly enforce stem cell programs and impair
human hematopoietic progenitor differentia-
tion. Cell Stem Cell 17(6):675–688
80. Mullenders J, Aranda-Orgilles B, Lhoumaud P,
Keller M, Pae J, Wang K, Kayembe C, Rocha
PP, Raviram R, Gong Y, Premsrirut PK,
Tsirigos A, Bonneau R, Skok JA, Cimmino L,
Hoehn D, Aifantis I (2015) Cohesin loss alters
adult hematopoietic stem cell homeostasis,
leading to myeloproliferative neoplasms. J Exp
Med 212(11):1833–1850
81. Yun S, Vincelette ND, Abraham I, Robertson
KD, Fernandez-Zapico ME, Patnaik MM6
(2016) Targeting epigenetic pathways in acute
myeloid leukemia and myelodysplastic syn-
drome: a systematic review of hypomethylating
agents trials. Clin Epigenetics 8:68
82. Yun S, Vincelette N, Segar J (2015). Overall
survival and treatment response in patients
with myelodysplastic syndrome and acute mye-
loid leukemia treated with DNA methyl-
transferase inhibitors vs. conventional care
regimens: A meta-analysis of 5 randomized
trials. |2015 ASCO Annual Meeting|
Abstracts|Meeting Library. http://
meetinglibrary.asco.org/content/142849-
156. Accessed 4 May 2017
83. Fenaux P, Mufti GJ, Hellstrom-Lindberg E,
Santini V, Gattermann N, Germing U,
Sanz G, List AF, Gore S, Seymour JF,
101
Dombret H, Backstrom J, Zimmerman L,
McKenzie D, Beach CL, Silverman LR (2010)
Azacitidine prolongs overall survival compared
with conventional care regimens in elderly
patients with low bone marrow blast count
acute myeloid leukemia. J Clin Oncol 28
(4):562–569
84. Griffiths EA, Gore SD (2008) DNA Methyl-
transferase and histone Deacetylase inhibitors
in the treatment of Myelodysplastic syndromes.
Semin Hematol 45(1):23–30
85. Meldi K, Qin T, Buchi F, Droin N, Sotzen J,
Micol JB, Selimoglu-Buet D, Masala E,
Allione B, Gioia D, Poloni A, Lunghi M,
Solary E, Abdel-Wahab O, Santini V, Figueroa
ME (2015) Specific molecular signatures pre-
dict decitabine response in chronic myelomo-
nocytic leukemia. J Clin Invest 125
(5):1857–1872
86. Traina F, Visconte V, Elson P, Tabarroki A,
Jankowska AM, Hasrouni E, Sugimoto Y,
Szpurka H, Makishima H, O’Keefe CL,
Sekeres MA, Advani AS, Kalaycio M, Copelan
EA, Saunthararajah Y, Olalla Saad ST, Macie-
jewski JP, Tiu RV (2014) Impact of molecular
mutations on treatment response to DNMT
inhibitors in myelodysplasia and related neo-
plasms. Leukemia 28(1):78–87
87. Peng L, Seto E (2011) Deacetylation of non-
histone proteins by HDACs and the implica-
tions in cancer. Handb Exp Pharmacol
206:39–56
88. Navada SC, Steinmann J, Lubbert M, Silver-
man LR (2014) Clinical development of
demethylating agents in hematology. J Clin
Invest 124(1):40–46
89. Mottamal M, Zheng S, Huang TL, Wang G
(2015) Histone deacetylase inhibitors in clini-
cal studies as templates for new anticancer
agents. Molecules 20(3):3898–3941
 Chapter 6

MicroRNAs Role in Prostate Cancer

Ovidiu Balacescu, Ramona G. Dumitrescu, and Catalin Marian

Abstract
Prostate cancer still represents a major health problem for men worldwide. Due to the specific limitation of
the currently used clinical biomarkers for prostate cancer, there is a need to identify new and more accurate
prostate-specific biomarkers, both for diagnosis and prediction. Small noncoding species of RNAs called
microRNAs (miRNAs) have emerged as possible biomarkers in cancer tissues as well as biological fluids,
including for prostate cancer. Moreover, it has been shown that miRNAs could be used as therapeutic
targets in different cancer types, including prostate cancer, playing an important role in improving diagnosis
and prognosis; and miRNAs have the potential to be clinically useful as predictors of response to persona-
lized cancer therapy and as predictors of prognosis. The analysis of miRNAs in prostate tissue is rather
straightforward and has been routinely done on fresh tissue. In addition, due to the more stable nature of
miRNAs, they are amenable to be analyzed in archived formalin fixed paraffin embedded tissue as well, and
also in serum, plasma and urine, using various analytical platforms including microarrays, next generation
sequencing and real time PCR. Moreover, although the existence or prostasomes (microvesicles secreted by
prostate cells including prostate cancer cells) has been known for years and they were studied as a source of
biomarkers for prostate cancer, only recently it has been described that these vesicles also contain miRNAs
that could be used as biomarkers in prostate cancer. This chapter underscores the feasibility of current
technologies for miRNA analysis and their importance in prostate cancer biology. Moreover, elucidating the
specific alteration of miRNA expression and how to modulate it in prostate tissue will open new avenues for
developing therapeutic strategies for prostate cancer treatment.

Key words Prostate cancer, MicroRNA, Biomarkers

1 Prostate Cancer Overview

With an incidence of over one million new cases and about 300,000
cancer related deaths, prostate cancer represents a major men
health problem worldwide [1]. Similar to other pathologies, the
major clinical challenge in prostate cancer is to identify new and
more accurate prostate-specific biomarkers, both for diagnosis and
prediction. Currently, a series of biomarkers are considered for
prostate cancer diagnosis and prognosis. A few of them,
FDA-approved, were developed as biomarkers in clinical use, and
others were developed as useful supplementary tests [2]. The first

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_6,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

103
104 Ovidiu Balacescu et al.

FDA-approved test was related to the prostate-specific antigen

(PSA), whose discovery resulted in significant advances in the
early diagnostic and management of prostate cancer [3].
PSA represents an organ-specific biomarker, secreted solely by
the epithelial cells of the prostate, with considered normal upper
values of 4 ng/ml. Patients with PSA serum level higher than 4 ng/
ml are taken into account for further investigation, in order to
confirm the diagnostic of prostate cancer by prostate biopsy. Nev-
ertheless, more than 50% of those investigated with elevated serum
of PSA level (>4.0 ng/ml) are negative on initial biopsy and about
20% of those with lower serum PSA level (<4.0 ng/ml) are con-
firmed with prostate cancer. The major problem of PSA relates to
the fact that even if it is highly organ-specific, PSA is not specific for
prostate malignancy, high levels of PSA have been associated with
inflammation and/or benign prostatic hyperplasia (BPH)
[4]. Moreover, the excess of carbohydrate intake or body weight
could lead to the PSA increasing [5]. Although PSA leads to over-
diagnosis and overtreatment of prostate cancer, it still represents a
useful FDA approved marker, and new recommendations including
the use of PSA screening were reconsidered [6].
A prostate health index (PHI), that include the values of
proPSA (PSA precursors), fPSA (free form of PSA) and total PSA
into an algorithm was approved by FDA. This algorithm is useful to
clarify the prostate cancer diagnosis for patients with normal digital
rectal examination (DRE) but PSA levels between 4 and 10 ng/ml.
However, because sometimes there are cases of cancer suspicion
unresolved by PSA, DRE or first biopsy, new approaches were
developed. After the discovery and validation of a urinary long
noncoding RNA, named prostate cancer antigen 3 (PCA3 or
DD3), FDA approved it for prostate cancer diagnosis [7]. Albeit
PCA3 has a higher specificity than PSA, it could not replace it
because of its lower sensitivity [8].
In an attempt to find new reliable prostate biomarkers, studies
using novel molecular discoveries based on small noncoding species
of RNAs called microRNAs (miRNAs) have been further
undertaken.

2 miRNAs Role in Cancer

Because cancer is an extremely heterogeneous and complex disease,

its early diagnosis and treatment are permanently challenging.
Recent years have brought new data related to genetic and genomic
alterations that occur in cancer cells, making possible a better
understanding of the tumor phenotype. By including this data in
the big puzzle of how a cancer appears and develops, researchers
have identified new molecular indicators that could be used as
biomarkers for early diagnosis and prognosis. However, because
 MicroRNAs Role in Prostate Cancer 105

this disease has to be permanently monitored during and after

treatment, identifying stable and reliable biomarkers represent the
great challenges for helping clinicians to fight cancer.
Genomics analyses have identified new molecular data that
advanced the knowledge about the complex regulatory signaling
networks that lead to cancer development. Consequently, both
coding and noncoding transcriptome data have been investigated
for identification of new cancer biomarkers. While only approxi-
mately 2% of human genome is represented by protein-coding
genes (exons), the rest of 98% include noncoding DNAs repre-
sented by introns from protein-coding genes, regulatory intragenic
and intergenic DNA sequences, or noncoding RNAs [9]. For many
years it was believed that noncoding DNA has no biological pur-
pose, being considered as “junk DNA.” Naturally, further research
has shown that a significant part of noncoding DNAs represents in
fact noncoding RNA (ncRNA) genes, a large class of functional
molecules with important functions in protein-coding gene regula-
tion [10]. Finished in 2012, the ENCODE project (Encyclopedia
of DNA Elements) has revealed that about 80% of human genome
is used in cell physiology, and noncoding RNAs represent a large
part of genome transcription [11]. From all species of ncRNAs,
microRNAs (miRNAs) are the most investigated, being named
master modulators of human genome because they are regulators
of more than 60% of mRNAs and their proteins [12]. As a result of
the characterization of a growing number of miRNA, a specific
website database (http://www.mirbase.org/) created in 2004
[13], is permanently updated. Currently, miRBase Release 21 con-
tains 35,828 mature miRNAs from 223 species, including 2588
mature human miRNAs.
MiRNAs transcription starts in the nucleus as a long hairpin
structure (pri-miRNAs) including hundreds or thousands of
nucleotides, followed by a processing in smaller structures of
about 70 nucleotides (pre-miRNAs) [14–16]. After exported in
cytoplasm, pre-miRNA is processed in mature miRNAs of about
21–23 nucleotides, functionalized by loaded into Argonaute
2 (AGO2) proteins and RNA-induced silencing complex (RISC)
[17], and used for transcriptional and translational regulation of
mRNAs. In an attempt to help finding miRNA biomarkers, Wong
et al. [18] recently developed a useful website tool named Onco-
miR: online resource for exploring pan-cancer miRNA dysregula-
tion, that integrate existing molecular data from miRNA-seq and
RNA-seq studies with clinical data from The Cancer Genome Atlas.
In physiological conditions, the regulation of cell cycle is
mediated by two classes of protein-coding genes including proto-
oncogenes (e.g., KRAS, RAF, ERK, MYC, WNT, BCR-ABL) and
tumor-suppressor genes (e.g., RB, TP53, INK4, APC, PTEN). In
cancer, because of genetic and epigenetic alterations of both classes
of these genes, cell cycle regulation become disrupted and leads to
106 Ovidiu Balacescu et al.

uncontrolled cell division [19]. Such as, proto-oncogenes are trans-

formed in oncogenes and become overexpressed by “gain of func-
tion,” while tumor-suppressor are inactivated or deleted, resulting
in their “loss of function.” Like protein-coding genes, miRNAs also
could be subject to genetic and epigenetic alterations, leading to
“gain” and “loss” of functions and consequently to cell cycle
deregulation. Calin et al. [20] were the first who associated the
miRNA alteration with malignant tumors. Further studies strongly
demonstrated the association of miRNAs with solid and hemato-
logical cancers, and that miRNA profiling represented better classi-
fiers than mRNA profiling [21–23]. Moreover, many following
studies showed that miRNAs are involved in all cancer hallmarks,
a summary of these being recently reported by Berindan-Neagoe
et al. [24].
MiRNAs can function as oncogenes (oncomiRs or onco-
miRNAs) or tumor-suppressor genes (TS-miRNAs). When func-
tion as oncogenes, onco-miRNAs negatively regulate the expres-
sion of tumor suppressor genes, while the role of TS-miRNAs is to
regulate the expression of proto-oncogenes. Generally, the altera-
tions of miRNAs expression in cancer are related to an increase of
oncomiR expression and a decreasing of TS-miRNAs, when com-
pared to normal cells.
MiR21 and miR155 are two examples of miRNAs identified in
many tumors. MiR21, one of the most oncogenic miRNAs, was
firstly identified in glioblastoma [25] and breast cancer [26], being
then associated with many other tumors [27] including prostate
cancer [28]. There are about 30 tumor suppressor genes experi-
mentally validated, such as phosphatase and tensin homolog
(PTEN), B-cell lymphoma protein 2 (BCL2), tropomyosin
1 (TPM1), tumor protein 63 (TP63), and programmed cell death
4 (PDCD4), to be downregulated by miR21 [29].Another impor-
tant oncomiR identified both in hematological and solid tumors is
miR-155. Part of its target genes are common with them of miR21
and include PTEN [30], BCL2 [31], or PDCD4 [32], as well as
B-cell CLL/lymphoma 6 (BCL6), suppressor of cytokine signaling
1 (SOCS1) and suppressor of cytokine signaling (SOCS6) [33]
respectively ANX7 in prostate cancer [34]. As a consequence of
their overexpression, miR21 and miR-155 lead to tumor cell pro-
liferation and survival.
When deleted or inactivated, TS-miRNAs do not function
anymore as suppressors of oncogenes, leading to overexpression
of the oncogenes, meaning an increase in cell proliferation and
survival. Croce’s lab identified the first cluster of TS-miRNAs
(mir-15a/miR-16-1), in B cell chronic lymphocytic leukemia
(B-CLL), by association with 13q14.3 region deletion [20]. They
demonstrated that both mir15 and miR16 were deleted or down-
regulated in the majority of CLL patients. Moreover, they identi-
fied arginyl-tRNA synthetase gene (RARS) as a putative target of
 MicroRNAs Role in Prostate Cancer 107

miR15 and miR16. Further studies demonstrated that mirR-15

family is involved in the regulation of post-natal mitotic arrest of
cardiomyocytes, by modulating checkpoint kinase 1 (Check1) gene
[35]. Mir34a is another TS-miRNA, with essential role in cancer
development, progression, and metastasis, by targeting different
transcription factors such as TWIST1, SLUG and ZEB1/2,
involved in the induction of epithelial to mesenchymal (EMT)
transition [36]. Moreover, the lack of miR34a expression was
related to increased stem cell properties and doxorubicin resistance
[37]. In prostate cancer, miR-34a was associated to chemo resis-
tance. MiR-143 represents another important TS-miRNA asso-
ciated with carcinogenesis and tumor progression. Part of
mir-143 targets involved in tumor cells proliferation and migration
include MAPK7, KRAS, and ERK proto-oncogenes [38, 39]. In
prostate cancer, when overexpressed, mir-143 inhibits cell migra-
tion and invasion by inhibiting matrix metalloproteinase 13
(MMP-13) [40].

3 miRNAs Role in Prostate Cancer

Performing a large-scale miRnome analysis using a large collection

of samples, including prostate cancers, Volinia et al. [41] demon-
strated for the first time an association of miRNAs with prostate
cancer. Using a gradual selection algorithm, they identified at least
50 miRNAs signature for each tumor type when compared to their
normal tissues, and a 21 miRNAs common solid cancer signature.
At least 12 miRNAs such as miR-21, miR-191, miR-17-5p,
miR-223, and miR-25 were overexpressed in prostate cancer.
Immediately afterwards, further studies confirmed the role of miR-
NAs as new biomarkers for prostate cancer.
Another important aspect was the discovery that miRNAs are
very stable in serum and plasma, regardless of storage conditions or
applying more freeze-thawing cycles. Mitchell et al. [42] were the
first who reported high stability of different circulating miRNAs,
associated with prostate cancer, and that high serum/plasma levels
of miR-141 can discriminate advanced prostate cancer from healthy
persons. Moreover, taking into account that PCA3 is a successful
FDA-approved urinary marker, urine was also investigated for
miRNA detection. Bryant et al. [43] were among the first who
identified alteration of urinary miRNAs expression in prostate can-
cer when compared with benign hyperplasia, opening the way to
investigate urine as an important biological fluid for mRNA bio-
marker discovery.
Currently, there is no doubt that miRNAs represent a new class
of biomarkers useful for diagnosis and prognosis of prostate cancer
and these aspects will be discussed in the following sections.
108 Ovidiu Balacescu et al.

Prostate cancer is an androgen-dependent disease, as androgen

receptors (AR) have an important role in developing of prostate
cancer. Previous studies have investigated the modulating role of
AR for miRNA alteration in prostate cancer. Massillo C et al. [44]
integrated in a very useful and comprehensive paper the majority of
miRNAs modulated by AR which are involved in prostate cancer
development and metastasis. Some of the miRNAs modulated by
androgen receptors are represented by oncomiRs such as miR-21,
miR-141, miR-135a or miR-27a or miR-32. By inhibiting of their
specific targets, these miRNAs lead to tumor cell proliferation [45],
migration and invasion [46], and decrease in and blocking of
apoptosis [47].

3.1 miRNAs in It has been shown that expression profiles for miRNAs differ
Prostate Cancer and between normal and tumor tissue [48], and the expression pattern
Normal Tissue is tissue specific. Moreover, miRNA profiles in cancer tissue have
been used to predict prognosis and are correlated with tumor
characteristics in several cancers, including prostate cancer
[49]. MiRNA expression studies on prostate cancer cell lines and
tumor tissues have evidenced the involvement of several miRNAs in
proliferation, invasion and metastasis, and the understanding of
these roles and the interactions with their specific targets is an
essential aspect for elucidating the carcinogenic process in prostate
cancer [50]. Moreover, several differentially expressed miRNAs
detected in prostate cancer tissues are considered good biomarkers
that could be used for the diagnosis, prognosis, and molecular
classification of prostate cancer [51].
Prostate cancer consists of a heterogeneous group of malignant
tumors among which the overwhelming majority is adenocarci-
noma originating from the glands and ducts in the prostate, grow-
ing multifocally in the prostate and rarely producing macroscopic
tumor nodules.
It is well known that full length messenger RNAs have a short
half-life leading to a high degree of preanalytical variability in
biological samples. By contrast, miRNA was shown to be stable in
serum, plasma, and other biological fluids and can be reliably
detected in archival FFPE samples that are over 10 years old
[42, 52]. Similarly, to the transcriptome analysis, several analytical
platforms can be used for miRNA profiling. However, when ana-
lyzing challenging biological specimens such as biological fluids
and FFPE samples, the preferred method is QRT-PCR due to its
increased specificity and sensitivity [53].
The analysis of microRNAs in prostate tissue is rather straight-
forward and has been routinely done on fresh tissue. However,
because the more available starting material is usually tissue
formalin-fixed and paraffin-embedded (FFPE), there have been
several efforts over the years to establish if this tissue preservation
is amenable for microRNA expression analysis. A recent extensive
 MicroRNAs Role in Prostate Cancer 109

up-to-date review has outlined the efforts to analyze microRNAs in

both fresh and FFPE prostate tissue as biomarkers for recurrence,
revealing the limited consistency among studies, mainly due to the
differences in study design, analytical platform and methods used,
and limited power, concluding that further larger and better
designed studies are needed to assess the real value of miRNAs as
biomarkers of recurrence in prostate cancer [54].
An early study of 14 miRNAs in matched fresh frozen and
FFPE prostate cancer reported that the analysis by RT-PCR is
feasible in FFPE specimens, at least for some miRNAs [55]. How-
ever, a very recent study reported that the stability of certain
miRNAs is clearly decreasing with the age of prostate FFPE sam-
ples, showing that some miRNAs were more stable than others over
time [56]. This difference is probably due to the difference in CG
content, as concluded by another recent report on the subject
[57]. In addition to RT-PCR, other methods were used to analyze
the feasibility of miRNAs study in FFPE samples. Good correlation
between miRNAs expression in FFPE and matched fresh frozen
tissue was found by microarray analysis [58], and deep sequencing
by NGS [59]. In addition, an optimized protocol for cDNA library
preparation for miRNAs analysis by NGS was also recently pub-
lished [60]. A multiplatform analysis of miRNA expression in
matched fresh frozen and FFPE tissue using three different micro-
array platforms, a digital counting assay and an NGS platform
showed high reproducibility and similar detection of miRNAs pat-
terns across the different platforms [61].
Prostate cancer tissue heterogeneity and the limited amount of
material from prostate biopsies are major limiting factors when
analyzing transcriptome levels. Laser-capture microdissection
(LCM) facilitates the analysis of enriched homogenous cell popula-
tions from the heterogeneous prostate tissue, thus mitigating these
limitations. Recent advances in the field have proved that this
technology is feasible in analyzing transcripts in FFPE prostate
tissue, a protocol on the matter being published [62].
The first study to compare RNA expression of LCM enriched
cells from archived biopsy and fresh prostate cancer tissue from the
same subject, which also examined miRNA expression, has shown
that this approach is quite feasible showing high correlation of the
FFPE to the frozen tissue [63]. In addition, our preliminary data
has also proved that LCM is a useful tool for analyzing miRNA
expression in cancer cells, including archived FFPE prostate cancer
tissue [64, 65].
Regardless of the type of tissue, fresh frozen or FFPE archived,
when analyzing miRNAs expression by RT-PCR, the need of using
a housekeeping gene for data normalization is essential, as in any
gene expression data analysis. There is an ongoing debate in the
scientific environment regarding to the most suitable normalizer to
be used when it comes to miRNA analysis, especially since the usual
110 Ovidiu Balacescu et al.

housekeeping genes such as GAPDH or beta actin are not suitable

when analyzing RNA extracted from FFPE tissue which could be of
poor quality. Several candidates have been proposed over time and
are widely used, mainly small nuclear RNAs such as U6, RNU44,
RNU48, RNU24, and others. A study comparing the stability of
seven candidate control genes in FFPE prostate cancer and adjacent
normal tissue, has revealed that RNU24 was the most suitable
endogenous control to be used [66].
The above-presented data underscores the feasibility of current
technologies for miRNA analysis and their importance in prostate
cancer biology. Moreover, elucidating the specific alteration of
miRNA expression and how to modulate it in prostate tissue will
open new avenues for developing therapeutic strategies for prostate
cancer treatment.

3.2 miRNAs in Data supporting the use of blood circulating miRNAs as biomar-
Biological Fluids of kers of diseases are still emerging. Mitchell et al. isolated and
Prostate Cancer compared the serum levels of a set of miRNAs between prostate
Patients cancer patients and normal controls, showing that miRNAs could
detect individuals with cancer with 60% sensitivity and 100% speci-
ficity; this being the first report of miRNAs in biological fluids as
biomarkers for prostate cancer [42]. Concomitantly, Chen et al.
also identified specific serum miRNAs expression patterns for lung
cancer, colorectal cancer and diabetes, suggesting that blood-based
miRNA biomarkers can be used for the detection of human cancers
and other diseases [67]. Subsequently, numerous studies have
shown the use of circulating miRNAs as cancer biomarkers for
several cancer sites. Relevant data exists regarding the detection of
miRNAs in many other types of biological fluids including urine,
and their use as biomarkers for different diseases [68]. Numerous
studies have investigated miRNAs in urine in relation to other
pathologic conditions, including for prostate cancer [43].
Regarding the study of miRNAs in biological fluids from pros-
tate cancer patients, the great majority of them investigated free
circulating miRNAs in serum or plasma. There is great heterogene-
ity among studies regarding both the number of individual miR-
NAs investigated as a panel and which specific candidate miRNAs
were selected to be studied. Although blood derived fluids such as
serum and plasma are mostly used as a source of cell free miRNA in
biomarker studies, there are several studies that used urine as
biological sample to evaluate microRNAs as biomarkers for PCa
diagnosis, prognosis, and treatment response. We have recently
performed an extensive review of urinary miRNA studies in pros-
tate cancer, reporting that there is a high degree of inconsistency
among studies due to several analytical aspects, starting with differ-
ent urinary fractions used for analysis and continuing with the
employment of various analytical platforms and methods of statisti-
cal analysis, and therefore future larger prospective studies,
 MicroRNAs Role in Prostate Cancer 111

preferably using standardized protocols for analysis, are needed.

Despite all these limitations, a few microRNAs were found to be
dysregulated in the urine of PCa patients, which alone or together
with serum prostate-specific antigen seem to improve diagnostic
power even in the gray zone of PCa [69].
Interestingly enough, although the existence or prostasomes
(microvesicles secreted by prostate cells including prostate cancer
cells) is known for years and they were studied as a source of
biomarkers for prostate cancer, only very recently it has been
described that these vesicles also contain RNA including noncoding
RNAs that could be used as biomarkers in prostate cancer [70, 71].
Prostate-derived exosomes have been reported in urine of prostate
cancer patients and are enriched after digital rectal examination of
the prostate [72, 73]. A recent study has identified miR-196a-5p
and miR-501-3p to be promising biomarkers in the exosomes from
urine of prostate cancer patients, by performing RNA-seq of exo-
somal RNA [74].
It is recognized that both free circulating miRNAs that are
released from disintegrated tumor cells as well as miRNAs
encapsulated in exosomes secreted by tumor cells during tumor-
igenesis exist in biological fluids; however, very few studies investi-
gated both in the same subjects [75]. One recent study showed that
there is a clear advantage in determining exosome miRNAs due to
their greater abundance in serum and saliva [76]; however, this
contradicts two previous studies that claimed the opposite (i.e.,
that free floating miRNAs are more abundant in biological fluids)
[77, 78].
Recent emerging data regarding molecular markers for prostate
cancer suggests that a combination of circulating (serum or plasma)
and urinary markers analyzed together significantly outperforms
the classical markers such as PSA and PCA3, as well as the analysis
of only circulating or only urinary markers [79]. Furthermore,
there is evidence suggestive that urinary molecular markers such
as DNA methylation and RNA-based transcript expression markers
show greater sensitivity for prostate cancer detection compared to
circulation, and therefore should not be overlooked when research-
ing for prostate cancer specific markers in biological fluids [80].

4 Role of MicroRNAs in Personalized Medicine in Prostate Cancer

There are many proposed targets for precision medicine and among
these targets, the miRNAs could play an essential role in revolutio-
nizing cancer prevention and management. In the last years, the
personalized pharmacotherapy played a central role in clinical
oncology and different biomarkers help the advancement of this
field. Recent studies indicated that the miRNAs can be detected in a
wide variety of human biologic specimens including blood, serum,
112 Ovidiu Balacescu et al.

and tissues, as described above, making them clinically useful bio-

markers of disease. In fact, it has been shown that miRNAs could be
used as therapeutic targets in different cancer types, including
prostate cancer, playing an important role in improving diagnosis
and prognosis types, including prostate cancer, playing an impor-
tant role in improving diagnosis and prognosis [81, 82].
The miRNAs have the potential to be clinically useful as pre-
dictors of response to personalized cancer therapy and as predictors
of prognosis. The MiRNAs signatures specific to each tumor could
be useful in monitoring the response to different therapies and in
checking for tumor recurrence [82]. As presented in the previous
sections, many miRNAs were found upregulated or downregu-
lated, acting as oncogenes or tumor suppressor genes, in different
tumors, and their expression is associated with the tumor behavior,
important for predicting prognosis [83].
Numerous studies have shown that the transcriptional repres-
sion of miRNAs is the result of corresponding promoter hyper-
methylation and this is commonly observed in many tumor types
[84]. In fact, a comprehensive analysis of the epigenetic regulation
of miRNAs in cancer revealed 122 miRNAs epigenetically regulated
in 23 cancer types. These miRNA genes silenced by aberrant
hypermethylation in human tumors (oncomiRs), have shown a
higher methylation frequency than the protein coding genes.
More than half of these miRNAs represented cancer-specific bio-
markers, being present in only one cancer type [85]. These findings
suggest that cancer-specific miRNA epigenetic signatures could be
the targets for new therapeutic strategies in cancer, with important
role in precision oncology.
Furthermore, given that selected dietary factors, including
alcohol, influence DNA methylation of numerous genes in human
tumors, it has been proposed that epigenetic changes related to
cancer development could be modified by specific food compo-
nents, with potential great impact for the personalized-cancer ther-
apy [86, 87].

4.1 Challenges of Despite the promising results of numerous studies showing the
miRNAs Use in potential value of miRNAs’ clinical use as biomarkers of early
Precision Medicine detection and prognosis, there are some challenges that would
need to be addressed before these markers would become available
in clinical practice. Some miRNAs have been found to have oppos-
ing functions, such as tumor suppression and tumor promotion,
resulting in different phenotypes. For example, the loss of
miR-15a/miR-16-1 expression, observed in CLLs patients with
13q deletion, leads to higher levels of the antiapoptotic proteins
BCL2 and myeloid cell leukemia sequence 1 (BCL2-related)
(MCL1), but also to higher levels of the tumor suppressor protein
TP53 [88].
 MicroRNAs Role in Prostate Cancer 113

This finding raises the question of how to achieve a specific

miRNA-targeted therapy and avoid adverse side effects. Another
issue that is not clearly understood is the amount of miRNA
expression that would be needed to be changed to achieve the
wanted cellular response. If there is no adequate variation, that
may lead to insufficient antitumor response. On the other hand, if
excess modulation in the miRNA expression is achieved that may
result in unintended consequences, especially when one miRNA
could influence many genes.
Other issues that need to be addressed in developing of the
personalized miRNA-targeted cancer therapy, refer to the preferred
route of drug administration and duration of action. Furthermore,
once these issues are addressed, more research could reveal if
miRNA therapy is most beneficial as a single treatment option or
if overall prognosis improves, when it is used in combination with
conventional cancer therapy.

References
1. Society AC (2015) Global cancer facts & fig-
ures, 3rd edn. American Cancer Society,
Atlanta
2. Cary KC, Cooperberg MR (2013) Biomarkers
in prostate cancer surveillance and screening:
past, present, and future. Ther Adv Urol 5
(6):318–329
3. Payne H, Cornford P (2011) Prostate-specific
antigen: an evolving role in diagnosis, monitor-
ing, and treatment evaluation in prostate can-
cer. Urol Oncol 29(6):593–601
4. Pienta KJ (2009) Critical appraisal of prostate-
specific antigen in prostate cancer screening:
20 years later. Urology 73(5 Suppl):S11–S20
5. Parekh N, Lin Y, Marcella S, Kant AK, Lu-Yao
G (2008) Associations of lifestyle and physio-
logic factors with prostate-specific antigen con-
centrations: evidence from the National Health
and Nutrition Examination Survey
(2001–2004). Cancer Epidemiol Biomark
Prev 17(9):2467–2472
6. Wolf AM, Wender RC, Etzioni RB, Thompson
IM, D’Amico AV, Volk RJ, Brooks DD,
Dash C, Guessous I, Andrews K et al (2010)
American Cancer Society guideline for the
early detection of prostate cancer: update
2010. CA Cancer J Clin 60(2):70–98
7. Filella X, Foj L, Mila M, Auge JM, Molina R,
Jimenez W (2013) PCA3 in the detection and
management of early prostate cancer. Tumour
Biol 34(3):1337–1347
8. Pepe P, Aragona F (2011) PCA3 score vs PSA
free/total accuracy in prostate cancer diagnosis
at repeat saturation biopsy. Anticancer Res 31
(12):4445–4449
9. Lander ES, Linton LM, Birren B, Nusbaum C,
Zody MC, Baldwin J, Devon K, Dewar K,
Doyle M, FitzHugh W et al (2001) Initial
sequencing and analysis of the human genome.
Nature 409(6822):860–921
10. Robinson VL (2009) Rethinking the central
dogma: noncoding RNAs are biologically rele-
vant. Urol Oncol 27(3):304–306
11. Pennisi E (2012) Genomics. ENCODE project
writes eulogy for junk DNA. Science 337
(6099):1159–1161
12. Lewis BP, Burge CB, Bartel DP (2005) Con-
served seed pairing, often flanked by adeno-
sines, indicates that thousands of human
genes are microRNA targets. Cell 120
(1):15–20
13. Griffiths-Jones S (2004) The microRNA regis-
try. Nucleic Acids Res 32(Database issue):
D109–D111
14. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek
SH, Kim VN (2004) MicroRNA genes are
transcribed by RNA polymerase II. EMBO J
23(20):4051–4060
15. Borchert GM, Lanier W, Davidson BL (2006)
RNA polymerase III transcribes human micro-
RNAs. Nat Struct Mol Biol 13
(12):1097–1101
16. Kim VN (2005) MicroRNA biogenesis: coor-
dinated cropping and dicing. Nat Rev Mol Cell
Biol 6(5):376–385
17. Meister G (2013) Argonaute proteins: func-
tional insights and emerging roles. Nat Rev
Genet 14(7):447–459
114 Ovidiu Balacescu et al.
18. Wong NW, Chen Y, Chen S, Wang X (2017)
OncomiR: an online resource for exploring
pan-cancer microRNA dysregulation. Bioinfor-
matics 34(4):713–715
19. Willis RE (2012) Human gene control by vital
oncogenes: revisiting a theoretical model and
its implications for targeted cancer therapy. Int
J Mol Sci 13(1):316–335
20. Calin GA, Dumitru CD, Shimizu M, Bichi R,
Zupo S, Noch E, Aldler H, Rattan S,
Keating M, Rai K et al (2002) Frequent dele-
tions and down-regulation of micro-RNA
genes miR15 and miR16 at 13q14 in chronic
lymphocytic leukemia. Proc Natl Acad Sci U S
A 99(24):15524–15529
21. Calin GA, Liu CG, Sevignani C, Ferracin M,
Felli N, Dumitru CD, Shimizu M, Cimmino A,
Zupo S, Dono M et al (2004) MicroRNA
profiling reveals distinct signatures in B cell
chronic lymphocytic leukemias. Proc Natl
Acad Sci U S A 101(32):11755–11760
22. Lu J, Getz G, Miska EA, Alvarez-Saavedra E,
Lamb J, Peck D, Sweet-Cordero A, Ebert BL,
Mak RH, Ferrando AA et al (2005) MicroRNA
expression profiles classify human cancers.
Nature 435(7043):834–838
23. Mihailovich M, Bremang M, Spadotto V,
Musiani D, Vitale E, Varano G, Zambelli F,
Mancuso FM, Cairns DA, Pavesi G et al
(2015) miR-17-92 fine-tunes MYC expression
and function to ensure optimal B cell lym-
phoma growth. Nat Commun 6:8725
24. Berindan-Neagoe I, Monroig Pdel C,
Pasculli B, Calin GA (2014) MicroRNAome
genome: a treasure for cancer diagnosis and
therapy. CA Cancer J Clin 64(5):311–336
25. Chan JA, Krichevsky AM, Kosik KS (2005)
MicroRNA-21 is an antiapoptotic factor in
human glioblastoma cells. Cancer Res 65
(14):6029–6033
26. Iorio MV, Ferracin M, Liu CG, Veronese A,
Spizzo R, Sabbioni S, Magri E, Pedriali M,
Fabbri M, Campiglio M et al (2005) Micro-
RNA gene expression deregulation in human
breast cancer. Cancer Res 65(16):7065–7070
27. Pfeffer SR, Yang CH, Pfeffer LM (2015) The
role of miR-21 in cancer. Drug Dev Res 76
(6):270–277
28. Yang Y, Guo JX, Shao ZQ (2017) miR-21
targets and inhibits tumor suppressor gene
PTEN to promote prostate cancer cell prolifer-
ation and invasion: an experimental study.
Asian Pac J Trop Med 10(1):87–91
29. Buscaglia LE, Li Y (2011) Apoptosis and the
target genes of microRNA-21. Chin J Cancer
30(6):371–380
30. Xu L, Leng H, Shi X, Ji J, Fu J (2017) MiR-155
promotes cell proliferation and inhibits apo-
ptosis by PTEN signaling pathway in the psori-
asis. Biomed Pharmacother 90:524–530
31. Willimott S, Wagner SD (2012) miR-125b and
miR-155 contribute to BCL2 repression and
proliferation in response to CD40 ligand
(CD154) in human leukemic B-cells. J Biol
Chem 287(4):2608–2617
32. Liu F, Song D, Wu Y, Liu X, Zhu J, Tang Y
(2017) MiR-155 inhibits proliferation and
invasion by directly targeting PDCD4 in
non-small cell lung cancer. Thorac Cancer 8
(6):613–619
33. Xue X, Liu Y, Wang Y, Meng M, Wang K,
Zang X, Zhao S, Sun X, Cui L, Pan L et al
(2016) MiR-21 and MiR-155 promote
non-small cell lung cancer progression by
downregulating SOCS1, SOCS6, and PTEN.
Oncotarget 7(51):84508–84519
34. Cai ZK, Chen Q, Chen YB, Gu M, Zheng DC,
Zhou J, Wang Z (2015) microRNA-155 pro-
motes the proliferation of prostate cancer cells
by targeting annexin 7. Mol Med Rep 11
(1):533–538
35. Porrello ER, Johnson BA, Aurora AB,
Simpson E, Nam YJ, Matkovich SJ, Dorn GW
2nd, van Rooij E, Olson EN (2011) MiR-15
family regulates postnatal mitotic arrest of car-
diomyocytes. Circ Res 109(6):670–679
36. Imani S, Wei C, Cheng J, Khan MA, Fu S,
Yang L, Tania M, Zhang X, Xiao X, Fu J
(2017) MicroRNA-34a targets epithelial to
mesenchymal transition-inducing transcription
factors (EMT-TFs) and inhibits breast cancer
cell migration and invasion. Oncotarget 8
(13):21362–21379
37. Park EY, Chang E, Lee EJ, Lee HW, Kang HG,
Chun KH, Woo YM, Kong HK, Ko JY, Suzuki
H et al (2014) Targeting of miR34a-
NOTCH1 axis reduced breast cancer stemness
and chemoresistance. Cancer Res 74
(24):7573–7582
38. Dong X, Lv B, Li Y, Cheng Q, Su C, Yin G
(2017) MiR-143 regulates the proliferation
and migration of osteosarcoma cells through
targeting MAPK7. Arch Biochem Biophys
630:47–53
39. Pekow J, Meckel K, Dougherty U, Butun F,
Mustafi R, Lim J, Crofton C, Chen X,
Joseph L, Bissonnette M (2015) Tumor sup-
pressors miR-143 and miR-145 and predicted
target proteins API5, ERK5, K-RAS, and
IRS-1 are differentially expressed in proximal
and distal colon. Am J Physiol Gastrointest
Liver Physiol 308(3):G179–G187

40. Wu D, Huang P, Wang L, Zhou Y, Pan H, Qu
P (2013) MicroRNA-143 inhibits cell migra-
tion and invasion by targeting matrix metallo-
proteinase 13 in prostate cancer. Mol Med Rep
8(2):626–630
41. Volinia S, Calin GA, Liu CG, Ambs S,
Cimmino A, Petrocca F, Visone R, Iorio M,
Roldo C, Ferracin M et al (2006) A microRNA
expression signature of human solid tumors
defines cancer gene targets. Proc Natl Acad
Sci U S A 103(7):2257–2261
42. Mitchell PS, Parkin RK, Kroh EM, Fritz BR,
Wyman SK, Pogosova-Agadjanyan EL,
Peterson A, Noteboom J, O’Briant KC, Allen
A et al (2008) Circulating microRNAs as stable
blood-based markers for cancer detection. Proc
Natl Acad Sci U S A 105(30):10513–10518
43. Bryant RJ, Pawlowski T, Catto JW, Marsden G,
Vessella RL, Rhees B, Kuslich C, Visakorpi T,
Hamdy FC (2012) Changes in circulating
microRNA levels associated with prostate can-
cer. Br J Cancer 106(4):768–774
44. Massillo C, Dalton GN, Farre PL, De Luca P,
De Siervi A (2017) Implications of microRNA
dysregulation in the development of prostate
cancer. Reproduction 154(4):R81–R97
45. Wan X, Huang W, Yang S, Zhang Y, Zhang P,
Kong Z, Li T, Wu H, Jing F, Li Y (2016)
Androgen-induced miR-27A acted as a tumor
suppressor by targeting MAP2K4 and
mediated prostate cancer progression. Int J
Biochem Cell Biol 79:249–260
46. Kroiss A, Vincent S, Decaussin-Petrucci M,
Meugnier E, Viallet J, Ruffion A, Chalmel F,
Samarut J, Allioli N (2015) Androgen-
regulated microRNA-135a decreases prostate
cancer cell migration and invasion through
downregulating ROCK1 and ROCK2. Onco-
gene 34(22):2846–2855
47. Jalava SE, Urbanucci A, Latonen L, Waltering
KK, Sahu B, Janne OA, Seppala J,
Lahdesmaki H, Tammela TL, Visakorpi T
(2012) Androgen-regulated miR-32 targets
BTG2 and is overexpressed in castration-
resistant prostate cancer. Oncogene 31
(41):4460–4471
48. Calin GA, Croce CM (2006) MicroRNA sig-
natures in human cancers. Nat Rev Cancer 6
(11):857–866
49. Hassan O, Ahmad A, Sethi S, Sarkar FH
(2012) Recent updates on the role of micro-
RNAs in prostate cancer. J Hematol Oncol 5:9
50. Lu Z, Liu M, Stribinskis V, Klinge CM, Ramos
KS, Colburn NH, Li Y (2008) MicroRNA-21
promotes cell transformation by targeting the
programmed cell death 4 gene. Oncogene 27
(31):4373–4379
MicroRNAs Role in Prostate Cancer 115
51. Porkka KP, Pfeiffer MJ, Waltering KK, Vessella
RL, Tammela TL, Visakorpi T (2007) Micro-
RNA expression profiling in prostate cancer.
Cancer Res 67(13):6130–6135
52. Siebolts U, Varnholt H, Drebber U, Dienes
HP, Wickenhauser C, Odenthal M (2009) Tis-
sues from routine pathology archives are suit-
able for microRNA analyses by quantitative
PCR. J Clin Pathol 62(1):84–88
53. Kong W, Zhao JJ, He L, Cheng JQ (2009)
Strategies for profiling microRNA expression.
J Cell Physiol 218(1):22–25
54. Zhao Z, Stephan C, Weickmann S, Jung M,
Kristiansen G, Jung K (2017) Tissue-based
MicroRNAs as predictors of biochemical recur-
rence after radical prostatectomy: what can we
learn from past studies? Int J Mol Sci 18(10):
E2023
55. Leite KR, Canavez JM, Reis ST, Tomiyama
AH, Piantino CB, Sanudo A, Camara-Lopes
LH, Srougi M (2011) miRNA analysis of pros-
tate cancer by quantitative real time PCR: com-
parison between formalin-fixed paraffin
embedded and fresh-frozen tissue. Urol
Oncol 29(5):533–537
56. Peskoe SB, Barber JR, Zheng Q, Meeker AK,
De Marzo AM, Platz EA, Lupold SE (2017)
Differential long-term stability of microRNAs
and RNU6B snRNA in 12–20 year old
archived formalin-fixed paraffin-embedded
specimens. BMC Cancer 17(1):32
57. Kakimoto Y, Tanaka M, Kamiguchi H,
Ochiai E, Osawa M (2016) MicroRNA stability
in FFPE tissue samples: dependence on GC
content. PLoS One 11(9):e0163125
58. Zhang X, Chen J, Radcliffe T, Lebrun DP,
Tron VA, Feilotter H (2008) An array-based
analysis of microRNA expression comparing
matched frozen and formalin-fixed paraffin-
embedded human tissue samples. J Mol
Diagn 10(6):513–519
59. Meng W, McElroy JP, Volinia S, Palatini J,
Warner S, Ayers LW, Palanichamy K,
Chakravarti A, Lautenschlaeger T (2013)
Comparison of microRNA deep sequencing
of matched formalin-fixed paraffin-embedded
and fresh frozen cancer tissues. PLoS One 8(5):
e64393
60. Loudig O, Wang T, Ye K, Lin J, Wang Y,
Ramnauth A, Liu C, Stark A, Chitale D, Green-
lee R et al (2017) Evaluation and adaptation of
a laboratory-based cDNA library preparation
protocol for retrospective sequencing of
archived MicroRNAs from up to 35-year-old
clinical FFPE specimens. Int J Mol Sci 18(3):
E627
116 Ovidiu Balacescu et al.
61. Kolbert CP, Feddersen RM, Rakhshan F, Grill
DE, Simon G, Middha S, Jang JS, Simon V,
Schultz DA, Zschunke M et al (2013) Multi-
platform analysis of microRNA expression
measurements in RNA from fresh frozen and
FFPE tissues. PLoS One 8(1):e52517
62. Joseph A, Gnanapragasam VJ (2011) Laser-
capture microdissection and transcriptional
profiling in archival FFPE tissue in prostate
cancer. Methods Mol Biol 755:291–300
63. Nonn L, Vaishnav A, Gallagher L, Gann PH
(2010) mRNA and micro-RNA expression
analysis in laser-capture microdissected pros-
tate biopsies: valuable tool for risk assessment
and prevention trials. Exp Mol Pathol 88
(1):45–51
64. Seclaman E, Narita D, Anghel A, Cireap N,
Ilina R, Sirbu IO, Marian C (2017) MicroRNA
expression in laser micro-dissected breast can-
cer tissue samples—a pilot study. Pathol Oncol
Res
65. Mihala A, Alexa AA, Samoila C, Dema A, Vizi-
tiu AC, Anghel A, Tamas L, Marian CV, Sirbu
IO (2015) A pilot study on the expression of
microRNAs resident on chromosome 21 in
laser microdissected FFPE prostate adenocarci-
noma samples. Romanian J Morphol Embryol
56(3):1063–1068
66. Carlsson J, Helenius G, Karlsson M,
Lubovac Z, Andren O, Olsson B, Klinga-
Levan K (2010) Validation of suitable endoge-
nous control genes for expression studies of
miRNA in prostate cancer tissues. Cancer
Genet Cytogenet 202(2):71–75
67. Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K,
Guo J, Zhang Y, Chen J, Guo X et al (2008)
Characterization of microRNAs in serum: a
novel class of biomarkers for diagnosis of can-
cer and other diseases. Cell Res 18
(10):997–1006
68. Weber JA, Baxter DH, Zhang S, Huang DY,
Huang KH, Lee MJ, Galas DJ, Wang K (2010)
The microRNA spectrum in 12 body fluids.
Clin Chem 56(11):1733–1741
69. Balacescu O, Petrut B, Tudoran O, Feflea D,
Balacescu L, Anghel A, Sirbu IO, Seclaman E,
Marian C (2017) Urinary microRNAs for pros-
tate cancer diagnosis, prognosis, and treatment
response: are we there yet? Wiley Interdiscip
Rev RNA 8(6)
70. Aalberts M, Stout TA, Stoorvogel W (2014)
Prostasomes: extracellular vesicles from the
prostate. Reproduction 147(1):R1–R14
71. Zijlstra C, Stoorvogel W (2016) Prostasomes
as a source of diagnostic biomarkers for pros-
tate cancer. J Clin Invest 126(4):1144–1151
72. Fendler A, Stephan C, Yousef GM,
Kristiansen G, Jung K (2016) The translational
potential of microRNAs as biofluid markers of
urological tumours. Nat Rev Urol 13
(12):734–752
73. Dijkstra S, Birker IL, Smit FP, Leyten GH, de
Reijke TM, van Oort IM, Mulders PF, Jannink
SA, Schalken JA (2014) Prostate cancer bio-
marker profiles in urinary sediments and exo-
somes. J Urol 191(4):1132–1138
74. Rodriguez M, Bajo-Santos C, Hessvik NP,
Lorenz S, Fromm B, Berge V, Sandvig K,
Line A, Llorente A (2017) Identification of
non-invasive miRNAs biomarkers for prostate
cancer by deep sequencing analysis of urinary
exosomes. Mol Cancer 16(1):156
75. Chen X, Liang H, Zhang J, Zen K, Zhang CY
(2012) Horizontal transfer of microRNAs:
molecular mechanisms and clinical applica-
tions. Protein Cell 3(1):28–37
76. Gallo A, Tandon M, Alevizos I, Illei GG
(2012) The majority of microRNAs detectable
in serum and saliva is concentrated in exo-
somes. PLoS One 7(3):e30679
77. Turchinovich A, Weiz L, Langheinz A, Bur-
winkel B (2011) Characterization of extracel-
lular circulating microRNA. Nucleic Acids Res
39(16):7223–7233
78. Arroyo JD, Chevillet JR, Kroh EM, Ruf IK,
Pritchard CC, Gibson DF, Mitchell PS, Ben-
nett CF, Pogosova-Agadjanyan EL, Stirewalt
DL et al (2011) Argonaute2 complexes carry
a population of circulating microRNAs inde-
pendent of vesicles in human plasma. Proc
Natl Acad Sci U S A 108(12):5003–5008
79. Prior C, Guillen-Grima F, Robles JE, Rosell D,
Fernandez-Montero JM, Agirre X, Catena R,
Calvo A (2010) Use of a combination of bio-
markers in serum and urine to improve detec-
tion of prostate cancer. World J Urol 28
(6):681–686
80. Roobol MJ, Haese A, Bjartell A (2011)
Tumour markers in prostate cancer III: bio-
markers in urine. Acta Oncol 50(Suppl
1):85–89
81. Sethi S, Kong D, Land S, Dyson G, Sakr WA,
Sarkar FH (2013) Comprehensive molecular
oncogenomic profiling and miRNA analysis of
prostate cancer. Am J Transl Res 5(2):200–211
82. Sethi S, Ali S, Kong D, Philip PA, Sarkar FH
(2013) Clinical implication of microRNAs in
molecular pathology. Clin Lab Med 33
(4):773–786
83. Sethi S, Ali S, Sarkar FH (2014) MicroRNAs in
personalized cancer therapy. Clin Genet 86
(1):68–73

84. Lopez-Serra P, Esteller M (2012) DNA
methylation-associated silencing of tumor-
suppressor microRNAs in cancer. Oncogene
31(13):1609–1622
85. Kunej T, Godnic I, Ferdin J, Horvat S, Dovc P,
Calin GA (2011) Epigenetic regulation of
microRNAs in cancer: an integrated review of
literature. Mutat Res 717(1–2):77–84
86. Hardy TM, Tollefsbol TO (2011) Epigenetic
diet: impact on the epigenome and cancer.
Epigenomics 3(4):503–518
87. Miozzo M, Vaira V, Sirchia SM (2015) Epige-
netic alterations in cancer and personalized
MicroRNAs Role in Prostate Cancer 117
cancer treatment. Future Oncol 11
(2):333–348
88. Fabbri M, Bottoni A, Shimizu M, Spizzo R,
Nicoloso MS, Rossi S, Barbarotto E,
Cimmino A, Adair B, Wojcik SE, Valeri N,
Calore F, Sampath D, Fanini F, Vannini I,
Musuraca G, Dell’Aquila M, Alder H, Davuluri
RV, Rassenti LZ, Negrini M, Nakamura T,
Amadori D, Kay NE, Rai KR, Keating MJ,
Kipps TJ, Calin GA, Croce CM (2011) Associa-
tion of a microRNA/TP53 feedback circuitry
with pathogenesis and outcome of B-cell chronic
lymphocytic leukemia. JAMA 305(1):59–67
 Part II

Contributing Environmental Factors to Epigenetic Changes

Leading to Cancer Development
 Chapter 7

Effects of Dietary Nutrients on Epigenetic Changes

in Cancer
Nicoleta Andreescu, Maria Puiu, and Mihai Niculescu

Abstract
Gene–nutrient interactions are important contributors to health management and disease prevention.
Nutrition can alter gene expression, as well as the susceptibility to disease, including cancer, through
epigenetic changes. Nutrients can influence the epigenetic status through several mechanisms, such as
DNA methylation, histone modifications, and miRNA-dependent gene silencing. These alterations were
associated with either increased or decreased risk for cancer development. There is convincing evidence
indicating that several foods have protective roles in cancer prevention, by inhibiting tumor progression
directly or through modifying tumor’s microenvironment that leads to hostile conditions favorable to
tumor initiation or growth. While nutritional intakes from foods cannot be adequately controlled for
dosage, the role of nutrients in the epigenetics of cancer has led to more research aimed at developing
nutriceuticals and drugs as cancer therapies. Clinical studies are needed to evaluate the optimum doses of
dietary compounds, the safety profile of dosages, to establish the most efficient way of administration, and
bioavailability, in order to maximize the beneficial effects already discovered, and to ensure replicability.
Thus, nutrition represents a promising tool to be used not only in cancer prevention, but hopefully also in
cancer treatment.

Key words Epigenetics, Nutrition, Nutriepigenomics, Cancer, Epigenetic diet

1 Introduction

Gene–nutrient interactions are important contributors to health

management and disease prevention. While nutrigenomics and
nutrigenetics investigate the relationship between genetic varia-
tions and nutrient requirements [1], nutrient-driven epigenetic
alterations have been recently proposed as other major contributors
that can influence such requirements. Nutrition can alter gene
expression, as well as the susceptibility to disease, including cancer,
through epigenetic changes [2–5]. During the last decade it has
become clearer that nutrition can exert imprinting effects on the
human genome, with many studies indicating that early life

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_7,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

121
122 Nicoleta Andreescu et al.

nutrition could influence the risk of developing chronic diseases in

adulthood [6, 7].
In regard to the role of nutrition in cancer development exist-
ing evidence suggests that some dietary components can impact
cancer-related epigenetic mechanisms, such as those involved in the
activation of tumor suppressor genes, cellular apoptosis, protein
translation, and noncoding microRNAs (miRNAs) with roles in
mRNA stability and translation [2, 8–13].
Few examples include nutrients such as genistein, resveratrol,
polyphenols, and different types of fatty acids. These nutrients,
with positive effects on health, are continuously studied in order
to establish their epigenetic role as protective factors against cancer,
cardiovascular disease, obesity, etc.
It has been more than three decades since it was suggested that
diet might be responsible for almost 30% the cancers diagnosed in
the USA [14, 15]. There are several studies indicating that fruits,
tea, vegetables, as well as various dietary compounds, can alter the
activation of tumor suppressor genes, increase apoptosis, and the
activity of cell survival proteins, thus having a protective role against
cancer [16, 17].

2 Nutrition and Cancer

Nutrients can influence the epigenetic status through several

mechanisms, such as DNA methylation, histone modifications,
and miRNA-dependent gene silencing. These alterations were asso-
ciated with either increased or decreased risk for cancer develop-
ment [15, 18, 19]. The American Institute for Cancer Research and
the World Cancer Research Fund estimated that, through an appro-
priate diet, regular physical activity and maintaining a normal body
weight, approximately 30–40% of all cancers can be prevented,
while the percent can be higher for specific cancer types [20].
Diets that would decrease the risk for cancer were proposed
based on epidemiological studies that evaluated the cancer risk
correlated with food intakes. Such diets should include an adequate
calorie count, daily fruit and vegetables intakes, no refined sugar
and flour, no red meat, low fat foods but which have essential fatty
acids with a balanced ratio of omega-3 and omega-6 such as flax
seed, antioxidants and phytochemicals (α-carotene, β-carotene,
β-cryptoxanthin), chlorophyll, and adequate vitamin intakes that
can also be achieved by supplementation with selenium, methylco-
balamin (B-12), folic acid, vitamin D, probiotics, and
enzymes [21].
Apart from the influence of nutrient intakes, the contamination
of food with carcinogenic agents was also studied. The grains and
peanuts can be contaminated with Aflatoxin B produced by Asper-
gillus, and it is associated with increased risk for liver cancer. Some
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 123

carcinogenic compounds are formed during food preparation

[20]. Meat cooked at high temperatures, grilled (broiled) or bar-
becued (charbroiled) over a direct flame, can contain heterocyclic
amines and polycyclic aromatic hydrocarbons. Environmental pol-
lution was also associated with foods contaminated with polycyclic
aromatic hydrocarbons. Meat and fish preserved with salt or other
preservatives, smoked or dried, can contain N-nitroso compounds,
which were associated with an increased risk for stomach and colon
cancer [20].

3 Nutrition and Cancer Epigenetics

DNA methylation patterns can be altered globally (throughout the

entire genome) or at specific sites [22–25]. The DNA methylation
mechanisms depend on the availability of methyl-donors, such as
those provided by the one-carbon cycle, as well as on cofactors that
modulate the enzymatic activity of DNA methyltransferases
(DNMTs) [22].
S-Aenosylmethionine (SAM) is the only known physiological
donor of methyl groups, allowing their transfer to cytosine (which
becomes methylated, 5mC) [26]. SAM is synthesized, via methio-
nine, from different dietary precursors (folate, choline, and beta-
ine), using homocysteine as methylation substrate [27]. It was
reported that the reduced availability of methyl donors resulted in
low SAM synthesis, which resulted in DNA methylation alterations
(either hypermethylation or hypomethylation, depending on the
tissue type and developmental stage), while increased availability of
methyl donors was usually associated with DNA hypermethylation
[28, 29]. DNA hypermethylation can result in the transcriptional
silencing of tumor suppressor genes, causing their inactivation and,
subsequently, malignant transformation for several cancer types,
while DNA hypomethylation is involved in the activation of
proto-oncogenes [30].
DNA hypomethylation was associated with increased risk for
many types of cancers including chronic lymphocytic leukemia,
breast and ovarian cancer, prostate cancer, and liver cancer
[31–33]. The hypomethylation of intragenic regions and repetitive
sequences was proved to be causal for genome instability due to
DNA breakage, and to induce loss of imprinting for some promo-
ters, thus increasing the risk for cancer development [34]. Apart
from the role in cancer initiation, DNA hypomethylation in cancer
cells was suggested to indicate poor prognosis for specific types of
ovarian cancer [31, 33].
DNA hypermethylation of promoters can lead to gene silenc-
ing, frequently found in different types of cancer [35]. For instance
hypermethylation of genes such as p16, p15, Rb, p14, BRCA1,
MGMT, estrogen receptor (ER) alpha, progesterone receptor
124 Nicoleta Andreescu et al.

(PR), and E-cadherin was reported in different cancers [36]. Con-

sequently, DNA hypomethylating agents are successfully used in
cancer therapy [35, 37].
The role of nutrition in maintaining the methylation status, and
its potential role in cancer promotion, was demonstrated in indivi-
duals who underwent the Dutch Hunger Winter (1944–1945). It
was found that severe famine in childhood and adolescence resulted
in significant modifications of the methylation status for several
cancer-related genes, and it was associated with a lower risk for
colorectal cancer [38, 39]. In addition, it was reported that perina-
tal maternal undernutrition was correlated with lower methylation
status of the insulin-like growth factor 2 (IGF2), as compared with
a control group unexposed to famine during the same perinatal
period [40]. As such, early nutritional exposures during fetal devel-
opment can permanently alter the DNA methylation pattern of an
individual, leading to modifications that could be related with an
increased risk for plurifactorial diseases [34].

3.1 Nutrients The availability of nutrients such as folate, methionine, cobalamin,

and DNA Methylation pyridoxine, and riboflavin, involved in the one-carbon metabolism,
in Cancer was associated with cancer-related alterations of DNA methylation.
The role of folate is still controversial, as various epidemiological
3.1.1 One-Carbon studies suggested opposite effects. However, it should be noted
Metabolism Nutrients that such effects were reported in relationship with different types
of cancer. Most studies suggested that increased dietary availability
of folate can modulate the DNA methylation status and thus, have
anticarcinogenic effects [41, 42]. Conversely, low folate intakes
were associated with increased risk for cancer development through
DNA damage, abnormal methylation and inhibition of DNA
methyltransferases (DNMTs) [43–45]. Folic acid supplementation
was associated with a reduction in cervical dysplasia and decreased
risk for cervical cancer in patients using contraceptives
[46]. Another study indicated that low intakes of methionine,
pyridoxine, cobalamin, niacin, and riboflavin was associated with
an increased risk for breast cancer, while supplementation with
folate would reduce the breast cancer risk in premenopausal
women, especially for estrogen receptor (ER)-negative cancers
[47, 48]. Riboflavin acts as a cofactor for methylenetetrahydrofo-
late reductase (MTHFR), which converts 5,10-MTHF to
5-MTHF. If this enzyme activity is inhibited, a diminished methio-
nine synthesis will occur, and subsequently a reduction of DNA
methylation reactions [49, 50]. However, not all cases of folate
supplementation proved to be beneficial for cancer reduction. Die-
tary supplementation with folic acid (5 mg) and vitamin B12
(1.25 mg) was associated with an increased risk for the misincor-
poration of uracil into DNA, followed by alterations in promoter
methylation in the rectal mucosa of patients with previously diag-
nosed colorectal adenomas [51, 52].
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 125

Pyridoxine is a cofactor for the serine hydroxymethyltransferase

involved in 5,10-MTHF synthesis and plays an important role in
glutathione synthesis from homocysteine [48, 53]. Low levels of
pyridoxine are responsible for the inhibition of DNMT activity,
leading to DNA hypomethylation and an increased risk for cancer
development [48, 54].

3.1.2 Phytoestrogens Phytoestrogens, such as resveratrol and genistein, interact with estro-
gen receptors and regulate estrogen-responsive genes [55]. Genistein
(40 ,5,7-trihydroxyisoflavone) is one of the polyphenols from soybean,
which was demonstrated in vitro to inhibit the epigenetic mechan-
isms responsible for the proliferation of esophageal squamous carci-
noma cells and prostate cancer cells, and subsequently to inhibit cell
proliferation and angiogenesis, doubled by an increased apoptosis
and cell cycle arrest [56]. Genistein decreased promoter methylation
in renal carcinoma cell lines and prostate cancer cells, having compa-
rable results with 5-aza-cytidine [11]. Phytoestrogens can also stim-
ulate p21 promoter and suppress transcriptional activity of AP-1
acting as an antagonist of ERs or inducing PTEN expression [57].

3.1.3 Bioflavonoids Bioflavonoids (such as quercetin), tea catechins [epigallocatechin-3-

gallate (EGCG)] and coffee polyphenols (caffeic acid, chlorogenic
acid) have inhibitory effects on DNA methylation and the activity of
DNMTs [32]. A high intake of chlorogenic acid was associated with
elevated concentrations of homocysteine, probably due to its inhibi-
tory role upon DNA methylation reactions [58]. The tea catechins
and bioflavonoids have also been reported to inhibit DNA methyl-
transferase activity by interfering with the substrates for the methyl-
ation reactions mediated by catechol-O-methyltransferase (COMT).
EGCG can exert a dual inhibitory effect on DNMT-mediated DNA
methylation and methyltransferase activity by increasing SAH in the
reaction catalyzed by COMT [50].

3.1.4 Curcumin Curcumin is a polyphenol found abundantly in turmeric and, to a

lesser extent, in ginger. Curcumin was reported to have anti-
inflammatory, antioxidant, antiangiogenic, and anti-cancer proper-
ties [59, 60]. The epigenetic mechanisms, studied in vitro, con-
sisted of the inhibition of DNMT activity and thus inducing DNA
hypomethylation, as shown in leukemia cells [61].

3.1.5 Lycopene Lycopene is a phytochemical found mostly in tomatoes and other

red fruits and vegetables, such as red carrots, watermelons, gac, and
papayas [62]. It is a terpenoid involved in the DNA hypomethyla-
tion of glutathione S transferase P1 (in mammary neoplasms) as
well as in altering the gene expression of RARβ2 and hairpin
induced 1 genes in noncancer cells [34]. Lycopene’s mechanism
of action is not yet clearly understood and more research is needed
for discovering its ability to alter DNA methylation status [34].
126 Nicoleta Andreescu et al.

3.2 Nutrients Many nutrients have also roles in altering the epigenetic marks on
and Histone histones, such as acetylation, deacetylation, and methylation, with
Modifications impact on cancer initiation and development [63]. Histones play an
in Cancer important role in the regulation of chromatin structure and gene
expression. Aberrant histone modifications, as a result of alterations
induced in the enzymes’ activity controlling these processes, were
linked to cancer [64]. Histone acetylation is necessary for opening
the chromatin to the action of transcription factors [65]. Alterations
in histone acetylation, as well as in histone phosphorylation, have
been reported in different cancers such as breast, prostate, and
colorectal cancer [66]. In vitro and in vivo studies indicated the
role of nutrients in the epigenetic modifications of histones, specifi-
cally in the inhibition of histone acetyl transferases, histone deace-
tylation and demethylation [67–70].
Because the acetylation–deacetylation balance for histones is
maintained by the interplay between histone acetyltransferases
(HATs) and histone deacetylases (HDACs), alterations in the activ-
ity (or protein expression) of these enzymes have a direct impact on
the epigenetic status of histones, with potential consequences in
cancer development [5]. As such an increased activity of HDACs
was reported in many cancers, with consequences upon cell-cycle
kinetics and apoptosis [71]. Several dietary components, such as
sulforaphane and epigallocatechin-3-gallate (EGCG), were
reported to inhibit the HDAC activity and might be used for
preventing carcinogenesis as well as for cancer therapy [2, 34].
Several natural compounds were reported to initiate changes in
the epigenetic status of histones.
1. Organosulfur compounds (such as diallyl disulfide in garlic, or
sulforaphane in cruciferous vegetables) inhibit HDAC activity,
with consequences upon gene expression, having a potential
tumor suppression effect [72, 73]. Diallyl disulfide is a com-
petitive HDAC inhibitor that induces histone hyperacetylation,
and increases p21 expression in colon cancer cells [73]. Sulfo-
raphane was reported to increase histone acetylation [74].
2. Sodium butyrate, a derivative of a short-chain fatty acid, and
luteolin, a flavonoid found in high concentrations in parsley,
thyme, peppermint, basil herb, celery, and artichoke, inhibit
HDACs and increase histone acetylation, resulting in the inhi-
bition of cancer cell growth, survival, and invasion [75].
3. Genistein was found to increase histone acetylation (HAT) and
HAT activity, while curcumin inhibits the activity of different
HDACs, suppresses cell proliferation, and induces apoptosis in
cancer cells [11, 76]. Curcumin’s activity is correlated with the
availability of reactive oxygen species because it was reported
that its effects were reduced when the availability of antioxidant
enzymes diminishes [77].
4. Resveratrol and quercetin activate protein deacetylase sirtuin
1 (SIRT1) which, in turn, contributes to the maintenance of an
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 127

inactive chromatin state, and thus alter gene transcription

[78]. Resveratrol was also reported to inhibit the expression
of oncogenic miRNAs, and to induce the expression of tumor
suppressor miRNAs [79].
5. Vitamin D is also involved in both histone modifications and
the regulation of noncoding RNAs. Supplementation with
vitamin D3 was reported to increase the expression of antipro-
liferative target genes and apoptosis, and induced inhibition of
proliferation in prostate cancer cells [80].
6. EGCG was found to alter histone acetylation and methylation
and also to act as a HDAC inhibitor in tumor cells [81, 82]. In
skin cancer, it was shown that EGCG also had an effect on
histone acetylation, methylation, and ubiquitination, while in
lung cancer was reported that EGCG can modify histone
phosphorylation [80].

3.3 Role of Nutrients Small noncoding RNAs, including microRNA (miRNA), small-
on Small Noncoding interfering RNA (siRNA), piwi-interacting RNA (piRNA), and
RNAs in Cancer small nucleolar RNA, are involved in the regulation of gene expres-
sion. These noncoding RNA species influence heterochromatin
formation, DNA methylation, and inhibit transcription or transla-
tion in up to 30% of the total genes and about 60% of genes that are
coding for proteins [82–84].
MiRNAs were described to impact mostly posttranscriptional
mechanisms. Studies indicated that altered miRNA expression was
correlated with the onset of different types of cancers, and that
miRNA profiles can be also used as a prognosis factor in malignan-
cies [18, 85]. The link between miRNA, nutrition and cancer was
hypothesized when it was reported that Western diets represent a
risk factor for colon cancer [86]. Western diets induced changes in
miRNA expression, hypothesized to represent the underlying
mechanism for cancer development. Conversely, Mediterranean
diets were reported to reduce the risk for cancer development, as
well as to have direct benefits toward reducing the severity of
hypertension [86].
A recent study indicated that carbohydrate intake, nonsteroidal
anti-inflammatory drug administration, and a diet with high doses
of antioxidants and lower in pro-oxidant factors can induce altera-
tions in miRNA expression in tumor tissues as compared with
nontumor tissues [87].

3.3.1 Natural An example of how nutrients can impact the expression of miRNAs
Compounds That Can in cancer, is the influence of folic acid (apart from its role in DNA
Influence miRNA methylation) upon miRNA expression [52, 88]. If the folate intake
Expression is adequate, some miRNA alterations (e.g., miRNA-122, specifi-
cally higher in hepatocarcinoma cells) can be prevented [89]. Wang
et al. reported that folate supplementation had a protective role,
128 Nicoleta Andreescu et al.

against the teratogenic effects of alcohol exposure, as miRNA-10a

expression induced by alcohol was inhibited by consequent folic
acid administration [90].
Curcumin also showed protection against cancer, by increasing
the expression of tumor suppressor miRNA-22, and by decreasing
the expression of the oncogenic miRNA-199a [18, 91–93]. In
addition, curcumin influences the expression of miR-15a and
miR-16 species in breast and prostate cancer cells [92, 94].
There is evidence that genistein can induce downregulation of
the oncogenic miRNA-27a in melanoma cells, with subsequent
inhibition of cell proliferation [91, 92, 95]. Genistein was found
to upregulate the tumor suppressor miRNA-1296 in prostate can-
cer cells, thereby decreasing the expression of MCM2 gene, which
is responsible for carcinogenesis [91].

4 Protective Role or Cancer Contributor?

There are over 25,000 different bioactives identified in various diets

[93, 96]. Different nutrients (around 500) were associated with an
increased risk for cancer development, while others were consid-
ered to have protective roles against carcinogenesis [97, 98].

4.1 Nutrients There is convincing evidence indicating that several foods (Table 1)
with Protective Roles have protective roles in cancer prevention, by inhibiting tumor
progression directly or through modifying tumor’s microenviron-
ment that conducts to hostile conditions favorable to tumor initia-
tion or growth [99].
Maybe the best studied mechanism for cancer development is
the DNA damage induced by free radicals [100]. Various nutrients
act upon the enzymatic systems that neutralize such radicals, and
thereby reducing the carcinogenetic potential, and also increasing
the excretion of carcinogens [101, 102].
Fruits and vegetables contain isothiocyanates and other phyto-
chemicals that can inhibit carcinogenesis by reducing the DNA
damage, and which are proposed to be used as an efficient first-line
defense against cancer [99]. Phytochemicals can increase cancer cell
apoptosis and thus act as inhibitory agents against tumor growth. As
such, phenethyl isothiocyanate, curcumin and resveratrol are good
proapoptotic candidates against tumor proliferation [99].
Several other phytochemicals have antiangiogenic activity that
can explain their chemo protective role. EGCG, at low concentra-
tions, has an inhibitory effect on vascular endothelial growth factor
receptor-2 [103, 104], while at high doses of EGCG administrated
orally, it induced a sustained inhibition of prostate cancer growth,
being associated with increased survival rate in animal models
[99]. In humans, the anticancer effect of EGCG was demonstrated
in chronic lymphocytic leukemia patients, who exhibited favorable
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 129

Table 1
Effect of various nutrients in preventing cancer, according to American Institute
for Cancer Research [20]

Nutrient Evidence Effect Site of cancer

Nonstarchy vegetables Probable Decreased risk of cancer Mouth, pharynx, larynx,
esophagus stomach
Allium vegetables (fresh) Probable Decreased risk of cancer Stomach
Garlic (fresh) Probable Decreased risk of cancer Colorectum
Fruits (fresh) Probable Decreased risk of cancer Mouth, pharynx, larynx,
esophagus, lung stomach
Foods containing folate Probable Decreased risk of cancer Pancreas, lung
Foods containing carotenoids Probable Decreased risk of cancer Mouth, pharynx, larynx
Foods containing beta-carotene Probable Decreased risk of cancer Esophagus
Foods (fruits and vegetables) Probable Decreased risk of cancer Prostate
containing lycopene
Foods containing vitamin C2 Probable Decreased risk of cancer Esophagus
Foods containing selenium Probable Decreased risk of cancer Prostate

objective clinical responses to EGCG administration [105]. Other

compounds that act on vascular endothelial growth factor receptor-
2 and inhibit angiogenesis include ellagic acid and delphinidin
[106, 107].
Outside epigenetic mechanisms, several phytochemicals such as
curcumin, EGCG, and resveratrol, were associated with anti-
inflammatory effects, which reduce the expression of COX-2 by
inhibiting the activity of the nuclear factor-κB transcription
factor [99].

5 Food Contamination and Cancer

Besides nutrients, foods also contain added ingredients, or contam-

ination compounds. The heat treatment of foods can also generate
various molecular species, some of them being associated with an
increased cancer risk (Table 2). These compounds, alone or in
association with other environmental triggers, can modify the epi-
genome, with consequences upon human health [108].
Red meat consumption was associated with an increased risk for
colon cancer [109]. There are studies indicating a link between
heme iron and red meat, and colon cancer risk [110]. It was
reported that heme iron in combinaton with nitrite or alone were
related to intestinal cancer [110, 111]. In animal models, it was
observed that heme was involved in the N-nitroso compounds
130 Nicoleta Andreescu et al.

Table 2
Nutrients associated with increased risk for cancer development according to American Institute for
Cancer Research [20]

Nutrient Evidence Effect Site of cancer

Red meat Convincing Increased risk of cancer Colorectum
Processed meat Convincing Increased risk of cancer Colorectum
Arsenic in drinking water Convincing Increased risk of cancer Lung
Alcoholic drinks Convincing Increased risk of cancer Mouth, pharynx,
and larynx, esophagus,
colorectum (men),
breast (premenopause
and postmenopause)
Beta-carotene supplements Convincing Increased risk of cancer Lung
Cantonese-style salted fish Probable Increased risk of cancer Nasopharynx
Diets high in calcium Probable Increased risk of cancer Prostate
Salt Probable Increased risk of cancer Stomach
Salted and salty foods Probable Increased risk of cancer Stomach
Arsenic in drinking water Probable Increased risk of cancer Skin
Maté Probable Increased risk of cancer Esophagus
Alcoholic drinks Probable Increased risk of cancer Liver, colorectum
(women)
Milk Probable Decreased risk of cancer Colorectum
Calcium supplements (200 μg/day) Probable Decreased risk of cancer Colorectum
Selenium supplements (200 μg/day) Probable Decreased risk of cancer Prostate

formation, which induced lipid oxidation, with increased cell pro-

liferation of mucosal cells [110, 112, 113].
Heterocyclic amines (HCAs), produced during cooking, were
associated with a potential risk for cancer development and it was
recommended to reduce their formation by avoiding the exposure
of meat surfaces to flames [114].
Fruits and vegetables are considered to have protective roles
against cancer development, but residues of biocides found in
tomatoes and peppers were associated with increased risk of malig-
nancies. An example is the increased risk for thyroid neoplasia
associated with the exposure to neurotoxic chemicals which may
enhance the risk for cancer onset [115].
Among mycotoxins, aflatoxin B1 (AFB1) induced hepatic carci-
nomas in several animal models, while fumonisin B1 was found to
induce cancer in rats [114]. The mushroom Agaricus bisporus contains
agaritine (β-N-[γ-l(+)-glutamyl]-4-hydroxymethylphenylhydrazine)
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 131

that is metabolized into carcinogenic products in mice [114].

Other mushrooms such as Cortinellus shiitake and Gyromitra escu-
lenta also contain carcinogenic hydrazine derivatives with carcinoge-
netic effects.
While the potential anticancer role of genistein was suggested
in several studies, in azoxymethane-induced colon cancer it was
reported that genistein had a procancer effect [114].
Different cooked products contain polycyclic aromatic hydro-
carbons (PAHs): broiled steak, charred parts of biscuits [114].
PAHs were also found in roasted coffee while in brewed coffee
exposed to atmospheric oxygen, hydrogen peroxide was identified
[114]. The same contamination was found in instant coffee, where
it was observed that hydrogen peroxide is produced after dissolving
in hot water. Hydrogen peroxide together with methylglyoxal
(from instant coffee), have a synergistic effect and may induce
mutagenesis [114].

6 Methods Used in Nutrigenomics and Nutriepigenomics

Today, the concept of personalized nutrition is a major focus of

scientific research and public health policy, with the hope that it will
allow practitioners to better tailor individual nutrition require-
ments [116]. There is evidence indicating that genetic variants
can influence the metabolism of nutrients, and that different health
outcomes can be achieved using same nutritional intakes in people
with different genotypes [117]. The new technologies allowing for
epigenetic or epigenomic evaluation include high-throughput
“omics” technologies such as genomics, transcriptomics, proteo-
mics, metabolomics, and epigenomics.
Genomic methods (e.g., RT-PCR, next-generation sequenc-
ing, pyrosequencing) can also identify epigenetic modifications
[118]. Transcriptomic methods (microarrays and real time
RT-PCR) are used for the evaluation of gene expression
(mRNAs), as a result of alterations in DNA methylation, or to
evaluate the expression of noncoding RNAs. Proteomics (e.g.,
protein sequencing, DNA–protein interactions at binding sites)
allows for evaluating specific proteins, or protein structures and
the interaction between proteins and other structures (proteins or
DNA). Metabolomics evaluates known metabolites, but can be also
used to identify unknown metabolites.
Histone modifications can be evaluated by using antibodies
against specific proteins or for protein modifications (in this case
for methylated and acetylated histones). There are several techni-
ques that allow the evaluation of posttranslational modifications of
histones: western blot (WB), immunohistochemistry (IHC),
immunocytochemistry (ICC), and ELISA. Other methods allow
for the protein quantitation using colorimetric or fluorometric
132 Nicoleta Andreescu et al.

platforms. Currently the most utilized method is chromatin immu-

noprecipitation (ChIP) that uses antibodies to isolate the protein
modification of interest, together with any bound DNA.
DNA methylation can be analyzed by using several techniques
for gene-specific analysis (qualitative and quantitative), and also for
the evaluation of global methylation patterns and genome wide
scans (arrays). Bisulfite pyrosequencing is used for the quantitation
of DNA methylation. It is site-specific and generates data as meth-
ylation percentage of a single-stranded sequences. Methylation-
specific PCR (MSP) and real-time PCR are easily accessible, but
have low precision, and do not provide single site resolution. For
genome-wide scans the most frequently used are microarrays (such
as Illumina Infinium for DNA methylation using bisulfite treated
DNA, or Nimblegen arrays) and next generation sequencing plat-
forms (Illumina, IonTorrent, TruSeq DNA Methylation; Agilent,
SureSelect Methyl-Seq).

7 Nutritional Epigenetics and the Development of Nutriceuticals and Drugs

for Cancer Treatment

While nutritional intakes from foods cannot be adequately con-

trolled for dosage, the role of nutrients in the epigenetics of cancer
has led to more research aimed at developing nutriceuticals and
drugs as cancer therapies.
Currently only a few nucleoside inhibitors (azacytidine and
decitabine), which have demonstrated anticancer properties in ani-
mal models and humans and are approved by the FDA, are used as
treatment for specific forms of cancer. The major problem for
developing efficient therapeutics with nucleoside inhibition effects,
is the toxicity of the drugs [119]. On the other hand, flavonoids
and other natural compounds such as vitamin C are under study as
they demonstrated DNA methyltransferase inhibition, via direct
inhibitory effects or through indirect mechanisms [120]. Flavo-
noids and their derivatives are already considered and extensively
studied as potential alternative compounds for the prevention and
treatment of cancer [121].
It is also hoped that nutrients that induce histone modifications
could be used for targeting genes that code for the proteins
involved in cell cycle regulation, proliferation, metabolism, and
signal transduction [52]. While drugs acting as DNMT and
HDAC inhibitors are needed in high doses, it is hoped that such
nutrients would be effective at low concentrations [52].
Short chain fatty acids, such as sodium butyrate and valproate,
act as histone deacetylase inhibitors (HDACi) [119]. Others are
histone deacetylase inhibitors isolated from natural sources or
extracted from plants [116]. Similar to Vorinostat, Romidepsin, a
natural product obtained from Chromobacterium violaceum, is a
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer 133

HDACi approved by FDA as therapeutics in cutaneous T cell

lymphoma [122–124]. Other HDACi, belinostat and panobino-
stat, were recently approved by the FDA to be used in the treatment
of relapsed or refractory peripheral T cell lymphoma, respectively
for the treatment of recurrent multiple myeloma [125, 126].
Because HDACi are associated with challenging adverse events,
there is intensive search for novel epigenetic drugs as well as for
innocuous phytochemicals including flavonoids as alternatives to
already developed drugs [127].

8 Implications for the Future

Several nutrients have showed interesting potential for cancer pre-

vention and may be used for the dietary management in cancer, along
with established medication [2]. Foods, apart from their content in
fiber, vitamins, and minerals, also contain bioactive compounds
(polyphenols, genistein, curcumin, resveratrol, sulforaphane, iso-
thiocyanates, silymarin, diallyl sulfide, lycopene, rosmarinic acid,
apigenin, and gingerol) with potential anticancer activity, and
which modify the epigenetic status [2]. Dietary components can
have a synergistic effect with traditional chemotherapy, in the pre-
vention of chemotherapy resistance, in reducing the adverse effects of
drugs, and in enhancing the response to chemotherapeutics [128].
The increasing knowledge of the epigenetic modifications
induced by nutrition in cancer is necessary for the understanding
of epigenetic mechanisms that will allow developing novel thera-
peutics and strategies for preventing cancer. Clinical studies are
needed to evaluate the optimum doses of dietary compounds, the
safety profile of dosages, to establish the most efficient way of
administration, and bioavailability, in order to maximize the bene-
ficial effects already discovered, and to ensure replicability. For sure,
nutrition represents a promising tool to be used not only in cancer
prevention but hopefully also in cancer treatment.

Acknowledgments

The work was funded, in part, by POSCCE Project ID: 1854, cod
SMIS: 48749, contract 677/09.04.2015, and by POC Project
Nutrigen, SMIS: 104852, contract 91/09.09.2016, ID P_37-684.

References
1. Kussmann M, Fay LB (2008) Nutrigenomics
and personalized nutrition: science and con-
cept. Pers Med 5(5):447–455
2. Meeran SM, Ahmed A, Tollefsbol TO (2010)
Epigenetic targets of bioactive dietary
components for cancer prevention and ther-
apy. Clin Epigenetics 1(3–4):101–116
3. Issa JP (2008) Cancer prevention: epigenetics
steps up to the plate. Cancer Prev Res (Phila
Pa) 1(4):219–222
134 Nicoleta Andreescu et al.
4. Suter MA, Aagaard-Tillery KM (2009) Envi-
ronmental influences on epigenetic profiles.
Semin Reprod Med 27(5):380–390
5. Herceg Z (2009) Epigenetics and cancer:
towards an evaluation of the impact of envi-
ronmental and dietary factors. Mutagenesis
22(2):91–103
6. Junien C (2006) Impact of diets and nutri-
ents/drugs on early epigenetic programming.
J Inherit Metab Dis 29(2–3):359–365
7. Dolinoy DC, Weidman JR, Jirtle RL (2007)
Epigenetic gene regulation: linking early
developmental environment to adult disease.
Reprod Toxicol 23(3):297–307
8. Landis-Piwowar KR, Milacic V, Dou QP
(2008) Relationship between the methylation
status of dietary flavonoids and their growth-
inhibitory and apoptosis-inducing activities in
human cancer cells. J Cell Biochem 105
(2):514–523
9. Li Y, Tollefsbol TO (2010) Impact on DNA
methylation in cancer prevention and therapy
by bioactive dietary components. Curr Med
Chem 17(20):2141–2151
10. Paluszczak J, Krajka-Kuźniak V, Baer-
Dubowska W (2010) The effect of dietary
polyphenols on the epigenetic regulation of
gene expression in MCF7 breast cancer cells.
Toxicol Lett 192(2):119–125
11. Majid S, Kikuno N, Nelles J, Noonan E,
Tanaka Y, Kawamoto K, Hirata H, Li LC,
Zhao H, Okino ST, Place RF, Pookot D,
Dahiya R (2008) Genistein induces the
p21WAF1/CIP1 and p16INK4a tumor sup-
pressor genes in prostate cancer cells by epige-
netic mechanisms involving active chromatin
modification. Cancer Res 68(8):2736–2734
12. Esteller M (2007) Cancer epigenomics: DNA
methylomes and histone-modification maps.
Nat Rev Genet 8(4):286–298
13. Ducasse M, Brown MA (2006) Epigenetic
aberrations and cancer. Mol Cancer 5:60
14. Doll R, Peto R (1981) The causes of cancer:
quantitative estimates of avoidable risks of
cancer in the United States today. J Natl Can-
cer Inst 66(6):1191–1308
15. Lundstrom K (2014) Nutritional influence on
epigenetics and disease. Austin Publ Group,
New Jersey 1(3):1014
16. Li Y, Tollefsbol TO (2011) p16(INK4a) sup-
pression by glucose restriction contributes to
human cellular lifespan extension through
SIRT1-mediated epigenetic and genetic
mechanisms. PLoS One 6(2):e17421
17. Meeran SM, Patel SN, Tollefsbol TO (2010)
Sulforaphane causes epigenetic repression of
hTERT expression in human breast cancer cell
lines. PLoS One 5(7):e11457
18. Ross SA, Davis CD (2011) MicroRNA, nutri-
tion, and cancer prevention. Adv Nutr 2
(6):472–485
19. Ong TP, Moreno FS, Ross SA (2011) Target-
ing the epigenome with bioactive food com-
ponents for cancer prevention. J Nutrigenet
Nutrigenomics 4(5):275–292
20. World Cancer Research Fund/American
Institute for Cancer Research (2007) Food,
nutrition, physical activity, and the prevention
of cancer: a global perspective. RR Donnelley,
Illinois
21. Donaldson MS (2004) Nutrition and cancer:
a review of the evidence for an anti-cancer
diet. Nutr J 3(1):19 Available from: http://
nutritionj.biomedcentral.com/articles/10.
1186/1475-2891-3-19
22. Zhang N (2015) Epigenetic modulation of
DNA methylation by nutrition and its
mechanisms in animals. Anim Nutr 1
(3):144–151
23. Altmann S, Murani E, Schwerin M, Metges
CC, Wimmers K, Ponsuksili S (2012) Somatic
cytochrome c (CYCS) gene expression and
promoter-specific DNA methylation in a por-
cine model of prenatal exposure to maternal
dietary protein excess and restriction. Br J
Nutr 107(6):791–799
24. Dudley KJ, Sloboda DM, Connor KL,
Beltrand J, Vickers MH (2011) Offspring of
mothers fed a high fat diet display hepatic cell
cycle inhibition and associated changes in
gene expression and DNA methylation.
PLoS One 6(7):e21662
25. Jousse C, Parry L, Lambert-Langlais S,
Maurin A-C, Averous J, Bruhat A,
Carraro V, Tost J, Letteron P, Chen P,
Jockers R, Launay JM, Mallet J, Fafournoux
P (2011) Perinatal undernutrition affects the
methylation and expression of the leptin gene
in adults: implication for the understanding of
metabolic syndrome. FASEB J 25
(9):3271–3278
26. Feil R, Fraga MF (2012) Epigenetics and the
environment: emerging patterns and implica-
tions. Nat Rev Genet 13(2):97–109
27. Zeisel SH (2009) Epigenetic mechanisms for
nutrition determinants of later health out-
comes. Am J Clin Nutr 89(5):1488S–1493S
28. Cheng X, Blumenthal RM (2008) Mamma-
lian DNA methyltransferases: a structural per-
spective. Structure 16(3):341–350
29. Niculescu MD, Lupu DS (2011) Nutritional
influence on epigenetics and effects on
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer
longevity. Curr Opin Clin Nutr Metab Care
14(1):35–40
30. Wajed SA, Laird PW, DeMeester TR (2001)
DNA methylation: an alternative pathway to
cancer. Ann Surg 234:1):10–1):20
31. Liao Y-P, Chen L-Y, Huang R-L, Su P-H,
Chan MWY, Chang C-C, Yu MH, Wang
PH, Yen MS, Nephew KP, Lai HC (2014)
Hypomethylation signature of tumor-
initiating cells predicts poor prognosis of
ovarian cancer patients. Hum Mol Genet 23
(7):1894–1906
32. Yang X, Yan L, Davidson NE (2001) DNA
methylation in breast cancer. Endocr Relat
Cancer 8(2):115–127
33. Daniel M, Tollefsbol TO (2015) Epigenetic
linkage of aging, cancer and nutrition. J Exp
Biol 218(1):59–70
34. Bishop KS, Ferguson LR (2015) The interac-
tion between epigenetics, nutrition and the
development of cancer. Nutrients 7
(2):922–947
35. Herman JG, Baylin SB (2003) Gene silencing
in cancer in association with promoter hyper-
methylation. N Engl J Med 349
(21):2042–2054
36. Singhal RP, Mays-Hoopes LL, Eichhorn GL
(1987) DNA methylation in aging of mice.
Mech Ageing Dev 41(3):199–210
37. Cheng JC, Matsen CB, Gonzales FA, Ye W,
Greer S, Marquez VE, Jones PA, Selker EU
(2003) Inhibition of DNA methylation and
reactivation of silenced genes by zebularine. J
Natl Cancer Inst 95(5):399–409
38. Hughes LA, van den Brandt PA, de Bruı̈ne
AP, Wouters KAD, Hulsmans S, Spiertz A,
Goldbohm RA, de Goeij AF, Herman JG,
Weijenberg MP, van Engeland M (2009)
Early life exposure to famine and colorectal
cancer risk: a role for epigenetic mechanisms.
PLoS One 4(11):e7951
39. Issa J-P (2004) CpG island methylator phe-
notype in cancer. Nat Rev Cancer 4
(12):988–993
40. Heijmans BT, Tobi EW, Stein AD, Putter H,
Blauw GJ, Susser ES, Slagboom PE, Lumey
LH (2008) Persistent epigenetic differences
associated with prenatal exposure to famine
in humans. Proc Natl Acad Sci U S A 105
(44):17046–17049
41. Pembrey M, Saffery R, Bygren LO (2014)
Human transgenerational responses to early-
life experience: potential impact on develop-
ment, health and biomedical research. J Med
Genet 51:563–572
42. Kyle UG, Pichard C (2006) The Dutch fam-
ine of 1944-1945: a pathophysiological
135
model of long-term consequences of wasting
disease. Curr Opin Clin Nutr Metab Care 9
(4):388–394
43. Lillycrop KA, Burdge GC (2012) Epigenetic
mechanisms linking early nutrition to long
term health. Best Pract Res Clin Endocrinol
Metab 26(5):667–676
44. Teegarden D, Romieu I, Lelièvre SA (2012)
Redefining the impact of nutrition on breast
cancer incidence: is epigenetics involved?
Nutr Res Rev 25(1):68–95
45. Yamaji T, Inoue M, Sasazuki S, Iwasaki M,
Kurahashi N, Shimazu T, Tsugane S, Japan
Public Health Center-based Prospective
Study Group (2008) Fruit and vegetable con-
sumption and squamous cell carcinoma of the
esophagus in Japan: the JPHC study. Int J
Cancer 123(8):1935–1940
46. Whitehead N, Reyner F, Lindenbaum J
(1989) The journal of the American Medical
Association: Megaloblastic changes in cervical
epithelium. Association with oral contracep-
tive therapy and reversal with folic acid. Nutr
Rev 47(10):318–321
47. Shrubsole MJ, Shu XO, Li HL, Cai H,
Yang G, Gao YT, Gao J, Zheng W (2011)
Dietary B vitamin and methionine intakes
and breast cancer risk among Chinese
women. Am J Epidemiol 173
(10):1171–1182
48. Maruti SS, Ulrich CM, White E (2009) Folate
and one-carbon metabolism nutrients from
supplements and diet in relation to breast can-
cer risk. Am J Clin Nutr 89(2):624–633
49. Singh SM, Murphy B, O’Reilly RL (2003)
Involvement of gene-diet/drug interaction
in DNA methylation and its contribution to
complex diseases: from cancer to schizophre-
nia. Clin Genet 64(6):451–460
50. Stefanska B, Karlic H, Varga F, Fabianowska-
Majewska K, Haslberger A (2012) Epigenetic
mechanisms in anti-cancer actions of
bioactive food components—the implications
in cancer prevention. Br J Pharmacol
167:279–297
51. van den Donk M, Pellis L, Crott JW, van
Engeland M, Friederich P, Nagengast FM,
van Bergeijk JD, de Boer SY, Mason JB, Kok
FJ, Keijer J, Kampman E (2007) Folic acid
and vitamin B-12 supplementation does not
favorably influence uracil incorporation and
promoter methylation in rectal mucosa DNA
of subjects with previous colorectal adenomas.
J Nutr 137(9):2114–2120
52. Supic G, Jagodic M, Magic Z (2013) Epige-
netics: a new link between nutrition and can-
cer. Nutr Cancer 65(6):781–792
136 Nicoleta Andreescu et al.
53. Selhub J (2002) Folate, vitamin B12 and vita-
min B6 and one carbon metabolism. J Nutr
Health Aging 6(1):39–42
54. Wei EK, Giovannucci E, Selhub J, Fuchs CS,
Hankinson SE, Ma J (2005) Plasma vitamin
B6 and the risk of colorectal cancer and ade-
noma in women. J Natl Cancer Inst 97
(9):684–692
55. Mandal S, Davie JR (2010) Estrogen regu-
lated expression of the p21 Waf1/Cip1 gene
in estrogen receptor positive human breast
cancer cells. J Cell Physiol 224(1):28–32
56. Fang MZ, Chen D, Sun Y, Jin Z, Christman
JK, Yang CS (2005) Reversal of hypermethy-
lation and reactivation of p16INK4a, RAR-
beta, and MGMT genes by genistein and
other isoflavones from soy. Clin cancer res
off J am Assoc. Cancer Res 11(19 Pt
1):7033–7041
57. Chung J-H, Ostrowski MC, Romigh T,
Minaguchi T, Waite KA, Eng C (2006) The
ERK1/2 pathway modulates nuclear PTEN-
mediated cell cycle arrest by cyclin D1 tran-
scriptional regulation. Hum Mol Genet 15
(17):2553–2559
58. Olthof MR, Hollman PC, Zock PL, Katan
MB (2001) Consumption of high doses of
chlorogenic acid, present in coffee, or of
black tea increases plasma total homocysteine
concentrations in humans. Am J Clin Nutr 73
(3):532–538
59. Goel A, Aggarwal BB (2010) Curcumin, the
golden spice from Indian saffron, is a chemo-
sensitizer and radiosensitizer for tumors and
chemoprotector and radioprotector for nor-
mal organs. Nutr Cancer 62(7):919–930
60. Maheshwari RK, Singh AK, Gaddipati J, Sri-
mal RC (2006) Multiple biological activities
of curcumin: a short review. Life Sci 78
(18):2081–2087
61. Liu Z, Xie Z, Jones W, Pavlovicz RE, Liu S,
Yu J, Li PK, Lin J, Fuchs JR, Marcucci G,
Li C, Chan KK (2009) Curcumin is a potent
DNA hypomethylation agent. Bioorg Med
Chem Lett 19(3):706–709
62. USDA Food Composition Databases [Inter-
net]. Available from: https://ndb.nal.usda.
gov/ndb/nutrients/report/nutrientsfrm?
max¼25&offset¼0&totCount¼0&
nutrient1¼337&nutrient2¼&nutrient3¼&
subset¼0&fg¼&sort¼c&measureby¼m
63. Kouzarides TBS (2007) Chromatin modifica-
tions and their mechanism of action. In: Allis
CD, Jenuwein T, Reinberg D (eds) Epige-
netics. Cold Spring Harbor Press, New York,
pp 191–209
64. Bannister AJ, Kouzarides T (2011) Regula-
tion of chromatin by histone modifications.
Cell Res 21:381–395
65. Su LJ, Mahabir S, Ellison GL, McGuinn LA,
Reid BC (2012) Epigenetic contributions to
the relationship between cancer and dietary
intake of nutrients, bioactive food compo-
nents, and Environmental Toxicants. Front
Genet 2:91 Available from: http://journal.
frontiersin.org/article/10.3389/fgene.
2011.00091/abstract
66. Cohen I, Poreba E, Kamieniarz K, Schneider
R (2011) Histone modifiers in cancer: friends
or foes? Genes Cancer 2(6):631–647
67. Kuroishi T, Rios-Avila L, Pestinger V, Wijer-
atne SSK, Zempleni J (2011) Biotinylation is a
natural, albeit rare, modification of human
histones. Mol Genet Metab 104(4):537–545
68. Morimoto T, Sunagawa Y, Kawamura T,
Takaya T, Wada H, Nagasawa A, Komeda M,
Fujita M, Shimatsu A, Kita T, Hasegawa K
(2008) The dietary compound curcumin inhi-
bits p300 histone acetyltransferase activity and
prevents heart failure in rats. J Clin Invest 118
(3):868–878
69. Boily G, Seifert EL, Bevilacqua L, He XH,
Sabourin G, Estey C, Moffat C, Crawford S,
Saliba S, Jardine K, Xuan J, Evans M, Harper
ME, McBurney MW (2008) SirT1 regulates
energy metabolism and response to caloric
restriction in mice. PLoS One 3(3):e1759
70. Wang J, Hevi S, Kurash JK, Lei H, Gay F,
Bajko J, Su H, Sun W, Chang H, Xu G,
Gaudet F, Li E, Chen T (2009) The lysine
demethylase LSD1 (KDM1) is required for
maintenance of global DNA methylation.
Nat Genet 41(1):125–129
71. Mariadason JM (2009) HDACs and HDAC
inhibitors in colon cancer. Epigenetics 3
(1):28–37
72. Nian H, Delage B, Ho E, Dashwood RH
(2009) Modulation of histone deacetylase
activity by dietary isothiocyanates and allyl
sulfides: studies with sulforaphane and garlic
organosulfur compounds. Environ Mol
Mutagen 50(3):213–221
73. Druesne-Pecollo N, Latino-Martel P (2011)
Modulation of histone acetylation by garlic
sulfur compounds. Anti Cancer Agents Med
Chem 11(3):254–259
74. Dashwood RH, Ho E (2007) Dietary histone
deacetylase inhibitors: from cells to mice to
man. Semin Cancer Biol 17(5):363–369
75. Attoub S, Hassan AH, Vanhoecke B, Iratni R,
Takahashi T, Gaben A-M, Bracke M, Awad S,
John A, Kamalboor HA, Al Sultan MA,
Arafat K, Gespach C, Petroianu G (2011)
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer
Inhibition of cell survival, invasion, tumor
growth and histone deacetylase activity by
the dietary flavonoid luteolin in human epi-
thelioid cancer cells. Eur J Pharmacol 651
(1–3):18–25
76. Cheng X, Blumenthal RM (2010) Coordi-
nated chromatin control: structural and func-
tional linkage of DNA and histone
methylation. Biochemistry (Mosc) 49
(14):2999–3008
77. Kang J, Chen J, Shi Y, Jia J, Zhang Y (2005)
Curcumin-induced histone hypoacetylation:
the role of reactive oxygen species. Biochem
Pharmacol 69(8):1205–1213
78. Chung S, Yao H, Caito S, Hwang J-W,
Arunachalam G, Rahman I (2010) Regulation
of SIRT1 in cellular functions: role of poly-
phenols. Arch Biochem Biophys 501
(1):79–90
79. Tili E, Michaille J-J, Alder H, Volinia S,
Delmas D, Latruffe N (2010) Resveratrol
modulates the levels of microRNAs targeting
genes encoding tumor-suppressors and effec-
tors of TGFβ signaling pathway in SW480
cells. Biochem Pharmacol 80(12):2057–2065
80. Khanim FL, Gommersall LM, Wood VHJ,
Smith KL, Montalvo L, O’Neill LP, Xu Y,
Peehl DM, Stewart PM, Turner BM, Camp-
bell MJ (2010) Altered SMRT levels disrupt
vitamin D3 receptor signalling in prostate
cancer cells. Oncogene 23(40):6712–6725
81. Gao Y, Tollefsbol T (2015) Impact of epige-
netic dietary components on cancer through
histone modifications. Curr Med Chem 22
(17):2051–2064
82. Li Y, Yuan Y-Y, Meeran SM, Tollefsbol TO
(2010) Synergistic epigenetic reactivation of
estrogen receptor-α (ERα) by combined
green tea polyphenol and histone deacetylase
inhibitor in ERα-negative breast cancer cells.
Mol Cancer 9:274
83. Lopez-Serra P, Esteller M (2012) DNA
methylation-associated silencing of tumor-
suppressor microRNAs in cancer. Oncogene
31(13):1609–1622
84. Liloglou T, Bediaga NG, Brown BRB, Field
JK, Davies MPA (2014) Epigenetic biomar-
kers in lung cancer. Cancer Lett 342
(2):200–212
85. Toraño EG, Fernandez AF, Urdinguio RG,
Fraga MF (2014) Role of epigenetics in neural
differentiation: implications for health and
disease. In: Maulik N, Karagiannis T (eds)
Molecular mechanisms and physiology of dis-
ease. Springer, New York, pp 63–79 Available
from: http://link.springer.com/10.1007/
978-1-4939-0706-9_2
137
86. Ferdin J, Kunej T, Calin GA (2010)
Non-coding RNAs: identification of cancer-
associated microRNAs by gene profiling.
Technol Cancer Res Treat 9(2):123–138
87. Gavrilas L, Ionescu C, Tudoran O, Lisencu C,
Balacescu O, Miere D (2016) The role of
bioactive dietary components in modulating
miRNA expression in colorectal cancer. Nutri-
ents 8:590
88. Slattery M, Herrick J, Mullany L, Stevens J,
Wolff R (2016) Diet and lifestyle factors asso-
ciated with miRNA expression in colorectal
tissue. Pharmacogenomics Pers Med 10:1–16
89. Kutay H, Bai S, Datta J, Motiwala T,
Pogribny I, Frankel W, Jacob ST, Ghoshal K
(2006) Downregulation of miR-122 in the
rodent and human hepatocellular carcinomas.
J Cell Biochem 99(3):671–678
90. Wang L-L, Zhang Z, Li Q, Yang R, Pei X,
Xu Y, Wang J, Zhou SF, Li Y (2009) Ethanol
exposure induces differential microRNA and
target gene expression and teratogenic effects
which can be suppressed by folic acid supple-
mentation. Hum Reprod 24(3):562–579
91. Parasramka MA, Ho E, Williams DE, Dash-
wood RH (2012) MicroRNAs, diet, and can-
cer: new mechanistic insights on the
epigenetic actions of phytochemicals. Mol
Carcinog 51(3):213–230
92. Saini S, Majid S, Dahiya R (2010) Diet,
microRNAs and prostate cancer. Pharm Res
27(6):1014–1026
93. Sun M, Estrov Z, Ji Y, Coombes KR, Harris
DH, Kurzrock R (2008) Curcumin (diferu-
loylmethane) alters the expression profiles of
microRNAs in human pancreatic cancer cells.
Mol Cancer Ther 7:464–473
94. Yang J, Cao Y, Sun J, Zhang Y (2010) Curcu-
min reduces the expression of Bcl-2 by upre-
gulating miR-15a and miR-16 in MCF-7
cells. Med Oncol 27(4):1114–1118
95. Sun Q, Cong R, Yan H, Gu H, Zeng Y, Liu N
(2009) Genistein inhibits growth of human
uveal melanoma cells and affects microRNA-
27a and target gene expression. Oncol Rep
22:563–567
96. Panagiotakos D, Sitara M, Pitsavos C, Stefa-
nadis C (2007) Estimating the 10-year risk of
cardiovascular disease and its economic con-
sequences, by the level of adherence to the
Mediterranean diet: the ATTICA study. J
Med Food 10(2):239–243
97. Komduur RH, Korthals M, te Molder H
(2009) The good life: living for health and a
life without risks? On a prominent script of
nutrigenomics. Br J Nutr 101(3):307–316
138 Nicoleta Andreescu et al.
98. Elsamanoudy AZ, Neamat-Allah MAM,
Mohammad FAH, Hassanien M, Nada HA
(2016) The role of nutrition related genes
and nutrigenetics in understanding the path-
ogenesis of cancer. J Microsc Ultrastruct 4
(3):115–122
99. Béliveau R, Gingras D (2007) Role of nutri-
tion in preventing cancer. Can Fam Physician
53(11):1905–1911
100. Ames BN, Gold LS, Willett WC (1995) The
causes and prevention of cancer. Proc Natl
Acad Sci U S A 92(12):5258–5265
101. Ioannides C, Lewis DFV (2004) Cyto-
chromes P450 in the bioactivation of chemi-
cals. Curr Top Med Chem 4(16):1767–1788
102. Conney AH (2003) Enzyme induction and
dietary chemicals as approaches to cancer che-
moprevention: the seventh DeWitt
S. Goodman Lecture. Cancer Res 63
(21):7005–7031
103. Lamy S, Gingras D, Béliveau R (2002) Green
tea catechins inhibit vascular endothelial
growth factor receptor phosphorylation.
Cancer Res 62(2):381–385
104. Béliveau R, Gingras D (2004) Green tea: pre-
vention and treatment of cancer by nutraceu-
ticals. Lancet 364(9439):1021–1022
105. Shanafelt TD, Lee YK, Call TG, Nowakowski
GS, Dingli D, Zent CS, Kay NE (2006) Clin-
ical effects of oral green tea extracts in four
patients with low grade B-cell malignancies.
Leuk Res 30(6):707–712
106. Labrecque L, Lamy S, Chapus A, Mihoubi S,
Durocher Y, Cass B, Bojanowski MW,
Gingras D, Béliveau R (2005) Combined
inhibition of PDGF and VEGF receptors by
ellagic acid, a dietary-derived phenolic com-
pound. Carcinogenesis 26(4):821–826
107. Lamy S, Blanchette M, Michaud-Levesque J,
Lafleur R, Durocher Y, Moghrabi A,
Barrette S, Gingras D, Béliveau R (2006) Del-
phinidin, a dietary anthocyanidin, inhibits vas-
cular endothelial growth factor receptor-
2 phosphorylation. Carcinogenesis 27
(5):989–996
108. Hardy TM, Tollefsbol TO (2006) Epigenetic
diet: impact on the epigenome and cancer.
Epigenomics 3(4):503–518
109. Aykan NF (2015) Red meat and colorectal
cancer. Oncol Rev 9(1):288 Available from:
http://www.oncologyreviews.org/index.
php/or/article/view/288
110. Oostindjer M, Alexander J, Amdam GV,
Andersen G, Bryan NS, Chen D, Corpet
DE, De Smet S, Dragsted LO, Haug A, Karls-
son AH, Kleter G, de Kok TM, Kulseng B,
Milkowski AL, Martin RJ, Pajari AM, Paulsen
JE, Pickova J, Rudi K, Sødring M, Weed DL,
Egelandsdal B (2015) The role of red and
processed meat in colorectal cancer develop-
ment: a perspective. Meat Sci 97(4):583–596
111. Joosen AMCP, Kuhnle GGC, Aspinall SM,
Barrow TM, Lecommandeur E, Azqueta A,
Collins AR, Bingham SA (2009) Effect of
processed and red meat on endogenous nitro-
sation and DNA damage. Carcinogenesis 30
(8):1402–1407
112. Ijssennagger N, Rijnierse A, de Wit NJW,
Boekschoten MV, Dekker J, Schonewille A,
Müller M, van der Meer R (2013) Dietary
heme induces acute oxidative stress, but
delayed cytotoxicity and compensatory hyper-
proliferation in mouse colon. Carcinogenesis
34(7):1628–1635
113. Bastide NM, Pierre FHF, Corpet DE (2011)
Heme iron from meat and risk of colorectal
cancer: a meta-analysis and a review of the
mechanisms involved. Cancer Prev Res
(Phila Pa) 4(2):177–184
114. Sugimura T (2000) Nutrition and dietary car-
cinogens. Carcinogenesis 21(3):387–395
115. Frentzel-Beyme R, Helmert U (2000) Asso-
ciation between malignant tumors of the thy-
roid gland and exposure to environmental
protective and risk factors. Rev Environ
Health 5(3):337–358
116. Kohlmeier M (2013) Nutrigenetics: applying
the science of personal nutrition [Internet].
Academic, Oxford. Available from: http://
www.myilibrary.com?id¼416654
117. Camp KM, Trujillo E (2014) Position of the
academy of nutrition and dietetics: nutritional
genomics. J Acad Nutr Diet 114(2):299–312
118. Yong W-S, Hsu F-M, Chen P-Y (2016)
Profiling genome-wide DNA methylation.
Epigenetics Chromatin [Internet]; 9. Avail-
able from: http://epigeneticsandchromatin.
biomedcentral.com/articles/10.1186/
s13072-016-0075-3
119. Busch C, Burkard M, Leischner C, Lauer
UM, Frank J, Venturelli S (2015) Epigenetic
activities of flavonoids in the prevention and
treatment of cancer. Clin Epigenetics 7:64
Available from: http://www.
clinicalepigeneticsjournal.com/content/7/
1/64
120. Chakravarty S, Bhat UA, Reddy RG, Gupta P,
Kumar A (2014) Histone Deacetylase inhibi-
tors and psychiatric disorders. In: Epigenetics
in psychiatry. Elsevier, New York, pp 515–544
Available from: http://linkinghub.elsevier.
com/retrieve/pii/
B9780124171145000255
 Effects of Dietary Nutrients on Epigenetic Changes in Cancer
121. Peedicayil J (2014) Epigenetic drugs for mul-
tiple sclerosis. Curr Neuropharmacol 4
(1):3–9
122. Gilbert ER, Liu D (2010) Flavonoids influ-
ence epigenetic-modifying enzyme activity:
structure—function relationships and the
therapeutic potential for cancer. Curr Med
Chem 17(17):1756–1768
123. Rajendran P, Williams DE, Ho E, Dashwood
RH (2011) Metabolism as a key to histone
deacetylase inhibition. Crit Rev Biochem Mol
Biol 46(3):181–199
124. Haberland M, Montgomery RL, Olson EN
(2009) The many roles of histone deacetylases
in development and physiology: implications
139
for disease and therapy. Nat Rev Genet 10
(1):32–42
125. Poole RM (2014) Belinostat: first global
approval. Drugs 74(13):1543–1554
126. Garnock-Jones KP (2015) Panobinostat: first
global approval. Drugs 75(6):695–704
127. Rodrı́guez-Paredes M, Esteller M (2011)
Cancer epigenetics reaches mainstream oncol-
ogy. Nat Med 17(3):330–339
128. Chang LC, Yu YL (2016) Dietary compo-
nents as epigenetic-regulating agents against
cancer. BioMedicine 6(1):2 Available from:
http://www.globalsciencejournals.com/arti
cle/10.7603/s40681-016-0002-8
 Chapter 8

Diet, Microbiome, and Epigenetics in the Era of Precision

Medicine
Gabriela Riscuta, Dan Xi, Dudith Pierre-Victor, Pamela Starke-Reed,
Jag Khalsa, and Linda Duffy

Abstract
Precision medicine is a revolutionary approach to disease prevention and treatment that takes into account
individual differences in lifestyle, environment, and biology. The US National Institutes of Health has
recently launched The All of Us Research Program (2016) to extend precision medicine to all diseases by
building a national research cohort of one million or more US participants. This review is limited to how the
human microbiome factors into precision medicine from the applied aspect of preventing and managing
cancer. The Precision Medicine Initiative was established in an effort to address particular characteristics of
each person with the aim to increase the effectiveness of medical interventions in terms of prevention and
treatment of multiple diseases including cancer. Many factors contribute to the response to an intervention.
The microbiome and microbially produced metabolites are capable of epigenetic modulation of gene
activity, and can influence the response through these mechanisms. The fact that diet has an impact on
microbiome implies that it will also affect the epigenetic mechanisms involving microbiota. In this chapter,
we review some major epigenetic mechanisms, notably DNA methylation, chromatin remodeling and
histone modification, and noncoding RNA, implicated in cancer prevention and treatment. Several exam-
ples of how microbially produced metabolites from food influence cancer risk and treatment response
through epigenetic mechanisms will be discussed. Some challenges include the limited understanding of
how diet shapes the microbiome and how to best evaluate those changes since both, diet and the micro-
biota, exhibit daily and seasonal variations. Ongoing research seeks to understand the relationship between
the human microbiome and multiple diseases including cancer.

Key words Diet, Microbiome, Epigenetics, Cancer, Precision medicine, Nutrition

1 Introduction

The Precision Medicine Initiative, now referred to as the “All of Us

Together Program,” was launched in January 2015, as a bold new
research effort to improve prevention and accelerate the develop-
ment of new treatments [1]. The aim of this initiative is to increase
the rate of positive responders and to decrease the nonresponders
rate and the complications associated with medical interventions.

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_8,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

141
142 Gabriela Riscuta et al.

The precision medicine approach for disease treatment and preven-

tion takes into account the individual variability in environment,
lifestyle, and genetic background, with the goal of developing more
effective ways to prolong health and treat diseases [1]. The gut
microbiome is contributing to the individual variability through the
action of its components and their metabolites toward a multitude
of processes in the body including epigenetic processes.
Human microbiome is defined as the combined genetic mate-
rial of the microbes colonizing the human body and includes
commensal and pathogenic bacteria, viruses, fungi, and protozoa.
As described in the NIH Human Microbiome Project, most of the
microbes in the microbiome are not pathogens. Diet plays an
important role in shaping the microbiome and exhibits daily and
seasonal variations. Similarly, microbiota shows daily and seasonal
variations. The microbial metabolism of diet produces compounds
that alter epigenetics either by (1) altering pools of substrates used
for modifications such as methylation or (2) by generating other
compounds that alter the activity of enzymes involved in heritable
epigenetic modifications [2].
Dietary intervention studies have shown that the gut micro-
biome can rapidly respond to changes in diet, potentially facilitating
the diversity of human dietary lifestyles [3]. Therefore, host’s expo-
sure to microbial metabolites is sometimes transient. While some of
the changes in the microbiome are temporary, there is a stable
functional “core” microbiome that results from long-term expo-
sures components of the diet [4]. Another aspect of epigenetic
impact is the particular time of exposure to the microbially pro-
duced metabolites. It has been shown that both maternal and
neonatal nutrition have a major impact on the epigenome of the
offspring since the food consumed modulates the composition of
the gut microbiota and therefore the metabolites produced
[5]. Ongoing research seeks to understand the relationship
between the human microbiome and multiple diseases including
cancer [6].
As discussed below, microbial metabolites may activate epige-
netic processes and influence cancer risk and progression. This
review also addresses the effect of microbiome on food and bioac-
tive food components as well as the impact of microbially produced
metabolites on specific epigenetics processes implicated in cancer.

2 Epigenetic Mechanisms Influenced by Microbially Produced Metabolites

Epigenetics refers to the molecular processes which can change

gene activities without changes in DNA sequence: DNA methyla-
tion, genomic imprinting silencing off the extra copy of the
X-chromosome, histone modifications, and noncoding RNAs
alterations.
Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 143

DNA methylation is the addition of a methyl group to the

carbon-5 position of the cytosine pyrimidine ring and occurs pre-
dominantly in cytosine guanine dinucleotide-rich regions known as
CpG islands found in the 50 regulatory regions of most genes.
Bacteria can cause changes in DNA methylation patterns of host
cells by providing epigenetically active metabolites such as folate,
butyrate, and acetate [5].
Folate (vitamin B9) occur naturally in a variety of foods like
green leafy vegetables, citrus fruits, legumes, organ meats, and they
can also be consumed in fortified foods or as a supplement. Folate is
a water-soluble vitamin that functions as methyl donor in 1-carbon
transfer reactions occurring in purine and pyrimidine biosynthesis
required for efficient DNA replication, repair, and methylation
[7]. Because folate has poor chemical stability and bioavailability,
many studies have assessed the possible contribution of intestinal
microflora to the folate production in the host [7]. Folate status is
also influenced by the presence of genetic variations in folate
metabolism, particularly those found in the 5,10-
methylenetetrahydrofolate reductase (MTHFR) gene [8]. It
appears that folate status and therefore needs depend on the intake
of folate rich foods, genetic background, and the presence and
activity of folate-producing bacteria.
A number of bacteria like Bifidobacterium (B. adolescentis and
B. pseudocatenulatum) and Lactobacillus (Lactobacillus plantarum
and reuteri) have been shown to produce folate in vivo [9]. Folate
production by a combination of Bifidobacterium (Bifidobacterium
adolescentis MB 227, B. adolescentis MB239, and Bifidobacterium
pseudocatenulatum MB 116) was evaluated in a rat study and the
increased level of folate indicated that it was both produced and
absorbed [10]. A pilot human study involving 23 healthy volun-
teers concluded that this probiotic combination has the ability to
produce folate also in the human intestine and significantly
increases the folate concentration in feces within 48 h after admin-
istration [11]. Other bacteria produce folate under specific condi-
tions. For example, Lactobacillus plantarum produces folate in the
presence of para-aminobenzoic acid (pABA) [9]. The implications
of Lactobacillus activities are multiple and are not entirely known or
understood. Lactobacillus reuteri, a symbiont found in the gastro-
intestinal (GI) tract of a variety of mammalian species, is considered
indigenous to the human gut. It suppresses intestinal inflammation
and produces 5,10-methenyltetrahydrofolic acid polyglutamates,
suggesting a link between folate and histidine–histamine metabo-
lism in mice [12]. The identification of genes and gene networks
regulating production of these bacterially derived immunoregula-
tory molecules may lead to improved anti-inflammatory strategies
for digestive diseases [12].
Some folate-producing probiotic strains should be considered
for further evaluation for their potential use in digestive and
144 Gabriela Riscuta et al.

extradigestive conditions with underlying inflammatory substrates.

The active absorption process of folate involves several genetically
and functionally distinct transporters, such as the folate receptors,
the family of organic anion transporters, the proton-coupled folate
transporter, and the reduced folate carrier, which are ubiquitously
expressed [13]. Each mechanism plays a unique role in mediating
the transport across epithelia and into systemic tissues and contri-
butes to folate homeostasis in humans [14]. An understanding of
all the components participating in folate homeostasis including
the intake, bacterial production, genetically controlled absorption,
needs and metabolism would assist with precise recommendation
to modulate inflammation, as it is an important mechanism impli-
cated in cancer risk and progression.
Acetate, butyrate, and propionate in a ratio of 3:1:1, or 3:2:1,
are the predominant short chain fatty acids (SCFA) from carbohy-
drate fermentation, although formate, caproate, and lactate are also
formed [15]. The fluxes through these pools vary by fiber source
and microbial pathways dictated by microbial community compo-
sition of the lumen, with acetate being the dominant end-product
of glycolysis. All three major SCFA are present in portal blood at
concentrations several times greater than peripheral venous blood,
indicating that the gut is as a major source of these fatty acids [16].
Cross-feeding between groups of bacteria occurs and can influence
SCFA pools; butyrate forming bacteria condense acetate from
butyryl CoA and external pools of acetate may alter the amount
of acetate and butyrate available to the host [2]. While butyrate
supplies the majority of energy to the colonic epithelial cells pri-
marily through beta-oxidation, the concentrations of SCFA in the
colon are also high enough to influence regulation of colon epithe-
lial gene expression [2]. Increasing the concentration of butyrate in
the colon can play a protective role, mainly by activating epigeneti-
cally silenced genes as p21 and BAK [17]. Additionally, butyrate has
been shown to be a major energy substrate for colonocytes, to
inhibit angiogenesis at high concentrations, to induce cell replica-
tion and proliferation, and to act as an inducer or inhibitor of cell
differentiation, induce apoptosis leading to cell growth arrest or cell
death [18]. Faecalibacterium prausnitzii, which belongs to the
cluster of Firmicute bacteria, has been consistently reported as
one of the main butyrate producers found in the intestine
[19]. Although F. prausnitzii is dominant in healthy adults, its
population in the intestine is modulated by diverse factors. First,
the amount of F. prausnitzii in the gut microbiota depends on the
sex of the host, with lower concentration in human females than
males [20]. Additionally, it varies with age. The amount of
F. prausnitzii-specific RNA in stools from babies up to the age of
6 months is below the detection threshold. It increases between
ages 6 and 24 months but remains low until early childhood
(2–3 years). It reaches a peak during late childhood and
Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 145

adolescence, and it finally decreases again during adulthood, espe-

cially in the elderly [20]. Besides Faecalibacterium prausnitzii and
Eubacterium rectale which have the most significant contribution
to butyrate production in the colon, other butyrate-producing
bacterial species in the human colon are Roseburia spp. (Clostridial
cluster XIVa, such as Roseburia faecis, Roseburia inulinivorans,
Roseburia intestinalis, and Roseburia hominis), Eubacterium spp.
(Clostridial cluster XIVa, such as Eubacterium hallii), Anaerostipes
spp. (Clostridial cluster XIVa, such as Anaerostipes butyraticus,
Anaerostipes caccae, and Anaerostipes hadrus), and Butyricicoccus
pullicaecorum (Clostridial IV) [21]. Nine operational taxonomic
units, represented by the butyrate-producing genera Faecalibacter-
ium and Roseburia, were significantly less abundant in the gut
microbiota of colorectal patients and 17 phylotypes closely related
to Bacteroides were enriched [22]. A deeper understanding of the
dynamics of the fecal microbiota as it relates to SCFA production
may assist in designing a diet containing prebiotics to sustain
butyrate-producing human colon bacterial species.
Histone acetylation and deacetylation are important processes
of gene regulation by which the lysine residues within the
N-terminal tail protruding from the histone core of the nucleosome
are acetylated and deacetylated. Histone acetylation is catalyzed by
lysine acetyltransferases (KATs), which transfer an acetyl group
from acetyl coenzyme A (acetyl-CoA) to lysine residues (Nε),
with the concomitant production of coenzyme A (CoA)
[23]. The gut microbiome produces SCFA used to generate ATP
via the tricarboxylic acid (TCA) cycle, which regulates also histones
acetylation [5]. Histone deacetylases (HDACs), can also be inhib-
ited by metabolites produced by the gut microbiome such as buty-
rate and propionate [5]. Histone deacetylase inhibitors (HDACi)
can act on the epigenome through chromatin remodeling changes
[24]. Suberoylanilide hydroxamic acid (SAHA, vorinostat, Zolinza)
and depsipeptide (romidepsin, Istodax) have been approved by the
US Food and Drug Administration (FDA) for the treatment of
refractory cutaneous T-cell lymphoma, in 2006 and 2009, respec-
tively [24]. Among other SCFA metabolites, butyrate functions as a
histone deacetylase inhibitor. Since diet is the primary source of
SCFA, nutrition and microbial flora have a marked influence on the
risk of colorectal cancer. The formation of butyrate and other
SCFAs possibly play a major chemopreventive role [25]. Probiotics
may restore intestinal dysbiosis and improve clinical disease
through elevated SCFA levels in the intestine [24].
Chromatin remodeling is a dynamic process through which
chromatin changes allow transcription proteins to access genomic
DNA and to control gene expression. Aberrant chromatin structure
and gene dysregulation are the primary characteristics of human
cancer progression [26]. Specific protein complexes play a pivotal
role in the process of chromatin remodeling by providing proper
146 Gabriela Riscuta et al.

nucleosome position and density [27]. The two major classes of

protein complexes which control chromatin remodeling are the
covalent histone-modifying complexes and the ATP-dependent
chromatin remodeling complexes [26].
RNA that does not code for a protein is termed noncoding
RNA (ncRNA), and the majority of the eukaryotic genome is
transcribed into ncRNA, which plays a major role in the regulation
of messenger RNA (mRNA) translation [5]. The broad functional
repertoire of long ncRNAs includes roles in high-order chromo-
somal dynamics, telomere biology, and subcellular structural orga-
nization [28]. Accumulating evidence has confirmed that ncRNAs
contribute to cancer initiation and progression through regulating
gene transcription and posttranscriptional regulation through
chromatin remodeling [26].
Various enzymes (methyltransferases, acetyltransferases, deace-
tylases, Bir A ligase, phosphotransferases, kinases, and synthetases)
are derived from the gut microbiota, and several key energy meta-
bolites (S-adenosylmethionine (SAM), acetyl-CoA, NAD+, α-KG,
and ATP) serve as essential cofactors for many, perhaps most,
epigenetic enzymes that regulate DNA methylation, posttransla-
tional histone modifications, and nucleosome position [5]. For
example, sulforaphane, a phenolic phytonutrient obtained from
all cruciferous vegetables, inhibits histone deacetylase in vivo and
suppresses tumorigenesis in Apc-minus mice [29]. As exemplified
above, microbially produced metabolites, may influence certain
epigenetic mechanisms.

3 Colorectal Cancer

According to the American Cancer Society (ACS), excluding skin

cancers, colorectal cancer (CRC) is the third most common cancer
diagnosed in both men and women in the USA [30]. The ACS’s
estimates for the new cases in the USA for 2017 are 95,520 colon
cancers and 39,910 rectal cancers. CRC is expected to cause about
50,260 deaths in 2017 alone. To address this problem, a better
understanding of the mechanisms involved in prevention and treat-
ment of this cancer is necessary. Maintaining healthy mucosa and
overall intestinal environment, may help protect against adenoma
and subsequently colon cancer. Accordingly, the American Institute
for Cancer Research (AICR), has cautioned that processed meat,
alcohol, and high trans and saturated fats consumption may
increase the risk of CRC [31]. Food high in fiber, and garlic
consumption have the potential to decrease the risk of CRC in
some populations [31]. It has been hypothesized that it may be
possible to prevent CRC by improving the intestinal environment
by adding probiotics to the diet [5]. Adding cruciferous vegetables
and green tea polyphenols may further bring beneficial epigenetic
Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 147

modifications in the bacterial DNA or the genes that they

target [2].
Besides the direct protection against CRC provided by an
increased consumption of fibers, microbially produced metabolites,
such as SFCAs may play an important role in cancer prevention by
activating several metabolic pathways. Due to their proximity,
colonic mucosa will be immediately exposed to these metabolites;
some of these metabolites will be absorbed and exhibit a systemic
effect. A study showed changes in fecal microbiota and decrease in
fecal SCFA concentrations with a significant increase in fecal pH in
colon cancer patients compared with healthy individuals [32].
Meta-analysis of prospective cohort and nested case-control studies
concluded that a high intake of dietary fibers, particularly cereal
fibers and whole grains, was associated with a reduced risk of CRC
[33]. High fiber foods contain a complex mixture of phytochem-
icals ready to be metabolized by the gut microbiota to metabolites
with epigenetic properties. Together, the complexity of food com-
position and unique individual microbiota will lead toward a varia-
bility in response to the same nutritional intervention.
Analysis of stool microbiome and metabolome shows differ-
ences in CRC patients and healthy adults, with higher levels of
glycerol and several unsaturated fatty acids detected in the stool
samples of healthy individuals compared with cancer patients
[34]. Correlation analysis of the microbiome and metabolome
data has also revealed strong associations between some members
of the stool microbiota and candidate metabolites. Bacteroides fine-
goldii, two Dialister spp., and P. ruminis were strongly correlated,
and Bacteroides intestinalis and Ruminococcus obeum were moder-
ately correlated with increased stool free fatty acids and glycerol
[34]. Several butyrate-producing bacteria were underrepresented
in CRC samples, whereas mucin-degrading species Akkermansia
muciniphila were about fourfold higher [34].
Attempts to characterize CRC microbiota have led to new
hypotheses regarding the influence of gut microbiota on CRC
development. One hypothesis suggests that there are “driver bacte-
ria” with procarcinogenic features that contribute to tumor devel-
opment and “passenger bacteria” that may outcompete drivers to
flourish in the tumor environment as the cancer progresses
[35]. While a detailed characterization of colon microbiota found
in healthy subjects compared to CRC patients is not available, some
features like high microbial diversity and presence of some bacteria
have started to be associated more with one condition versus
another. Additional metabolites like isothiocyanates (ITC), which
is microbially produced from glucosinolates, showed epigenetic
activities. Escherichia coli, Bacteroides thetaiotaomicron, Enterococ-
cus faecalis, Enterococcus faecium, Peptostreptococcus sp., and Bifido-
bacterium sp. were isolated from the human gut or feces and
showed potential to produce ITCs and other derivatives from
148 Gabriela Riscuta et al.

glucosinolates [36–38]. The amount of ITC produced varies in

individuals, which lead to the question of which other factors
could be involved in its production. Likely, part of the interindivid-
ual variability may be due to the composition of the entire micro-
biota, the genetic background and its interaction with the
microbiome, the diet as a whole, and medications. Potentially, the
exposure to ITCs in vivo may have a protective effect on tumor
growth through the effects on DNA methylation, histone modifi-
cation, and miRNA.
As mentioned previously, certain types of high-fat diet increase
the risk of CRC in some individuals. In response to a high-fat diet,
secondary bile acids, deoxychloate (DCA), and lithodeoxycholate
(LDA) increase. Bile acids delivered to the colon undergo anaerobic
microbial metabolism to secondary bile acids deoxycholate (DCA),
lithocholate (LCA), and ursodeoxycholate (UDCA). Secondary
bile acids, DCA and LCA increase in response to high fat diet and
are correlated with higher risk of colorectal cancer [39]. In particu-
lar, there was a positive association with DCA and colorectal ade-
nomas, a precursor to colorectal cancer and in opposition, an
increase in the amount of UDCA in stools has been shown in
animal and in vitro studies to reduce the risk of cancer dysplasia
and cancer development [40]. UDCA induces cell differentiation
and senescence in colon cancer cells via histone hypoacetylation and
is found in stools of healthy individuals correlated with Rumino-
coccus sp. [34].
High fat diet was demonstrated to reduce purportedly benefi-
cial Bifidobacterium spp. and Lactobacillus spp. due to exposing
these bacteria to the environment containing bile acid salts, and
very poor in nutrients [41]. However, there are inconsistencies in
epidemiological studies regarding the protective role of polyunsat-
urated fatty acids consumption against colon cancer, and these
inconsistencies have been attributed to many factors. For example,
in a study in mice, a diet high in fish oil had no appreciable
stimulatory effect on colonic 7α-dehydroxylating enzyme content
or the excretion of secondary bile acids [42]. The importance of the
ration between n-6 fatty acid and n-3 fatty acid intake has been
evaluated and concluded as important, as exemplified by the
Australian study that showed that plasma phospholipid saturated
fatty acid concentrations were associated with high cancer risk
whereas high n-3 polyunsaturated fatty acid levels were associated
with low risk [43].
However, despite progressive westernization, n-3 fatty acid
content in red blood cells continues to be considerably high in
Alaska Native people, due to high fish oil consumption resulting
in a ratio of n-6–n-3 fatty acids of approximately 1:1, compared
with 10–30:1 in US Caucasians. Thus, Alaska Natives should be
protected from colorectal cancer by their high consumption of fish
oil. However, they have the highest reported rate of CRC in the
 Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 149

world [44]. The explanation for this finding is currently unknown,

many other factors are potentially implicated, including lifestyle
and pollution [45]. Some believe that it might be related to their
extremely low intakes of fibers and phytochemical-rich foods, low
butyrate level, since experimental evidence shows that when
provided together, butyrate and n-3 fatty acids have synergistic
antineoplastic effects [46–48]. These results indicated not only
that concomitant consumption of fish oil and nondigestible starch
are necessary but also that the analysis of diet as a whole.
Regarding food which would potentially increase the risk of
CRC, according with reports from AICR, red meat consumption
may increase the risk of CRC in some populations. There is a
probable involvement of colon microbiota in dictating whether
red meat contributes to colon tumorigenesis. Such involvement
points to the fact that it is the response to the overall dietary
characteristics that drives associations between tumorigenesis and
red meat consumption [49]. Special attention is given to Strepto-
coccus bovis, a gram-positive bacterium and a member of normal
gastrointestinal flora in ruminants, which may be acquired through
dietary intake of ruminant-derived foods, such as unpasteurized
dairy products, red meat, and animal organs [50]. Approximately
10% of healthy individuals have been estimated to carry this bacte-
rium asymptomatically in their digestive tract, but a more recent
study found that 52% of Streptococcus bovis bacteremia patients had
advanced adenoma/cancer, which was approximately 2.5-fold
more frequent than colonoscopy controls [51]. Similar prevalence
(60%) of advanced adenoma/cancer was reported in SB endocardi-
tis patients by Sharara et al. [52]. Presently, Streptococcus bovis is
being evaluated as being causal or having an incidental involvement
in CRC [50–53]. Thus, the effect of microbiota is also direct, and is
likely not only through the epigenetic mechanisms. It appears that
it is a complex interaction between not only the host genes and
microbiota but also with the microbes introduced through food
itself via unchecked food microbiology.

4 Breast and Prostate Cancers

Breast and prostate cancers are the most widespread hormone -

dependent cancers in the USA. Based on 2012–2014 SEER data,
approximately 12.4% of women will be diagnosed with breast can-
cer at some point during their lifetime, and 40,610 women are
estimated to die from it in 2017 [54]. Approximately 11.6% of men
will be diagnosed with prostate cancer at some point during their
lifetime, and based on same data source, 161,360 men are esti-
mated to die from it in 2017 alone [55]. Cancer is a group of
multifactorial diseases, in which microbiota plays a role through
the microbially produced metabolites which interact with human
150 Gabriela Riscuta et al.

hormones, and also activates some epigenetic pathways. It was

observed that germfree mice have lower reproductive capacity,
which is normalized upon addition of specific bacteria
[56]. Hence, normal hormonal activities require the presence of
microbiota. The gut microbiota influences the amount of circulat-
ing estrogens and estrogen metabolites with impact in breast cancer
risk [57].
Some botanical agents such as glucoraphanin, an isothiocya-
nate belonging to the group of organosulfur compounds found in
cruciferous vegetables, can be transformed into sulforaphane (SFN)
by the microbiota in the colon, and the amount of SFN produced
varies with the microbiota composition [58]. SFN can also be
produced by the myrosinase, an enzyme found in the plant
[59]. SFN has been identified to have histone deacetylase
(HDAC) inhibitory activity and antiproliferative and proapoptotic
effects in many cancer cells, including breast cancer [60]. It is
difficult to separate the anticancer actions of the food itself from
the anticancer action of the microbially produced metabolites. It is
even more difficult when the same metabolite, like SFN can be
produced by the gut microbiota and the enzymes found in the
particular vegetable, and to identify exactly the magnitude of each
action.
The protective effect of soy consumption against breast cancer
is another example of the role of microbiome in the effectiveness of
a nutritional intervention. Modulatory effects on the intestinal
bacterial populations might be associated with the beneficial prop-
erties attributed to soy consumption [61]. Equol is the one micro-
bial metabolite produced from soy showing potential protection
against breast and prostate cancer. Since the amount of urinary
equol excretion is correlated with a reduced risk of breast cancer,
it is likely that soy isoflavones metabolites have stronger anticancer
effect than the actual isoflavones. Therefore, the microbiome may
play an important role in cancer prevention since only a percentage
of population is equol producers [62]. The understanding of the
microbial interactions with food may help identify more precise
ways to prevent breast cancer. Equol appears to be promising
chemopreventive and therapeutic agents for prostate cancer based
on the fact that equol augments Skp2-mediated androgen receptor
degradation [63]. Skp2 expression was indicated to be crucial for
the effect of soy isoflavones. Hence soy isoflavones may be applica-
ble for precancerous and cancerous conditions [63]. It appears that
one particular food, for example soy and its metabolite equol, may
be protective for more than one type of cancer.
 Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 151

5 Other Cancers: Liver Cancer and Gastric Cancer

Prevention and treatment of other cancers such as liver and gastric

cancers may become more precise once we are able to have a deeper
understanding of the interaction between the microbiome with, the
food, and the epigenetic actions of microbially produced
metabolites.
For example, toll-like receptors (TLR4) are activated by lipo-
polysaccharide (LPS) from gut bacteria and may contribute to
injury and inflammation-driven tumor promotion in the liver
[64]. Gut sterilization restricted to late stages of hepatocarcinogen-
esis reduced hepatocellular carcinoma (HCC) suggesting that the
intestinal microbiota and TLR4 represent therapeutic targets for
HCC prevention in advanced liver disease [64]. Dietary approaches
with the aim to inhibit TLR4, may play a role in altering the
inflammation process and reduce the risk of liver cancer.
Gastric cancer is often caused by infection with Helicobacter
pylori which induces chronic gastritis and peptic ulcers. In addition,
H. pylori itself can cause DNA damage and epigenetic changes that
trigger genetic instability and neoplastic transformation [65].
Interestingly, there is the consistent inverse relationship noted
between H. pylori and esophageal adenocarcinoma, and since gas-
tric cancer is not frequent in the USA, some are concerned with
H. pylori eradication [66]. Recent research in this field has focused
on genetic susceptibility, such as polymorphisms in genes govern-
ing gastric inflammatory responses, H. pylori heterogeneity and on
other environmental influences (e.g., dietary salt or the presence of
non-Helicobacter species within the gastrointestinal microbiome)
may explain why only a small proportion of individuals who are
colonized by H. pylori go on to develop gastric cancer [66]. Under-
standing the other contributing factors besides the presence of
H. pylori may lead to more effective ways of preventing gastric
cancer.

6 Discussions and Conclusions

The concepts of precision medicine have evolved because of

advances in molecular or omics technologies such as genomics,
transcriptomics, proteomics, metabolomics, and metabonomics
which can potentially lead to unique patient phenotypes and inter-
individual differences in treatment responses [67]. The micro-
biome plays a crucial role in health and disease, as it influences
endocrinology, physiology, and even neurology, thereby altering
the outcome of many different disease states and augments drug
responses and tolerance [68]. There is a bidirectional interaction:
the gut microbiota, its composition and metabolism, are influenced
152 Gabriela Riscuta et al.

by changes in the diet and the gut microbiota produce metabolites

with beneficial or detrimental effect to the host through multiple
mechanisms including epigenetic mechanisms. We presented some
examples of how microbiota influence cancer risk, but the state of
the science is presently limited thus preventing definitive
conclusions.
Multiple epigenetic mechanisms could be influenced by micro-
bially produced metabolites DNA methylation, histone modifica-
tions, and noncoding RNAs. Through these epigenetic
mechanisms, one microbial metabolite could potentially influence
more than one type of cancer, as equol, for example, which has an
impact on breast and prostate cancers risk. Conversely, one type of
cancer risk and treatment can be modified by more than one
microbial metabolite. It has been also shown that maternal and
neonatal nutrition has a major impact on the epigenome of the
offspring. Hence, we are dealing with not only the present but also
with the previous exposure. However, cancer risk cannot be
reduced to the presence or absence of a specific microbe. In the
case of gastric cancer for example, when H. pylori is considered
causal, other factors like salt intake, which is related to the increase
of inflammatory status is a contributing risk factor, and should not
be ignored. Therefore, cancer risk is a complex interaction among
the microbiome, genome, and diet.
We need to take into consideration not only the food–micro-
biome–host interactions but also the microbe–microbe interac-
tions, and their interactions with viruses, archea, and fungi.
Currently, the understanding of these interactions is limited.
Other environmental exposures such as water microbiology and
mineral composition including the presence of heavy metals, pollu-
tants, and food components play a role in the way the microbiota
reacts. Diet as a whole, and specific bioactive food components may
have the potential to reduce the impact of some heavy metals.
Special precautions must be taken in case of mineral deficiencies,
since, for example, iron fortification adversely affects the gut micro-
biome. It has recently been shown that iron increases pathogen
abundance and induces intestinal inflammation in Kenyan
infants [69].
In conclusion, multiple pathways can be activated and generate
compounds with the capacity to influence epigenetic mechanisms.
In addition to the systemic effect, a local effect on the colonic
mucosa, due to an intimate exposure can be more affected by the
microbiota and its metabolites. Biological systems are very complex
and exhibit properties that extend far beyond observations asso-
ciated with one single cellular process. Therefore, it is critical to
evaluate the multiple cancer related processes simultaneously
[70]. However, the microbiota resides not only in the colon but
also in the entire digestive system and on the skin. Recent studies
showed that body tissues previously considered sterile, such as
 Diet, Microbiome, and Epigenetics in the Era of Precision Medicine 153

breast tissue, contained commensal bacteria collected from healthy

subjects, not only in cases of infections [71].
Commensal bacteria react with the pathogens and have a role in
maintaining health status. The role of microbiome analysis in health
and diseases status has the potential to evolve to one of informing
direct therapeutic manipulation of the microbiome and to increas-
ing our understanding of the delicate homeostasis between the
intestine and its microbes, which could lead to new insights into
the pathogenesis of diseases and novel therapeutic strategies
[67]. Probiotics have shown promise in providing health benefits
through multiple mechanisms, but a deeper understanding of
microbiome interaction with the host in the context of health and
disease is necessary to avoid adverse events. The basic mechanistic
studies are to provide a solid base for rigorous interventional
research focused on microbiome–host–diet interaction. Current
evidence supports the rationale for the potential use of probiotics
in human clinical studies. However, it is difficult to link a specific
bacterial activity with each metabolite directly due to the complex-
ity and functional redundancy of the gut microbiota.
The microbiome and its metabolites are playing an important
role in cancer risk, prevention, and treatment, but if we are to attain
the goal of precision medicine, we must understand that the micro-
biome is only one part of the equation. We need to explore gen-
e–environment interactions, including in utero exposure, expedite
the discovery of biosignatures, and characterize health and disease
status including cancer. Although multiomic-driven technologies
are changing biomedical research, it is not yet clear to what extent
these technologies will effectively change clinical decision support
systems and health delivery. Part of inconsistencies in results in
terms of sensitivity to the environmental carcinogens or genetic
predisposition to cancer shows that other factors, such as the
microbiome, are implicated. Administering an “epigenetic diet”
to prevent cancer or together with conventional treatment can be
an effective way to increase the effectiveness of the intervention.
Thus, by manipulating both the microbiome and the diet, we may
discover novel approaches that act through epigenetic pathways
and add to our effective strategies against cancer.

References

1. The White House (2015) President Obama’s
Precision Medicine Initiative. https://
obamawhitehouse.archives.gov/the-press-
office/2015/01/30/fact-sheet-president-
obama-s-precision-medicine-initiative
2. Hullar MA, Fu BC (2014) Diet, the gut micro-
biome, and epigenetics. Cancer J 20
(3):170–175
3. David LA, Maurice CF, Carmody RN, Goo-
tenberg DB, JE B, Wolfe BE, Ling AV, Devlin
AS, Varma Y, Fischbach MA, Biddinger SB,
Dutton RJ, Turnbaugh PJ (2014) Diet rapidly
and reproducibly alters the human gut micro-
biome. Nature 505(7484):559–563
4. Lozupone CA, Stombaugh JI, Gordon JI,
Jansson JK, Knight R (2012) Diversity, stability
154 Gabriela Riscuta et al.
and resilience of the human gut microbiota.
Nature 489(7415):220–230
5. Paul B, Barnes S, Demark-Wahnefried W,
Morrow C, Salvador C, Skibola C, Tollefsbol
TO (2015) Influences of diet and the gut
microbiome on epigenetic modulation in can-
cer and other diseases. Clin Epigenetics 7:112.
https://doi.org/10.1186/s13148-015-0144-
7 1186/1868-7083-4-4
6. Rajagopala SV, Vashee S, Oldfield LM,
Suzuki Y, Venter JC, Telenti A, Nelson KE
(2017) The human microbiome and cancer.
Cancer Prev Res 10(4):226–234
7. Linus Pauling Institute (2017) Micronutrient
information: folate. http://lpi.oregonstate.
edu/mic/vitamins/folate
8. Bueno O, Molloy AM, Fernandez-Ballart JD,
Garcı́a-Minguillán CJ, Ceruelo S, Rı́os L,
Ueland PM, Meyer K, Murphy MM (2016)
Common polymorphisms that affect folate
transport or metabolism modify the effect of
the MTHFR 677C> T polymorphism on
folate status. J Nutr 146(1):1–8
9. Rossi M, Amaretti A, Raimondi S (2011)
Folate production by probiotic bacteria. Nutri-
ents 3(1):118–134
10. Pompei A, Cordisco L, Amaretti A, Zanoni S,
Raimondi S, Matteuzzi D, Rossi M (2007)
Administration of folate-producing bifidobac-
teria enhances folate status in Wistar rats. J
Nutr 137(12):2742–2746
11. Strozzi GP, Mogna L (2008) Quantification of
folic acid in human feces after administration of
Bifidobacterium probiotic strains. J Clin Gas-
troenterol 42(S3):S179–S184
12. Thomas CM, Saulnier DMA, Spinler JK,
Hemarajata P, Gao C, Jones SE, Grimm S, Bal-
deras MA, Burstein MD, Morra C, Roeth D,
Kalkum M, Versalovic J (2016) FolC2-
mediated folate metabolism contributes to sup-
pression of inflammation by probiotic Lactoba-
cillus reuteri. Microbiology 5(5):802–818
13. Matherly LH, Hou Z, Deng Y (2007) Human
reduced folate carrier: translation of basic biol-
ogy to cancer etiology and therapy. Cancer
Metastasis Rev 26:111–128
14. Zhao R, Matherly LH, Goldman ID (2009)
Membrane transporters and folate homeosta-
sis: intestinal absorption and transport into sys-
temic compartments and tissues. Expert Rev
Mol Med 11:e4. https://doi.org/10.1017/
S1462399409000969
15. Hurst NR, Kendig DM, Murthy KS, Grider JR
(2014) The short chain fatty acids, butyrate
and propionate have differential effects on the
motility of the Guinea pig colon. Neurogas-
troenterol Motil 26(11):1586–1596
16. Cummings JH, Pomare EW, Branch WJ, Nay-
lor CP, Macfarlane GT (1987) Short chain fatty
acids in human large intestine, portal, hepatic
and venous blood. Gut 28(10):1221–1227
17. Canani RB, Costanzo M, Leone L (2012) The
epigenetic effects of butyrate: potential thera-
peutic implications for clinical practice. Clin
Epigenetics 4(1):4. https://doi.org/10.
18. Liu D, Andrade SP, Castro PR, Treacy J,
Ashworth J, Slevin M (2016) Low concentra-
tion of sodium butyrate from ultrabraid +
NaBu suture, promotes angiogenesis and tissue
remodelling in tendon-bones injury. Sci Rep
6:346–349
19. Lopez-Siles M, Duncan SH, Garcia-Gil LJ,
Martinez-Medina M (2017) Faecalibacterium
prausnitzii: from microbiology to diagnostics
and prognostics. ISME J 11:841–852
20. Miquel S, Martı́n R, Bridonneau C, Robert V,
Sokol H, Bermúdez-Humarán LG, Thomas M,
Langella P (2014) Ecology and metabolism of
the beneficial intestinal commensal bacterium
Faecalibacterium prausnitzii. Gut Microbes 5
(2):146–151
21. Rivière A, Selak M, Lantin D, Leroy F, De
Vuyst L (2016) Bifidobacteria and butyrate-
producing colon bacteria: importance and stra-
tegies for their stimulation in the human gut.
Front Microbiol 7:979. https://doi.org/10.
3389/fmicb.2016.00979
22. Wu N, Yang X, Zhang R, , Li J, Xiao X, Hu Y,
Chen Y, Yang F, Lu N, Wang Z, Luan C, Liu Y,
Wang B, Xiang C, Wang Y, Zhao F, Gao GF,
Wang S, Li L, Zhang H, Zhu B (2013) Dys-
biosis signature of fecal microbiota in colorec-
tal cancer patients. Microb Ecol 66
(2):462–470
23. Roth SY, Denu JM, Allis CD (2001) Histone
acetyltransferases. Annu Rev Biochem 70
(1):81–120
24. Licciardi PV, Ververis K, Karagiannis TC
(2011) Histone deacetylase inhibition and die-
tary short-chain fatty acids. ISRN Allergy
2011:869647. https://doi.org/10.5402/
2011/869647
25. Waldecker M, Kautenburger T, Daumann H,
Busch C, Schrenk D et al (2008) Inhibition of
histone-deacetylase activity by short-chain fatty
acids and some polyphenol metabolites formed
in the colon. J Nutr Biochem 19(9):587–593
26. Tang Y, Wang J, Lian Y, Fan C, Zhang P, Wu Y,
Li X, Xiong F, Li X, Li G, Xiong W, Zeng Z
(2017) Linking long non-coding RNAs and
SWI/SNF complexes to chromatin remodeling
in cancer. Mol Cancer 16(1):42. https://doi.
org/10.1186/s12943-017-0612-0
 Diet, Microbiome, and Epigenetics in the Era of Precision Medicine
27. Reisman D, Glaros S, Thompson EA (2009)
The SWI/SNF complex and cancer. Oncogene
28:1653–1668
28. Mercer TR, Dinger ME, Mattick JS (2009)
Long non-coding RNAs: insights into func-
tions. Nat Rev Genet 10(3):155–159
29. Myzak MC, Dashwood WM, Orner GA et al
(2006) Sulforaphane inhibits histone deacety-
lase in vivo and suppresses tumorigenesis in
Apc-minus mice. FASEB J 20(3):506–508
30. American Cancer Society (2017) Key statistics
for colorectal cancer. https://www.cancer.org/
cancer/colon-rectal-cancer/about/key-statis
tics.html
31. American Institute for Cancer Research (2017)
Learn about colorectal cancer. http://www.
aicr.org/learn-more-about-cancer/colorectal-
cancer/
32. Ohigashi S, Sudo K, Kobayashi D,
Takahashi O, Takahashi T, Asahara T,
Nomoto K, Onodera H (2013) Changes of
the intestinal microbiota, short chain fatty
acids, and fecal pH in patients with colorectal
cancer. Dig Dis Sci 58(6):1717–1726
33. Aune D, Chan DS, Lau R, Vieira R, Green-
wood DC, Kampman E, Norat T (2011) Die-
tary fibre, whole grains, and risk of colorectal
cancer: systematic review and dose-response
meta-analysis of prospective studies. BMJ
343:d6617. https://doi.org/10.1136/bmj.
d6617
34. Weir TL, Manter DK, Sheflin AM, Barnett BA,
Heuberger AL, Ryan EP (2013) Stool micro-
biome and metabolome differences between
colorectal cancer patients and healthy adults.
PLoS One 8(8):e70803. https://doi.org/10.
1371/journal.pone.0070803
35. Tjalsma H, Boleij A, Marchesi JR, Dutilh BE
(2012) A bacterial driver–passenger model for
colorectal cancer: beyond the usual suspects.
Nat Rev Microbiol 10:575–582
36. Brabban AD, Edwards C (1994) Isolation of
glucosinolate degrading microorganisms and
their potential for reducing the glucosinolate
content of rapemeal. FEMS Microbiol Lett
119:83–88
37. Elfoul L, Rabot S, Khelifa N, Quinsac A,
Duguay A, Rimbault A (2001) Formation of
allyl isothiocyanate from sinigrin in the diges-
tive tract of rats monoassociated with a human
colonic strain of Bacteroides thetaiotaomicron.
FEMS Microbiol Lett 197:99–103
38. Holst B, Williamson G (2003) A critical review
of the bioavailability of glucosinolates and
related compounds. Nat Prod Rep 21
(3):425–447
155
39. Kundu S, Kumar S, Bajaj A (2015) Cross-talk
between bile acids and gastrointestinal tract for
progression and development of cancer and its
therapeutic implications. IUMBM Life 67
(7):514–523
40. Khare T, Khare S (2014) Controversies in che-
moprevention of colorectal cancer with urso-
deoxycholic. Acid JSM Gastroenterol Hepatol
2(1):1009
41. Dziedzic K, Szwengie A, Górecka D, Gujska E,
Kaczkowska J, Drożdżyńska A, Walkowiak J
(2016) Effect of wheat dietary fiber particle
size during digestion in vitro on bile acid, faecal
bacteria and short-chain fatty acid content.
Plant Foods Hum Nutr 71:151–157
42. Woodworth HL, McCaskey SJ, Duriancik DM,
Clinthorne JF, Langohr IM, Gardner EM,
Fenton JI (2010) Dietary fish oil alters T lym-
phocyte cell populations and exacerbates dis-
ease in a mouse model of inflammatory colitis.
Cancer Res 70(20):7960–7969
43. Hodge AM, Williamson EJ, Bassett JK, MacIn-
nis RJ, Giles GG, English DR (2015) Dietary
and biomarker estimates of fatty acids and risk
of colorectal cancer. Int J Cancer 137
(5):1224–1223
44. Young TK, Kelly JJ, Friborg J, Soininen L,
Wong KO (2016) Cancer among circumpolar
populations: an emerging public health con-
cern. Int J Circumpolar Health 75(1):29787
45. O’Brien DK, Upton L (2008) Cancer inci-
dence and mortality in Alaska, 1996–2004.
Alaska Department of Health and Social Ser-
vices, Section of Chronic Disease and Health
Promotion, Alaska Cancer Registry. Depdhss,
Anchorage (AK alaska.gov/dph/Chronic/
Documents/Cancer/assets/
cancerRegistry1996-2004.pdf
46. Hofmanová J, Vaculová A, Lojek A, Kozubı́k A
(2005) Interaction of polyunsaturated fatty
acids and sodium butyrate during apoptosis in
HT-29 human colon adenocarcinoma cells.
Eur J Nutr 44:40–51
47. Kolar SSN, Barhoumi R, Callaway ES,
Barhoumi R, Callaway ES, Fan Y-Y, Wang N,
Lupton JR, Chapkin RS (2007) Synergy
between docosahexaenoic acid and butyrate
elicits p53-independent apoptosis via mito-
chondrial Ca2+ accumulation in colonocytes.
Am J Physiol Gastrointest Liver Physiol 293:
G935–G943
48. O’Keefe SJ (2016) Diet, microorganisms and
their metabolites, and colon cancer. Nat Rev
Gastroenterol Hepatol 13(12):691–706
49. Turner ND, Lloyd SK (2017) Association
between red meat consumption and colon
156 Gabriela Riscuta et al.
cancer: a systematic review of experimental
results. Exp Biol Med 242(8):813–839
50. Sun J, Kato I (2016) Gut microbiota, inflam-
mation and colorectal cancer. Genes Dis 3
(2):130–113
51. Corredoira-Sánchez J, Garcı́a-Garrote F,
Rabuñal R, López-Roses L, Garcı́a-Paı́s MJ,
Castro E, González-Soler R, Coira A, Pita J,
López-Álvarez MJ, Alonso MP, Varela J (2012)
Association between bacteremia due to strep-
tococcus gallolyticus subsp. Gallolyticus (strep-
tococcus bovis I) and colorectal neoplasia: a
case control study. Clin Infect Dis 55
(4):491–494
52. Sharara AI, Hamdan AT, Malli A, El-Halabi
MM, Hashash JG, Ghaith OA, Kanj SS
(2013) Association of Streptococcus bovis
endocarditis and advanced colorectal neoplasia:
a case-control study. J Dig Dis 14(7):382–387
53. zur Hausen H (2006) Streptococcus bovis:
causal or incidental involvement in cancer of
the colon? Int J Cancer 119(9):xi–xii. https://
doi.org/10.1002/ijc.22314
54. National Cancer Institute (2017) Cancer stats
facts: female breast cancer. https://seer.cancer.
gov/statfacts/html/breast.html
55. National Cancer Institute (2017) Cancer stats
facts: prostate cancer. https://seer.cancer.gov/
statfacts/html/prost.html
56. Shimizu K, Muranaka Y, Fujimura R, Ishida H,
Tazume S, Shimamura T (1998) Normaliza-
tion of reproductive function in germfree
mice following bacterial contamination. Exp
Anim 47(3):151–158
57. Fuhrman BJ, Feigelson HS, Flores R, Gail MH,
Xu X, Ravel J, Goeder JJ (2014) Associations of
the fecal microbiome with urinary estrogens
and estrogen metabolites in postmenopausal
women. J Clin Endocrinol Metab 99
(12):4632–4640
58. Li F, Hullar MA, Beresford SA, Lampe JW
(2011) Variation of glucoraphanin metabolism
in vivo and ex vivo by human gut bacteria. Br J
Nutr 106(3):408–416
59. de Figueiredo SM, Binda NS, Nogueira-
Machado JA, Vieira-Filho SA, Caligiorne RB
(2015) The antioxidant properties of organo-
sulfur compounds (sulforaphane). Recent Pat
Endocr Metab Immune Drug Discov 9
(1):24–39
60. Meeran SM, Patel SN, Tollefsbol TO (2010)
Sulforaphane causes epigenetic repression of
hTERT expression in human breast cancer cell
lines. PLoS One 5(7):e11457
61. Vázquez L, Flórez AB, Guadamuro L, Mayo B
(2017) Effect of soy isoflavones on growth of
representative bacterial species from the human
gut. Nutrients 9(7):E727. https://doi.org/
10.3390/nu9070727
62. Rowland IR, Wiseman H, Sanders TA,
Adlercreutz H, Bowey EA (2000) Interindivid-
ual variation in metabolism of soy isoflavones
and lignans: influence of habitual diet on equol
production by the gut microflora. Nutr Cancer
36(1):27–32
63. Itsumi M, Shiota M, Takeuchi A, Kashiwagi E,
Inokuchi J, Tatsugami K, Kajioka S,
Uchiumi T, Naito S, Eto M, Yokomizo A
(2016) Equol inhibits prostate cancer growth
through degradation of androgen receptor by
S-phase kinase-associated protein 2. Cancer Sci
107(7):1022–1028
64. Dapito DH, Mencin A, Gwak GY, Pradere JP,
Jang MK, Mederacke I (2001) Promotion of
hepatocellular carcinoma by the intestinal
microbiota and TLR4. Cancer Cell 21
(4):504–516
65. Zhang W, Hong L, Graham DY (2014) An
update on helicobacter pylori as the cause of
gastric cancer. Gastrointest Tumors 1
(3):155–165
66. Moss SF (2016) The clinical evidence linking
helicobacter pylori to gastric cancer. Cell Mol
Gastroenterol Hepatol 3(2):183–191
67. Khalsa J, Duffy LC, Riscuta G, Starke-Reed P,
Hubbard VS (2017) Omics for understanding
the gut-liver-microbiome axis and precision
medicine. Clin Pharmacol Drug Dev 6
(2):176–185
68. Kuntz TM, Gilbert JA (2017) Introducing the
microbiome into precision medicine. Trends
Pharmacol Sci 38(1):81–91
69. Jaeggi T, Kortman GA, Moretti D, Chassard C,
Holding P, Dostal A, Boekhorst J, Timmerman
HM, Swinkels DW, Tjalsma H, Njenga J,
Mwangi A, Kvalsvig J, Lacroix C, Zimmer-
mann MB (2015) Iron fortification adversely
affects the gut microbiome, increases pathogen
abundance and induces intestinal inflammation
in Kenyan infants. Gut 64(5):731–742
70. Riscuta G, Dumitrescu RG (2012) Nutrige-
nomics: implications for breast and colon can-
cer prevention. Methods Mol Biol
863:343–358
71. Urbaniak C, Cummins J, Brackstone M, Mack-
laim JM, Gloor GB, Baban CK, Scott L,
O’Hanlon DM, Burton JP, Francis KP,
Tangney M, Reid G (2014) Microbiota of
human breast tissue. Appl Environ Microbiol
80(10):3007–3014
 Chapter 9

Alcohol-Induced Epigenetic Changes in Cancer

Ramona G. Dumitrescu

Abstract
Chronic, heavy alcohol consumption is associated with serious negative health effects, including the
development of several cancer types. One of the pathways affected by alcohol toxicity is the one-carbon
metabolism. The alcohol-induced impairment of this metabolic pathway results in epigenetic changes
associated with cancer development. These epigenetic changes are induced by folate deficiency and by
products of the ethanol metabolism. The changes induced by long-term heavy ethanol consumption result
in elevations of homocysteine and S-adenosyl-homocysteine (SAH) and reductions in
S-adenosylmethionine (SAM) and antioxidant glutathione (GSH) levels, leading to abnormal promoter
gene hypermethylation, global hypomethylation, and metabolic insufficiency of antioxidant defense
mechanisms. In addition, reactive oxygen species (ROS) generated during the ethanol metabolism induce
alterations in DNA methylation patterns that play a critical role in cancer development. Specific epigenetic
changes in esophageal, hepatic, and colorectal cancers have been detected in blood samples and proposed to
be used clinically as epigenetic biomarkers for diagnosis and prognosis of these cancers. Also, genetic
variants of genes involved in one-carbon metabolism and ethanol metabolism were found to modulate the
relationship between alcohol-induced epigenetic changes and cancer risk. Furthermore, alcohol metabo-
lism products have been associated with an increase in NADH levels, which lead to histone modifications
and changes in gene expression that in turn influence cancer susceptibility. Chronic excessive use of alcohol
also affects selected members of the family of microRNAs, and as miRNAs could act as epigenetic
regulators, this may play an important role in carcinogenesis. In conclusion, targeting alcohol-induced
epigenetic changes in several cancer types could make available clinical tools for the diagnosis, prognosis,
and treatment of these cancers, with an important role in precision medicine.

Key words Heavy alcohol consumption, One-carbon metabolism, Ethanol metabolism, Genetic
variants, DNA methylation, Histone modifications, miRNAs

1 Introduction

The harmful use of alcohol is linked to a large social, economic and

disease burden in many societies, being considered one of the major
causes of mortality and morbidity around the world [1]. Alcohol-
related harm is caused by the volume of alcohol consumed, the
pattern of drinking and the quality of alcohol consumed in some
settings [2].

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_9,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

157
158 Ramona G. Dumitrescu

Chronic, heavy alcohol consumption is associated with serious

negative health effects, including cancer development, heart and
liver disease, several neurological, cognitive and behavior deficits as
well as developmental defects [2]. Several cancer types have been
associated with harmful use of alcohol [3]. The mechanisms of
alcohol-induced toxicity in different cancer types are still not fully
understood. Here, some of these mechanisms are described in more
details, together with the abnormalities of these pathways identified
in several cancer types.

2 Pathways Involved in Alcohol-Induced Epigenetic Changes

One of these mechanisms involved in alcohol toxicity is the

impairment of one-carbon metabolism (OCM) [4]. OCM is a
complex pathway that has two main functions de novo nucleotide
biosynthesis, critical for DNA replication and repair and providing
methyl groups for the methylation reactions [5]. DNA methylation
plays a critical role in gene expression regulation and together with
changes in histone modifications, associated with chromatin remo-
deling, influences the activation and inactivation of genes involved
in important cellular processes from early life with potential effects
into adulthood [6]. Thus, any impairment in the OCM pathway
results in epigenetic changes associated with disease development.
It has been found that the excessive alcohol consumption has
harmful effects by affecting the one-carbon metabolism [7, 8] so
the ethanol-related disruption could induce epigenetic modifica-
tions. These epigenetic changes are induced as a result of folate
deficiency due to alcohol-induced OCM impairment and also by
products of the ethanol metabolism.
Folate is a critical component of OCM and folate deficiency in
those individuals consuming heavy amounts of alcohol, can occur
as result of poor diet, malabsorption, increased urinary excretion,
or a combination of these factors [9, 10]. Both clinical and animal
studies have shown diverse effects of chronic ethanol exposure on
enzymes involved in the methionine metabolism, such as methio-
nine synthase (MS). This ethanol-induced aberrant methionine
metabolism leading to deficiencies of folate and vitamins B-6 and
B-12 have been shown to play a critical role in pathogenesis
[9, 10]. These changes induced by long-term heavy ethanol con-
sumption, result in elevations in homocysteine and S-adenosyl-
homocysteine (SAH) and reductions in S-adenosylmethionine
(SAM) and antioxidant glutathione (GSH) levels [9–11]. Reduced
liver SAM and increase SAH levels due to alcohol-induced reduc-
tion in folate and the inhibition of methionine synthase, can lead to
abnormal epigenetic regulation of genes important for pathogene-
sis pathways, global hypomethylation, and metabolic insufficiency
of antioxidant defense mechanisms [11, 12].
 Alcohol-Induced Epigenetic Changes in Cancer 159

Furthermore, the by-products that can affect the OCM directly

are generated by alcohol dehydrogenase (ADH), cytochrome P450
2E1, or catalase during the ethanol metabolizing process to acetal-
dehyde [13, 14]. Alcohol dehydrogenase is the major enzyme
responsible for the oxidation of ethanol and is present to the largest
extent in the liver [13, 14]. The cytochrome P450 2E1 (Cyp2E1),
that is involved to a lesser extent in the ethanol-oxidizing process, is
found both in liver and other tissues including the brain [15]. In
fact, in vitro studies showed that in the brain, where ADH activity is
low, a high percentage of the acetaldehyde is generated by the
catalase, present throughout the brain, in the peroxisomes and
Cyp2E1 [14, 15]. In fact, it has been found that alcoholics show
deficiency of S-adenosylmethionine, folate, and betaine due to
destruction by acetaldehyde and that the inhibition of the methyl
group transfer are involved in the gene expression regulation in
carcinogenesis [9, 16, 17].
When acetaldehyde is generated by the ethanol metabolism,
reactive oxygen species (ROS) are produced as well. Numerous
studies have showed that ROS could induce genetic mutations
[18]. In addition, ROS could induce epigenetic alterations that
play a critical role in cancer development [18]. DNA lesions
induced by the ROS, such as 8-hydroxyl-2-deoxyguanosine,
8-hydroxyguanine, 8-OHdG, O6-methylguanine and single
stranded DNA have been shown to contribute to alterations in
DNA methylation patterns [19].
First, these products can interfere with the availability of the
DNA, as a substrate for the DNA methyltransferases (DNMTs),
resulting in global hypomethylation [19]. There are several methyl-
transferases responsible for the regulation of DNA methylation,
namely DNMT 1, 2, 3A and 3B, that could be influenced by
these products and then lead to epigenetic modifications.
Furthermore, ROS-induced oxidative stress can contribute to
gene silencing by mechanisms that involve aberrant hypermethyla-
tion of tumor suppressor genes, that once silenced could play a role
in tumor development. It is believed that the promoter hyper-
methylation triggers recruitment of histone deacetylases, histone
methyltransferases, leading to changes in the chromatin structure
so that the transcription factors would not have access to DNA and
then the transcription is repressed. For example, it has been
observed that oxidized products like dimethyl sulfoxide and methi-
onine sulfoxide triggered aberrant methylation-induced gene
silencing [20].
Several tumor suppressor genes such as p16INK4A and
p15INK4B were found to be inactivated via ROS-mediated aber-
rant promoter hypermethylation [21]. Also, the NAD(P)H qui-
none oxidoreductase 1 (NQO1) and glutathione S-transferase P1
(GSTP1) genes (phase II xenobiotic metabolizing enzymes) have
been observed to be inactivated via promoter hypermethylation in
160 Ramona G. Dumitrescu

hepatocellular carcinoma and other cancer types. These findings

indicate the link between the inactivation of antioxidant enzymes,
important in metabolizing ROS generation, and tumor develop-
ment through DNA hypermethylation-induced silencing [19].
Furthermore, the alcohol consumption was associated with
hypermethylation of DNA repair genes like the hMLH1 and
O6-methylguanine-DNA methyltransferase (MGMT), important
for the removal of mutagenic methyl adducts from guanine
[22]. This hypermethylation-induced silencing could affect the
DNA repair process leading to genomic instability, with has critical
role in carcinogenesis.
Moreover, genetic variations of several genes involved in
one-carbon metabolism and ethanol metabolism could also modu-
late the risk of alcohol-associated carcinogenesis. Some of these
polymorphisms and their interactions will be described below for
different cancer types, together with the epigenetic changes
observed.

3 Alcohol and DNA Methylation in Cancer

Many epidemiological studies have shown that alcohol is associated

with tumor suppressor gene promoter hypermethylation and global
DNA hypomethylation in several cancers, including esophageal,
hepatic, and colorectal cancers [23].

3.1 Alcohol and Esophageal carcinoma is the eighth most common cancer world-
Aberrant DNA wide, being one of the leading causes of cancer-related mortality
Methylation in [24]. Esophageal cancers are classified into two histological types,
Esophageal Cancers esophageal squamous cell carcinoma (ESCC), and adenocarci-
noma, with the ESCC being the most frequent diagnosed histolog-
ical type [25]. The incidences of the esophageal cancers types have a
wide geographic distribution, most likely due to difference envi-
ronmental exposures. Both alcohol consumption and cigarette
smoking are major risk factors for the development of ESCC and
it is considered that their synergistic effects on carcinogenesis,
explain more than 61% of ESCC [26, 27]. It was found that cancers
of the oral cavity and pharynx, oesophagus and larynx show a
stronger association with alcohol consumption than cancers of
other organ sites [28]. As discussed above, acetaldehyde is the
most toxic ethanol metabolite but ethanol itself is involved directly
in cancer development by inhibiting DNA methylation and by
interacting with retinoid metabolism.
Several studies have consistently shown that alcohol consump-
tion is an etiological factor of human ESCC [29]. It has been
observed that both local and systemic effects of ethanol may lead
to cancer development, especially among chronic alcoholics
[29]. For oro-esophageal squamous cell carcinoma (OESCC),
 Alcohol-Induced Epigenetic Changes in Cancer 161

there were three mechanisms described to be involved in carcino-

genesis, namely the disturbance of systemic metabolism of nutri-
ents, the disturbance of redox metabolism in squamous epithelial
cells, leading to oxidative damage and the disturbance of signaling
pathways in squamous epithelial cells [30]. As described above,
genetic polymorphisms of ethanol-metabolizing genes, such as
acetaldehyde dehydrogenase (ALDH) and alcohol dehydrogenases
(ADH), are involved in cancer susceptibility and they were found to
be associated with ESCC development, showing their direct
genetic contribution to ESCC risk, especially through the interac-
tion with alcohol consumption [31–33].
The methylation changes observed in ESCC affect several path-
ways involved in carcinogenesis, including cell cycle, DNA damage
repair, Wnt, TGF-β, and NF-κB signaling pathways, with genes like
P16, MGMT, SFRP2, DACH1, and ZNF382 being found hyper-
methylated [29]. DNA hypermethylation of HIN1, TFPI-2,
DACH1, and SOX17 was found in precancerous lesions of the
esophagus, showing the value of DNA methylation as an early
detection biomarker, while the methylation of CHFR and FHIT
genes was associated with a late-stage ESCC tumor, marker of
chemotherapy sensitivity, and poor prognosis. Thus, aberrant pro-
moter methylation of several important genes in ESCC develop-
ment could serve as diagnostic and predictive markers [29].
Further, when the interaction between alcohol and folate was
evaluated in esophageal cancers, a strong positive association
between the risk of ESCC and alcohol consumption of more than
170 g/week was observed [34, 35]. This increased risk of ESCC
associated with alcohol intake was restricted to those with low food
folate intake. For the EAC, the risk associated with high food folate
intake was lower regardless of the level of alcohol intake [35].
Polymorphisms in OCM genes, like methylenetetrahydrofolate
reductase (MTFHR), methionine synthase (MTR) and methionine
synthase reductase (MTRR) have been shown to interact with
alcohol and influence the risk of esophageal cancers and other
gastrointestinal cancers [36–38]. For example, MTHFR 677CT/
TT polymorphism has been reported to increase the risk of esopha-
geal cancer, and the risk is influenced by alcohol, tobacco, and
folate intake [36]. In addition, this preventive effect of folate on
the developing esophageal cancer was observed in different popu-
lations [35, 36].
Furthermore, it has been found that one-carbon metabolism
impairment is important in the head and neck cancers as well. In
fact, a study conducted in the European Prospective Investigation
into Cancer and Nutrition (EPIC) cohort reported that individuals
with elevated circulating levels of homocysteine had higher risk of
developing squamous cell carcinoma of the head and neck [39]. In
addition, the detection of aberrant gene promoter methylation as
diagnosis or prognostic marker have been also described for
162 Ramona G. Dumitrescu

HNSCC, suggesting that the analysis of these biomarkers is an

important step in identifying individuals in the early stages of
head and neck cancer, critical for improving prognosis and long-
term survival [40].

3.2 Alcohol and Hepatocellular carcinoma (HCC) is a major cause of cancer-related

Aberrant Methylation mortality worldwide and several risk factors like viral infection
in Hepatocellular (hepatitis B or C viruses), chronic heavy alcoholism, and exposure
Carcinoma to aflatoxins were found to be involved in the development of HCC
[41]. In the USA, alcohol consumption is considered a major cause
of liver-related disease and deaths [42].
Alcohol-induced epigenetic changes have been well-
characterized contributing factors in the development of liver dis-
ease [42, 43]. As described for other solid tumors, aberrant meth-
ylation, consisting of promoter gene CpG hypermethylation
and/or DNA hypomethylation has been involved in the develop-
ment of HCC. In fact, when the promoter methylation of over
100 putative tumor suppressor genes and global levels of DNA
methylation were analyzed, it was observed that the genome-wide
hypomethylation and CpG hypermethylation were associated with
biological characteristics and specific clinical outcomes in HCC
patients [43].
A study conducting a methylome profiling, showed that a panel
of 36 DNA methylation markers are able to accurately predicts poor
survival in HCC patients [44]. Furthermore, specific methylation
of an independent subset of promoters were found to be associated
with etiological risk factors, including alcohol consumption, with
tumor progression (i.e., stage of the tumor and grade of differenti-
ation), background (i.e., cirrhotic versus non-cirrhotic surrounding
tissue) and survival after cancer therapy, suggesting that these
distinct DNA methylation signatures have the potential to be
used as clinical predictors [45].
In addition, a genome-wide DNA methylation analysis and
gene expression profiling showed that retinol metabolism genes
and SHMT1 are also epigenetically regulated through promoter
DNA methylation and there are several other candidate tumor-
suppressor genes epigenetically regulated in alcohol-associated
hepatocarcinogenesis [46].
Genetic variants of genes involved in OCM, such as MTHFR,
MTR, and TS, have been associated with the risk of developing
HCC. It is considered that these polymorphisms affecting the
enzymatic activity lead to abnormal levels of SAMe and SAH and
their ratio SAMe/SAH, which influences DNA methylation and
then contribute to cancer development [23].
Furthermore, the overall effects of the C677T MTHFR poly-
morphism, for example could only be evaluated if folate levels are
considered. When there is adequate folate supply, the levels of 5,10-
MTHF would increase, which can offset the effects of reduced
 Alcohol-Induced Epigenetic Changes in Cancer 163

SAMe, having a protective effect. However, when there is folate

deficiency the levels of both 5,10-MTHF and SAMe would be
reduced, leading to DNA hypomethylation and chromosomal
instability [23].
Additionally, it has been shown that in hepatocellular carci-
noma (HCC) cell lines, ROS influences the Oct-1, a member of
the POU-domain transcription factor family, which is ubiquitously
expressed, with important role in cell cycle regulation and in sens-
ing for cellular stress [47]. It has been found that the Oct-1, which
acts as an activator of catalase, by binding to the catalase promoter,
can be downregulated through promoter CpG island methylation
by ROS [47]. Thus, ROS-induced methylation of the Oct-1 pro-
moter is another mechanism by which catalase is downregulated
in HCC.
Moreover, when hepatocellular carcinoma cells were exposed
to hydrogen peroxide (H2O2), hypermethylation of the
E-cadherin gene promoter was observed [48]. This was induced
as a result of increasing the expression of Snail, a transcription factor
that downregulates the expression of E-cadherin, leading to the
recruitment of histone deacetylase 1 and DNA methyltransferase
1, involved in the methylation of the promoter region [48]. Fur-
ther, downregulation of E-cadherin has been associated with
epithelial-to-mesenchymal transitions, metastasis, and poor prog-
nosis in hepatocellular carcinoma. Another tumor-suppressor gene
displaying oxidative stress-induced silencing in hepatocellular car-
cinoma, through abnormal promoter methylation, is the SOCS1
gene [49].

3.3 Alcohol and Colorectal cancer is the third most common cancer diagnosed in
Aberrant Methylation both men and women in the USA [50]. Colorectal cancer has been
in Colorectal Cancer linked to heavy alcohol use [50] and it is considered a likely etio-
logic factor for this type of cancer [51]. Therefore, limiting alcohol
use to no more than two drinks a day for men and one drink a day
for women could have many health benefits, including a lower risk
of colorectal cancer [50, 52].
Several studies have shown the role of epigenetic changes in
alcohol-related colorectal carcinogenesis [23]. It was reported that
high alcohol consumption (> or ¼ 15 g alcohol per day) was
associated with increased risk of LINE-1 hypomethylated colon
cancers [53]. Similarly, when the association between alcohol intake
and incident colorectal cancer was evaluated, according to the
tumor methylation level of insulin-like growth factor 2 (IGF2)
differentially methylated region-0 (DMR0), previously associated
with a worse prognosis, it was observed, that the consumption of
15 g alcohol/d was associated with elevated risk of colorectal
cancer exhibiting lower levels of IGF2 DMR0 methylation
[54]. Also, individuals reporting <200 micrograms of folate intake
per day were more likely to develop LINE-1 hypomethylated colon
164 Ramona G. Dumitrescu

cancers than those reporting more than 400 micrograms folate

intake per day [53]. In addition, several studies suggested that
low folate intake and high alcohol intake may be associated with
changes in promoter hypermethylation of APC-1A, p14ARF,
p16INK4a, hMLH1, O6-MGMT, and RASSF1A genes, involved
in colorectal cancer carcinogenesis [55]. Furthermore, promoter
hypermethylation of numerous tumor suppressor genes identified
in colorectal cancers have been proposed as potential biomarkers
for colorectal cancer diagnosis [56].
When the association between genetic variants of one-carbon
metabolism genes like MTHFR, MTR, and TS, and colon cancer
risk has been studied, it was found that these polymorphisms inter-
act with alcohol drinking to influence colorectal cancer develop-
ment [57]. Moreover, it was found that the variant allele for the
MTHFR C677 T polymorphism was linked to increased risk for
proximal colon cancer but decreased risk for distal cancers. Also, the
increased risk for proximal cancers was more pronounced in older
individuals, in those with a low folate intake and high alcohol
consumption [58].
Furthermore, when the association between folate, alcohol
intake, and MTHFR C677T polymorphism and the risk of colo-
rectal cancer was studied in the Korean population, it was observed
that low folate intake together with high alcohol intake increased
the risk of colon cancer and the effect of dietary methyl groups on
colorectal cancer development could differ according to MTHFR
C677T genotype and the subsite of origin in the Korean population
[59]. In addition, another study suggested that the genetic poly-
morphism MTHFR A1298AC, interacting with folate and alcohol
consumption, may play a role in the development of highly
CpG-methylated colon cancers [60].

4 Histone Modifications: Acetylation, Phosphorylation, and Methylation

The modification of histone amino acid residues by methylation,

acetylation and phosphorylation can alter the conformation of the
histone leading to gene activation or repression. In fact, the alcohol
metabolism products have been associated with an increase in
NADH levels, which lead to histone modifications. The increase
levels of NADH affects SIRT1 activity, leading to the activation
and/or silencing of genes’ expression [11, 12]. It is known that
histone acetylation results in transcriptional activation, whereas
deacetylation is associated with gene silencing [61]. In fact, when
the effects of environmental factors on histone modifications and
their role in tumorigenesis were studied, it was observed that
H3Me3K4 and H3Me2K9 were the most frequently reported
histone modifications and these changes were affected by environ-
mental factors including alcohol exposure [62]. This suggests that
 Alcohol-Induced Epigenetic Changes in Cancer 165

the environmental stressors change gene expression by inducing

histone modifications and that will play an important role in cancer
susceptibility.
In alcoholic liver disease (ALD), methylation at H3K4,
H3K36, and H3K79 was observed to lead to gene activation,
while methylation at histone residues H3K9, H327, and H4K20
were associated with gene silencing [63]. For example, in vitro
studies have shown that increased H3K4 was associated with
increased activation of genes involved in oxidative stress and
decreased H3K9 methylation was associated with downregulation
of genes [64, 65].
Furthermore, histone modifications, such as the methylation of
H3 histone at specific lysine positions, K4, K9, and K27 and acety-
lation of lysines on H3 histone at positions K4, K9, and K18 were
described in oral cancers. In addition, methylation at H3K27 was
associated with the size of tumor, nodal status, tumor stage, and
perineural invasion [66]. Histone 2 variant γ-H2A.X was also
observed in oral cancers and oral dysplastic tissue, suggesting that
the γ-H2A.X variant is binding to DNA repair proteins in the
dysplastic tissue, so that the early therapeutic targeting of the
DNA damage response (DDR) may play an important role in the
prevention of OSCC [67].
In addition, several enzymes like the histone deacetylases
(HDACs) that regulate the amount of acetylation on histone tails,
have been shown to be involved in growth arrest, differentiation,
cytotoxicity, and apoptosis [66]. HDAC 6 was found to be over-
expressed in oral cancers and the expression levels were associated
with tumor aggressiveness [68]. Chromatin assembly factor-1
(CAF-1), a histone chaperone, that acts as an epigenetic regulator
of chromatin organization during DNA replication was found to be
associated with prognosis in oral cancer patients [69].
In HCC, there are several histone modifications, including the
Patt1 (a GNAT family acetyltransferase) downregulation, which
leads to inactivation of apoptotic genesthat affects the apoptotic
potential of cancerous hepatocytes [70]. Another study showed
that high H3K4diMe expression is rare in hepatocellular carcinoma
when compared to hepatobiliary and gastrointestinal carcinomas,
which potentially helps with the differential diagnosis. It was con-
cluded that the lack of H 3K4diMe is most likely due to the
epigenetic regulation involving methylase, Ash2 and the demethy-
lase, LSD1 [71].
Moreover, in alcohol-associated HCCs it is suggested that
abnormal histone modification downregulates CYP2E1 gene
expression and that CYP2E1-dependent mitochondrial oxidative
stress plays a role in apoptosis in human hepatocellular carcinoma
(HCC) cell lines [13].
In conclusion, different environmental exposures, including
alcohol consumption lead to several histones modifications and
166 Ramona G. Dumitrescu

the crosstalk between these modifications play an important role in

cancer initiation and progression.

5 miRNA as Epigenetic Modulators

Numerous studies have shown that miRNAs play a critical role in

essential biological events, including development, proliferation,
differentiation, cell fate determination, apoptosis, signal transduc-
tion, organ development, hematopoietic lineage differentiation,
and carcinogenesis [72, 73]. MiRNAs act as epigenetic modulators,
especially at the posttranscriptional level, playing an important role
in gene expression regulation [74]. More specifically, the miRNAs
can degrade specific mRNAs or can inhibit the translation process
by affecting mechanisms such as initiation, elongation, degrada-
tion, or segregation of mRNA into P bodies [75–77].
Like protein-coding genes, miRNAs can either promote or
suppress tumor formation, based on their role by negatively reg-
ulating their targets, thus being classified as tumor suppressors or
oncogenes [78, 79]. Also, it was observed that about 50% of
miRNA genes are located in regions of the genome linked to cancer
development or in fragile sites, which suggests the importance of
miRNAs in carcinogenesis [78]. Interestingly, when the miRNA
expression was analyzed in different cancer types, it was observed
that there is a set of miRNAs constantly deregulated in tumors, or a
cancer specific miRNA-regulatory network [80]. The identification
of this network shows how dysregulated miRNAs affect oncogenic
processes across different cancer types.
Importantly, the miRNA alterations in tumors can be evaluated
in serum, plasma or sputum, suggesting their potential use as tumor
biomarkers for poor prognosis, metastasis and response to antitu-
moral treatment [81].
The miRNAs have been observed to be involved in the disrup-
tion of neural stem cell proliferation and differentiation in the
exposed fetus, gut leakiness, leading to endotoxemia and alcoholic
liver disease, and possibly hepatocellular carcinomas and other
gastrointestinal cancers. It is also believed that the miRNAs could
be mediators of ethanol’s effects on inflammation as well as the
potential diagnostic biomarkers and targets for alcohol related
therapeutic interventions [82].
Several studies have shown that miRNAs play an important role
in controlling post-transcriptional modifications and influencing
gene expression in liver diseases like the viral hepatitis, alcoholic
fatty liver disease and nonalcoholic fatty liver disease (NAFLD),
fibrosis, and hepatocellular carcinoma [83, 84]. It has been
observed that chronic excessive alcohol affects selected members
of the family of microRNAs, like miRNA-155 and miRNA-212,
 Alcohol-Induced Epigenetic Changes in Cancer 167

resulting in an abnormal miRNA profile in the liver of those with

alcoholic liver disease (ALD) [85, 86].
Furthermore, it has been shown that the miRNAs are an
important component of the epigenetic changes that regulates the
transcription and translation of protein-coding gene networks and
they are involved in both developmental and adult effects of alcohol
consumption [87].
In fact, it is believed that miRNAs are involved in the regulation
of epigenetic-modifying enzymes such as DNA methyltransferases
or histone deacetylases. Also, aberrant methylation of miRNA-
associated CpG islands have been observed [79, 88].
For example, a miRNA cluster located on chromosome
19q31.41, named C19MC, was found to have the paternal allele
imprinted, and the maternal allele silenced by methylation [89]. In
HCCs, C19MC cluster was overexpressed and genetic amplifica-
tion of the corresponding locus was observed [89]. In addition,
these high levels of C19MC miRNA were found to be associated
with poor clinical outcomes, increased tumor recurrence and
shorter survival time [89].
Moreover, a complex relationship between epigenetic and
miRNA expression changes was observed in HCC. More specifi-
cally, it was found that hypomethylation of the miR-191 locus leads
to high expression of mir-191, which induces the transition to
hepatocellular carcinoma [90]. On the other hand, DNA hyper-
methylation was involved in silencing of miR-1, miR-124,
miR-125b, and miR-203 [91]. Also, changes in the expression of
miR-29, miR-152, and miR-200a were found to affect DNA meth-
ylation and histone modifications in HCC [91].
Thus, numerous studies have shown that there are cancer-
specific miRNA epigenetic signatures [79, 88], so targeting the
epigenetic regulation of miRNAs could provide the basis for new
therapeutic strategies in cancer [92] with an important role in
precision medicine.

6 Conclusions

This chapter describes the effects of alcohol on metabolic pathways

involved in cancer development and progression. Understanding
the alcohol-induced epigenetic changes, such DNA methylation,
histone modifications, and cancer-specific epigenetic miRNAs sig-
natures could provide critical information about the potential tar-
gets for a more precise cancer prevention and treatment. Thus,
targeting alcohol-induced epigenetic changes in several cancer
types could make available clinical tools for the diagnosis, progno-
sis, and treatment of these cancers, with an important role in
precision medicine.
168 Ramona G. Dumitrescu
References
1. World Health Organization (WHO) (2014)
Global Status Report on Alcohol and Health.
p. XIV. 2014 ed. Available at: http://www.
who.int/substance_abuse/publications/
global_alcohol_report/msb_gsr_2014_1.pdf?
ua¼1. Last Accessed 21 Sept 2017
2. World Health Organization (WHO) (2014)
Global Status Report on Alcohol and Health.
p. XIII. 2014 ed. Available at: http://www.
who.int/substance_abuse/publications/
global_alcohol_report/msb_gsr_2014_1.pdf?
ua¼1. Last Accessed 21 Sept 2017
3. American Cancer Society (2017) Cancer facts
and figures 2017. Available at: https://www.
cancer.org/research/cancer-facts-statistics/
all-cancer-facts-figures/cancer-facts-figures-
2017.html. Last Accessed 21 Sept 2017
4. Kruman II, Fowler AK (2014) Impaired one
carbon metabolism and DNA methylation in
alcohol toxicity. J Neurochem 129
(5):770–780
5. Stover PJ (2009) One-carbon metabolism-
genome interactions in folate-associated
pathologies. J Nutr 139:2402–2405
6. Szyf M (2011) The early life social environ-
ment and DNA methylation: DNA methyla-
tion mediating the long-term impact of social
environments early in life. Epigenetics 6
(8):971–978
7. Giovannucci E (2004) Alcohol, one-carbon
metabolism, and colorectal cancer: recent
insights from molecular studies. J Nutr 134
(9):2475S–2481S
8. Kharbanda KK (2009) Alcoholic liver disease
and methionine metabolism. Semin Liver Dis
29(2):155–165
9. Seitz HK, Stickel F (2009) Molecular mechan-
isms of alcohol-mediated carcinogenesis. Nat
Rev Cancer 7(8):599–612
10. Halsted CH, Medici V (2011) Vitamin-
dependent methionine metabolism and alco-
holic liver disease. Adv Nutr 2(5):421–427
11. Halsted CH, Medici V (2012) Aberrant
hepatic methionine metabolism and gene
methylation in the pathogenesis and treatment
of alcoholic steatohepatitis. Int J Hepatol
2012:959746
12. Zakhari S (2013) Alcohol metabolism and epi-
genetics changes. Alcohol Res 35(1):6–16
13. Yang H, Nie Y, Li Y, Wan YJ (2010a) Histone
modification-mediated CYP2E1 gene expres-
sion and apoptosis of HepG2 cells. Exp Biol
Med (Maywood) 235(1):32–39
14. Cederbaum AI (2012) Alcohol metabolism.
Clin Liver Dis 16(4):667–685
15. Zimatkin SM, Pronko SP, Vasiliou V, Gonzalez
FJ, Deitrich RA (2006) Enzymatic mechanisms
of ethanol oxidation in the brain. Alcohol Clin
Exp Res 30(9):1500–1505
16. Lu SC, Mato JM (2005) Role of methionine
adenosyltransferase and S-adenosylmethionine
in alcohol-associated liver cancer. Alcohol 35
(3):227–234
17. Mason JB, Choi SW (2005) Effects of alcohol
on folate metabolism: implications for carcino-
genesis. Alcohol 35(3):235–241
18. Ziech D, Franco R, Pappa A, Panayiotidis MI
(2011) Reactive oxygen species (ROS)--
induced genetic and epigenetic alterations in
human carcinogenesis. Mutat Res 711
(1–2):167–173
19. Franco R, Schoneveld O, Georgakilas AG,
Panayiotidis MI (2008) Oxidative stress,
DNA methylation and carcinogenesis. Cancer
Lett 266(1):6–11
20. Kawai K, Li YS, Song MF, Kasai H (2010)
DNA methylation by dimethyl sulfoxide and
methionine sulfoxide triggered by hydroxyl
radical and implications for epigenetic modifi-
cations. Bioorg Med Chem Lett 20
(1):260–265
21. Toyokuni S (2008) Molecular mechanisms of
oxidative stress-induced carcinogenesis: from
epidemiology to oxygenomics. IUBMB Life
60(7):441–447
22. Puri SK, Si L, Fan CY, Hanna E (2005) Aber-
rant promoter hypermethylation of multiple
genes in head squamous cell carcinoma. Am J
Otolaryngol 26:12–17
23. Varela-Rey M, Woodhoo A, Martinez-Chantar
ML, Mato JM, Lu SC (2013) Alcohol, DNA
methylation, and cancer. Alcohol Res 35
(1):25–35
24. Ferlay J, Soerjomataram I, Dikshit R, Eser S,
Mathers C, Rebelo M, Parkin DM, Forman D,
Bray F (2015) Cancer incidence and mortality
worldwide: sources, methods and major pat-
terns in GLOBOCAN 2012. Int J Cancer 136
(5):E359–E386
25. Pennathur A, Gibson MK, Jobe BA, Luketich
JD (2013) Oesophageal carcinoma. Lancet
381(9864):400–412
26. Pelucchi C, Gallus S, Garavello W, Bosetti C,
La Vecchia C (2006) Cancer risk associated
with alcohol and tobacco use: focus on upper
aero-digestive tract and liver. Alcohol Res
Health 29(3):193–198
27. Anantharaman D, Marron M, Lagiou P,
Samoli E, Ahrens W, Pohlabeln H, Slamova A,
Schejbalova M, Merletti F, Richiardi L,
 Alcohol-Induced Epigenetic Changes in Cancer
Kjaerheim K, Castellsague X, Agudo A,
Talamini R, Barzan L, Macfarlane TV,
Tickle M, Simonato L, Canova C, Conway
DI, McKinney PA, Thomson P, Znaor A,
Healy CM, McCartan BE, Hashibe M,
Brennan P, Macfarlane GJ (2011) Population
attributable risk of tobacco and alcohol for
upper aerodigestive tract cancer. Oral Oncol
47(8):725–731
28. Bagnardi V, Blangiardo M, La Vecchia C, Cor-
rao G (2001) A meta-analysis of alcohol drink-
ing and cancer risk. Br J Cancer 85
(11):1700–1705
29. Ma K, Cao B, Guo M (2016) The detective,
prognostic, and predictive value of DNA meth-
ylation in human esophageal squamous cell
carcinoma. Clin Epigenetics 8:43
30. Liu Y, Chen H, Sun Z, Chen X (2015) Molec-
ular mechanisms of ethanol-associated oro-e-
sophageal squamous cell carcinoma. Cancer
Lett 361(2):164–173
31. Oze I, Matsuo K, Suzuki T, Kawase T,
Watanabe M, Hiraki A, Ito H, Hosono S,
Ozawa T, Hatooka S, Yatabe Y, Hasegawa Y,
Shinoda M, Kiura K, Tajima K, Tanimoto M,
Tanaka H (2009) Impact of multiple alcohol
dehydrogenase gene polymorphisms on risk of
upper aerodigestive tract cancers in a Japanese
population. Cancer Epidemiol Biomark Prev
18(11):3097–3102
32. Tanaka F, Yamamoto K, Suzuki S, Inoue H,
Tsurumaru M, Kajiyama Y, Kato H, Igaki H,
Furuta K, Fujita H, Tanaka T, Tanaka Y,
Kawashima Y, Natsugoe S, Setoyama T,
Tokudome S, Mimori K, Haraguchi N,
Ishii H, Mori M (2010) Strong interaction
between the effects of alcohol consumption
and smoking on oesophageal squamous cell
carcinoma among individuals with ADH1B
and/or ALDH2 risk alleles. Gut 59
(11):1457–1464
33. Wu C, Kraft P, Zhai K, Chang J, Wang Z, Li Y,
Hu Z, He Z, Jia W, Abnet CC, Liang L, Hu N,
Miao X, Zhou Y, Liu Z, Zhan Q, Liu Y, Qiao Y,
Zhou Y, Jin G, Guo C, Lu C, Yang H, Fu J,
Yu D, Freedman ND, Ding T, Tan W, Gold-
stein AM, Wu T, Shen H, Ke Y, Zeng Y, Cha-
nock SJ, Taylor PR, Lin D (2012) Genome-
wide association analyses of esophageal squa-
mous cell carcinoma in Chinese identify multi-
ple susceptibility loci and gene-environment
interactions. Nat Genet 44(10):1090–1097
34. Pandeya N, Williams G, Green AC, Webb PM,
Whiteman DC (2009) Alcohol consumption
and the risks of adenocarcinoma and squamous
cell carcinoma of the esophagus. Gastroenter-
ology 136:1215–1224
169
35. Ibiebele TI, Hughes MC, Pandeya N, Zhao Z,
Montgomery G, Hayward N, Green AC,
Whiteman DC, Webb PM, Study of Digestive
Health; Australian Cancer Study (2011) High
intake of folate from food sources is associated
with reduced risk of esophageal cancer in an
Australian population. J Nutr 141(2):274–283
36. Liu YX, Wang B, Wan MH, Tang WF, Huang
FK, Li C (2011) Meta-analysis of the relation-
ship between the Metholenetetrahydrofolate
reductase C677T genetic polymorphism, folate
intake and esophageal cancer. Asian Pac J Can-
cer Prev 12(1):247–252
37. Zhao P, Lin F, Li Z, Lin B, Lin J, Luo R (2011)
Folate intake, methylenetetrahydrofolate
reductase polymorphisms, and risk of esopha-
geal cancer. Asian Pac J Cancer Prev 12
(8):2019–2023
38. Chang SC, Chang PY, Butler B, Goldstein BY,
Mu L, Cai L, You NC, Baecker A, Yu SZ,
Heber D, Lu QY, Li L, Greenland S, Zhang
ZF (2014) Single nucleotide polymorphisms of
one-carbon metabolism and cancers of the
esophagus, stomach, and liver in a Chinese
population. PLoS One 9(10):e109235
39. Fanidi A, Relton C, Ueland PM, Midttun O,
Vollset SE, Travis RC, Trichopoulou A,
Lagiou P, Trichopoulos D, Bueno-de-Mes-
quita HB, Ros M, Boeing H, Tumino R,
Panico S, Palli D, Sieri S, Vineis P, Sánchez
MJ, Huerta JM, Barricarte Gurrea A, Luján-
Barroso L, Quiros JR, Tjønneland A,
Halkjær J, Boutron-Ruault MC, Clavel-
Chapelon F, Cadeau C, Weiderpass E,
Johansson M, Riboli E, Brennan P, Johansson
M (2015) A prospective study of one-carbon
metabolism biomarkers and cancer of the head
and neck and esophagus. Int J Cancer 136
(4):915–927
40. Arantes LM, de Carvalho AC, Melendez ME,
Carvalho AL, Goloni-Bertollo EM (2014)
Methylation as a biomarker for head and neck
cancer. Oral Oncol 50(6):587–592
41. American Cancer Society (2017) Cancer Facts
and Figures 2017. pg17 Available at: https://
www.cancer.org/research/cancer-facts-statis
tics/all-cancer-facts-figures/cancer-facts-
figures-2017.html. Last Accessed 21 Sept 2017
42. Moghe A, Joshi-Barve S, Ghare S,
Gobejishvili L, Kirpich I, McClain CJ, Barve S
(2011) Histone modifications and alcohol-
induced liver disease: are altered nutrients the
missing link? World J Gastroenterol 17
(20):2465–2472
43. Calvisi DF, Ladu S, Gorden A, Farina M, Lee
JS, Conner EA, Schroeder I, Factor VM, Thor-
geirsson SS (2007) Mechanistic and prognostic
significance of aberrant methylation in the
170 Ramona G. Dumitrescu
molecular pathogenesis of human hepatocellu-
lar carcinoma. J Clin Invest 117(9):2713–2722
44. Villanueva A, Portela A, Sayols S, Battiston C,
Hoshida Y, Mendez-Gonzalez J, Imbeaud S,
Letouze E, Hernandez-Gea V, Cornella H,
Pinyol R, Sole M, Fuster J, Zucman-Rossi J,
Mazzaferro V, Esteller M, Llovet JM, HEP-
TROMIC Consortium (2015) DNA
methylation-based prognosis and epidrivers in
hepatocellular carcinoma. Hepatology 61
(6):1945–1956
45. Hernandez-Vargas H, Lambert MP, Le Calvez-
Kelm F, Gouysse G, McKay-Chopin S, Tavti-
gian SV, Scoazec JY, Herceg Z (2010) Hepato-
cellular carcinoma displays distinct DNA
methylation signatures with potential as clinical
predictors. PLoS One 5(3):e9749
46. Udali S, Guarini P, Ruzzenente A, Ferrarini A,
Guglielmi A, Lotto V, Tononi P, Pattini P,
Moruzzi S, Campagnaro T, Conci S,
Olivieri O, Corrocher R, Delledonne M, Choi
SW, Friso S (2015) DNA methylation and gene
expression profiles show novel regulatory path-
ways in hepatocellular carcinoma. Clin Epige-
netics 7:43
47. Quan X, Lim SO, Jung G (2011) Reactive
oxygen species downregulate catalase expres-
sion via methylation of a CpG island in the
Oct-1 promoter. FEBS Lett 585
(21):3436–3441
48. Lim SO, Gu JM, Kim MS, Kim HS, Park YN,
Park CK, Cho JW, Park YM, Jung G (2008)
Epigenetic changes induced by reactive oxygen
species in hepatocellular carcinoma: methyla-
tion of the E-cadherin promoter. Gastroenter-
ology 135(6):2128–2140 2140.e1-8
49. Zhao RC, Zhou J, He JY, Wei YG, Qin Y, Li B
(2016) Aberrant promoter methylation of
SOCS-1 gene may contribute to the pathogen-
esis of hepatocellular carcinoma: a meta-
analysis. J BUON 21(1):142–151
50. American Cancer Society. Cancer Facts & Fig-
ures 2017. Pg32 Available at: https://www.can
cer.org/research/cancer-facts-statistics/all-
cancer-facts-figures/cancer-facts-figures-2017.
html. Last Accessed 21 Sept 2017
51. Baan R, Straif K, Grosse Y, Secretan B, El
Ghissassi F, Bouvard V, Altieri A, Cogliano V,
WHO International Agency for Research on
Cancer Monograph Working Group (2007)
Carcinogenicity of alcoholic beverages. Lancet
Oncol 8(4):292–293
52. United States Department of Agriculture
(2016) Dietary Guidelines for Americans
2015–2020. https://health.gov/
dietaryguidelines/2015/guidelines/
53. Schernhammer ES, Giovannucci E,
Kawasaki T, Rosner B, Fuchs CS, Ogino S
(2010) Dietary folate, alcohol and B vitamins
in relation to LINE-1 hypomethylation in
colon cancer. Gut 59(6):794–799
54. Nishihara R, Wang M, Qian ZR, Baba Y,
Yamauchi M, Mima K, Sukawa Y, Kim SA,
Inamura K, Zhang X, Wu K, Giovannucci EL,
Chan AT, Fuchs CS, Ogino S, Schernhammer
ES (2014) Alcohol, one-carbon nutrient
intake, and risk of colorectal cancer according
to tumor methylation level of IGF2 differen-
tially methylated region. Am J Clin Nutr 100
(6):1479–1488
55. van Engeland M, Weijenberg MP, Roemen
GM, Brink M, de Bruine AP, Goldbohm RA,
van den Brandt PA, Baylin SB, de Goeij AF,
Herman JG (2003) Effects of dietary folate and
alcohol intake on promoter methylation in spo-
radic colorectal cancer: the Netherlands cohort
study on diet and cancer. Cancer Res 63
(12):3133–3137
56. Ng JM, Yu J (2015) Promoter hypermethyla-
tion of tumour suppressor genes as potential
biomarkers in colorectal cancer. Int J Mol Sci
16(2):2472–2496
57. Matsuo K, Ito H, Wakai K, Hirose K, Saito T,
Suzuki T, Kato T, Hirai T, Kanemitsu Y,
Hamajima H, Tajima K (2005) One-carbon
metabolism related gene polymorphisms inter-
act with alcohol drinking to influence the risk
of colorectal cancer in Japan. Carcinogenesis
26(12):2164–2171
58. Iacopetta B, Heyworth J, Girschik J, Grieu F,
Clayforth C, Fritschi L (2009) The MTHFR
C677T and DeltaDNMT3B C-149T poly-
morphisms confer different risks for right- and
left-sided colorectal cancer. Int J Cancer 125
(1):84–90
59. Kim J, Cho YA, Kim DH, Lee BH, Hwang DY,
Jeong J, Lee HJ, Matsuo K, Tajima K, Ahn YO
(2012) Dietary intake of folate and alcohol,
MTHFR C677T polymorphism, and colorec-
tal cancer risk in Korea. Am J Clin Nutr 95
(2):405–412
60. Curtin K, Slattery ML, Ulrich CM, Bigler J,
Levin TR, Wolff RK, Albertsen H, Potter JD,
Samowitz WS (2007) Genetic polymorphisms
in one-carbon metabolism: associations with
CpG island methylator phenotype (CIMP) in
colon cancer and the modifying effects of diet.
Carcinogenesis 28(8):1672–1679
61. Lane AA, Chabner BA (2009) Histone deace-
tylase inhibitors in cancer therapy. J Clin Oncol
27(32):5459–5468
62. Dik S, Scheepers PT, Godderis L (2012)
Effects of environmental stressors on histone
modifications and their relevance to
 Alcohol-Induced Epigenetic Changes in Cancer
carcinogenesis: a systematic review. Crit Rev
Toxicol 42(6):491–500
63. Mandrekar P (2011) Epigenetic regulation in
alcoholic liver disease. World J Gastroenterol
17(20):2456–2464
64. Bardag-Gorce F, Oliva J, Dedes J, Li J, French
BA, French SW (2009) Chronic ethanol feed-
ing alters hepatocyte memory which is not
altered by acute feeding. Alcohol Clin Exp
Res 33(4):684–692
65. Pal-Bhadra M, Bhadra U, Jackson DE,
Mamatha L, Park PH, Shukla SD (2007) Dis-
tinct methylation patterns in histone H3 at
Lys-4 and Lys-9 correlate with up- & down-
regulation of genes by ethanol in hepatocytes.
Life Sci 81(12):979–987
66. D’Souza W, Saranath D (2015) Clinical impli-
cations of epigenetic regulation in oral cancer.
Oral Oncol 51(12):1061–1068
67. Chou SJ, Alawi F (2011) Expression of DNA
damage response biomarkers during oral carci-
nogenesis. Oral Surg Oral Med Oral Pathol
Oral Radiol Endod 111(3):346–353
68. Sakuma T, Uzawa K, Onda T, Shiiba M,
Yokoe H, Shibahara T, Tanzawa H (2006)
Aberrant expression of histone deacetylase
6 in oral squamous cell carcinoma. Int J
Oncol 29(1):117–124
69. Staibano S, Mascolo M, Rocco A, Lo Muzio L,
Ilardi G, Siano M, Pannone G, Vecchione ML,
Nugnes L, Califano L, Zamparese R, Bufo P,
De Rosa G (2011) The proliferation marker
chromatin assembly Factor-1 is of clinical
value in predicting the biological behaviour of
salivary gland tumours. Oncol Rep 25
(1):13–22
70. Herceg Z, Paliwal A (2011) Epigenetic
mechanisms in hepatocellular carcinoma: how
environmental factors influence the epigen-
ome. Mutat Res 727(3):55–61
71. Magerl C, Ellinger J, Braunschweig T,
Kremmer E, Koch LK, Höller T, Büttner R,
Lüscher B, Gutgemann I (2010) H3K4
dimethylation in hepatocellular carcinoma is
rare compared with other hepatobiliary and
gastrointestinal carcinomas and correlates with
expression of the methylase Ash2 and the
demethylase LSD1. Hum Pathol 41
(2):181–189
72. Kloosterman WP, Plasterk RH (2006) The
diverse functions of microRNAs in animal
development and disease. Dev Cell
11:441–450
73. Fontana L, Sorrentino A, Condorelli G,
Peschle C (2008) Role of microRNAs in hae-
mopoiesis, heart hypertrophy and cancer. Bio-
chem Soc Trans 36:1206–1210
171
74. Chekulaeva M, Filipowicz W (2009) Mechan-
isms of miRNA-mediated post-transcriptional
regulation in animal cells. Curr Opin Cell Biol
21:452–460
75. Humphreys DT, Westman BJ, Martin DI, Pre-
iss T (2005) MicroRNAs control translation
initiation by inhibiting eukaryotic initiation
factor 4E/cap and poly(A) tail function. Proc
Natl Acad Sci U S A 102:16961–16966
76. Liu J, Valencia-Sanchez MA, Hannon GJ,
Parker R (2005) MicroRNA-dependent locali-
zation of targeted mRNAs to mammalian
P-bodies. Nat Cell Biol 7:719–723
77. Nottrott S, Simard MJ, Richter JD (2006)
Human let-7a miRNA blocks protein produc-
tion on actively translating polyribosomes. Nat
Struct Mol Biol 13:1108–1114
78. Zhang B, Pan X, Cobb GP, Anderson TA
(2007) microRNAs as oncogenes and tumor
suppressors. Dev Biol 302(1):1–12
79. Baer C, Claus R, Plass C (2013) Genome-wide
epigenetic regulation of miRNAs in cancer.
Cancer Res 73(2):473–477
80. Plaisier CL, Pan M, Baliga NS (2012) A
miRNA-regulatory network explains how dys-
regulated miRNAs perturb oncogenic pro-
cesses across diverse cancers. Genome Res 22
(11):2302–2314
81. Miozzo M, Vaira V, Sirchia SM (2015) Epige-
netic alterations in cancer and personalized
cancer treatment. Future Oncol 11
(2):333–348
82. Miranda RC, Pietrzykowski AZ, Tang Y,
Sathyan P, Mayfield D, Keshavarzian A,
Sampson W, Hereld D (2010) MicroRNAs:
master regulators of ethanol abuse and toxicity?
Alcohol Clin Exp Res 34(4):575–587
83. Bala S, Marcos M, Szabo G (2009) Emerging
role of microRNAs in liver diseases. World J
Gastroenterol 15(45):5633–5640
84. Szabo G, Bala S (2013) MicroRNAs in liver
disease. Nat Rev Gastroenterol Hepatol 10
(9):542–552
85. Bala S, Marcos M, Kodys K, Csak T,
Catalano D, Mandrekar P, Szabo G (2011)
Up-regulation of microRNA-155 in macro-
phages contributes to increased tumor necrosis
factor {alpha} (TNF{alpha}) production via
increased mRNA half-life in alcoholic liver dis-
ease. J Biol Chem 286(2):1436–1444
86. Szabo G, Satishchandran A (2015) Micro-
RNAs in alcoholic liver disease. Semin Liver
Dis 35(1):36–42
87. Miranda RC (2014) MicroRNAs and ethanol
toxicity. Int Rev Neurobiol 115:245–284
88. Kunej T, Godnic I, Ferdin J, Horvat S, Dovc P,
Calin GA (2011) Epigenetic regulation of
172 Ramona G. Dumitrescu
microRNAs in cancer: an integrated review of
literature. Mutat Res 717(1–2):77–84
89. Augello C, Vaira V, Caruso L, Destro A,
Maggioni M, Park YN, Montorsi M,
Santambrogio R, Roncalli M, Bosari S (2012)
MicroRNA profiling of hepatocarcinogenesis
identifies C19MC cluster as a novel prognostic
biomarker in hepatocellular carcinoma. Liver
Int 32(5):772–782
90. He Y, Cui Y, Wang W, Gu J, Guo S, Ma K, Luo
X (2011) Hypomethylation of the hsa-miR-
191 locus causes high expression of hsa-mir-
191 and promotes the epithelial-to-mesenchy-
mal transition in hepatocellular carcinoma.
Neoplasia 13(9):841–853
91. Pogribny IP, Rusyn I (2014) Role of epigenetic
aberrations in the development and progres-
sion of human hepatocellular carcinoma. Can-
cer Lett 342(2):223–230
92. Van Roosbroeck K, Calin GA (2017) Cancer
hallmarks and MicroRNAs: the therapeutic
connection. Adv Cancer Res 135:119–149
 Chapter 10

Epigenetic Basis of Circadian Rhythm Disruption in Cancer

Edyta Reszka and Shanbeh Zienolddiny

Abstract
Self-sustained and synchronized to environmental stimuli, circadian clocks are under genetic and epigenetic
regulation. Recent findings have greatly increased our understanding of epigenetic plasticity governed by
circadian clock. Thus, the link between circadian clock and epigenetic machinery is reciprocal. Circadian
clock can affect epigenetic features including genomic DNA methylation, noncoding RNA, mainly miRNA
expression, and histone modifications resulted in their 24-h rhythms. Concomitantly, these epigenetic
events can directly modulate cyclic system of transcription and translation of core circadian genes and
indirectly clock output genes. Significant findings interlocking circadian clock, epigenetics, and cancer have
been revealed, particularly in breast, colorectal, and blood cancers. Aberrant methylation of circadian gene
promoter regions and miRNA expression affected circadian gene expression, together with 24-h expression
oscillation pace have been frequently observed.

Key words Circadian rhythm, Circadian genes, DNA methylation, miRNA, Histone modification,
Cancer

1 Circadian Rhythm: An Introduction

Cyclic changes of various processes in metabolism, physiology, and

behavioral activity are one of the features that characterize living
organisms. They are named circadian rhythm, because they oscillate
with a period of approximately 24 h, namely circadian. This intrin-
sic mechanism plays a crucial role in adaptation to ever-changing
environmental stimuli. Their rhythmic or random alterations pos-
sess capacity to reset or activate the internal central and peripheral
clocks. Thus, lifestyle factors, such as a high-fat diet, low physical
activity, short sleep during the night, stimulants such as smoking or
alcohol consumption, and also occupational factors such as shift
work with exposure to light at night (LAN) may result in disruption
of the circadian clock rhythmicity, also known as
chronodisruption [1].
In mammals, the circadian timing system relies on multiple
oscillators. It is governed by the central autonomous clock, located

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_10,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

173
174 Edyta Reszka and Shanbeh Zienolddiny

in the suprachiasmatic nucleus (SCN) of the hypothalamus, with

neuronal connections to retina. Circadian rhythmicity generated in
SCN is synchronized to external cues which interact with the
peripheral clocks by sending signals to various cells of the body
tissues [2]. These endogenous, cell-autonomous, and self-sustained
peripheral clocks in humans play the role of basic controller, adjust-
ing several molecular, biochemical, and physiological processes in
response to environmental light and temperature changes resulting
in the adaptation of sleep–wake cycles, body temperature, energy
metabolism, cell cycle, and hormone secretion according to time of
day or seasonal changes [3].

2 Molecular Mechanism of Circadian Rhythm

The mammalian circadian clock evolved in several genes forming

interlocking transcriptional–translational feedback loops involving
various genes and their proteins with an intrinsic period close to
24 h [4, 5]. Until now, around 20 candidate genes associated with
the generation and maintenance of circadian rhythm in SCN and
peripheral tissues have been identified and intensively investigated
[5]. The main key players of core circadian clock include among
others CLOCK [6], BMAL1 (ARNTL, MOP3) [7], PER1, PER2,
PER3 [8], CRY1, CRY2 [9], BMAL2 [10] and NPAS2 [11],
NR1D1 (REV-ERB alpha) [12], RORA [13] (Table 1).
Molecular clock constitutes a very complex network of motifs
necessary for generating independent and self-sustained circadian
rhythm. It creates three interlocking feedback loops and it is
observed not only in the SCN, but in nearly every mammalian
tissue [14]. Circadian rhythm is generated and mediated by three
autoregulatory transcriptional–translational feedback loops, all
involve positive and negative trans- and cis-regulatory elements:
morning-time E-box or E’-box (CACGT[G/T]), day-time D-box
(TTA[T/C]GTAA), and night-time ROR elements (RRE) ([A/T]
A[A/T]NT[A/G]GGTCA) [15–18]. Three clock-controlled
loops include the E-box transcription factors (BMAL1, BMAL2,
CLOCK, NPAS2), inhibitors of E-box activated transcription
(CRY1, CRY2, PER1, PER2, PER3, DEC1, DEC2), nuclear
receptors of RRE (RORA, RORB, RORC, NR1D1, NR1D2),
and D-box transcription factors (DBP, E4BP4, TEF, HLF) [17]
(Fig. 1).
CLOCK and BMAL1 form a heterodimer that binds to the
E-box elements on the promoters of PER and CRY genes and
activates their expression. In turn PER and CRY proteins accumu-
late to a critical level and form complexes with CLOCK/BMAL1 or
NPAS/BMAL1 heterodimers and thereby repress the transcription
of their own genes [19]. NR1Ds (REV-ERBs) and RORs, two
retinoic acid-related orphan nuclear receptors constitute the
 Epigenetics and Circadian Rhythm 175

Table 1
Circadian genes in humans

Gene
Gene ID Official full name Function
E-box transcription factors
1 ARNTL 406 Aryl hydrocarbon receptor nuclear Encodes aryl hydrocarbon receptor
translocator like or brain and muscle nuclear translocator-like protein 1;
ARNT-like 1; BMAL1, MOP3 basic helix-loop-helix (bHLH)
transcription factor belonging to
the PAS (PER, ARNT, SIM)
superfamily; forms heterodimer
with CLOCK or NPAS2; PER and
CRY expression activator
2 ARNTL2 56938 Aryl hydrocarbon receptor nuclear Forms heterodimer with CLOCK or
translocator like 2; BMAL2, MOP9 NPAS2; PER and CRY expression
activator
3 CLOCK 9575 Clock circadian regulator Encodes circadian locomoter output
cycles protein kaput; forms
heterodimer with ARNTL; PER
and CRY expression activator
4 NPAS2 4862 Neuronal PAS domain protein 2 Forms heterodimer with ARNTL;
PER and CRY expression activator
Repressors of E-box driven transcription
5 PER1 5187 Period circadian clock 1 Encodes period circadian protein
homolog 1; CLOCK and ARNTL
repressor
6 PER2 8864 Period circadian clock 2 Encodes period circadian protein
homolog 2; CLOCK and ARNTL
repressor
7 PER3 8863 Period circadian clock 3 Encodes period circadian protein
homolog 3; CLOCK and ARNTL
repressor
8 CRY1 1407 Cryptochrome circadian clock 1 Encodes cryptochrome-1; CLOCK
and ARNTL repressor
9 CRY2 1408 Cryptochrome circadian clock 2 Encodes cryptochrome-2; CLOCK
and ARNTL repressor
10 BHLHE40 8553 Basic helix-loop-helix family member Encodes class E basic helix-loop-helix
e40; DEC1 protein 40; interact with ARNTL
or compete for E-box binding sites
in the promoter of PER1
11 BHLHE41 79365 Basic helix-loop-helix family member Encodes class E basic helix-loop-helix
e41; DEC2 protein 41; interact with ARNTL
or compete for E-box binding sites
in the promoter of PER1

(continued)
176 Edyta Reszka and Shanbeh Zienolddiny

Table 1
(continued)

Gene
Gene ID Official full name Function
Nuclear receptors
12 NR1D1 9572 Nuclear receptor subfamily 1 group D Encodes REV-ERB alpha; ARNTL
member 1 repressor
13 NR1D2 9975 Nuclear receptor subfamily 1 group D Encodes nuclear receptor REV-ERB
member 2 beta; ARNTL repressor
14 RORA 6095 Retinoic acid RAR related orphan Encodes nuclear receptor
receptor A ROR-alpha; ARNTL activator
15 RORB 6096 RAR related orphan receptor B Encodes nuclear receptor ROR-beta;
ARNTL activator
16 RORC 6097 RAR related orphan receptor C Encodes nuclear receptor
ROR-gamma; ARNTL activator
D-box binding transcription factors
17 DBP 1628 D-box binding PAR bZIP Encodes albumin D-element-binding
transcription factor protein; member of the PAR
(proline and acidic amino acid-
rich) subfamily of basic region/
leucine zipper (bZIP) transcription
factors; D-box activator
18 TEF 7008 TEF, PAR bZIP transcription factor Encodes thyrotrophic embryonic
factor; D-box activator
19 HLF 3131 HLF, PAR bZIP transcription factor Encodes human hepatic leukemia
factor; D-box activator
20 NFIL3 4783 Nuclear factor, interleukin Encodes nuclear factor interleukin-3-
3 regulated; E4BP4 regulated protein; D-box
repressor; PER1 and PER2
expression repressor
Post-translational modificators
21 CSNK1E 1454 Casein kinase 1 epsilon PERs, CRYs, and ARNTL
phosphorylation
22 CSNK1D 1453 Casein kinase 1 delta PERs, CRYs, and ARNTL
phosphorylation
23 FBXL3 26224 F-box and leucine-rich repeat protein CRYs phosphorylation-dependent
3 ubiquitination and degradation
Others
24 TIMELESS 8914 Timeless circadian clock Interacts with PER genes
25 TIPIN 54962 TIMELESS interacting protein Binds TIMELESS
Source: https://www.ncbi.nlm.nih.gov/gene/
 Epigenetics and Circadian Rhythm 177

CRY1,2
PER1,2,3

NPAS2 HLF
BMAL1,2 TEF
CLOCK DBP
RORA,B,C

5’ D-box E-box RRE CCG 3’

NR1D1,2 NFIL3

DEC1,2

Fig. 1 Circadian promoter elements: E-box, D-box, ROR-element (RRE) and their
activators and repressors in clock-controlled gene (CCG) transcription

stabilizing loop by competing to bind to RRE in BMAL1. While

RORs activate transcription of BMAL1, REV-ERBs repress the
same transcription process [12, 13]. The third, D-box driven auxil-
iary loop provides the circadian oscillation of PERs with positive
(DBP, TEF, and HLF) and negative (NFIL3) elements [20–22]
(Fig. 2).
Another level of regulation occurs post-translationally and cir-
cadian proteins undergo specific modifications required for loops
maintaining. Briefly, in the cytoplasm PERs and CRYs are phos-
phorylated by casein kinases CSNK1E and CSNK1D and accumu-
lated clock proteins are then translocated into the nucleus where in
the form of a protein complex they inhibit BMAL1 expression.
Apart from phosphorylation, posttranslational modifications also
include acetylation, sumoylation, and ubiquitination that contrib-
ute to controlling the level of proteins, nuclear shuttle trafficking,
proteasomal degradation in the cytoplasm, and repressor activity
of core clock components. FBXL3 is a critical enzyme that regu-
lates the core circadian proteins which functions through
phosphorylation-dependent ubiquitination of the proteins
[22, 23] (Table 1).
Two other genes important for molecular regulation of the
circadian pathway are TIMLESS and TIMELESS interacting
(TIPIN) genes that are regarded to be additional clock genes
outside of the three main transcriptional–translational loops.
Although the influence of TIMLESS on circadian rhythm has
been demonstrated, it appears to play additional role. It is regarded
that TIMELESS provides important functions in molecular clock
and cell cycle, contributing an important role in cancer develop-
ment [24] (Table 1).
178 Edyta Reszka and Shanbeh Zienolddiny

RORA DBP

CLOCK CRY

BMAL 1 PER

NR1D1 NFIL3

Fig. 2 Schematic diagram of the transcriptional–translational feedback loops in

circadian clock

3 Circadian Rhythm in the Mammalian Transcriptome

Circadian rhythms of gene expression occur widely in peripheral

tissues. Several human and rodent data indicate a vast and diverse
level of transcripts controlled by the peripheral circadian clock.
High-throughput analyses have proved that circadian genes are
crucial in controlling the expression of a variety of genes involved
in multiple biological processes with possible implications for can-
cer in particular, and health in general [25–27]. The main mecha-
nism of circadian control of gene expression relies mainly on
CLOCK and BMAL1 triggering genome-wide expression of
clock-controlled genes (CCGs) [28]. For example, cyclic 24-h
expression of many key genes involved in rate-limiting steps in
various metabolic pathways, including energy metabolism and
xenobiotic detoxification underlies molecular regulation by clock-
controlled transcription factors [29, 30].
Primary microarray studies have shown that up to 7–21% of
mammalian transcriptome in peripheral tissues present circadian
oscillation [31–33]. Microarray studies of transcriptomes across
12 mouse organs over time showed that 43% of the mouse
protein-coding genome is rhythmic in at least one organ, and in
an organ-specific manner. For example, liver presented the most
CCGs, followed by kidney and lung, whereas brain regions had the
 Epigenetics and Circadian Rhythm 179

fewest CCGs. Importantly, only ten genes oscillated in all 12 mouse

organs, including seven core clock genes: Arntl, Dbp, Nr1d1,
Nr1d2, Per1, Per2, and Per3 [34].
The human blood transcriptome was also found to present
daily variation in expression at 6.4–8.8% [35, 36]. Circadian
rhythm of human transcriptome strongly adapts to environmental
stimuli such as sleep disturbances. Reduction of rhythmic blood
transcripts due to sleep delaying was attenuated from 6.4% at
baseline to only 1.0%. Importantly, sleep pattern changes led to
reduction of circadian transcripts, including among others core
clock genes CLOCK, BMAL1, PER3. Nonetheless, the circadian
hormone melatonin level was not affected by sleep disturbances
[35]. Moreover, insufficient sleep also affected among others, cir-
cadian genes PER1, PER2, PER3, CRY2, CLOCK, NR1D1,
NR1D2, RORA, DEC1, and CSNK1E in human blood
transcriptome [36].

4 Circadian Rhythm and Epigenetics

Epigenetics refers to mechanisms that act to integrate genetic back-

ground with environmental signals in order to provide adaptation
to various internal mechanisms like aging, but also including intrin-
sic circadian clock. Epigenetic modifications are responsible to
regulate gene expression without alterations of the nucleotide
sequence in DNA and they refer to both heritable, as well as
nonheritable changes. There are different levels of epigenetic regu-
lation that includes DNA methylation, posttranscriptional modifi-
cations by noncoding RNAs (ncRNA), histone modifications and
nucleosome positioning, consequently affecting DNA and chroma-
tin structure, respectively [37]. Apart from genetic transcriptio-
nal–translational feedback loops and posttranslational control of
several core clock proteins, complex clock controlled genome inter-
play may also include epigenetic regulation. Indeed, there is
increasing evidence showing modulation of the core circadian
genes through various epigenetic regulatory mechanisms. Con-
comitantly, it has been hypothesized that the majority of expressed
genes are under epigenetic control in a circadian 24-h manner as a
response to endogenous and external environmental stimuli
[38]. This hypothesis was supported by the findings that only
22% of cycling transcripts in a mouse liver has been driven by de
novo transcription. Thus, it reveals that transcriptional, posttran-
scriptional, and posttranslational mechanisms underlie the mam-
malian circadian clock, including histone modification, DNA
methylation, and ncRNA expression [39]. Thus, understanding
the interplay between circadian clock in peripheral tissues of mam-
mals with an epigenetic control of gene expression seems to be
essential, especially in cancer development.
180 Edyta Reszka and Shanbeh Zienolddiny

4.1 DNA Methylation The mechanism of circadian DNA methylation and also DNA
methylation in maintaining of core circadian clock has been ran-
domly investigated. DNA methylation occurs mainly as a reversible
event, because recent findings show that DNA methylation reveals
rather dynamic nature of epigenetic machinery [40]. Moreover,
DNA methylation comprises epigenetic modulation to drive circa-
dian clock plasticity in response to environmental stimuli.

4.1.1 Circadian Rhythm Several rodent and human studies clearly indicate that DNA meth-
in DNA Methylation ylation undergoes circadian alteration during 24 h. Analysis of
human genomic DNA methylation showed a significant rhythmic-
ity with increased levels at night [41]. To compare, global DNA and
long interspersed nucleotide element-1 (LINE-1) methylation
levels in mouse livers displayed a daily variation with the similar
patterns observed in humans, i.e., the peak phases occurred during
the end of the day and the lowest level at the beginning of the day in
the light–dark or dark–dark cycles [42]. Interestingly, aberrations
of core clock genes significantly affected DNA methylation. Per1
and Per2 double knockout mouse possessed induced DNA methyl-
ation accompanied with loss of the rhythmicity of global DNA
methylation [42]. To add, after shortened day to 22 h in mouse,
it was observed aberrant methylation of circadian genes in SCN of
the hypothalamus. Among differentially methylation regions, Cry1
and Per2 hypermethylation was observed, while Clock promoter
region was hypomethylated [43].
Light seems to be necessary to generate cyclic DNA methyla-
tion. Azzi et al. revealed efficient plasticity of epigenome in mouse
SCN after exposure to a shortened lighting environment (22-h day
instead of regular 24-h) [43]. Shortened daily period stably alters
the genetically determined period of circadian behavior in the SNC.
Altered global transcription accompanied with genome-wide meth-
ylation profiling revealed global alterations in promoter DNA
methylation. Importantly, behavioral, transcriptional, and DNA
methylation changes were reversible after prolonged reentrainment
to 24 h, indicating plasticity of this epigenetic event [43]. For
comparison, genome-wide epigenetic analysis in liver and SCN of
mouse kept in constant darkness, did not indicate alterations in
DNA methylation [43, 44]. Moreover, sleep loss also poses a broad
impact on the epigenetic landscape of the cereberal cortex of mouse
brain, with DNA methylation and hydroxymethylation
modifications [45].
Desynchronization of sleep–wake timing and LAN exposure,
such as occurs in shift work is associated with disruption of circa-
dian clock rhythmicity. Recent epidemiological studies investigat-
ing shift work and the epigenetic profile, showed differentially
methylated CpG sites within the circadian genes as well as several
other genes involved in various molecular and cellular pathways
[46, 47]. To add, aberrant DNA methylation with a decrease in
 Epigenetics and Circadian Rhythm 181

global methylation in around 39% was observed in short

day-acclimated mice with injected murine breast tumor cells [48].
Nevertheless, the role of circadian DNA methylation in
humans is still uncertain. A recent study showed evidence of signif-
icant daily rhythmicity of DNA methylation in the human brain. In
postmortem human dorsolateral prefrontal cortex samples from
738 subjects it was observed 24-h rhythmicity of 420,132 DNA
methylation sites throughout the genome [49]. Interestingly, 24-h
rhythms of DNA methylation were observed particularly near tran-
scription start site (TSS) that was enriched for high-amplitude
rhythmic DNA methylation sites [49].
One of the mechanisms by which DNA methylation oscillates
in a diurnal manner may rely on aberrant expression and/or activity
of DNA methyltransferase (DNMT), but also accessibility of
methyl donors. Notably, zebularine, a DNMT inhibitor caused
suppression of period changes in mouse SCN [43]. Methyl group
donors that are necessary for DNA methylation, including homo-
cysteine showed a significant daily rhythm with an evening peak and
nocturnal nadir in humans [41]. Indeed, S-adenosyl homocysteine
(SAH) and S-adenosyl methionine (SAM) levels presented daily
variation in mouse livers, but the ratio of SAM to SAH had no
influence on the DNA methylation level. Additionally, recent find-
ings showed that over 50% of mouse liver metabolites are circadian,
with enrichment of nucleotide, amino acid, and methylation path-
ways, e.g., methylation compounds methyl thioadenosine (MTA)
and SAH that play a role in epigenetic regulation. Importantly,
genetic perturbations of human cells show that rhythmicity of
metabolites depends on circadian clock [50].

4.1.2 Clock Genes Cytosine DNA methylation is a stable epigenetic mark that is
Methylation in Cancer critical for cancer and may be considered as one of the hallmarks
of carcinogenesis [51]. The epigenetic status of clock genes often
correlates with gene expression and aberrant promoter methylation
of circadian genes. Circadian gene silencing has been implicated as
an important feature of cancer, because disruption of circadian
homeostasis frequently leads to this pathologic condition. Thus,
core clock genes may be involved directly and also indirectly in
several critical molecular pathways in carcinogenesis due to regula-
tion of cancer-related CCGs. This includes apoptosis, metastatic
capability, cell cycle arrest, metabolism, DNA damage/repair, cell
proliferation, maintenance of genomic stability, inflammation, and
oxidative stress [52–55]. For example, large scale genomic analysis
showed that a total of 515 CpG sites of aberrantly methylated genes
were mainly associated with cancer-relevant pathways in CRY2
knockdown breast cancer cell line [56]. Current findings on
deregulated methylation of BMAL1, CLOCK, CRY1, CRY2,
PER1, PER2, PER3, RORA, and TIMELESS circadian genes in
182 Edyta Reszka and Shanbeh Zienolddiny

Table 2
Circadian gene promoter methylation in human cancer

Gene Cancer site References

Hypermethylation
BMAL1 Ovarian cancerb, acute lymphoblastic leukemia and non-Hodgkin [68, 78, 80]
lymphomac, T cell acute lymphoblastic leukemiab
CRY1 Breast cancera, endometrial cancera, chronic lymphocytic leukemiac, [58, 70, 73, 77]
hepatocarcinomaa,d
CRY2 Breast cancerc,d [59, 61]
PER1 Breast cancera,d,e, endometrial cancera, hepatocarcinomaa,d, [57, 58, 60, 70,
lung cancera 71, 73, 74]
PER2 Endometrial cancera, chronic myeloid leukemiac, gliomaa [70, 75, 76, 79]
c a
PER3 Chronic myeloid leukemia , hepatocarcinoma [72, 79]
c
RORA Gastric cancer [65]
Hypomethylation
CLOCK Breast cancerc [62]
b c
PER1 Cerevical cancer , colorectal cancer [69]
b
PER2 T cell acute lymphoblastic leukemia [68]
c
PER3 Colorectal cancer [67]
TIMELESS Breast cancerc [64]
Promoter methylation in tumors of patients, human cancer cell line, blood of patients, ER
vs ERþ tumors, eER
/
a b c d

PR
vs ERþ/PRþ tumors

clinical specimens and also human cell lines point out toward
hypermethylation rather than hypomethylation of circadian gene
promoter sites in human cancers (Table 2).
The majority of circadian gene promoter analyses were con-
ducted on breast cancer tumors in comparison to adjacent normal
tissue indicating significant increase in PER1, CRY1, and CRY2
hypermethylation, often accompanied with deregulated gene
expression [57–61]. Increased DNA hypermethylation was asso-
ciated with ER
and/or PR
status of breast tumors [58, 60,
61]. Only CLOCK presented hypomethylation in blood of breast
cancer patients compared with controls [62], while CRY2 was
hypermethylated in blood [63]. Hypomethylation of TIMELESS
in blood significantly associated with advanced stages of the disease
and poorer breast cancer prognosis [64]. Epigenetic alterations in
the promoter region of DNA in blood of gastric cancer patients
were related with increased RORA methylation [65], while in the
second study there were no differences in RORA methylation
measured in blood of gastric patients versus controls
 Epigenetics and Circadian Rhythm 183

[66]. Additionally, PER1 and PER2 were frequently methylated in

blood of colorectal cancer patients [67]. Hypomethylation was also
observed in PER2 promoter region in T cell acute lymphoblastic
leukemia cells [68] and PER1 promoter in cells derived from
cervical tumors [69]. Elevated hypermethylation in PER1 and
PER2 was observed in endometrial cancers [70, 71], hepatocarci-
noma [72, 73], lung cancer [74], and glioma [75, 76]. BMAL1,
CRY1, PER2, and PER3 genes were found to be hypermethylated
in various hematologic malignancies [68, 77–79]. It is worth to
noting that three high-throughput DNA methylation studies of
cancer cell lines and human specimens indicated that PER1 is
epigenetically silenced in breast cancer [60], PER3 in hepatocarci-
noma [72] and BMAL1 in ovarian cancer [80].
To provide full insight in circadian gene methylation status it
was noticed that the methylation status of clock gene promoters
varied between individuals. In forensic autopsy specimens the pro-
moters of BMAL1, CLOCK, PER1, CRY2, and CSNK1E were
unmethylated in all the forensic autopsy specimens, while the pro-
moters of CRY1, PER2, PER3, and TIMLESS were partially
methylated [81]. Similarly, different cell lines may present various
methylation frequencies in promoter site of a particular circadian
gene, e.g., PER1 in cervical cancer cell lines [69], CRY1, PER1,
and PER3 in hepatocellular carcinoma [73] and BMAL1 in
non-Hodgkin lymphoma [78]. Moreover, circadian genes methyl-
ation seems to be cancer specific, like in the case of BMAL1 fre-
quently methylated in cell lines derived from hematologic
malignancies, but not in solid tumors [78].
Interestingly, several studies on human cell lines clearly show
that methylation status of circadian genes directly affects their
expression, because treatment of the cell lines with 5-aza-2-
0
-deoxycytidine (5-aza-dC) to demethylate the gene resulted in
increase of mRNA levels. Inhibition of DNMT activity, mediated
by 5-aza-dC treatment leads to reversion of CpG sites methylation.
5-aza-dC intercalates with DNA during S phase of cell cycle and
after being recognized by DNMT, it forms a covalent irreversible
complex with the enzyme, and blocks DNMT function [82]. It was
found that 5-aza-dC treatment restored or enhanced PER3 expres-
sion in human hepatocellular carcinomas [72], CRY2 expression in
breast tumors [61], PER1 and PER2 gene expression in various
cancer cell lines [68, 69]. PER2 oscillation within a day in the acute
lymphoplastic leukemia cell lines was restored with this demethy-
lating agent treatment [68], indicating that promoter hypermethy-
lation of circadian genes is responsible not only for gene silencing,
but circadian gene 24-h circadian rhythm. Moreover, 5-aza-dC-
induced recovery of circadian gene expression level and DNA
methylation alterations may depend on the rapid response to
demethylation, and thus it provides an important feature to clinical
strategies for cancer treatment, especially in hematological cancers.
184 Edyta Reszka and Shanbeh Zienolddiny

4.2 Noncoding RNAs Noncoding RNA transcripts (ncRNAs), constituting almost 98% of
human genome, were demonstrated to play a significant role in
various pathological processes, including carcinogenesis. It is
regarded that micro RNAs (miRNAs) and also long noncoding
RNA (lncRNAs) possess capacity to act as putative negative regu-
lators of gene expression at transcriptional, posttranscriptional, and
epigenetic level of the target genes [83].
Growing evidence suggests daily oscillation in ncRNA expres-
sion profiles, mainly miRNA, but also its important role in main-
taining circadian rhythmicity driven by circadian clock regulation.
miRNAs have been identified as critical modulators of core clock
gene expression and its posttranscriptional mechanisms, and there-
fore are also involved in regulation of circadian clock output func-
tions. Unfortunately only a few studies have focused on the role of
such modification in human cancer.

4.2.1 Circadian Rhythm Similar to transcriptional expression, recent findings reveal occur-
in Noncoding RNA rence of both 24-h cyclic and also noncyclic expression of miRNAs.
Rhythmic expressions have been found to be characteristic to
ncRNA, including miRNA. Comprehensive study of 12 mouse
tissues revealed that 32% of conserved ncRNAs oscillated in at
least one organ, whereas nonconserved ncRNAs were less likely to
oscillate. Oscillating expression was observed in more than 1000
known and novel ncRNAs, some of them recognized as miRNA.
Interestingly, ncRNAs conserved between mouse and human
showed rhythmic expression in similar proportions as protein cod-
ing genes [34]. Moreover, several ncRNAs including miRNA tran-
scripts also showed circadian oscillations in adult mouse livers
[44]. Genomic location analysis in mouse liver showed intronic
region of circadian genes with higher abundance of cyclic than
noncyclic miRNAs targeting these genes, while other 30 untranlated
region (3’-UTR), exon and intergenic regions showed no differ-
ence in targeting by specific miRNAs [84].

4.2.2 miRNA Regulation It has been revealed that miRNA activity may alter circadian rhyth-
of Core Circadian Genes micity in mammals. Brain-specific miR-219 and miR-132 are
expressed rhythmically [85]. miR-219 exhibits robust circadian
rhythms of expression, while miR-132 is induced by photic entrain-
ment. Collectively, these data reveal miRNAs as clock- and light-
regulated genes and provide a mechanistic examination of their
roles as effectors of pacemaker activity and entrainment
[85]. Indeed, miR-132 is associated with homeostasis restoring
and resetting the induction of clock genes caused by LAN-related
alteration of the circadian clock. Nocturnal light triggers the chro-
matin remodeling gene methyl CpG binding protein 2 (MeCP2),
which activates among others the transcription of core clock genes
Per1 and Per2. Additionally, it was also shown that miR-132 likely
regulates a number of target genes that are involved in chromatin
 Epigenetics and Circadian Rhythm 185

remodeling and translational control in mouse SCN [86]. Circadian

clock initiators, Clock and Bmal1, showed inversely correlated cir-
cadian expression patterns against their corresponding miRNAs,
miR-181d and miR-191, targeting them in mouse liver. In con-
trast, circadian suppressors Pers, Crys, Csnk1s, and Nr1ds exhibited
positively correlated circadian expression patterns to their
corresponding miRNAs. Moreover, specific miRNAs and their tar-
gets present concordant 24-h expression profile [84]. Importantly,
it was also observed that miRNAs provide an essential mechanism
in generating the delay of circadian clock due to translational
control of Pers in cytoplasm in mice cells. Interestingly miRNA
activity can lead to changes in circadian period, e.g., miR-132 is
capable of shortening circadian period in SNC [85]. The exoge-
nous expression of miR-192/194 shortens the length of the circa-
dian period in a cellular system through the simultaneous inhibition
of all Per genes [87]. Interestingly, the period shortening was
caused by faster PER1 and PER2 translation in the globally
miRNA deficient human cells [88]. Based on a system-theoretical
approach it was found that miR-206 has a profound effect on the
dynamic mechanism of the mammalian circadian clock, both by
controlling of the amplitude and control or alteration of the fre-
quency to affect the level of the gene expression and to interfere
with the temporal sequence of the gene production or
delivery [89].

4.2.3 Noncoding RNA, The importance of regulatory mechanisms of circadian rhythm by

Circadian Genes, miRNAs in human cancer has been widely investigated. The tem-
and Cancer poral expression of miRNAs was recently observed in human breast
cell lines after circadian clock resetting through serum shock
entrainment. Moreover, miRNAs specificity was also noted,
because regardless of rhythmic expression of hundreds of miRNAs
exhibited in each malignant and nonmalignant breast cell line,
distinct sets of miRNAs were characteristic for two or three cell
lines [90]. Changes in peripheral clocks are significantly related to
miRNA expression disturbances. Using human cancer cell lines, the
miR-192/194 cluster was identified as a potent inhibitor of the
entire PER gene family. Interestingly, various human cell lines,
including cancer-derived cells expressed various levels of
miR-192/194, whereas in fibroblast cells NIH2T3, miR-192,
and miR-194 were almost undetectable [87]. Additionally, it was
found that circadian disruption in rat mammary gland tissues [91]
and human nonmalignant and malignant cancer cell lines [90, 92]
can modulate miRNA expression level and amplitude. To add,
miRNA expression together with 24-h amplitude may be regulated
by light at night and also by melatonin secretion. For example,
downregulation of miR-219 was found in blood of night shift
workers compared to day workers [93]. After whole-genome
186 Edyta Reszka and Shanbeh Zienolddiny

Table 3
Noncoding RNA (miRNA, lncRNA) expression and their circadian gene targets in human cancer

Target gene ncRNA downregulated ncRNA upregulated Cancer site References

ncRNA expression
CLOCK let-7e-5p Colorectal cancera [95]
NPAS2 miR-140-3p
PER1 let-7e-5p, miR-125b-5p,
miR-99b-5p
RORA miR-125b-5p, miR-99b-5p
NR1D2 miR-19b-3p
TIMELESS miR-140-3p, miR-99b-5p, miR-19b-3p
miR-139-5p
TIPIN miR-125b-5p
ncRNA correlationb
CLOCK " miR-124 Gliomac [96]
PER1 # miR-192, miR-194 Colorectal cancerd
[97]
PER1 # miR-34a Cholangiocarcinoma c
[92]
PER3 # miR-103 Colorectal cancerc [98]
TIMELESS " miR-139-5p Colorectal cancere
[95]
CLOCK " lncHULC Hepatocarcinoma c
[99]
a
As compared to nontumor tissues, data from microarray repositories and clinical specimens
b
Up-regulation " or down-regulation # of circadian genes
c
Clinical specimens and human cancer cell lines
d
Data from The Cancer Genome Atlas (TCGA)
e
Clinical specimens

miRNA and mRNA expression, 22 miRNAs were differentially

expressed in melatonin-treated human MCF-7 breast cancer cells
[94]. High-throughput genome-wide miRNA analysis of mam-
mary gland in rats showed differentially expressed miRNAs that
potentially target Cry2, Clock, Npas2, and Timeless circadian
genes [91].
Only few studies have focus on ncRNA-driven targeting core
clock genes in gastrointestinal human cancers and gliomas. Never-
theless, these findings reveal that miRNAs and also lncRNAs may
play crucial roles in perturbing circadian rhythm in cancer
[92, 95–99] (Table 3). In general, negative correlation patterns
between miRNA and target circadian mRNA was observed that
may indicate that circadian genes play suppressive roles in mainly
gastrointestinal cancers. Data obtained in silico were validated in
colorectal cancer patients and human colorectal cancer cell lines
 Epigenetics and Circadian Rhythm 187

indicated severe alterations of clock gene-related coding–noncod-

ing RNA regulatory networks in tumor tissues, which were later
corroborated by the analysis of human colorectal cancer specimens,
and also experiments performed in vitro. Specific miRNAs can
target and regulate the transcription and translation of clock
genes. Moreover, clock gene-related miRNA
miRNA interactions
as well as mRNA
miRNA interactions were found to be altered in
colorectal cancer [95].
Based on data extracted from The Cancer Genome Atlas
(TCGA) database, it was observed downregulation of PER1 linked
to upregulation of miR-192 and miR-194 expression in colorectal
cancer. In survival analyses, high miR-192 and miR-194 correlated
with better overall survival in Stage II patients, but worse survival in
more advanced Stage III/IV patients [97]. PER1 was verified as a
target of miR-34a that inhibits PER1 expression in human cholan-
giocarcinoma cells. miR-34a was rhythmically expressed in both
malignant and nonmalignant cholangiocytes, but its expression in
cancer cells was significantly higher than in nonmalignant cells. The
inhibition of miR-34a decreased proliferation, migration, and inva-
sion in cholangiocarcinoma cells [92]. It was found that PER3 was
targeted, at least partially, by miR-103 and PER3 was downregu-
lated in colorectal cancer tissues and cell lines, whereas miR-103
was upregulated in colorectal cancer cell lines [98].
In contrast to PER1 and PER3 in human cancer, CLOCK and
TIMELESS expression level was increased. CLOCK, a direct target
of miR-124 was significantly upregulated in high-grade human
glioma tissues and glioblastoma cell lines, while miR-124 expres-
sion was attenuated in similar samples [96]. Upregulation of TIME-
LESS with concomitant downregulation of its miR-139-5p was
found in colorectal cancer specimens [95].
Recently, new insights into the mechanisms by which lncRNA
may influence cancer through disturbing circadian rhythm have
occurred. The only study so far has focused on the role of lncRNAs
in circadian rhythm in hepatocellular carcinoma. It was found that
an lncRNA highly upregulated in liver cancer (lncHULC) contri-
butes to upregulation of the expression levels of CLOCK in human
cancer cells and also clinical hepatocellular carcinoma samples.
CLOCK levels were higher in HCC tissues compared with adjacent
tissues. Strikingly, lncHULC disturbed rhythm is different in hepa-
toma and normal cells, e.g., altered the expression pattern and
prolonged the periodic expression of CLOCK in hepatocellular
carcinoma cells [99].
Specific miRNAs comprise important modulators of circadian
rhythm by mediating posttranscriptional/epigenetic regulation of
key clock genes and miRNAs have been found to be implicated
in initiation and progression of various human cancers. Impor-
tantly, it can provide new insights into potential mechanisms of
188 Edyta Reszka and Shanbeh Zienolddiny

carcinogenesis. To sum up, miRNAs can be involved in the molec-

ular clock through (1) direct binding to 3’-UTR regions [87] in
mRNA of circadian genes or indirect regulation of clock translation
[86], (2) alterations in rhythmic expression of miRNA [88] and
controlling 24-h amplitude of clock genes transcription and trans-
lation [86], and finally (3) concomitant changes of miRNAs and
their target clock genes [84].

4.3 Histone Circadian organization of the mammalian transcriptome is achieved

Modification by rhythmic recruitment of key modifiers of chromatin structure.
Several studies clearly indicate that core clock genes and clock
output genes underlay rhythmic histone modifications. Circadian
24-h rhythm of histone modifications and chromatin conforma-
tional rearrangements play crucial roles in maintaining the periph-
eral circadian clocks [39, 100]. For example histone methylation
[101] and acetylation [39, 100] have been found to be vital for
driving and modulation of circadian gene expression of core clock
genes and clock output genes, which may be critical for tissue
physiology and homeostasis. Furthermore, core circadian genes
are regulated by histone phosphorylation [102], acetylation
[100, 103, 104], and methylation [101, 105]. CLOCK, BMAL1,
and CRY1 bind in a cyclic manner to regulatory regions of CCGs
that are accompanied by rhythmic changes in methylation and
acetylation of H3 residues that are characteristic for active promoter
regions, while BMAL1 and PER2 were found to be specific targets
for SIRT1 deacetylase, which represses transcription of various
CCGs [106, 107]. Interestingly, the central key player in molecular
clock, transcription factor CLOCK enables additional regulation of
output clock genes expression due to its intrinsic histone acetyl-
transferase (HAT) activity directed to BMAL1 acetylation and acet-
ylation of H3K9 and H3K14 residues [108, 109]. SIRT1, HDAC3
histone deacetylases, MLL1 and MLL3 histone methyltransferases
are recruited to promoter regions of CCGs in a circadian manner.
CLOCK interacts with MLL1 via histone H3 methylation, which
subsequently leads to the transcription induction of core clock
genes [105]. MLL3 contributes to histone methylation by modu-
lation of core circadian gene and CCG expression [101].
Studies at the genome scale in mouse liver show that rhythmic
transcription in mouse genome was accompanied with circadian
oscillations in multiple histone modifications and recruitment of
multiple chromatin-associated clock components [44]. To add,
robust modification of histone H3 around the transcription start
site of expressed genes reveals that cyclic transcription may be
associated with DNA methylation at promoter regions [39]. Tran-
script oscillation in mouse liver was also found to be often corre-
lated with rhythmic histone modifications in promoters, gene
bodies, or enhancers; nonetheless, promoter DNA methylation
was relatively stable [44].
 Epigenetics and Circadian Rhythm 189

Adaptation to environmental stimuli may also affect histone

modification and therefore influencing gene expression. For exam-
ple insufficient sleep causes significant reduction of rhythmic
expression of genes associated with chromatin modification [35]
and sleep reduction attenuated expression of genes affected chro-
matin modification in human blood [36].

5 Human Epigenetic Databases, Resources, and Tools

Various bioinformatics tools for biological and medical applications

have been developed rapidly in the recent decades. Many of these
approaches have been established for various epigenetic applica-
tions. The widely used in silico tools for single gene and high-
throughput DNA methylation analyses are readily and currently
accessible over the World Wide Web.

5.1 Genome There are numerous online and computational methods to com-
Databases prehensively annotate the regulatory features of human mammalian
for Promoter Sequence genome for further promoter region gene methylation analysis.
Retrieval The related information of the regulatory features include among
others TSS, first exon end position, transcription factor binding site
(TFBS), CpG island, and G þ C content. Promoters represent
genomic regions containing many such regulatory signals. The
boundaries of promoters are not very clear, but most important
transcriptional signals known today are generally located within the
segment of approximately
2000 downstream and þ 500 upstream
relative to the transcription start site (TSS þ1).
Databases for promoter regions retrieval within human
genome includes: (1) The Encyclopedia of DNA Elements
(ENCODE) (https://genome.ucsc.edu/ENCODE/) with the
UCSC genome browser (http://genome.ucsc.edu/), (2) DBTSS
database (http://dbtss.hgc.jp), (3) GeneBank® (https://www.
ncbi.nlm.nih.gov/genbank/).
The commonly used for promoter sequence retrieval and the
most popular is UCSC Genome Browser, an online genome
browser hosted by the University of California, Santa Cruz
(UCSC) [110]. It is an interactive website offering access to
genome sequence data from a variety of vertebrate and invertebrate
species and major model organisms, integrated with a large collec-
tion of aligned annotations. The Browser is a graphical viewer
optimized to support fast interactive performance and is an open-
source, Web-based tool suite for rapid visualization, examination,
and querying of the data at many levels. DBTSS database presents
a major part of collected from a total of 20 human adult and
embryonic tissues and seven cell cultures tissues are covered
[111, 112]. GenBank® is the National Institutes of Health
(NIH) genetic sequence database, an annotated collection of all
190 Edyta Reszka and Shanbeh Zienolddiny

publicly available DNA sequences, which comprises the DNA Data-

Bank of Japan (DDBJ), the European Nucleotide Archive (ENA),
and GenBank® at the National Center for Biotechnology Informa-
tion (NCBI) [113].

5.2 Promoter Multiple online Promoter browsers and promoter prediction pro-
Prediction Tools grams to identify promoter regions in a human genome using
computational programs have been developed. Three of online
browsers possess sequence Retrieval Tool for displaying Gene struc-
ture and Promoter image for particular target gene. It includes
UCSC Genome Browser, DBTSS platform, and Eukaryotic Pro-
moter Database (EPD, EPDnew). EPDnew is a collection of exper-
imentally validated promoters in human, mouse, D. melanogaster,
and zebrafish genomes and it is integrated with UCSC genome
browser [114, 115]. Selected (reviewed in [116]) currently imple-
mented freely available and commercial promoter prediction pro-
grams for analysis of user-input promoter sequence are presented
in Table 4. A compilation of promoter prediction resources can

Table 4
Promoter retrieval and promoter prediction online resources

Tool URL References

Online browser
DBTSS (release 8.0, 9.0, 10.0 http://dbtss.hgc.jp/index.html [111, 112]
beta)a
UCSC (Human Assembly, http://genome.ucsc.edu/cgi-bin/hgGateway [110]
GRCh38/hg38)a
EPDnew (previous release http://epd.vital-it.ch/human/human_database.php [114, 115]
EPD)a
Promoter prediction online software
Promoter 2.0 http://www.cbs.dtu.dk/services/Promoter/ [120]
PromoSer http://biowulf.bu.edu/zlab/PromoSer/ [121]
GPMiner http://gpminer.mbc.nctu.edu.tw/index.php [122]
CorePromoter http://rulai.cshl.org/tools/genefinder/ [123]
CPROMOTER/human.htm
FirstEF http://rulai.cshl.org/tools/FirstEF/ [124]
Eponine https://bioinformatics.ca/links_directory/tool/9592/ [125]
eponine
CpGProD http://doua.prabi.fr/software/cpgprod [126]
b
Gene2Promoter https://www.genomatix.de/online_help/help_ Genomatix
eldorado/Gene2Promoter_Intro.html GmbH
a
Human CpG island prediction tool
b
Free trial possibility
 Epigenetics and Circadian Rhythm 191

be also found at http://www.shodhaka.com/cgi-bin/startbioinfo/

simpleresources.pl?tn¼Promoter%20prediction.

5.3 CpG Islands Currently, free online software for human CpG island searching is
Prediction Tools mainly integrated with promoter sequence retrieval browsers:
and Primer Design (1) UCSC browser, (2) DBTSS, and (3) EPDnew database
Tools for Gene (Table 4). There are also three tools (4) MethPrimer and Methpri-
Promoter Methylation mer 2.0 [117], (5) Methyl Primer Express™ Software v1.0,
(6) Beacon Designer™ dedicated for methylation primers design-
ing (Table 5) with possibility to CpG searching. Moreover,
(7) EMBOSS Cpgplot browser (http://www.ebi.ac.uk/Tools/
seqstats/emboss_cpgplot/) identifies and plots CpG islands in
user-input nucleotide sequence(s). This is widely used Web-based
genome browser that includes a regulatory build with various
epigenome data sets from the European Bioinformatics Institute
(EMBL-EBI), a center for research and services in bioinformatics,
and is part of European Molecular Biology Laboratory (EMBL)
[118]. Moreover, (8) CPGFinder (http://www.softberry.com/
berry.phtml?topic¼cpgfinder&group¼programs&subgroup¼pro
moter), a promoter-scanning program from Softberry, Inc. is com-
mercially purchased, and also free available for light-volume use by
researchers from academic institutions.
Majority of available Web tools rely on sodium bisulfite primer
design for methylation-specific PCR (MSP), followed by bisulfite
sequencing (Table 5).

5.4 Epigenetic Data Downloading and uploading of Epigenome Datasets are available
Browsers by several Web tools. There are several different methods (ftp or
and Repositories htp) and file formats (.wig, .bed, .bam) for employing a different
data matrix from Genome-Wide Epigenetic Studies in Human
Disease (reviewed in [119]). The majority of browsers and reposi-
tories use UCSC or ENCODE style interfaces (Table 6).

6 Conclusions

Circadian clock intrinsic mechanism is under epigenetic control

that comprises additional regulatory mechanism of molecular clock.
Simultaneously, epigenetic plasticity is governed by circadian clock
in mammals. Thus, there is reciprocal linking between circadian
clock and epigenetic machinery. This review systemizes epigenetic
mechanism for regulation of the circadian clock at a posttranscrip-
tional level and provides important insights into the development
of cancer. Further exploration of the interplay between epigenetic
events in core clock and clock output genes in human cancer should
be performed to reveal whether epigenetically affected circadian
rhythm disruption is a cause or result of cancer. Taken together,
well-designed molecular epidemiology studies together with high-
192 Edyta Reszka and Shanbeh Zienolddiny

Table 5
Tools for methylation assays primer design and their features

Tool Description URL References

a
MethPrimer , Online tool that can be used for http://www.urogene.org/ [117]
MethPrimer designing primers for bisulfite methprimer/, http://www.
2.0a sequencing (BSP), urogene.org/methprimer2
methylation-specific PCR
(MSP), MethyLight BSP, the
combined restriction bisulfite
analysis (CORBRA), Nested
MSP, MethyLight MSP,
degenerate BSP assays
BiSearch A MSP primer-design algorithm http://bisearch.enzim.hu/ [127]
MethMarker Software that facilitates the http://methmarker.mpi-inf. [128]
design and optimization of mpg.de/
gene-specific DNA
methylation assays. COBRA,
bisulfite single nucleotide
primer extension (SNuPE),
MSP, MethyLight, bisulfite
pyrosequencing, methylated
DNA immunoprecipitation-
qPCR (MeDIP-qPCR) assays
Bisulfite Online bisulfite primer design http://www.zymoresearch. Zymo
Primer tool com/tools/bisulfite- Research Corp.
Seeker2 primer-seeker
MSP- A high-throughput primer design https://sourceforge.net/ [129]
HTPrimer tool to design primers pairs for projects/msp-htprimer/
MSP, BSP, pyrosequencing,
COBRA, and methylation-
sensitive restriction enzyme
digestion PCR (MSRE) assays
BiQ Analyzer Software tool for manual http://biq-analyzer.bioinf. [130]
processing of DNA mpi-inf.mpg.de/
methylation data from bisulfite
sequencing
BiQ Analyzer Software tool that supports locus- http://biq-analyzer-ht.bioinf. [131]
HT specific analysis and mpi-inf.mpg.de/
visualization of high-
throughput bisulfite
sequencing data
BiQ Analyzer Software tool for sequence http://biq-analyzer-himod. [132]
HiMod alignment, quality control and bioinf.mpi-inf.mpg.de
initial analysis of locus-specific
DNA modification data. BiQ
Analyzer HiMod combines
well-established graphical user
interface of BiQ Analyzer HT

(continued)
 Epigenetics and Circadian Rhythm 193

Table 5
(continued)

Tool Description URL References

Methyl Primer Software that can be used for http://resource.thermofisher. Life Technologies
Express™ designing primers for bisulfite com/page/WE28396_2/ (a retired brand
software sequencing (BSP), of Thermo
v1.0a,b methylation-specific PCR Fisher Scientific)
(MSP) assays
Beacon Software solution that can be http://www.premierbiosoft. Premier Biosoft
Designer™a used for designing primers and com/molecular_beacons/
probes for quantitative MSP
(MethyLight)
PyroMark PyroMark supplementary https://www.qiagen.com/us/ Qiagen
CpG SW 1.0 software expands assay shop/automated-
flexibility and analysis breadth solutions/sequencers/
of pyrosequencing analysis pyromark-supplementary-
software/
#orderinginformation
a
Prediction of CpG islands in DNA sequences
b
Free software

Table 6
Human epigenetic data browsers and repositories

Browser Description URL References

MethylomeDB The Brain Methylome Database http://www.neuroepigenomics. [133]
provides DNA methylation profiles org/methylomedb/
from humans and mice
DiseaseMeth Methylomes of human disease supports http://202.97.205.78/ [134]
multiple search options such as gene diseasemeth/
ID and disease name. Experimental
information from over 14,000 entries
and 175 high-throughput data sets
from a wide number of sources
MethBase MethBase is a central reference http://smithlabresearch.org/ [135]
methylome database created from software/methbase/
public bisulfite sequencing datasets
ROADMAP The NIH Roadmap Epigenomics http://www. [136]
Epigenomics Mapping Consortium was launched roadmapepigenomics.org/
with the goal of producing a public NIH Roadmap Epigenomics
resource of human epigenomic data: Project Data Listings
DNA methylation, histone Through the GEO repository
modifications, chromatin https://www.ncbi.nlm.nih.
accessibility, and small RNA gov/geo/roadmap/
transcripts in human cell types and epigenomics/
tissues

(continued)
194 Edyta Reszka and Shanbeh Zienolddiny

Table 6
(continued)

Browser Description URL References

Human Epigenome Browser at Wash U:
http://epigenomegateway.wustl.edu/
Epigenome Atlas Epigenome Atlas,
Release 9:
http://www.genboree.org/
epigenomeatlas/index.rhtml
Roadmap Epigenomics Visualization
Hub (VizHub):
http://vizhub.wustl.edu/
IHEC Data The International Human Epigenome http://epigenomesportal.ca/ [137]
Portal Consortium (IHEC) coordinates the ihec/
production of reference epigenome
maps through the characterization of
the regulome, methylome, and
transcriptome from a wide range of
tissues and cell types.
CEEHRC Canadian Epigenetics, Environment http://epigenie.com/
platform and Health Research Consortium epigenetic-tools-and-
(CEEHRC) Network provides a databases/
reference epigenome project for
human cells and not the typical stem
cell lines
Deep Blue Store and work with genomic and http://deepblue.mpi-inf.mpg. [138]
epigenomic data from a number of de/
international consortiums
Ensembl Ensembl is part of GENCODE, a http://www.ensembl.org/ [139]
subproject of the ENCODE scale-up info/website/tutorials/
project. The ENCODE project has encode.html
produced genome-wide data for over
100 different cell types for
investigating different aspects of
genomic regulation, including
chromatin structure (5C), open
chromatin (DNase-seq and FAIRE-
seq), histone modifications and DNA
binding of over 100 transcription
factors (ChIP-seq), and RNA
transcription (RNAseq and CAGE)

throughput epigenome analysis should be applied for investigations

of solid tumor as well as blood cancer. Novel epigenetic circadian
biomarkers can provide a useful therapeutic target for human
cancer.

References
1. Terzibasi-Tozzini E, Martinez-Nicolas A,
Lucas-Sanchez A (2017) The clock is ticking.
Ageing of the circadian system: from physiol-
ogy to cell cycle. Semin Cell Dev Biol
70:164–176. https://doi.org/10.1016/j.
semcdb.2017.06.011
2. Webb AB, Oates AC (2016) Timing by
rhythms: daily clocks and developmental
rulers. Dev Growth Differ 58(1):43–58.
https://doi.org/10.1111/dgd.12242
3. Delezie J, Challet E (2011) Interactions
between metabolism and circadian clocks:
reciprocal disturbances. Ann N Y Acad Sci
1243:30–46
4. Reppert SM, Weaver DR (2001) Molecular
analysis of mammalian circadian rhythms.
Annu Rev Physiol 63:647–676
5. Ukai H, Ueda HR (2010) Systems biology of
mammalian circadian clocks. Annu Rev
Physiol 72:579–603
6. Gekakis N, Staknis D, Nguyen HB, Davis FC,
Wilsbacher LD, King DP, Takahashi JS, Weitz
CJ (1998) Role of the CLOCK protein in the
mammalian circadian mechanism. Science
280(5369):1564–1569
7. Bunger MK, Wilsbacher LD, Moran SM,
Clendenin C, Radcliffe LA, Hogenesch JB,
Simon MC, Takahashi JS, Bradfield CA
(2000) Mop3 is an essential component of
the master circadian pacemaker in mammals.
Cell 103(7):1009–1017
8. Jin X, Shearman LP, Weaver DR, Zylka MJ, de
Vries GJ, Reppert SM (1999) A molecular
mechanism regulating rhythmic output from
the suprachiasmatic circadian clock. Cell 96
(1):57–68
9. van der Horst GT, Muijtjens M, Kobayashi K,
Takano R, Kanno S, Takao M, de Wit J,
Verkerk A, Eker AP, van Leenen D, Buijs R,
Bootsma D, Hoeijmakers JH, Yasui A (1999)
Mammalian Cry1 and Cry2 are essential for
maintenance of circadian rhythms. Nature
398(6728):627–630
10. Hogenesch JB, Gu YZ, Moran SM,
Shimomura K, Radcliffe LA, Takahashi JS,
Bradfield CA (2000) The basic helix-loop-
helix-PAS protein MOP9 is a brain-specific
heterodimeric partner of circadian and hyp-
oxia factors. J Neurosci 20(13):Rc83
11. Zhou YD, Barnard M, Tian H, Li X, Ring
HZ, Francke U, Shelton J, Richardson J, Rus-
sell DW, McKnight SL (1997) Molecular
characterization of two mammalian bHLH-
PAS domain proteins selectively expressed in
Epigenetics and Circadian Rhythm 195
the central nervous system. Proc Natl Acad Sci
U S A 94(2):713–718
12. Preitner N, Damiola F, Lopez-Molina L,
Zakany J, Duboule D, Albrecht U, Schibler
U (2002) The orphan nuclear receptor
REV-ERBalpha controls circadian transcrip-
tion within the positive limb of the mamma-
lian circadian oscillator. Cell 110(2):251–260
13. Akashi M, Takumi T (2005) The orphan
nuclear receptor RORalpha regulates circa-
dian transcription of the mammalian core-
clock Bmal1. Nat Struct Mol Biol 12
(5):441–448
14. Stratmann M, Schibler U (2006) Properties,
entrainment, and physiological functions of
mammalian peripheral oscillators. J Biol
Rhythm 21(6):494–506
15. Ukai-Tadenuma M, Yamada RG, Xu H, Rip-
perger JA, Liu AC, Ueda HR (2011) Delay in
feedback repression by cryptochrome 1 is
required for circadian clock function. Cell
144(2):268–281
16. Korencic A, Bordyugov G, Kosir R,
Rozman D, Golicnik M, Herzel H (2012)
The interplay of cis-regulatory elements rules
circadian rhythms in mouse liver. PLoS One 7
(11):e46835
17. Korencic A, Kosir R, Bordyugov G,
Lehmann R, Rozman D, Herzel H (2014)
Timing of circadian genes in mammalian tis-
sues. Sci Rep 4:5782. https://doi.org/10.
1038/srep05782
18. Pett JP, Korencic A, Wesener F, Kramer A,
Herzel H (2016) Feedback loops of the mam-
malian circadian clock constitute Repressila-
tor. PLoS Comput Biol 12(12):e1005266.
https://doi.org/10.1371/journal.pcbi.
1005266
19. Akashi M, Okamoto A, Tsuchiya Y, Todo T,
Nishida E, Node K (2014) A positive role for
PERIOD in mammalian circadian gene
expression. Cell Rep 7(4):1056–1064
20. Mitsui S, Yamaguchi S, Matsuo T, Ishida Y,
Okamura H (2001) Antagonistic role of
E4BP4 and PAR proteins in the circadian
oscillatory mechanism. Genes Dev 15
(8):995–1006
21. Yamaguchi S, Mitsui S, Yan L, Yagita K,
Miyake S, Okamura H (2000) Role of DBP
in the circadian oscillatory mechanism. Mol
Cell Biol 20(13):4773–4781
22. Ko CH, Takahashi JS (2006) Molecular com-
ponents of the mammalian circadian clock.
Hum Mol Genet 15:R271–R277 Spec No
2. https://doi.org/10.1093/hmg/ddl207
196 Edyta Reszka and Shanbeh Zienolddiny
23. Stojkovic K, Wing SS, Cermakian N (2014) A
central role for ubiquitination within a circa-
dian clock protein modification code. Front
Mol Neurosci 7:69. https://doi.org/10.
3389/fnmol.2014.00069
24. Mazzoccoli G, Laukkanen MO,
Vinciguerra M, Colangelo T, Colantuoni V
(2016) A timeless link between circadian pat-
terns and disease. Trends Mol Med 22
(1):68–81
25. Hatanaka F, Matsubara C, Myung J,
Yoritaka T, Kamimura N, Tsutsumi S,
Kanai A, Suzuki Y, Sassone-Corsi P,
Aburatani H, Sugano S, Takumi T (2010)
Genome-wide profiling of the core clock pro-
tein BMAL1 targets reveals a strict relation-
ship with metabolism. Mol Cell Biol 30
(24):5636–5648
26. Yi CH, Zheng T, Leaderer D, Hoffman A,
Zhu Y (2009) Cancer-related transcriptional
targets of the circadian gene NPAS2 identified
by genome-wide ChIP-on-chip analysis. Can-
cer Lett 284(2):149–156
27. Rey G, Cesbron F, Rougemont J, Reinke H,
Brunner M, Naef F (2011) Genome-wide and
phase-specific DNA-binding rhythms of
BMAL1 control circadian output functions
in mouse liver. PLoS Biol 9(2):e1000595.
https://doi.org/10.1371/journal.pbio.
1000595
28. Menet JS, Pescatore S, Rosbash M (2014)
CLOCK:BMAL1 is a pioneer-like transcrip-
tion factor. Genes Dev 28(1. United
States):8–13. https://doi.org/10.1101/gad.
228536.113
29. Asher G, Schibler U (2011) Crosstalk
between components of circadian and meta-
bolic cycles in mammals. Cell Metab 13
(2):125–137
30. Eckel-Mahan K, Sassone-Corsi P (2013)
Metabolism and the circadian clock converge.
Physiol Rev 93(1):107–135
31. Ptitsyn AA, Zvonic S, Conrad SA, Scott LK,
Mynatt RL, Gimble JM (2006) Circadian
clocks are resounding in peripheral tissues.
PLoS Comput Biol 2(3):e16. https://doi.
org/10.1371/journal.pcbi.0020016
32. Panda S, Antoch MP, Miller BH, Su AI,
Schook AB, Straume M, Schultz PG, Kay
SA, Takahashi JS, Hogenesch JB (2002)
Coordinated transcription of key pathways in
the mouse by the circadian clock. Cell 109
(3):307–320
33. Akhtar RA, Reddy AB, Maywood ES, Clayton
JD, King VM, Smith AG, Gant TW, Hastings
MH, Kyriacou CP (2002) Circadian cycling
of the mouse liver transcriptome, as revealed
by cDNA microarray, is driven by the supra-
chiasmatic nucleus. Curr Biol 12(7):540–550
34. Zhang R, Lahens NF, Ballance HI, Hughes
ME, Hogenesch JB (2014) A circadian gene
expression atlas in mammals: implications for
biology and medicine. Proc Natl Acad Sci U S
A 111(45):16219–16224
35. Archer SN, Laing EE, Moller-Levet CS, van
der Veen DR, Bucca G, Lazar AS, Santhi N,
Slak A, Kabiljo R, von Schantz M, Smith CP,
Dijk DJ (2014) Mistimed sleep disrupts circa-
dian regulation of the human transcriptome.
Proc Natl Acad Sci U S A 111(6):E682–E691
36. Moller-Levet CS, Archer SN, Bucca G, Laing
EE, Slak A, Kabiljo R, Lo JC, Santhi N, von
Schantz M, Smith CP, Dijk DJ (2013) Effects
of insufficient sleep on circadian rhythmicity
and expression amplitude of the human blood
transcriptome. Proc Natl Acad Sci U S A 110
(12):E1132–E1141
37. Simo-Riudalbas L, Esteller M (2014) Cancer
genomics identifies disrupted epigenetic
genes. Hum Genet 133(6):713–725
38. Powell WT, LaSalle JM (2015) Epigenetic
mechanisms in diurnal cycles of metabolism
and neurodevelopment. Hum Mol Genet 24
(R1):R1–R9. https://doi.org/10.1093/
hmg/ddv234
39. Koike N, Yoo SH, Huang HC, Kumar V,
Lee C, Kim TK, Takahashi JS (2012) Tran-
scriptional architecture and chromatin land-
scape of the core circadian clock in
mammals. Science 338(6105):349–354
40. Brown SE, Fraga MF, Weaver IC,
Berdasco M, Szyf M (2007) Variations in
DNA methylation patterns during the cell
cycle of HeLa cells. Epigenetics 2(1):54–65
41. Bonsch D, Hothorn T, Krieglstein C,
Koch M, Nehmer C, Lenz B, Reulbach U,
Kornhuber J, Bleich S (2007) Daily variations
of homocysteine concentration may influence
methylation of DNA in normal healthy indi-
viduals. Chronobiol Int 24(2):315–326
42. Xia L, Ma S, Zhang Y, Wang T, Zhou M,
Wang Z, Zhang J (2015) Daily variation in
global and local DNA methylation in mouse
livers. PLoS One 10(2):e0118101. https://
doi.org/10.1371/journal.pone.0118101
43. Azzi A, Dallmann R, Casserly A, Rehrauer H,
Patrignani A, Maier B, Kramer A, Brown SA
(2014) Circadian behavior is light-
reprogrammed by plastic DNA methylation.
Nat Neurosci 17(3):377–382
44. Vollmers C, Schmitz RJ, Nathanson J, Yeo G,
Ecker JR, Panda S (2012) Circadian oscilla-
tions of protein-coding and regulatory RNAs

in a highly dynamic mammalian liver epigen-
ome. Cell Metab 16(6):833–845
45. Massart R, Freyburger M, Suderman M,
Paquet J, El Helou J, Belanger-Nelson E,
Rachalski A, Koumar OC, Carrier J, Szyf M,
Mongrain V (2014) The genome-wide land-
scape of DNA methylation and hydroxy-
methylation in response to sleep deprivation
impacts on synaptic plasticity genes. Transl
Psychiatry 4:e347. https://doi.org/10.
1038/tp.2013.120
46. Zhu Y, Stevens RG, Hoffman AE,
Tjonneland A, Vogel UB, Zheng T, Hansen
J (2011) Epigenetic impact of long-term
shiftwork: pilot evidence from circadian
genes and whole-genome methylation analy-
sis. Chronobiol Int 28(10):852–861
47. Bhatti P, Zhang Y, Song X, Makar KW, Sather
CL, Kelsey KT, Houseman EA, Wang P
(2014) Nightshift work and genome-wide
DNA methylation. Chronobiol Int
32:103–112. https://doi.org/10.3109/
07420528.2014.956362
48. Schwimmer H, Metzer A, Pilosof Y, Szyf M,
Machnes ZM, Fares F, Harel O, Haim A
(2014) Light at night and melatonin have
opposite effects on breast cancer tumors in
mice assessed by growth rates and global
DNA methylation. Chronobiol Int 31
(1):144–150
49. Lim AS, Srivastava GP, Yu L, Chibnik LB,
Xu J, Buchman AS, Schneider JA, Myers AJ,
Bennett DA, De Jager PL (2014) 24-hour
rhythms of DNA methylation and their rela-
tion with rhythms of RNA expression in the
human dorsolateral prefrontal cortex. PLoS
Genet 10(11):e1004792. https://doi.org/
10.1371/journal.pgen.1004792
50. Krishnaiah SY, Wu G, Altman BJ, Growe J,
Rhoades SD, Coldren F, Venkataraman A,
Olarerin-George AO, Francey LJ,
Mukherjee S, Girish S, Selby CP, Cal S,
Er U, Sianati B, Sengupta A, Anafi RC,
Kavakli IH, Sancar A, Baur JA, Dang CV,
Hogenesch JB, Weljie AM (2017) Clock reg-
ulation of metabolites reveals coupling
between transcription and metabolism. Cell
Metab 25(4):961–974.e964
51. Flavahan WA, Gaskell E, Bernstein BE (2017)
Epigenetic plasticity and the hallmarks of can-
cer. Science 357(6348):eaal2380. https://
doi.org/10.1126/science.aal2380
52. Unsal-Kaçmaz K, Mullen TE, Kaufmann WK,
Sancar A (2005) Coupling of human circadian
and cell cycles by the timeless protein. Mol
Cell Biol 25(8):3109–3116
Epigenetics and Circadian Rhythm 197
53. Gauger MA, Sancar A (2005) Cryptochrome,
circadian cycle, cell cycle checkpoints, and
cancer. Cancer Res 65(15):6828–6834
54. Matsuo T, Yamaguchi S, Mitsui S, Emi A,
Shimoda F, Okamura H (2003) Control
mechanism of the circadian clock for timing
of cell division in vivo. Science 302
(5643):255–259
55. Kettner NM, Katchy CA, Fu L (2014) Circa-
dian gene variants in cancer. Ann Med 46
(4):208–220
56. Mao Y, Fu A, Hoffman AE, Jacobs DI, Jin M,
Chen K, Zhu Y (2015) The circadian gene
CRY2 is associated with breast cancer aggres-
siveness possibly via epigenomic modifica-
tions. Tumour Biol 36(5):3533–3539
57. Chen ST, Choo KB, Hou MF, Yeh KT, Kuo
SJ, Chang JG (2005) Deregulated expression
of the PER1, PER2 and PER3 genes in breast
cancers. Carcinogenesis 26(7):1241–1246
58. Kuo SJ, Chen ST, Yeh KT, Hou MF, Chang
YS, Hsu NC, Chang JG (2009) Disturbance
of circadian gene expression in breast cancer.
Virchows Arch 454(4):467–474
59. Hoffman AE, Zheng T, Yi CH, Stevens RG,
Ba Y, Zhang Y, Leaderer D, Holford T,
Hansen J, Zhu Y (2010) The core circadian
gene Cryptochrome 2 influences breast cancer
risk, possibly by mediating hormone signal-
ing. Cancer Prev Res (Phila) 3(4):539–548
60. Li L, Lee KM, Han W, Choi JY, Lee JY, Kang
GH, Park SK, Noh DY, Yoo KY, Kang D
(2010) Estrogen and progesterone receptor
status affect genome-wide DNA methylation
profile in breast cancer. Hum Mol Genet 19
(21):4273–4277
61. Liu L, Shen H, Wang Y (2017) CRY2 is sup-
pressed by FOXM1 mediated promoter
hypermethylation in breast cancer. Biochem
Biophys Res Commun 490(1):44–50
62. Hoffman AE, Yi CH, Zheng T, Stevens RG,
Leaderer D, Zhang Y, Holford TR, Hansen J,
Paulson J, Zhu Y (2010) CLOCK in breast
tumorigenesis: genetic, epigenetic, and tran-
scriptional profiling analyses. Cancer Res 70
(4):1459–1468
63. Hoffman AE, Zheng T, Ba Y, Stevens RG, Yi
CH, Leaderer D, Zhu Y (2010) Phenotypic
effects of the circadian gene Cryptochrome
2 on cancer-related pathways. BMC Cancer
10:110. https://doi.org/10.1186/1471-
2407-10-110
64. Fu A, Leaderer D, Zheng T, Hoffman AE,
Stevens RG, Zhu Y (2012) Genetic and epi-
genetic associations of circadian gene TIME-
LESS and breast cancer risk. Mol Carcinog 51
(12):923–929
198 Edyta Reszka and Shanbeh Zienolddiny
65. Yang M, Kim HS, Cho MY (2014) Different
methylation profiles between intestinal and
diffuse sporadic gastric carcinogenesis. Clin
Res Hepatol Gastroenterol 38(5):613–620
66. Tahara T, Maegawa S, Chung W, Garriga J,
Jelinek J, Estecio MR, Shibata T, Hirata I,
Arisawa T, Issa JP (2013) Examination of
whole blood DNA methylation as a potential
risk marker for gastric cancer. Cancer Prev Res
(Phila) 6(10):1093–1100
67. Alexander M, Burch JB, Steck SE, Chen CF,
Hurley TG, Cavicchia P, Shivappa N, Guess J,
Zhang H, Youngstedt SD, Creek KE, Lloyd S,
Jones K, Hebert JR (2017) Case-control
study of candidate gene methylation and ade-
nomatous polyp formation. Int J Color Dis 32
(2):183–192
68. Tomita T, Kurita R, Onishi Y (2017) Epige-
netic regulation of the circadian clock: role of
5-aza-20 -deoxycytidine. Biosci Rep 37(3):
BSR20170053. https://doi.org/10.1042/
bsr20170053
69. Hsu MC, Huang CC, Choo KB, Huang CJ
(2007) Uncoupling of promoter methylation
and expression of Period1 in cervical cancer
cells. Biochem Biophys Res Commun 360
(1):257–262
70. Shih MC, Yeh KT, Tang KP, Chen JC, Chang
JG (2006) Promoter methylation in circadian
genes of endometrial cancers detected by
methylation-specific PCR. Mol Carcinog 45
(10):732–740
71. Yeh KT, Yang MY, Liu TC, Chen JC, Chan
WL, Lin SF, Chang JG (2005) Abnormal
expression of period 1 (PER1) in endometrial
carcinoma. J Pathol 206(1):111–120
72. Neumann O, Kesselmeier M, Geffers R,
Pellegrino R, Radlwimmer B, Hoffmann K,
Ehemann V, Schemmer P, Schirmacher P,
Lorenzo Bermejo J, Longerich T (2012)
Methylome analysis and integrative profiling
of human HCCs identify novel protumori-
genic factors. Hepatology 56(5):1817–1827
73. Lin YM, Chang JH, Yeh KT, Yang MY, Liu
TC, Lin SF, Su WW, Chang JG (2008) Dis-
turbance of circadian gene expression in hepa-
tocellular carcinoma. Mol Carcinog 47
(12):925–933
74. Gery S, Komatsu N, Kawamata N, Miller CW,
Desmond J, Virk RK, Marchevsky A,
McKenna R, Taguchi H, Koeffler HP (2007)
Epigenetic silencing of the candidate tumor
suppressor gene Per1 in non-small cell lung
cancer. Clin Cancer Res 13(5):1399–1404
75. Wang F, Luo Y, Li C, Chen L (2014) Corre-
lation between deregulated expression of
PER2 gene and degree of glioma malignancy.
Tumori 100(6):e266–e272. https://doi.org/
10.1700/1778.19292
76. Fan W, Chen X, Li C, Chen L, Liu P, Chen Z
(2014) The analysis of deregulated expression
and methylation of the PER2 genes in glio-
mas. J Cancer Res Ther 10(3):636–640
77. Hanoun M, Eisele L, Suzuki M, Greally JM,
Huttmann A, Aydin S, Scholtysik R, Klein-
Hitpass L, Duhrsen U, Durig J (2012) Epige-
netic silencing of the circadian clock gene
CRY1 is associated with an indolent clinical
course in chronic lymphocytic leukemia. PLoS
One 7(3):e34347. https://doi.org/10.
1371/journal.pone.0034347
78. Taniguchi H, Fernandez AF, Setien F,
Ropero S, Ballestar E, Villanueva A,
Yamamoto H, Imai K, Shinomura Y, Esteller
M (2009) Epigenetic inactivation of the circa-
dian clock gene BMAL1 in hematologic
malignancies. Cancer Res 69(21):8447–8454
79. Yang MY, Chang JG, Lin PM, Tang KP, Chen
YH, Lin HY, Liu TC, Hsiao HH, Liu YC, Lin
SF (2006) Downregulation of circadian clock
genes in chronic myeloid leukemia: alternative
methylation pattern of hPER3. Cancer Sci 97
(12):1298–1307
80. Yeh CM, Shay J, Zeng TC, Chou JL, Huang
TH, Lai HC, Chan MW (2014) Epigenetic
silencing of ARNTL, a circadian gene and
potential tumor suppressor in ovarian cancer.
Int J Oncol 45(5):2101–2107
81. Nakatome M, Orii M, Hamajima M, Hirata Y,
Uemura M, Hirayama S, Isobe I (2011)
Methylation analysis of circadian clock gene
promoters in forensic autopsy specimens.
Legal medicine (Tokyo, Japan) 13
(4):205–209
82. Biswas S, Rao CM (2017) Epigenetics in can-
cer: fundamentals and beyond. Pharmacol
Ther. https://doi.org/10.1016/j.
pharmthera.2017.02.011
83. Liz J, Esteller M (2016) lncRNAs and micro-
RNAs with a role in cancer development. Bio-
chim Biophys Acta 1859(1):169–176
84. Na YJ, Sung JH, Lee SC, Lee YJ, Choi YJ,
Park WY, Shin HS, Kim JH (2009) Compre-
hensive analysis of microRNA-mRNA co-ex-
pression in circadian rhythm. Exp Mol Med
41(9):638–647
85. Cheng HY, Papp JW, Varlamova O,
Dziema H, Russell B, Curfman JP,
Nakazawa T, Shimizu K, Okamura H,
Impey S, Obrietan K (2007) microRNA mod-
ulation of circadian-clock period and entrain-
ment. Neuron 54(5):813–829
86. Alvarez-Saavedra M, Antoun G, Yanagiya A,
Oliva-Hernandez R, Cornejo-Palma D,

Perez-Iratxeta C, Sonenberg N, Cheng HY
(2011) miRNA-132 orchestrates chromatin
remodeling and translational control of the
circadian clock. Hum Mol Genet 20
(4):731–751
87. Nagel R, Clijsters L, Agami R (2009) The
miRNA-192/194 cluster regulates the period
gene family and the circadian clock. FEBS J
276(19):5447–5455
88. Chen R, D’Alessandro M, Lee C (2013) miR-
NAs are required for generating a time delay
critical for the circadian oscillator. Curr Biol
23(20):1959–1968
89. Zhou W, Li Y, Wang X, Wu L, Wang Y (2011)
MiR-206-mediated dynamic mechanism of
the mammalian circadian clock. BMC Syst
Biol 5:141. https://doi.org/10.1186/1752-
0509-5-141
90. Chacolla-Huaringa R, Moreno-Cuevas J,
Trevino V, Scott SP (2017) Entrainment of
breast cell lines results in rhythmic fluctua-
tions of MicroRNAs. Int J Mol Sci 18:7.
https://doi.org/10.3390/ijms18071499
91. Kochan DZ, Ilnytskyy Y, Golubov A, Deibel
SH, McDonald RJ, Kovalchuk O (2015) Cir-
cadian disruption-induced microRNAome
deregulation in rat mammary gland tissues.
Oncoscience 2(4):428–442
92. Han Y, Meng F, Venter J, Wu N, Wan Y,
Standeford H, Francis H, Meininger C,
Greene J Jr, Trzeciakowski JP, Ehrlich L,
Glaser S, Alpini G (2016) miR-34a-depen-
dent overexpression of Per1 decreases cholan-
giocarcinoma growth. J Hepatol 64
(6):1295–1304
93. Shi F, Chen X, Fu A, Hansen J, Stevens R,
Tjonneland A, Vogel UB, Zheng T, Zhu Y
(2013) Aberrant DNA methylation of
miR-219 promoter in long-term night shift-
workers. Environ Mol Mutagen 54
(6):406–413
94. Lee SE, Kim SJ, Youn JP, Hwang SY, Park CS,
Park YS (2011) MicroRNA and gene expres-
sion analysis of melatonin-exposed human
breast cancer cell lines indicating involvement
of the anticancer effect. J Pineal Res 51
(3):345–352
95. Mazzoccoli G, Colangelo T, Panza A,
Rubino R, Tiberio C, Palumbo O,
Carella M, Trombetta D, Gentile A,
Tavano F, Valvano MR, Storlazzi CT,
Macchia G, De Cata A, Bisceglia G,
Capocefalo D, Colantuoni V, Sabatino L,
Piepoli A, Mazza T (2016) Analysis of clock
gene-miRNA correlation networks reveals
candidate drivers in colorectal cancer. Onco-
target 7(29):45444–45461
Epigenetics and Circadian Rhythm 199
96. Li A, Lin X, Tan X, Yin B, Han W, Zhao J,
Yuan J, Qiang B, Peng X (2013) Circadian
gene clock contributes to cell proliferation
and migration of glioma and is directly regu-
lated by tumor-suppressive miR-124. FEBS
Lett 587(15):2455–2460
97. Wu S, Fesler A, Ju J (2016) Implications of
circadian rhythm regulation by microRNAs in
colorectal Cancer. Cancer Transl Med 2
(1):1–6
98. Hong Z, Feng Z, Sai Z, Tao S (2014) PER3, a
novel target of miR-103, plays a suppressive
role in colorectal cancer in vitro. BMB Rep 47
(9):500–505
99. Cui M, Zheng M, Sun B, Wang Y, Ye L,
Zhang X (2015) A long noncoding RNA per-
turbs the circadian rhythm of hepatoma cells
to facilitate hepatocarcinogenesis. Neoplasia
17(1):79–88
100. Etchegaray JP, Lee C, Wade PA, Reppert SM
(2003) Rhythmic histone acetylation under-
lies transcription in the mammalian circadian
clock. Nature 421(6919):177–182
101. Valekunja UK, Edgar RS, Oklejewicz M, van
der Horst GT, O’Neill JS, Tamanini F, Turner
DJ, Reddy AB (2013) Histone methyltrans-
ferase MLL3 contributes to genome-scale cir-
cadian transcription. Proc Natl Acad Sci U S A
110(4):1554–1559
102. Crosio C, Cermakian N, Allis CD, Sassone-
Corsi P (2000) Light induces chromatin
modification in cells of the mammalian circa-
dian clock. Nat Neurosci 3(12):1241–1247
103. Naruse Y, Oh-hashi K, Iijima N, Naruse M,
Yoshioka H, Tanaka M (2004) Circadian and
light-induced transcription of clock gene Per1
depends on histone acetylation and deacetyla-
tion. Mol Cell Biol 24(14):6278–6287
104. Curtis AM, Seo SB, Westgate EJ, Rudic RD,
Smyth EM, Chakravarti D, FitzGerald GA,
McNamara P (2004) Histone
acetyltransferase-dependent chromatin remo-
deling and the vascular clock. J Biol Chem
279(8):7091–7097
105. Katada S, Sassone-Corsi P (2010) The his-
tone methyltransferase MLL1 permits the
oscillation of circadian gene expression. Nat
Struct Mol Biol 17(12):1414–1421
106. Asher G, Gatfield D, Stratmann M, Reinke H,
Dibner C, Kreppel F, Mostoslavsky R, Alt FW,
Schibler U (2008) SIRT1 regulates circadian
clock gene expression through PER2 deace-
tylation. Cell 134(2):317–328
107. Nakahata Y, Kaluzova M, Grimaldi B, Sahar S,
Hirayama J, Chen D, Guarente LP, Sassone-
Corsi P (2008) The NADþ
dependent dea-
cetylase SIRT1 modulates CLOCK-mediated
200 Edyta Reszka and Shanbeh Zienolddiny
chromatin remodeling and circadian control.
Cell 134(2):329–340
108. Doi M, Hirayama J, Sassone-Corsi P (2006)
Circadian regulator CLOCK is a histone acet-
yltransferase. Cell 125(3):497–508
109. Hirayama J, Sahar S, Grimaldi B, Tamaru T,
Takamatsu K, Nakahata Y, Sassone-Corsi P
(2007) CLOCK-mediated acetylation of
BMAL1 controls circadian function. Nature
450:1086–1090
110. Rosenbloom KR, Armstrong J, Barber GP,
Casper J, Clawson H, Diekhans M, Dreszer
TR, Fujita PA, Guruvadoo L, Haeussler M,
Harte RA, Heitner S, Hickey G, Hinrichs AS,
Hubley R, Karolchik D, Learned K, Lee BT,
Li CH, Miga KH, Nguyen N, Paten B, Raney
BJ, Smit AF, Speir ML, Zweig AS,
Haussler D, Kuhn RM, Kent WJ (2015) The
UCSC genome browser database: 2015
update. Nucleic Acids Res 43(Database
issue):D670–D681. https://doi.org/10.
1093/nar/gku1177
111. Suzuki A, Wakaguri H, Yamashita R,
Kawano S, Tsuchihara K, Sugano S,
Suzuki Y, Nakai K (2015) DBTSS as an inte-
grative platform for transcriptome, epigen-
ome and genome sequence variation data.
Nucleic Acids Res 43(Database issue):
D87–D91. https://doi.org/10.1093/nar/
gku1080
112. Yamashita R, Sugano S, Suzuki Y, Nakai K
(2012) DBTSS: DataBase of transcriptional
start sites progress report in 2012. Nucleic
Acids Res 40(Database issue):D150–D154.
https://doi.org/10.1093/nar/gkr1005
113. Benson DA, Cavanaugh M, Clark K, Karsch-
Mizrachi I, Lipman DJ, Ostell J, Sayers EW
(2013) GenBank. Nucleic Acids Res 41(Data-
base issue):D36–D42. https://doi.org/10.
1093/nar/gks1195
114. Dreos R, Ambrosini G, Cavin Perier R,
Bucher P (2013) EPD and EPDnew, high-
quality promoter resources in the next-
generation sequencing era. Nucleic Acids
Res 41(Database issue):D157–D164.
https://doi.org/10.1093/nar/gks1233
115. Dreos R, Ambrosini G, Perier RC, Bucher P
(2015) The eukaryotic promoter database:
expansion of EPDnew and new promoter
analysis tools. Nucleic Acids Res 43(Database
issue):D92–D96. https://doi.org/10.1093/
nar/gku1111
116. Abeel T, Van de Peer Y, Saeys Y (2009)
Toward a gold standard for promoter predic-
tion evaluation. Bioinformatics (Oxford,
England) 25(12):i313–i320. https://doi.
org/10.1093/bioinformatics/btp191
117. Li LC, Dahiya R (2002) MethPrimer: design-
ing primers for methylation PCRs. Bioinfor-
matics (Oxford, England) 18
(11):1427–1431
118. McWilliam H, Li W, Uludag M, Squizzato S,
Park YM, Buso N, Cowley AP, Lopez R
(2013) Analysis tool web services from the
EMBL-EBI. Nucleic Acids Res 41(Web
Server issue):W597–W600. https://doi.org/
10.1093/nar/gkt376
119. Yan H, Tian S, Slager SL, Sun Z, Ordog T
(2016) Genome-wide epigenetic studies in
human disease: a primer on -Omic technolo-
gies. Am J Epidemiol 183(2):96–109
120. Knudsen S (1999) Promoter2.0: for the rec-
ognition of PolII promoter sequences. Bioin-
formatics (Oxford, England) 15(5):356–361
121. Halees AS, Leyfer D, Weng Z (2003) Promo-
Ser: a large-scale mammalian promoter and
transcription start site identification service.
Nucleic Acids Res 31(13):3554–3559
122. Lee TY, Chang WC, Hsu JB, Chang TH,
Shien DM (2012) GPMiner: an integrated
system for mining combinatorial
cis-regulatory elements in mammalian gene
group. BMC Genomics 13(Suppl 1):S3.
https://doi.org/10.1186/1471-2164-13-
s1-s3
123. Zhang J, Shi Z, Nan Y, Li M (2016) Inhibit-
ing malignant phenotypes of the bladder can-
cer cells by silencing long noncoding RNA
SChLAP1. Int Urol Nephrol 48(5):711–716
124. Davuluri RV, Grosse I, Zhang MQ (2001)
Computational identification of promoters
and first exons in the human genome. Nat
Genet 29(4):412–417
125. Down TA, Hubbard TJ (2002) Computa-
tional detection and location of transcription
start sites in mammalian genomic DNA.
Genome Res 12(3):458–461
126. Ponger L, Mouchiroud D (2002) CpGProD:
identifying CpG islands associated with tran-
scription start sites in large genomic mamma-
lian sequences. Bioinformatics (Oxford,
England) 18(4):631–633
127. Aranyi T, Tusnady GE (2007) BiSearch:
ePCR tool for native or bisulfite-treated
genomic template. Methods in molecular
biology (Clifton, NJ) 402:385–402. https://
doi.org/10.1007/978-1-59745-528-2_20
128. Schuffler P, Mikeska T, Waha A, Lengauer T,
Bock C (2009) MethMarker: user-friendly
design and optimization of gene-specific
DNA methylation assays. Genome Biol 10
(10):R105. https://doi.org/10.1186/gb-
2009-10-10-r105

129. Pandey RV, Pulverer W, Kallmeyer R,
Beikircher G, Pabinger S, Kriegner A, Wein-
hausel A (2016) MSP-HTPrimer: a high-
throughput primer design tool to improve
assay design for DNA methylation analysis in
epigenetics. Clin Epigenetics 8:101. https://
doi.org/10.1186/s13148-016-0269-3
130. Bock C, Reither S, Mikeska T, Paulsen M,
Walter J, Lengauer T (2005) BiQ analyzer:
visualization and quality control for DNA
methylation data from bisulfite sequencing.
Bioinformatics (Oxford, England) 21
(21):4067–4068
131. Lutsik P, Feuerbach L, Arand J, Lengauer T,
Walter J, Bock C (2011) BiQ analyzer HT:
locus-specific analysis of DNA methylation by
high-throughput bisulfite sequencing.
Nucleic Acids Res 39(Web Server issue):
W551–W556. https://doi.org/10.1093/
nar/gkr312
132. Becker D, Lutsik P, Ebert P, Bock C,
Lengauer T, Walter J (2014) BiQ analyzer
HiMod: an interactive software tool for
high-throughput locus-specific analysis of
5-methylcytosine and its oxidized derivatives.
Nucleic Acids Res 42(Web Server issue):
W501–W507. https://doi.org/10.1093/
nar/gku457
133. Xin Y, Chanrion B, O’Donnell AH,
Milekic M, Costa R, Ge Y, Haghighi FG
(2012) MethylomeDB: a database of DNA
methylation profiles of the brain. Nucleic
Acids Res 40(Database issue):
D1245–D1249. https://doi.org/10.1093/
nar/gkr1193
134. Lv J, Liu H, Su J, Wu X, Li B, Xiao X, Wang F,
Wu Q, Zhang Y (2012) DiseaseMeth: a
human disease methylation database. Nucleic
Acids Res 40(Database issue):
D1030–D1035. https://doi.org/10.1093/
nar/gkr1169
Epigenetics and Circadian Rhythm 201
135. Song Q, Decato B, Hong EE, Zhou M,
Fang F, Qu J, Garvin T, Kessler M, Zhou J,
Smith AD (2013) A reference methylome
database and analysis pipeline to facilitate
integrative and comparative epigenomics.
PLoS One 8(12):e81148. https://doi.org/
10.1371/journal.pone.0081148
136. Satterlee JS, Beckel-Mitchener A,
McAllister K, Procaccini DC, Rutter JL,
Tyson FL, Chadwick LH (2015) Community
resources and technologies developed
through the NIH roadmap Epigenomics pro-
gram. Methods Mol Biol 1238:27–49
137. Bujold D, Morais DA, Gauthier C, Cote C,
Caron M, Kwan T, Chen KC, Laperle J, Mar-
kovits AN, Pastinen T, Caron B, Veilleux A,
Jacques PE, Bourque G (2016) The interna-
tional human Epigenome consortium data
portal. Cell Syst 3(5):496–499.e492
138. Albrecht F, List M, Bock C, Lengauer T
(2016) DeepBlue epigenomic data server:
programmatic data retrieval and analysis of
epigenome region sets. Nucleic Acids Res 44
(W1):W581–W586. https://doi.org/10.
1093/nar/gkw211
139. Aken BL, Achuthan P, Akanni W, Amode
MR, Bernsdorff F, Bhai J, Billis K, Carvalho-
Silva D, Cummins C, Clapham P, Gil L, Giron
CG, Gordon L, Hourlier T, Hunt SE, Janacek
SH, Juettemann T, Keenan S, Laird MR,
Lavidas I, Maurel T, McLaren W, Moore B,
Murphy DN, Nag R, Newman V, Nuhn M,
Ong CK, Parker A, Patricio M, Riat HS,
Sheppard D, Sparrow H, Taylor K,
Thormann A, Vullo A, Walts B, Wilder SP,
Zadissa A, Kostadima M, Martin FJ,
Muffato M, Perry E, Ruffier M, Staines DM,
Trevanion SJ, Cunningham F, Yates A, Zer-
bino DR, Flicek P (2017) Ensembl 2017.
Nucleic Acids Res 45(D1):D635–d642.
https://doi.org/10.1093/nar/gkw1104
 Chapter 11

Epigenetic Changes of the Immune System with Role

in Tumor Development
Irina Daniela Florea and Christina Karaoulani

Abstract
Tumor development is closely related to chronic inflammation and to evasion of immune defense mechan-
isms by neoplastic cells. The mediators of the inflammatory process as well as proteins involved in immune
response or immune response evasion can be subject to various epigenetic changes such as methylation,
acetylation, or phosphorylation. Some of these, such as cytokine suppressors, are undergoing repression
through epigenetic changes, and others such as cytokines or chemokines are undergoing activation through
epigenetic changes, both modifications having as a result tumor progression. The activating changes can
affect the receptor molecules involved in immune response and these promote inflammation and subse-
quently tumor development while the inactivating changes seem to be related to the tumor regression
process. The proteins involved in antigen presentation, and, therefore in immune response escape, such as
classical HLA proteins and related APM (antigen presentation machinery) with their epigenetic changes
contribute to the tumor development process, either to tumor progression or regression, depending on the
immune effector cells that are in play.

Key words Epigenetics, Immune escape, Methylation, Acetylation, HLA, TLR, Cytokines, Chemo-
kines, Cancer, Inflammation, SOCS, NK cells, Nonclassical HLA, APM, CIITA, 5-aza-2-deoxycyti-
dine, HDAC inhibitors

1 Introduction

Human malignancies are closely related to chronic inflammation on

one side and to mechanisms of immune response escape on the
other side.
Chronic inflammation is a complex response of the immune
system which relies on a large number of immune mediators
attempting to neutralize and remove the agent of an insult and at
the same time to restore the structure and function of the involved
tissue.
It is demonstrated that up to 20% of cancers are related to the
chronic infection that associates chronic inflammatory process to
different stages in tumorigenesis such as cellular transformation,

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_11,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

203
204 Irina Daniela Florea and Christina Karaoulani

tumor progression, invasion, angiogenesis, and metastasis

[1, 2]. Inflammatory chronic process is mediated by a variety of
cytokines. Among the most important ones are tumor necrosis
factor (TNF) and members of its family such as IL-1a, IL-1-b,
IL-6, IL-8, IL-18, chemokines, VEGF, and MMP-9 [2]. They
can be involved in tumor initiation and progression when they are
produced in an uncontrolled manner due, in part, to events like
aberrant epigenetic changes. Several transcriptions factors are
involved in the synthesis of these proinflammatory mediators, over-
expression of these, such as NF-kB, leading to an accentuated
inflammatory process and consequently to tumor development
[3–5]. These mediators are the result of the activity of tumor
microenvironment that comprises innate immune cells (macro-
phages, neutrophils, mast cells, dendritic cells and natural killer
cells) as well as adaptive immune cells (T and B cells), cells belong-
ing to the stroma (fibroblasts, endothelial cells, pericytes, mesen-
chymal cells), and tumor cells [1]. The final pro or antitumor effect
is decided according to amount and activation state of each of the
components of the tumor microenvironment [1]. The most
numerous cells in the tumor microenvironment are the macro-
phages under the name of tumor associated macrophages (TAM)
and T lymphocytes [1]. The cytokines secreted by macrophages and
T cells, through activation of NF-kB, AP-1, STAT, SMAD tran-
scription factors, influence tumoral microenvironment in favor of
tumor progression (e.g., IL-6, IL-17, IL-23) or in favor of protec-
tion against tumors (e.g., IL-12, TRAIL, IFN gamma).
In addition to soluble mediators mentioned above, inflamma-
tion is mediated by mechanisms of immune response that involve
immune receptors and cell surface proteins such as HLA proteins,
costimulatory proteins, and cell adhesion molecules. Some of the
above mentioned proteins can be used by tumor cells to avoid
mechanisms of immune response.
Epigenetic processes are changes in the gene expression that are
not due to changes in DNA sequences. These changes involve DNA
methylation as well as histone modifications such as methylation,
acetylation, or phosphorylation. Hypermethylation of promoter
regions which mainly involves the cytosine residues present at the
CpG sites induces transcriptional silencing, while, oppositely, hypo-
methylation favors gene expression. DNA hypomethylation can
affect the expression of proteins like NFAT-1, Ras, p16 which are
important for the activity of nonimmune but also for immune cells
[6–10] and in this case show global loss of methylcytosine content.
Malignant cells can also undergo gains in methylation of promoter
CpG islands which induce silencing of tumor suppressor genes such
as p16, BRCA1, or hMLH. Another mechanism of epigenetic
control is represented by histone acetylation. This mechanism can
induce tumor suppressor gene silencing in association with CpG
island hypermethylation [1, 7]. A different type of epigenetic
 Epigenetic Changes of the Immune System with Role in Tumor Development 205

change is mediated by the interaction between noncoding RNA

transcripts (ncRNA) and target messenger RNAs (mRNAs) [1, 7,
11, 12].

2 Cytokines and Chemokines Epigenetic Changes in Cancer

Cytokines, as proinflammatory mediators, are involved in certain

situations in tumor initiation and tumor development and in other
situations in arresting the tumoral process. Epigenetic changes of
the genes coding these proteins seem to have an important role in
favoring their protumoral role. Many research studies focused on
the role of epigenetic changes of genes coding the proteins that
function as negative regulators of cytokine signaling also called
suppressors of cytokine signaling (SOCS).
The suppressors of cytokine signaling 1-7 (SOCS-1 up to
SOCS-7) are negative regulators of the JAK-STAT pathway. The
Janus kinase (JAK) and signal transducers and activators of tran-
scription (STAT) signaling pathway is involved, among other pro-
cesses, such as cell growth and differentiation, in cytokine signaling
pathway and therefore in immune response through secretion of
IL-1, IL-6, IL-10, and TGF-beta. Following cytokine binding to
correspondent cytokine receptors, the non-receptor tyrosine kinase
JAK is activated which in turn phosphorylates the STATs which
dimerize and become active transcription factors.
Several studies indicated that in dysregulated cases, JAK-STAT
pathway is involved in initiation and development of hepatocellular
carcinoma (HCC) [13], non-small cell lung cancer [14, 15], and
head and neck squamous cell carcinoma [16]. In normal cells, the
SOCS family proteins including SOCS-1 and SOCS-3 are directly
interacting with a specific phosphorylated tyrosine residue of JAK
molecule and thus inducing inhibition of STAT phosphorylation.
Therefore, SOCS family proteins are involved in inhibition of signal
transduction of cytokines and growth factors [17]. SOCS-1 and
SOCS-3 interact with FAK promoting its ubiquitination and deg-
radation in certain cell lines (COS-7) [17]. FAK is a cytoplasmic
tyrosine kinase that plays a role in integrin-mediated signal trans-
duction. When activated, it forms a complex with members of Src
family, initiating cell signaling pathways that promote migration
and cell spreading. The inflammatory pathways, such as the
IL6/JAK/STAT pathway, have been demonstrated to be able of
sustaining cancer stem cells in hepatocellular carcinoma develop-
ment, a process that was observed in a mouse model exhibiting
disrupted TGFβ signaling and spontaneous liver cancer develop-
ment at the same time with activation of IL6 signaling [18].
There are several studies that show that SOCS-1 gene is down-
regulated due to the CpG islands promoter methylation, in hepa-
tocellular carcinoma when compared to the nontumoral tissue in
206 Irina Daniela Florea and Christina Karaoulani

humans [13, 19–23] or rat models [24]. Loss of SOCS-1 expres-

sion in HCC is associated with increased production of TNF-alfa,
IL-2, IL-4, and interferon gamma, due to the fact that, epigenetic
mechanisms can interfere with inflammation generated by the acti-
vation of the JAK/STAT3, inflammation which was well correlated
with HCC derived from liver cirrhosis [19]. SOCS-1 is involved in
suppression of STAT3 and p38MAPK, suppression that leads to the
antiproliferative effect on gastric cancer cells in culture [25]. Inacti-
vation through hypermethylation leads to activation of JAK/STAT
pathway and secretion of IL-6 in gastric cell cancer lines [26].
SOCS-6 inhibits cell proliferation and is downregulated in gastric
cancer [27]. In vivo, SOCS-1 is inactivated by hypermethylation in
gastric cancer and this type of inactivation was detected in gastric
mucosa of gastric cancer patients [25]. Silencing through hyper-
methylation of SOCS-1 is also observed in pancreatic cancer cell
lines or tissue specimens [28, 29].
SOCS-1 hypermethylation was also reported in colon cancer
cell lines [30, 31], in the development of sporadic colon cancer
[32], ulcerative related colon cancer [33] and cholangiocarcinoma
[34, 35]. Also, there are studies showing the association between
this methylation with the development of colon cancer especially in
the young patients [36].
Some other studies relate the SOCS-1 family to the develop-
ment of hematological malignancies such as multiple myeloma,
chronic lymphocytic leukemia [37], chronic and acute myeloid
leukemia [38, 39] and mantle cell lymphoma [40] as well as to
precursor lesions such as myelodisplastic syndrome [41].
SOCS-3, another member of the SOCS family, is also having an
important role in carcinogenesis, due to epigenetic changes leading
to hepatocellular carcinoma. It was demonstrated that SOCS-3
showed an increased methylation frequency and intensity in HCC
HBV related, compared with that in the nonadjacent tissue. It was
shown that SOCS-3 expression was downregulated in HCC lines
and tumor tissues and this was inversely correlated with promoter
methylation, the suggestion being that SOCS-3 methylation could
predict a poor prognosis in HBV infection-related HCC
[42]. Lung cancer and its metastases development seem to be also
related to SOCS methylation, especially to SOCS-3 methylation
[14, 15]. Prostate and central nervous system tumors seem to
exhibit SOCS-3 hypermethylation as well [43, 44].
Inflammatory tumor microenvironment is also influenced by
chemokines. Chemokines are involved not only in inflammatory
response but also in neoplastic transformation, cancer progression,
and angiogenesis [45]. Epigenetic changes of chemokine receptors
genes (demethylation and deacetylation) can induce the receptors’
overexpression and inflammatory changes that favor tumor forma-
tion. For example, epigenetic changes of CXCR4 and CCR7 genes
have been associated with melanoma progression [46], breast
 Epigenetic Changes of the Immune System with Role in Tumor Development 207

cancer progression [47], and pancreatic cancer and uterine cancer

development [48, 49]. In other situations, methylation changes of
various cytokines genes like IL-6, IL-20, and IL-21 have been
shown to induce progression of different cancer types such as
cholangiocarcinoma [50], NSCLC [51], hepatocellular carcinoma
[52], or a more aggressive phenotype of a certain tumor type. For
example, the IL-6 overexpression in basal-like breast cancer due to
changes in methylation [53]. On the other hand, ligands for these
receptors induce protective antitumor effects due to the fact that
they attract immune cells (monocytes and dendritic cells) with
important effect in antigen presentation. Epigenetic changes of
these can induce tumor progression. For example, CXCL-14 epi-
genetic changes are involved in prostate cancer progression [54],
Interferon class I promoter methylation has adverse effects on
melanoma [55] and Interferon class II gene methylation inhibits
the activity of tumor infiltrating lymphocytes [56]. Likewise, meth-
ylation of CXCL-12 is involved in gastric cancer [57], breast cancer
[58–60] and NSCLC [61].

3 Immune Cell Receptors and Epigenetics

Not only the cytokines and chemokines are involved in generating

and mediating the inflammation, but also the cell receptors that are
involved in cell signaling leading to cytokine and chemokine syn-
thesis and release. An important class of receptors whose activation
by their respective ligands induces inflammation initiation through
cytokine synthesis is that of TLRs. On the one side, the TLR
signaling induces inflammatory antitumoral immune effects. On
the other side, uncontrolled TLR signaling can have protumori-
genic effects that induce malignant cells to proliferate and evade
immune responses. It was found that TLR3 expression is associated
with high probability of metastasis and at the same time that TLR4
expression by mononuclear inflammatory cells is associated with
and increased probability of metastasis [62].
In HCC, TLR4 activated by its ligand LPS induces in turn
activation of NF-kB and Snail level increase followed by increased
level of invasiveness in HCC and TLR-4 expression was shown to
be higher in patients with poor cancer-free or overall survival
compared to those with low expression of this receptor [63]. In
pancreatic cancer, TLR7 was shown to have an important role in
mediating tumor progression through several ways. TLR7 was
shown to be highly expressed in both neoplastic ductal epithelia
and inflammatory cells which are found in the tumor microenvi-
ronment while TLR7 had minimal expression in normal pancreatic
tissue [64]. TLR2 was shown to be expressed in over 70% of
pancreatic tumors but not in normal tissue [65]. TLR4 was also
related to pancreatic tumor progression because TLR4 is highly
208 Irina Daniela Florea and Christina Karaoulani

expressed in leucocytes of pancreatic tumor microenvironment

[66]. TLR6 and TLR7 were shown to be linked to lung cancer
progression due to their relationship to inflammation, tumor
growth and chemoresistance in lung cancer cells [67]. TLR9 was
found to be highly expressed in tumor tissue and TLR4 moderately
expressed in tumor tissue compared to normal tissue [68]. In lym-
phomas, changes in TLR signaling pathways seem also to be
involved. Multiple myeloma (MM) and mantle cell lymphoma
might use TLR4 and the cell signaling pathway initiated by its
ligand binding [69–72]. Epigenetic regulation can interfere with
cytokine expression following TLR activation. For example, his-
tone phosphorylation at IL-10 promoter caused by ERK1/
2 MAPK activation following TLR ligand binding induces
enhanced IL-10 production [73]. TLR4 activation induces epige-
netic changes, for example, of the TNF-alfa promoter [74–76],
which in turn induces, through NF-kB, an MM favorable microen-
vironment in the bone marrow. Epigenetic modification of TLR-4
through hypomethylation has been shown to be involved in gastric
cancer [77]. Activation of TLR9 might have a role in the survival of
malignant B cells in endemic Burkitt’s lymphoma by decreasing the
levels of phosphorylated histone H3 and acetylated histones H4,
and H3 bound to the Epstein-Barr virus master regulatory lytic
gene promoter. Therefore, all these changes prevent the lytic phase
of the Epstein-Barr [78].

4 Cell Surface and Cytosolic Proteins Involved in Immune Response and Epigenetic
Changes

Beside proinflammatory mechanisms that promote tumorigenesis,

there are mechanisms belonging to tumor cells that help them in
escaping the immune system surveillance. Some immune stimula-
tory molecules are undergoing DNA methylation in their promoter
regions. Among these molecules are costimulatory molecules,
adhesion molecules (such as ICAM-1 and LFA-3) and HLA mole-
cules together with molecules involved in antigen presentation
machinery. Epigenetic changes seem to have an important role in
the expression of HLA, APM (antigen presentation machinery)
components, costimulatory molecules, and tumor antigens
(TA) in malignant cells [6, 7, 79–88].
Cell surface proteins belonging to HLA system are involved in
immune recognition of tumor antigen. HLA I is involved in the
recognition and destruction of tumor cells by specific cytotoxic T
lymphocytes, and thus the level of HLA I expression correlates with
the evolution of the malignant disease if the protection mechanisms
against it relies on CTLs. Therefore, an important role in tumor
escape is provided by mechanisms that can avoid tumor antigen
Epigenetic Changes of the Immune System with Role in Tumor Development 209

presentation which include mechanisms that interfere with HLA

expression. Changes in HLA expression can occur due to mutations
in the genomic DNA as well as defects in HLA gene transcription
and translation regulation. Campoli’s group showed that HLA I
downregulation is related to a reduction in disease free interval and
survival in HNSCC, breast carcinoma, small cell lung carcinoma,
bladder carcinoma, prostate carcinoma, cervical carcinoma, and
melanoma [79].
HLA proteins epigenetic regulation can induce tumor progres-
sion and these facts were investigated in studies that correlated
HLA proteins level of expression due to epigenetic changes with
the evolution of different cancer types. The results, which involved
studies showing that HLA levels of expression can be reversed
during treatment with HDAC inhibitors [89], indicated that
HLA-A, B, and C gene promoter hypermethylation correlates
with the development of cutaneous primary and metastatic mela-
noma [90–92], uveal melanoma [93], esophageal squamous cell
carcinoma [94, 95], gastric cancer cells [96], or cervical cancer cell
lines [97].
Not only HLA I heavy chain can be affected by epigenetic
regulation, but also the beta2 microglobulin that can undergo
posttranscriptional regulation, a fact that was described in a drug
resistant breast carcinoma cell line [98].
HLA I non classical proteins expression is involved in avoiding
the immune response mediated by effectors such as NK cells. NK
cells are activated by NK cell activating ligands but once the target
cells express HLA I the NK cells receive an inhibitory signal and
subsequently, the activation induced pathway of these cells is inhib-
ited. Regarding the nonclassical HLA I, an overexpression of
HLA-G was detected in glioma, retinoblastoma, carcinomas of
the breast, mesothelial, gastric colon, kidney, bladder, endome-
trium, ovary, and cervix as well as in B cell chronic lymphocytic
lymphoma (CLL) and in non-Hodgkin B and T cell lymphoma
[99–107]. In some cases, the level of expression is related to epi-
genetics changes [107]. On the other hand, HLA-G was shown to
be partly hidden by methylation in kidney cancer [107] and mela-
noma cell lines [108] and probably in ovarian tumors [109].
HLA-II proteins are mediating antigen specific recognition by
T helper cells in exogenous antigen processing pathway, followed
by cytokine synthesis and release, cytokines which are in turn
mediating various immune responses carried by adaptive immune
cells in relationship with innate immune cells. Studies using IHC
investigations showed that HLA II antigens are often overexpressed
in malignant cells [89], sometimes due to epigenetic changes, and
these cells belong to HNSCC carcinomas of the lung, esophagus,
breast, colon, liver, kidney, bladder, ovary, cutaneous, and uveal
carcinoma. On the other side the information related to HLA II
expression in malignant tumors is conflicting due probably to the
210 Irina Daniela Florea and Christina Karaoulani

technical difficulties already mentioned above and also due to the

fact that the studies were focused on the HLA II classical HLA-DR,

DQ and -DP. In order to perform its function, the HLA II is
associating also with APM components of the exogenous pathway
as well as with costimulatory molecules such as B7.1/B7.2 and
CD40 molecules. At the same time, the HLA II antigen presenta-
tion in the absence of the costimulatory molecules already men-
tioned, is inducing anergy of Th cells, instead of inducing
stimulation, that is why the results of studies trying to correlate
the level of HLA II expression with the disease prognosis range
from favorable to unfavorable and seem inconsistent [89].
Not only HLA proteins but also proteins belonging to antigen
processing machinery (APM) in endogenous pathway, such as
TAP1, are related to the prognostics of malignant diseases. TAP1
lower expression in tumor cells leads to lower binding and associa-
tion of tumor antigens with MHC I, therefore to defective presen-
tation to cytolitic T cells. Its importance was underscored by studies
that indicated a relationship between downregulation of TAP1 and
reduced survival in patients with breast carcinoma, SCLC, cervical
cancer, and cutaneous melanoma [79].
These components of APM involved in the generation of the
peptide bound to MHC can as well be subjected to epigenetic
regulation. Melanoma and RCC cell lines are sharing methylation
of tapasin and/or TAP2 promoter, fact that was demonstrated
using demethylating agent 5-aza-2-deoxycytidine (5-AC), which
induced reversal of the function of TAP2 as well as the transcription
of TAP1 [110]. Oppositely, hypoacetylation of the H3 histone
induces eventually lowered expression of HLA I in a lung carci-
noma cell line [82]. Other components of the APM such as TAP1,
TAP2, and LMP7 can be regulated epigenetically in certain tumors
[81]. The mechanism of regulation seems to be shared by mice,
because the same HDAC inhibitors had similar effects in mouse
tumor cells [80].
Regarding HLA II, epigenetic regulations are related to CIITA
promoter. CIITA is a transactivator protein that positively controls
the expression of HLA II, invariant chain (Ii) and HLA-DM, its
own expression being driven by several different promoters in
various types of APCs [89]. Its epigenetic changes such as hyper-
methylation and histone deacetylation [111, 112] leads to its
reduced transcription due to lower recruitment of several transcrip-
tion factors such as IRF-1, STAT-1, and USF-1 to CIITA-PIV and
subsequently to lower IFN gamma inducible HLA-DR expression
[113]. This mechanism was described in cell lines derived from
breast carcinoma [114], stomach [115, 116], colon [84, 116],
cervix [112], cutaneous epithelia [117], T cell leukemia [118],
neuroblastoma [119], teratocarcinoma and choriocarcinoma [81],
and plasma cell tumors [120].
Epigenetic Changes of the Immune System with Role in Tumor Development 211

Studies with tumor tissues showed that epigenetic inactivation

of CIITA leads in several situations to lower level of HLA II
expression such as in colorectal and gastric cancer cells in which
the HLA-DR was sometimes shown to be absent [116], in squa-
mous cell carcinoma [117], or in hematopoietic tumor cell lines
[118]. A study conducted on a population of Uighur women [121]
showed an inverse correlation between the methylation of TAP1,
LMP7, and ERP57 genes and the correspondent protein expres-
sion. The study also concluded that the methylation level of these
genes is significantly higher in cases positive for HPV16 infection
than in negative ones. Their conclusion was that the development
of CSCC from normal epithelium was associated with decrease in
expression of HLA1, TAP1, TAP2, LMP2, LMP7, ERAP1, tapa-
sin, and Erp57 and this was a consequence of lowered gene tran-
scription due to hypermethylation promoters of the
aforementioned genes.
One of the costimulatory molecules is represented by CD80
protein. Its down regulation is one of the main ways by which CRC
cells evade the immune system antitumor mechanisms [122]. There
are studies showing that CD80 mRNA levels are significantly lower
in the non-inflammatory dysplastic mucosa of patients with one or
more methylated genes and inversely correlated with patients’
methylation scores, a limit of the study being the lack of a direct
evidence of DNA methylation of the CD80 promoter [123].
Fas (Apo-1 or CD95) is a member of TNF receptor superfamily
whose loss leads to lymphoproliferation and malignancy [124]. Fas
is an important molecule used as a target of NK cells and Tc cells for
tumor cell elimination [125]. It was shown that p53 wild-type cells
can repress Fas expression through an acetylation related mecha-
nism reversed by Trichostatin, an HDAC inhibitor [126]. It is
possible that such events could occur in vivo along malignant
progression. The same authors showed that, in vivo, epigenetic
silencing of Fas induces tumor growth. In vitro, restoration of Fas
activity either by transfection of Fas or by treatment with Trichos-
tatin A (TSA), an inhibitor of histone deacetylase, arrests the
growth of tumor and restores chemosensitivity, this demonstrating
the importance of epigenetic modification in tumor progression
and immune system evasion. This epigenetic change seems to be
responsible for colorectal cancer carcinogenesis that was studied in
tumor tissue and colon cancer cell lines [127, 128] as well as for
prostatic and urinary bladder carcinogenesis [129]. Epigenetic
changes are demonstrated to be involved in resistance to chemo-
therapy in ovarian cancer through histone deacetylation of Fas
promoter [130] or for resistance to chemotherapy in bladder can-
cer through methylation of Fas promoter [131], changes that can
be reversed by radiotherapy [132].
212 Irina Daniela Florea and Christina Karaoulani

5 Conclusions

The data presented in this review demonstrates that epigenetic

changes affecting different components of the immune system can
be related to cancer initiation, progression, and metastasis.
Although data related to somatic mutations of proteins with a
role in the immune response are extensive, these are not able to
entirely explain carcinogenesis and failures of current cancer ther-
apy. Therefore, a lot of research studies focused on epigenetic
modifications underwent by these proteins have been conducted
in the last 20 years. The abovementioned studies involved proteins
that induce chronic inflammation, process demonstrated to be
directly linked to cancer development, such as cytokines, chemo-
kines, and immune receptors related to inflammatory mediator’s
synthesis, as well as proteins involved in tumor cell escape from the
immune system surveillance. Immunoepigenetics approach to car-
cinogenesis could represent a step forward not only in understand-
ing more thoroughly the cancer development but also in cancer
therapy that can aim to reverse the abnormal epigenetic changes.
Advanced studies in this field are necessary in order to develop new
potential targets and more efficient therapeutic agents in cancer
treatment.

References
1. Grivennikov SI, Greten FR, Karin M (2010)
Immunity, inflammation and cancer. Cell 140
(6):883–899
2. Yasmin R, Siraj S, Hassan A, Khan AR,
Abbasi R, Ahmad N (2015) Epigenetic regu-
lation of inflammatory cytokines and asso-
ciated genes in human malignancies. Mediat
Inflamm 2015:201703
3. Dong J, Jimi E, Zeiss C, Hayden MS, Ghosh S
(2010) Constitutively active NF-kappaB trig-
gers systemic TNFalpha-dependent inflam-
mation and localized TNFalpha-independent
inflammatory disease. Genes Dev 24
(16):1709–1717
4. Bharti AC, Shishodia S, Reuben JM,
Weber D, Alexanian R, Raj-Vadhan S,
Estrov Z, Talpaz M, Aggarwal BB (2004)
Nuclear factor-kappaB and STAT3 are consti-
tutively active in CD138+ cells derived from
multiple myeloma patients, and suppression
of these transcription factors leads to apopto-
sis. Blood 103(8):3175–3184
5. Nakshatri H, Bhat-Nakshatri P, Martin DA,
Goulet RJ Jr, Sledge GW Jr (1997) Constitu-
tive activation of NF-kappaB during progres-
sion of breast cancer to hormone-
independent growth. Mol Cell Biol 17
(7):3629–3639
6. Esteller M (2006) Epigenetics provides a new
generation of oncogenes and tumour-
suppressor genes. Br J Cancer 94(2):179–183
7. Lettini AA, Guidoboni M, Fonsatti E,
Anzalone L, Cortini E, Maio M (2007) Epi-
genetic remodelling of DNA in cancer. Histol
Histopathol 22(12):1413–1424
8. Fuks F, Burgers WA, Godin N, Kasai M, Kou-
zarides T (2001) Dnmt3a binds deacetylases
and is recruited by a sequence-specific repres-
sor to silence transcription. EMBO J 20
(10):2536–2544
9. Di Croce L, Raker VA, Corsaro M, Fazi F,
Fanelli M, Faretta M, Fuks F, Lo Coco F,
Kouzarides T, Nervi C, Minucci S, Pelicci
PG (2002) Methyltransferase recruitment
and DNA hypermethylation of target promo-
ters by an oncogenic transcription factor. Sci-
ence 295(5557):1079–1082
10. Herman JG, Baylin SB (2003) Gene silencing
in cancer in association with promoter hyper-
methylation. N Engl J Med 349
(21):2042–2054
 Epigenetic Changes of the Immune System with Role in Tumor Development
11. Berezikov E, Guryev V, van de Belt J,
Wienholds E, Plasterk RH, Cuppen E
(2005) Phylogenetic shadowing and compu-
tational identification of human microRNA
genes. Cell 120(1):21–24
12. Sontheimer EJ, Carthew RW (2005) Silence
from within: endogenous siRNAs and miR-
NAs. Cell 122(1):9–12
13. Yoshikawa H, Matsubara K, Qian GS,
Jackson P, Groopman JD, Manning JE, Harris
CC, Herman JG (2001) SOCS-1, a negative
regulator of the JAK/STAT pathway, is
silenced by methylation in human hepatocel-
lular carcinoma and shows growth-
suppression activity. Nat Genet 28(1):29–35
14. He B, You L, Uematsu K, Zang K, Xu Z, Lee
AY, Costello JF, McCormick F, Jablons DM
(2003) SOCS-3 is frequently silenced by
hypermethylation and suppresses cell growth
in human lung cancer. Proc Natl Acad Sci U S
A 100(24):14133–14138
15. He B, You L, Xu Z, Mazieres J, Lee AY,
Jablons DM (2004) Activity of the suppressor
of cytokine signaling-3 promoter in human
non-small-cell lung cancer. Clin Lung Cancer
5(6):366–370
16. Weber A, Hengge UR, Bardenheuer W,
Tischoff I, Sommerer F, Markwarth A,
Dietz A, Wittekind C, Tannapfel A (2005)
SOCS-3 is frequently methylated in head
and neck squamous cell carcinoma and its
precursor lesions and causes growth inhibi-
tion. Oncogene 24(44):6699–6708
17. Niwa Y, Kanda H, Shikauchi Y, Saiura A,
Matsubara K, Kitagawa T, Yamamoto J,
Kubo T, Yoshikawa H (2005) Methylation
silencing of SOCS-3 promotes cell growth
and migration by enhancing JAK/STAT and
FAK signalings in human hepatocellular carci-
noma. Oncogene 24(42):6406–6417
18. Tang Y, Kitisin K, Jogunoori W, Li C, Deng
CX, Mueller SC, Ressom HW, Rashid A, He
AR, Mendelson JS, Jessup JM, Shetty K,
Zasloff M, Mishra B, Reddy EP, Johnson L,
Mishra L (2008) Progenitor/stem cells give
rise to liver cancer due to aberrant TGF-beta
and IL-6 signaling. Proc Natl Acad Sci U S A
105(7):2445–2450
19. Chu PY, Yeh CM, Hsu NC, Chang YS, Chang
JG, Yeh KT (2010) Epigenetic alteration of
the SOCS1 gene in hepatocellular carcinoma.
Swiss Med Wkly 140:w13065
20. Saelee P, Chuensumran U, Wongkham S,
Chariyalertsak S, Tiwawech D, Petmitr S
(2012) Hypermethylation of suppressor of
cytokine signaling 1 in hepatocellular carci-
noma patients. Asian Pac J Cancer Prev 13
(7):3489–3493
213
21. Miyoshi H1, Fujie H, Moriya K, Shintani Y,
Tsutsumi T, Makuuchi M, Kimura S, Koike K
(2004) Methylation status of suppressor of
cytokine signaling-1 gene in hepatocellular
carcinoma. J Gastroenterol 39(6):563–569
22. Formeister EJ, Tsuchiya M, Fujii H,
Shpyleva S, Pogribny IP, Rusyn I (2010)
Comparative analysis of promoter methyla-
tion and gene expression endpoints between
tumorous and non-tumorous tissues from
HCV-positive patients with hepatocellular
carcinoma. Mutat Res 692(1-2):26–33
23. Zhao RC, Zhou J, He JY, Wei YG, Qin Y, Li B
(2016) Aberrant promoter methylation of
SOCS-1 gene may contribute to the patho-
genesis of hepatocellular carcinoma: a meta-
analysis. J BUON 21(1):142–151
24. Bagnyukova TV, Tryndyak VP,
Muskhelishvili L, Ross SA, Beland FA,
Pogribny IP (2008) Epigenetic downregula-
tion of the suppressor of cytokine signaling
1 (Socs1) gene is associated with the STAT3
activation and development of hepatocellular
carcinoma induced by methyl-deficiency in
rats. Cell Cycle 7(20):3202–3210
25. Souma Y, Nishida T, Serada S, Iwahori K,
Takahashi T, Fujimoto M, Ripley B,
Nakajima K, Miyazaki Y, Mori M, Doki Y,
Sawa Y, Naka T (2012) Antiproliferative effect
of SOCS-1 through the suppression of
STAT3 and p38 MAPK activation in gastric
cancer cells. Int J Cancer 131(6):1287–1296
26. To KF, Chan MW, Leung WK, Ng EK, Yu J,
Bai AH, Lo AW, Chu SH, Tong JH, Lo KW,
Sung JJ, Chan FK (2004) Constitutional acti-
vation of IL-6-mediated JAK/STAT pathway
through hypermethylation of SOCS-1 in
human gastric cancer cell line. Br J Cancer
91(7):1335–1341
27. Lai RH, Hsiao YW, Wang MJ, Lin HY, Wu
CW, Chi CW Li AF, Jou YS, Chen JY (2010)
SOCS6, down-regulated in gastric cancer,
inhibits cell proliferation and colony forma-
tion. Cancer Lett 288(1):75–85
28. Komazaki T, Nagai H, Emi M, Terada Y,
Yabe A, Jin E Kawanami O, Konishi N,
Moriyama Y, Naka T, Tet K (2004)
Hypermethylation-associated inactivation of
the SOCS-1 gene, a JAK/STAT inhibitor, in
human pancreatic cancers. Jpn J Clin Oncol
34(4):191–194
29. Fukushima N, Sato N, Sahin F, Su GH, Hru-
ban RH, Goggins M (2003) Aberrant meth-
ylation of suppressor of cytokine signalling-1
(SOCS-1) gene in pancreatic ductal neo-
plasms. Br J Cancer 89(2):338–343
30. Xu SB, Liu XH, Li BH, Zhang Y, Yuan J,
Yuan Q, Li PD, Yang XZ, Li F, Zhang WJ
214 Irina Daniela Florea and Christina Karaoulani
(2009) DNA methylation regulates constitu-
tive expression of Stat6 regulatory genes
SOCS-1 and SHP-1 in colon cancer cells. J
Cancer Res Clin Oncol 135(12):1791–1798
31. Liu XH, Xu SB, Yuan J, Li BH, Zhang Y,
Yuan Q, Li PD, Li F, Zhang WJ (2009)
Defective interleukin-4/Stat6 activity corre-
lates with increased constitutive expression of
negative regulators SOCS-3, SOCS-7, and
CISH in colon cancer cells. J Interf Cytokine
Res 29(12):809–816
32. Hibi K, Kodera Y, Ito K, Akiyama S, Nakao A
(2005) Aberrant methylation of HLTF,
SOCS-1, and CDH13 genes is shown in colo-
rectal cancers without lymph node metastasis.
Dis Colon Rectum 48(6):1282–1286
33. Li Y, Deuring J, Peppelenbosch MP, Kuipers
EJ, de Haar C, van der Woude CJ (2012)
IL-6-induced DNMT1 activity mediates
SOCS3 promoter hypermethylation in ulcer-
ative colitis-related colorectal cancer. Carcino-
genesis 33(10):1889–1896
34. Isomoto H (2009) Epigenetic alterations in
cholangiocarcinoma-sustained IL-6/STAT3
signaling in cholangiocarcinoma due to
SOCS3 epigenetic silencing. Digestion 79
(Suppl 1):2–8
35. Isomoto H, Mott JL, Kobayashi S, Werne-
burg NW, Bronk SF, Haan S, Gores GJ
(2007) Sustained IL-6/STAT-3 signaling in
cholangiocarcinoma cells due to SOCS-3 epi-
genetic silencing. Gastroenterology 132
(1):384–396
36. Fujitake S, Hibi K, Okochi O, Kodera Y,
Ito K, Akiyama S, Nakao A (2004) Aberrant
methylation of SOCS-1 was observed in
younger colorectal cancer patients. J Gastro-
enterol 39(2):120–124
37. Hatirnaz O, Ure U, Ar C, Akyerli C, Soysal T,
Ferhanoğlu B, Ozçelik T, Ozbek U (2007)
The SOCS-1 gene methylation in chronic
myeloid leukemia patients. Am J Hematol 82
(8):729–730
38. Liu TC, Lin SF, Chang JG, Yang MY, Hung
SY, Chang CS (2003) Epigenetic alteration of
the SOCS1 gene in chronic myeloid leukae-
mia. Br J Haematol 123(4):654–661
39. Chen CY, Tsay W, Tang JL, Shen HL, Lin SW,
Huang SY, Yao M, Chen YC, Shen MC, Wang
CH, Tien HF (2003) SOCS1 methylation in
patients with newly diagnosed acute myeloid
leukemia. Genes Chromosomes Cancer 37
(3):300–305
40. Molavi O, Wang P, Zak Z, Gelebart P,
Belch A, Lai R (2013) Gene methylation and
silencing of SOCS3 in mantle cell lymphoma.
Br J Haematol 161(3):348–356
41. Wu SJ, Yao M, Chou WC, Tang JL, Chen CY,
Ko BS, Tsay W, Chen YC, Shen MC, Wang
CH, Yeh YC, Tien HF (2006) Clinical impli-
cations of SOCS1 methylation in myelodys-
plastic syndrome. Br J Haematol 135
(3):317–323
42. Zhang X, You Q, Zhang X, Chen X (2015)
SOCS3 methylation predicts a poor prognosis
in HBV infection-related hepatocellular carci-
noma. Int J Mol Sci 16(9):22662–22675
43. Pierconti F, Martini M, Pinto F, Cenci T,
Capodimonti S, Calarco A, Bassi PF, Larocca
LM (2011) Epigenetic silencing of SOCS3
identifies a subset of prostate cancer with an
aggressive behavior. Prostate 71(3):318–325
44. Martini M, Pallini R, Luongo G, Cenci T,
Lucantoni C, Larocca LM (2008) Prognostic
relevance of SOCS3 hypermethylation in
patients with glioblastoma multiforme. Int J
Cancer 123(12):2955–2960
45. Singh RK, Sudhakar A, Lokeshwar BL (2010)
Role of chemokines and chemokine receptors
in prostate Cancer development and progres-
sion. J Cancer Sci Ther 2(4):89–94
46. Mori T, Kim J, Yamano T, Takeuchi H,
Huang S, Umetani N, Koyanagi K, Hoon
DS (2005) Epigenetic up-regulation of C-C
chemokine receptor 7 and C-X-C chemokine
receptor 4 expression in melanoma cells. Can-
cer Res 65(5):1800–1807
47. Ramos EA, Grochoski M, Braun-Prado K,
Seniski GG, Cavalli IJ, Ribeiro EM, Camargo
AA, Costa FF, Klassen G (2011) Epigenetic
changes of CXCR4 and its ligand CXCL12 as
prognostic factors for sporadic breast cancer.
PLoS One 6(12):e29461
48. Sato N, Matsubayashi H, Fukushima N, Gog-
gins M (2005) The chemokine receptor
CXCR4 is regulated by DNA methylation in
pancreatic cancer. Cancer Biol Ther 4
(1):70–76
49. Luczak MW, Roszak A, Pawlik P, Ke˛dzia H,
Ke˛dzia W, Malkowska-Walczak B, Lianeri M,
Jagodziński PP (2012) Transcriptional analy-
sis of CXCR4, DNMT3A, DNMT3B and
DNMT1 gene expression in primary
advanced uterine cervical carcinoma. Int J
Oncol 40(3):860–866
50. Wehbe H, Henson R, Meng F, Mize-Berge J,
Patel T (2006) Interleukin-6 contributes to
growth in cholangiocarcinoma cells by aber-
rant promoter methylation and gene expres-
sion. Cancer Res 66(21):10517–10524
51. Baird AM, Gray SG, O’Byrne KJ (2011)
IL-20 is epigenetically regulated in NSCLC
and down regulates the expression of VEGF.
Eur J Cancer 47(12):1908–1918
 Epigenetic Changes of the Immune System with Role in Tumor Development
52. Zhong D, Cen H (2017) Aberrant promoter
methylation profiles and association with sur-
vival in patients with hepatocellular carci-
noma. Onco Targets Ther 10:2501–2509
53. D’Anello L, Sansone P, Storci G, Mitrugno V,
D’Uva G, Chieco P, Bonafé M (2010) Epige-
netic control of the basal-like gene expression
profile via Interleukin-6 in breast cancer cells.
Mol Cancer 9:300
54. Song EY, Shurin MR, Tourkova IL, Gutkin
DW, Shurin GV (2010) Epigenetic mechan-
isms of promigratory chemokine CXCL14
regulation in human prostate cancer cells.
Cancer Res 70(11):4394–4401
55. Borden EC (2007) Augmentation of effects
of interferon-stimulated genes by reversal of
epigenetic silencing: potential application to
melanoma. Cytokine Growth Factor Rev 18
(5-6):491–501
56. Janson PC, Marits P, Thörn M, Ohlsson R,
Winqvist O (2008) CpG methylation of the
IFNG gene as a mechanism to induce immu-
nosuppression [correction of immunosupres-
sion] in tumor-infiltrating lymphocytes. J
Immunol 181(4):2878–2886
57. Zhi Y, Chen J, Zhang S, Chang X, Ma J, Dai
D (2012) Down-regulation of CXCL12 by
DNA hypermethylation and its involvement
in gastric cancer metastatic progression. Dig
Dis Sci 57(3):650–659
58. Zhou W, Jiang Z, Liu N, Xu F, Wen P, Liu Y,
Zhong W, Song X, Chang X, Zhang X, Wei G,
Yu J (2009) Down-regulation of CXCL12
mRNA expression by promoter hypermethy-
lation and its association with metastatic pro-
gression in human breast carcinomas. J
Cancer Res Clin Oncol 135(1):91–102
59. Ramos EA, Camargo AA, Braun K, Slowik R,
Cavalli IJ, Ribeiro EM, Pedrosa Fde O, de
Souza EM, Costa FF, Klassen G (2010)
Simultaneous CXCL12 and ESR1 CpG island
hypermethylation correlates with poor prog-
nosis in sporadic breast cancer. BMC Cancer
10:23
60. Wendt MK, Cooper AN, Dwinell MB (2008)
Epigenetic silencing of CXCL12 increases the
metastatic potential of mammary carcinoma
cells. Oncogene 27(10):1461–1471
61. Suzuki M, Mohamed S, Nakajima T, Kubo R,
Tian L, Fujiwara T, Suzuki H, Nagato K,
Chiyo M, Motohashi S, Yasufuku K,
Iyoda A, Yoshida S, Sekine Y, Shibuya K,
Hiroshima K, Nakatani Y, Yoshino I, Fujisawa
T (2008) Aberrant methylation of CXCL12
in non-small cell lung cancer is associated with
an unfavorable prognosis. Int J Oncol 33
(1):113–119
215
62. González-Reyes S, Marı́n L, González L,
González LO, del Casar JM, Lamelas ML
et al (2010) Study of TLR3, TLR4 and
TLR9 in breast carcinomas and their associa-
tion with metastasis. BMC Cancer 10:665
63. Jing YY, Han ZP, Sun K, Zhang SS, Hou J,
Liu Y, Li R, Gao L, Zhao X, Zhao QD, Wu
MC, Wei LX (2012) Toll-like receptor 4 sig-
naling promotes epithelial-mesenchymal tran-
sition in human hepatocellular carcinoma
induced by lipopolysaccharide. BMC Med
10:98
64. Ochi A, Graffeo CS, Zambirinis CP,
Rehman A, Hackman M, Fallon N, Barilla
RM, Henning JR, Jamal M, Rao R, Greco S,
Deutsch M, Medina-Zea MV, Bin Saeed U,
Ego-Osuala MO, Hajdu C, Miller G (2012)
Toll-like receptor 7 regulates pancreatic carci-
nogenesis in mice and humans. J Clin Invest
122(11):4118–4129
65. Huynh AS, Chung WJ, Cho HI, Moberg VE,
Celis E, Morse DL, Vagner J (2012) Novel
toll-like receptor 2 ligands for targeted pan-
creatic cancer imaging and immunotherapy. J
Med Chem 55(22):9751–9762
66. Ochi A, Nguyen AH, Bedrosian AS, Mushlin
HM, Zarbakhsh S, Barilla R, Zambirinis CP,
Fallon NC, Rehman A, Pylayeva-Gupta Y,
Badar S, Hajdu CH, Frey AB, Bar-Sagi D,
Miller G (2012) MyD88 inhibition amplifies
dendritic cell capacity to promote pancreatic
carcinogenesis via Th2 cells. J Exp Med 209
(9):1671–1687
67. Cherfils-Vicini J, Platonova S, Gillard M,
Laurans L, Validire P, Caliandro R,
Magdeleinat P, Mami-Chouaib F, Dieu-
Nosjean MC, Fridman WH, Damotte D,
Sautès-Fridman C, Cremer I (2010) Trigger-
ing of TLR7 and TLR8 expressed by human
lung cancer cells induces cell survival and che-
moresistance. J Clin Invest 120
(4):1285–1297
68. Zhang YB, He FL, Fang M, Hua TF, Hu BD,
Zhang ZH, Cao Q, Liu RY (2009) Increased
expression of toll-like receptors 4 and 9 in
human lung cancer. Mol Biol Rep 36
(6):1475–1481
69. Wang L, Zhao Y, Qian J, Sun L, Lu Y, Li H,
Li Y, Yang J, Cai Z, Yi Q (2013) Toll-like
receptor-4 signaling in mantle cell lymphoma:
effects on tumor growth and immune evasion.
Cancer 119(4):782–791
70. Xu Y, Zhao Y, Huang H, Chen G, Wu X,
Wang Y, Chang W, Zhu Z, Feng Y, Wu D
(2010) Expression and function of toll-like
receptors in multiple myeloma patients: toll-
like receptor ligands promote multiple mye-
loma cell growth and survival via activation of
216 Irina Daniela Florea and Christina Karaoulani
nuclear factor-kappaB. Br J Haematol 150
(5):543–553
71. Bell JK (2011) The TOLL of inflammation in
multiple myeloma. Cancer Biol Ther 11
(1):68–70
72. Bao H, Lu P, Li Y, Wang L, Li H, He D,
Yang Y, Zhao Y, Yang L, Wang M, Yi Q, Cai
Z (2011) Triggering of toll-like receptor-4 in
human multiple myeloma cells promotes pro-
liferation and alters cell responses to immune
and chemotherapy drug attack. Cancer Biol
Ther 11(1):58–67
73. Banerjee S, Halder K, Bose A, Bhattacharya P,
Gupta G, Karmahapatra S, Das S,
Chaudhuri S, Bhattacharyya Majumdar S,
Majumdar S (2011) TLR signaling-mediated
differential histone modification at IL-10 and
IL-12 promoter region leads to functional
impairments in tumor-associated macro-
phages. Carcinogenesis 32(12):1789–1797
74. Hideshima T, Bergsagel PL, Kuehl WM,
Anderson KC (2004) Advances in biology of
multiple myeloma: clinical applications. Blood
104(3):607–618
75. van Horssen R, Ten Hagen TL, Eggermont
AM (2006) TNF-alpha in cancer treatment:
molecular insights, antitumor effects, and
clinical utility. Oncologist 11(4):397–408
76. Sullivan KE, Reddy AB, Dietzmann K, Sur-
iano AR, Kocieda VP, Stewart M, Bhatia M
(2007) Epigenetic regulation of tumor necro-
sis factor alpha. Mol Cell Biol 27
(14):5147–5160
77. Kim TW, Lee SJ, Oh BM, Lee H, Uhm TG,
Min JK, Park YJ, Yoon SR, Kim BY, Kim JW,
Choe YK, Lee HG (2016) Epigenetic modifi-
cation of TLR4 promotes activation of NF-κB
by regulating methyl-CpG-binding domain
protein 2 and Sp1 in gastric cancer. Oncotar-
get 7(4):4195–4209
78. Zauner L, Melroe GT, Sigrist JA, Rechsteiner
MP, Dorner M, Arnold M, Berger C,
Bernasconi M, Schaefer BW, Speck RF,
Nadal D (2010) TLR9 triggering in Burkitt’s
lymphoma cell lines suppresses the EBV
BZLF1 transcription via histone modification.
Oncogene 29(32):4588–4598
79. Chang CC, Campoli M, Ferrone S (2005)
Classical and nonclassical HLA class I antigen
and NK cell-activating ligand changes in
malignant cells: current challenges and future
directions. Adv Cancer Res 93:189–234
80. Magner WJ, Kazim AL, Stewart C, Romano
MA, Catalano G, Grande C, Keiser N,
Santaniello F, Tomasi TB (2000) Activation
of MHC class I, II, and CD40 gene
expression by histone deacetylase inhibitors.
J Immunol 165(12):7017–7024
81. Tomasi TB, Magner WJ, Khan AN (2006)
Epigenetic regulation of immune escape
genes in cancer. Cancer Immunol Immun-
other 55(10):1159–1184
82. Setiadi AF, David MD, Seipp RP, Hartikainen
JA, Gopaul R, Jefferies WA (2007) Epigenetic
control of the immune escape mechanisms in
malignant carcinomas. Mol Cell Biol 27
(22):7886–7894
83. Khan AN, Magner WJ, Tomasi TB (2004) An
epigenetically altered tumor cell vaccine. Can-
cer Immunol Immunother 53(8):748–754
84. Chou SD, Khan AN, Magner WJ, Tomasi TB
(2005) Histone acetylation regulates the cell
type specific CIITA promoters, MHC class II
expression and antigen presentation in tumor
cells. Int Immunol 17(11):1483–1494
85. Singh NP, Yolcu ES, Taylor DD, Gercel-
Taylor C, Metzinger DS, Dreisbach SK, Shir-
wan H (2003) A novel approach to cancer
immunotherapy: tumor cells decorated with
CD80 generate effective antitumor immunity.
Cancer Res 63(14):4067–4073
86. Scanlan MJ, Gure AO, Jungbluth AA, Old LJ,
Chen YT (2002) Cancer/testis antigens: an
expanding family of targets for cancer immu-
notherapy. Immunol Rev 188:22–32
87. Maio M, Coral S, Fratta E, Altomonte M,
Sigalotti L (2003) Epigenetic targets for
immune intervention in human malignancies.
Oncogene 22(42):6484–6488
88. Germenis AE, Karanikas V (2007) Immunoe-
pigenetics: the unseen side of cancer immu-
noediting. Immunol Cell Biol 85(1):55–59
89. Campoli M, Ferrone S (2008) HLA antigen
changes in malignant cells: epigenetic
mechanisms and biologic significance. Onco-
gene 27(45):5869–5885
90. Serrano A, Tanzarella S, Lionello I,
Mendez R, Traversari C, Ruiz-Cabello F, Gar-
rido F (2001) Rexpression of HLA class I
antigens and restoration of antigen-specific
CTL response in melanoma cells following
5-aza-20 -deoxycytidine treatment. Int J Can-
cer 94(2):243–251
91. Khan AN, Gregorie CJ, Tomasi TB (2008)
Histone deacetylase inhibitors induce TAP,
LMP, Tapasin genes and MHC class I antigen
presentation by melanoma cells. Cancer
Immunol Immunother 57(5):647–654
92. Fonsatti E, Sigalotti L, Coral S, Colizzi F,
Altomonte M, Maio M (2003) Methylation-
regulated expression of HLA class I antigens
in melanoma. Int J Cancer 105(3):430–431
 Epigenetic Changes of the Immune System with Role in Tumor Development
93. Radosevich M, Jager M, Ono SJ (2007) Inhi-
bition of MHC class II gene expression in
uveal melanoma cells is due to methylation
of the CIITA gene or an upstream activator.
Exp Mol Pathol 82(1):68–76
94. Nie Y, Yang G, Song Y, Zhao X, So C, Liao J,
Wang LD, Yang CS (2001) DNA hyper-
methylation is a mechanism for loss of expres-
sion of the HLA class I genes in human
esophageal squamous cell carcinomas. Carci-
nogenesis 22(10):1615–1623
95. Qifeng S, Bo C, Xingtao J, Chuanliang P,
Xiaogang Z (2011) Methylation of the pro-
moter of human leukocyte antigen class I in
human esophageal squamous cell carcinoma
and its histopathological characteristics. J
Thorac Cardiovasc Surg 141(3):808–814
96. Ye Q, Shen Y, Wang X, Yang J, Miao F,
Shen C, Zhang J (2010) Hypermethylation
of HLA class I gene is associated with HLA
class I down-regulation in human gastric can-
cer. Tissue Antigens 75(1):30–39
97. Mora-Garcı́a Mde L, Duenas-González A,
Hernández-Montes J, De la Cruz-
Hernández E, Pérez-Cárdenas E, Weiss-
Steider B, Santiago-Osorio E, Ortı́z-Navar-
rete VF, Rosales VH, Cantú D, Lizano-
Soberón M, Rojo-Aguilar MP, Monroy-Gar-
cı́a A (2006) Up-regulation of HLA class-I
antigen expression and antigen-specific CTL
response in cervical cancer cells by the
demethylating agent hydralazine and the his-
tone deacetylase inhibitor valproic acid. J
Transl Med 4:55
98. Ogretmen B, McCauley MD, Safa AR (1998)
Molecular mechanisms of loss of beta
2-microglobulin expression in drug-resistant
breast cancer sublines and its involvement in
drug resistance. Biochemistry 37
(33):11679–11691
99. Ye SR, Yang H, Li K, Dong DD, Lin XM, Yie
SM (2007) Human leukocyte antigen G
expression: as a significant prognostic indica-
tor for patients with colorectal cancer. Mod
Pathol 20(3):375–383
100. Yie SM, Yang H, Ye SR, Li K, Dong DD, Lin
XM (2007) Expression of human leukocyte
antigen G (HLA-G) correlates with poor
prognosis in gastric carcinoma. Ann Surg
Oncol 14(10):2721–2729
101. Yie SM, Yang H, Ye SR, Li K, Dong DD, Lin
XM (2007) Expression of human leucocyte
antigen G (HLA-G) is associated with prog-
nosis in non-small cell lung cancer. Lung Can-
cer 58(2):267–274
102. Chang CC, Ferrone S (2003) HLA-G in mel-
anoma: can the current controversies be
solved? Semin Cancer Biol 13(5):361–369
217
103. Lin A, Yan WH, Xu HH, Gan MF, Cai JF,
Zhu M, Zhou MY (2007) HLA-G expression
in human ovarian carcinoma counteracts NK
cell function. Ann Oncol 18(11):1804–1809
104. Li XJ, Zhang X, Lin A, Ruan YY, Yan WH
(2012) Human leukocyte antigen-G
(HLA-G) expression in cervical cancer lesions
is associated with disease progression. Hum
Immunol 73(9):946–949
105. Xu DP, Shi WW, Zhang TT, Lv HY, Li JB,
Lin A, Yan WH (2016) Elevation of HLA-G-
expressing DC-10 cells in patients with gastric
cancer. Hum Immunol 77(9):800–804
106. Sebti Y, Le Maux A, Gros F, De Guibert S,
Pangault C, Rouas-Freiss N, Bernard M,
Amiot L (2007) Expression of functional sol-
uble human leucocyte antigen-G molecules in
lymphoproliferative disorders. Br J Haematol
138(2):202–212
107. Dunker K, Schlaf G, Bukur J, Altermann WW,
Handke D, Seliger B (2008) Expression and
regulation of non-classical HLA-G in renal
cell carcinoma. Tissue Antigens 72
(2):137–148
108. Yan WH, Lin AF, Chang CC, Ferrone S
(2005) Induction of HLA-G expression in a
melanoma cell line OCM-1A following the
treatment with 5-aza-20 -deoxycytidine. Cell
Res 15(7):523–531
109. Menendez L, Walker LD, Matyunina LV,
Totten KA, Benigno BB, McDonald JF
(2008) Epigenetic changes within the pro-
moter region of the HLA-G gene in ovarian
tumors. Mol Cancer 7:43
110. Seliger B (2008) Molecular mechanisms of
MHC class I abnormalities and APM compo-
nents in human tumors. Cancer Immunol
Immunother 57(11):1719–1726
111. Reith W, LeibundGut-Landmann S, Wald-
burger JM (2005) Regulation of MHC class
II gene expression by the class II transactiva-
tor. Nat Rev Immunol 5(10):793–806
112. Wright KL, Ting JP (2006) Epigenetic regu-
lation of MHC-II and CIITA genes. Trends
Immunol 27(9):405–412
113. van den Elsen PJ, van der Stoep N, Viëtor
HE, Wilson L, van Zutphen M, Gobin SJ
(2000) Lack of CIITA expression is central
to the absence of antigen presentation func-
tions of trophoblast cells and is caused by
methylation of the IFN-gamma inducible
promoter (PIV) of CIITA. Hum Immunol
61(9):850–856
114. Campoli M, Chang CC, Oldford SA, Edge-
combe AD, Drover S, Ferrone S (2004) HLA
antigen changes in malignant tumors of mam-
mary epithelial origin: molecular mechanisms
218 Irina Daniela Florea and Christina Karaoulani
and clinical implications. Breast Dis
20:105–125
115. van der Stoep N, Biesta P, Quinten E, van den
Elsen PJ (2002) Lack of IFN-gamma-
mediated induction of the class II transactiva-
tor (CIITA) through promoter methylation is
predominantly found in developmental
tumor cell lines. Int J Cancer 97(4):501–507
116. Satoh A, Toyota M, Ikeda H, Morimoto Y,
Akino K, Mita H, Suzuki H (2004) Epige-
netic inactivation of class II transactivator
(CIITA) is associated with the absence of
interferon-gamma-induced HLA-DR expres-
sion in colorectal and gastric cancer cells.
Oncogene 23(55):8876–8886
117. Kanaseki T et al (2003) Histone deacetyla-
tion, but not hypermethylation, modifies
class II transactivator and MHC class II gene
expression in squamous cell carcinomas. J
Immunol 170(10):4980–4985
118. Morimoto Y, Toyota M, Satoh A, Murai M,
Mita H, Suzuki H (2004) Inactivation of class
II transactivator by DNA methylation and
histone deacetylation associated with absence
of HLA-DR induction by interferon-gamma
in haematopoietic tumour cells. Br J Cancer
90(4):844–852
119. Takamura Y, Ikeda H, Kanaseki T, Toyota M,
Tokino T, Imai K, Houkin K (2004) Regula-
tion of MHC class II expression in glioma
cells by class II transactivator (CIITA). Glia
45(4):392–405
120. Ghosh N, Gyory I, Wright G, Wood J, Wright
KL (2001) Positive regulatory domain I bind-
ing factor 1 silences class II transactivator
expression in multiple myeloma cells. J Biol
Chem 276(18):15264–15268
121. Hasim A, Abudula M, Aimiduo R, Ma JQ,
Jiao Z, Akula G, Wang T (2012) Post-
transcriptional and epigenetic regulation of
antigen processing machinery (APM) compo-
nents and HLA-I in cervical cancers from
Uighur women. PLoS One 7(9):e44952
122. Chaux P, Moutet M, Faivre J, Martin F, Mar-
tin M (1996) Inflammatory cells infiltrating
human colorectal carcinomas express HLA
class II but not B7-1 and B7-2 costimulatory
molecules of the T-cell activation. Lab Inves-
tig 74(5):975–983
123. Scarpa M, Castagliuolo I, Erroi F, Basato S,
Brun P, Angriman I (2016) CD80 down-
regulation is associated to aberrant DNA
methylation in non-inflammatory colon carci-
nogenesis. BMC Cancer 16:388
124. Adachi M, Watanabe-Fukunaga R, Nagata S
(1993) Aberrant transcription caused by the
insertion of an early transposable element in
an intron of the Fas antigen gene of lpr mice.
Proc Natl Acad Sci U S A 90(5):1756–1760
125. Ashkenazi A, Dixit VM (1998) Death recep-
tors: signaling and modulation. Science 281
(5381):1305–1308
126. Maecker HL, Borhani N, Karbasi A,
Koochaki A, Kazemi B (2002) Epigenetic
changes in tumor Fas levels determine
immune escape and response to therapy. Can-
cer Cell 2(2):139–148
127. Manoochehri M, Borhani N, Karbasi A,
Koochaki A, Kazemi B (2016) Promoter
hypermethylation and downregulation of the
FAS gene may be involved in colorectal carci-
nogenesis. Oncol Lett 12(1):285–290
128. Petak I, Danam RP, Tillman DM, Vernes R,
Howell SR, Berczi L, Kopper L, Brent TP,
Houghton JA (2003) Hypermethylation of
the gene promoter and enhancer region can
regulate Fas expression and sensitivity in
colon carcinoma. Cell Death Differ 10
(2):211–217
129. Santourlidis S, Warskulat U, Florl AR, Maas S,
Pulte T, Fischer J (2001) Hypermethylation
of the tumor necrosis factor receptor super-
family 6 (APT1, Fas, CD95/Apo-1) gene
promoter at rel/nuclear factor kappaB sites
in prostatic carcinoma. Mol Carcinog 32
(1):36–43
130. Cacan E (2016) Histone Deacetylase-1-
mediated suppression of FAS in Chemoresis-
tant ovarian Cancer cells. Anticancer Res 36
(6):2819–2826
131. Watson CJ, O’Kane H, Maxwell P, Sharaf O,
Petak I, Hyland PL (2012) Identification of a
methylation hotspot in the death receptor
Fas/CD95 in bladder cancer. Int J Oncol 40
(3):645–654
132. Cacan E, Greer SF, Garnett-Benson C (2015)
Radiation-induced modulation of immuno-
genic genes in tumor cells is regulated by
both histone deacetylases and DNA methyl-
transferases. Int J Oncol 7(6):2264–2275
 Chapter 12

DNA Methylation as a Biomarker of Aging in Epidemiologic

Studies
Unhee Lim and Min-Ae Song

Abstract
Cancer is largely an aging disease. Accelerated biological aging may be the strongest predictor of cancer and
other chronic disease risks. In the absence of reliable and quantifiable biomarkers of aging to date, it has
long been observed that tumorigenesis shares distinct epigenetic alterations with the aging process.
Recently, epigenetic age estimates have been developed based on the availability of genome-wide DNA
methylation profiles, by applying in the prediction formula the methylation level at a subset of highly
predictive methylation sites, called epigenetic clock. These DNA methylation age estimates have produced
remarkably strong correlations with chronological age, with a small deviation and high reproducibility
across different age groups and study populations. Moreover, an increasing number of epidemiologic
studies have demonstrated an independent association of DNA methylation age or the extent of accelera-
tion with mortality and various aging-related conditions, even after accounting for differences in chrono-
logical age and other risk factors. Although epigenetic profiles are known to be tissue-specific, both target
tissue- and multiple tissue-derived estimates appear to perform well to capture what is thought to be the
cumulative epigenetic drift that represents a multifactorial degenerative process across tissues and organ-
isms. Further refinement of the epigenetic age estimates is anticipated over time to accommodate a better
technological coverage of the methylome and a better understanding of the biology underlying predictive
regions. Epidemiologic principles will remain critical for the evaluation of research findings involving, for
example, different study populations, design, follow-up time, and quality of covariate data. Overall, the
epigenetic age estimates are an exciting development with useful implications for biomedical research of
healthy aging and disease prevention and control.

Key words Aging, Biomarker, DNA methylation, Epigenetic clock

1 Introduction

Cancer is largely an aging disease. Molecular profiling of aging

would provide a valuable insight into tumorigenesis, its prevention
and treatment. It has been known that tumorigenesis shares distinct
epigenetic alterations with the aging process, showing only an
accelerated rate [1, 2]. Specifically for DNA methylation at C
(5) cytosine of CpG dinucleotides, aging has been associated with
gradual genome-wide loss of methylation, leading to global

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_12,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

219
220 Unhee Lim and Min-Ae Song

hypomethylation, activation of proto-oncogenes, and chromo-

somal instability. At the same time, aging is correlated with gradual
increases in methylation around the promoter of critical genes,
leading to CpG island hypermethylation, and diminished gene
expression [3–5]. If the aging-associated epigenetic changes can
be accurately and reliably quantified, such a biomarker would serve
multiple purposes, for example, to study the etiology of various
aging diseases and drug targets in biomedical research, assess the
efficacy of antiaging interventions, and enhance forensic and arche-
ological analyses.
Recent advances in the methylome analysis and the availability
of large quantities of methylation array data of overall healthy
individuals have allowed the development of epigenetic age esti-
mates. These DNA methylation age (DNAm age) estimates have
shown remarkably high correlations with chronological age and an
independent association with all-cause mortality and disease risks in
epidemiologic studies. This review describes the key studies for the
development of two most commonly used DNAm age estimates
and examines their properties. We also include a brief summary of
the findings from epidemiologic studies involving the DNAm age
estimates and suggest future considerations.

2 DNA Methylation Age Estimates Based on Genome-Wide Methylation Profiles

Two DNAm age estimation approaches based on genome-wide

methylation arrays, specifically Illumina Infinium HumanMethyla-
tion450 (450 K) and HumanMethylation27 (27 K) BeadChip
arrays, are most commonly considered.

2.1 The Hannum Hannum, Guinney et al. performed a 450 K array analysis of whole
Estimate blood DNA from a convenience sample of 656 individuals (age
19–101 years) and detected a significant association between the
methylation level of 70,387 probes (15% of the array) and chrono-
logical age at a false discovery rate <0.05 [6]. A subset of predictive
CpGs was selected in training data including 482 individuals using a
multivariate penalized regression method (elastic net) that
regressed chronological age on the methylation measurements at
these ~70,000 CpGs and also sex and body mass index (BMI). The
final model containing 71 methylation markers produced estimates
that are highly correlated with age (r¼0.96) with a small error or
median absolute difference of 3.9 years from chronological age.
They validated the model in the remaining 174 individuals, which
confirmed a high correlation (r¼0.91) and a small error (4.9 years).
Also, the methylation level of 70 of the 71 predictor CpGs was
individually correlated with chronological age in an independent
study and in bisulfite sequencing profiles data. For the association
with phenotypes of sex and BMI, they also defined apparent
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies 221

methylomic aging rate (AMAR) as the ratio of the predicted age to

the chronological age, in order to examine the specific role of
individual deviation in DNAm age from chronological age. Using
AMAR, they observed a 4% faster rate of aging in men compared to
women, but no difference in rates by BMI levels.

2.2 The Horvath Horvath developed a multitissue predictor of methylation age

Estimate based on 82 publicly available methylation array data sets that
collectively included 7844 samples (age 0–100 years) of 51 different
tissue and cell types analyzed on either the Illumina 27 K or 450 K
platform [7]. The data were split, and the training data were
selected to include a wide array of tissue and cell types and a high
proportion of 450 K platform data (37%) and to be comparable to
test data in age distribution (43  25 years, 42  25 years). As for
the Hannum estimate, elastic net regression of chronological age
on methylation measurements was used to select predictor CpGs,
but using a limited pool of 21,368 probes that are found on both
the 27 K and 450 K platforms with few missing values. Using the
353 clock CpGs selected in the regression, Horvath further applied
a calibration function to reflect a higher aging rate during develop-
ment and a slower constant rate in adulthood. The resulting
DNAm age had a high correlation with chronological age (correla-
tion ¼ 0.96) and a small error (3.6 years) in the test data. Horvath
also suggested 110 of the 353 clock CpGs as an alternative, based
on a more stringent selection criterion in the penalized regression
model.

2.3 Comparison There are several differences between the Hannum [6] and Hor-
of the Hannum vath [7] estimates of DNAm age. The Hannum estimate is a whole
and Horvath Methods blood-based estimate, whereas the Horvath estimate was developed
as a multitissue predictor. The source of Horvath prediction was
limited to ~21,000 probes that are present on both the Illumina
27 K and 450 K platforms, whereas the Hannum estimate was
based on 450 K data: only seven probes overlap between the
predictor CpGs of the two approaches. To normalize the methyla-
tion data, the Hannum method used the Illumina default protocol
that adjusts for internal controls, whereas the Horvath method
applied the beta mixture quantile dilation (BMIQ) method [8] to
normalize the type II probes from either 27 K or 450 K platform to
match the mean DNA methylation in a reference study of
715 whole blood samples [9]. The Hannum method excludes
methylation data of sex chromosomes and adjusts for sex, as well
as BMI, in the DNAm age prediction model, whereas the Horvath
method strictly relies on methylation data and predicts sex based on
the methylation pattern of sex chromosomes. The batch effect was
adjusted only in the Hannum method.
The Horvath estimation was developed in training data that
included 12% normal adjacent tissue samples from cancer patients
222 Unhee Lim and Min-Ae Song

as available in The Cancer Genome Atlas, which may have been

affected by the epigenetic field effects. In a recent meta-analysis of
population-based cohort studies, the correlation between Hannum
and Horvath DNAm age estimates was 0.76 among the 13,089
individuals (mean age of individual studies: 57–79 years) [10]. The
Horvath estimation can be implemented easily by uploading the
27 K or 450 K methylation data of interest onto the developer’s
online calculator (https://dnamage.genetics.ucla.edu/), which
also provides DNAm age estimates based on the Hannum method
and the R script.

2.4 Validity of DNA As emphasized by Horvath, the correlation between DNAm age
Methylation Age and chronological age cannot be taken as a measure of absolute
accuracy, as true biological age is unknown and since the age
correlation would be more favorable in a study population with
some variations in age [7]. Nevertheless, independent studies
reviewed in this article generally showed high correlations
(r > 0.6) of DNAm age estimates with chronological age. For
example, a normal breast epigenome study of 100 samples showed
a high correlation between DNAm age and chronological age
(r ¼ 0.95) [11]. DNAm age estimation also appears valid in pre-
dicting extreme biological ages: the DNAm age approached zero in
embryonic stem cells and also in experimentally induced pluripo-
tent stem cells derived from adult somatic cells [7], whereas it
also showed a high correlation (r ¼ 0.89) [12] and a small error
[13] with the high chronological age among centenarians. Horvath
observed a significant correlation between cell passage number and
DNAm age. However, there was little DNAm age effects on gene
expression in the publicly available data on naive CD8 T cells and
CD8 memory cells [7].

2.5 Tissue Although age-associated epigenetic changes have been observed to

Specificity be tissue-specific [4, 14], Day et al. found common, as well as
and Composition tissue-specific, age-associated CpGs (ageCGs) [15]. In their DNA
methylation profiling of human blood, brain, kidney, and skeletal
muscle tissue samples (n ¼ 283), they observed that common
ageCGs tended to be positively correlated with age and more
stochastic, while tissue-specific ageCGs had a protective correlation
with age and were frequently found outside CpG islands in a
hypomethylated pattern. Similarly, Hannum’s whole blood-based
DNAm age model could be expanded to other tissues using the
368 control individuals’ data of The Cancer Genome Atlas
(TCGA): the DNAm age estimate showed a strong predictive
power for these individuals’ chronological age across several tissue
types (r ¼ 0.72) [6]. Horvath further demonstrated that a multi-
tissue predictor can be developed to perform reasonably well across
tissues and cell types. Whole blood samples, which is a mixture of
cell types with different life spans, showed a similar DNAm age
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies 223

distribution compared to peripheral blood mononuclear cells

(PBMC) and seven sorted cell types (coefficient of variation
(CV) ¼ 0.32 and median error ¼ 1.9 years) [7]. Different brain
tissues exhibited a similar DNAm age as well. Also, multiple tissues
of the same individual showed similar DNAm age estimates (CVs
~0.2 or less). Nonetheless, certain tissues exhibited high levels of
deviation from chronological age of ~10 years or more: breast
samples showed a higher DNAm age, and ovary and sperm samples
showed a lower DNAm age, compared to chronological age [7].
What makes it more complicated for whole blood is that the
proportion of several cell components is known to change with age
[16]. Abundance of ten blood cell components estimated from
methylation profiles shows a consistent pattern of correlations
with chronological age: specifically, naive CD8+ T cells are inversely
correlated with age, and senescent CD8+ T cells are positively
correlated with age [10]. This may confound the association
between DNAm age and age-related outcomes. As supporting
evidence, epigenetic age estimates that incorporate the information
on blood cell composition appear to reflect the biological age
better, yielding a stronger association with mortality, compared to
crude estimates of DNAm age or estimates statistically adjusted for
cell composition [10].

2.6 Trans-Species Using the Horvath algorithm for DNAm age estimation developed
Comparisons in humans, the epigenetic drift associated with lifespan appeared
conserved in mice and rhesus monkeys as well [17]. Also, DNAm
age of heart, liver, and kidney samples from chimpanzees showed a
similar age correlation as in the corresponding human tissues
[7]. DNAm age signatures have been developed in mice using blood
[18] and liver samples [19] and expanded to multitissue estimation,
with a median absolute difference in DNAm age of <4 weeks across
tissues [20].

3 Biological Functions of Epigenetic Clock CpGs

Aging can be defined as an accumulation of molecular changes in

a multifactorial degenerative process, which ultimately compro-
mises cellular and organ functions [21]. Horvath postulates that
DNAm age measures the cumulative degradation of the epigenetic
maintenance system and that it is not a marker of cellular senes-
cence since DNAm age advances even in nonproliferative or
immortal cells [7]. The Ingenuity Pathway Analysis of the genes
associated with the 353 Horvath clock CpGs suggested enrichment
of genes involved in the regulation of cell cycle, development, and
growth, as well as cancer [7]. Of the 353 clock CpGs, the methyla-
tion level of 193 sites was positively correlated with chronological
age, whereas 160 CpGs were negative correlated. The positively
224 Unhee Lim and Min-Ae Song

correlated DNAm markers were more likely to be found near

Polycomb-group target genes and with less variation across tissues,
while the negatively correlated markers were found more in CpG
shores and varied across tissues [7].
In the Hannum estimation, most of the 71 predictor markers
were associated with genes involved in tissue degradation, DNA
damage, and oxidative stress, with known functions in aging-
related conditions, including Alzheimer’s disease (e.g., SST), regu-
lation of metabolism and obesity (e.g., KLF14) and cancer [6]. The
KLF14 methylation was also recently reported to have a stronger
correlation with chronological age among centenarians than in
younger adults [13].

3.1 Heritability Aging has been observed to involve few predominant genetic
sequence determinants [22] and more likely multiple environmen-
tal exposures. Consistently, heritability of DNAm age among twins
supported the known epigenetic drift with age, declining from
100% among newborns to ~40% among older adults [6]. On the
other hand, the offspring of semisupercentenarians (age
105–109 years) had a lower DNAm age than age-matched unre-
lated controls, which may have both shared genetic and environ-
mental factors at play [12].

4 Association of DNAm Age Measures with Aging Phenotypes in Observational

Studies

4.1 Association Several cohort studies observed that individuals with DNAm age
with Mortality acceleration had a higher risk of all-cause mortality, independent of
chronological age and known risk factors [23–25]. A recent meta-
analysis expanded the investigation to 13 population-based cohort
studies, including over 13,000 participants and 2734 deaths
[10]. They analyzed both the Hannum and Horvath DNAm age
estimates.
It is notable that this meta-analysis utilized several measures of
DNAm age acceleration. Simple age acceleration was defined as the
residuals from the regression of DNAm age on age. Because
DNAm age acceleration is correlated, albeit weakly, with blood
cell counts, and out of the concern for confounding from
age-related blood cell composition changes, two additional acceler-
ation measures were adopted. Intrinsic epigenetic age acceleration
independent of changes in blood cell composition was defined as
the residual from regressing DNAm age on chronological age and
measures of blood cell counts. Specifically, blood cell counts were
estimated following the Houseman method [26], supplemented by
the Horvath method to further estimate T cell components
[27]. Extrinsic epigenetic age acceleration instead incorporated
the changes in blood cell composition and was defined as the
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies 225

weighted average of the Hannum DNAm age, where the weights

were determined by the correlation between chronological age and
the abundance of three blood cell components that are known to
change with age (naive T cells that decrease, and exhausted T cells
and plasmablasts that increase, with age).
All three DNAm age acceleration measures (simple, intrinsic,
and extrinsic) were associated with increased mortality but the
extrinsic acceleration showed the strongest association, with a sum-
mary odds ratio (OR) of 1.03 (95% confidence interval (CI):
1.02–1.04; p ¼ 3.4E-19) in the meta-analysis [10]. The association
was independent of chronological age, BMI, education, alcohol
intake, smoking pack years, history of diseases (diabetes, cancer,
hypertension), and physical activity levels. Furthermore, the associ-
ation did not differ across the three racial/ethnic groups of Whites,
Blacks and Hispanics, between men and women, by follow-up
duration after blood draw, or by BMI categories, smoking history,
and recreational physical activity status.

4.2 Association In a study of PBMC methylation and longevity, semisupercentenar-

with Exceptional ians showed a 8.6 years lower DNAm age over chronological age
Longevity (105.6  1.6 years), and their offspring also had a lower DNAm age
than the age-matched unrelated controls by 5.1 years ( p ¼ 0.0004)
[12]. In another study of long-lived individuals, DNAm age based
on both the Hannum and Horvath methods was lower than chro-
nological age, but only the Hannum age showed a significant
correlation with chronological age among centenarians (age
97.9  1.9 years) [13]. The Hannum predictor CpGs also individ-
ually showed a strong correlation with age. The study called atten-
tion to the effect of normalization methods of methylation data on
DNAm age estimates and age correlations.

4.3 Association Both the Hannum and Horvath estimates of epigenetic age were
with Cancer observed to be accelerated in tumor tissue. When tissue-specific
methylation age prediction models were developed in the TCGA
normal control data (n ¼ 319) using the Hannum method and
applied to estimate DNAm age of tumor samples, a 40% higher
DNAm age was detected in tumor tissue of the breast, kidney, and
lung compared to the matched normal tissue from the same indi-
vidual [6]. Similarly, in publicly available array data of ~6000 tumor
samples, Horvath observed a substantially accelerated DNAm age
by 36.2 years on average [7]. Some variations were noted, however,
by somatic mutation status, like BRAF mutations in colorectal
cancer samples and mutations in estrogen receptor or progesterone
receptor, but not by HER2/neu amplification, in breast cancer
samples [7]. These observations indicated that epigenetic age accel-
eration reflects biological age better in the absence of critical muta-
tions; for example, it is more relevant in luminal A tumors and less
relevant in basal-like subtypes. Horvath also hypothesized that
226 Unhee Lim and Min-Ae Song

DNAm age is accelerated by mitogens and oncogenes under intact

p53 signaling with fewer mutations.
Considering the aberrant methylation and substantially accel-
erated epigenetic age in tumor as described above, epidemiologic
studies of DNAm age as a marker for cancer risk will have to be
based on prediagnostic samples to capture the effects of aging, not
the underlying carcinogenic process [28]. To date, several prospec-
tive studies have been conducted and support the positive associa-
tion between blood DNAm age measures and subsequent cancer
risks or mortality.
In a study of 43 lung cancer cases nested in a prospective cohort
of 2029 women (age at baseline, 65.3  7.1 years), the intrinsic
acceleration measure of Horvath DNAm age was associated with an
increased risk of cancer (hazard ratio (HR) ¼ 1.50, p ¼ 2.3E-3)
[29]. In another study of 442 individuals, not only the baseline
measure of DNAm and its difference from chronological age but
also increase over a year were associated with the later risk of cancer
incidence (HR ¼ 1.06; 95% CI: 1.02–1.10) and mortality
(HR ¼ 1.17; 95% CI: 1.07–1.28) [30]. In a nested case-control
study of breast cancer in a cohort with 480 incident cases (age
52.3  8.9 years) and 480 age-matched controls, the Horvath
estimate of intrinsic DNAm age acceleration in prediagnostic
blood was associated with a 4% increased risk of breast cancer per
year (OR ¼ 1.04; 95% CI: 1.01–1.08) [31]. The association was
stronger for postmenopausal cases (OR ¼ 1.07; 95% CI:
1.02–1.11) and for diagnoses within 10 years from the blood
draw. When the analysis was stratified by the region of the predictor
CpGs, the methylation increase in CpG islands was associated with
a 20% higher risk (95% CI: 1.03–1.40) for each standard deviation.
In another prospective study, blood DNAm age estimated by
several different methods was compared in 235 breast cancer cases
and 166 colorectal cancer cases versus 424 cancer-free, age--
matched controls [32]. Only the ELOVL2 age acceleration was
associated with breast cancer risk, and Horvath DNAm age and
FHL2 age accelerations were associated with male colorectal
cancer.

4.4 Association Methylation age acceleration was detected in dorsolateral prefron-

with Other Aging- tal cortex of 700 patients with Alzheimer’s disease and was asso-
Related Conditions ciated with extensive neuropathological and cognitive function
measurements [33]. Intrinsic and extrinsic methylation age acceler-
ation was also associated with Parkinson’s disease in a study of early-
stage blood from >300 patients, where a striking difference in
methylation-based leukocyte composition was noted between
cases and controls [34]. Similarly, accelerated epigenetic age in
whole blood was strongly associated with a comprehensive measure
of frailty in older adults, specifically a 50% increase in functional
deficit was associated with 6-year acceleration in the Horvath
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies 227

DNAm age [35]. Also, the age at onset and disease survival of
C9orf72 repeats-induced amyotrophic lateral sclerosis and fronto-
temporal dementia showed a strong inverse correlation with
DNAm age acceleration [36].

4.5 DNA Methylation Calorie restriction by 20–40% has been observed to be the most
Age in Calorie potent way to extend the lifespan in mammals [37] and has been
Restriction associated with attenuation of age-related DNA methylation
[38]. Maegawa et al. reported that rhesus monkeys and mice on
30–40% calorie restriction starting in early to middle ages, com-
pared to ad libitum-fed controls, showed a substantially attenuated
methylation age in blood DNA by 7 years and 2 years, respectively,
with a similar pattern observed in other tissues [17]. Replication in
human interventions may be of interest, which would assess the
value of DNAm age in intervention studies for healthy aging.

4.6 Comparison Telomere attrition is the best established biomarker of aging

with Telomere Length [21]. The tandem repeats of a hexameric sequence, TTAGGG, at
the end of eukaryotic chromosomes, are irreversibly shortened with
aging, by about 50–120 base pairs per cell division in humans
[39]. Shorter leukocyte telomeres have been associated with a
higher risk of cardiovascular disease in epidemiologic studies [40]
and with an overall decreased life expectancy, likely due to dimin-
ished structural protection. However, the use of telomere length in
studies of aging-related morbidity and mortality is challenged by
the lack of standardized assay methodology and large intercellular
and interlaboratory variability [39, 41]. Furthermore, the associa-
tion of telomere length with the risk of cancer appears compli-
cated and bidirectional. As evidenced in a recent meta-analysis of
prospective studies, leukocyte telomere length may have a disad-
vantageous positive, not inverse, association with lung cancer, over-
all cancer risk in men, and cancers based on prediagnostic telomere
assessment at older ages [42]. Therefore, DNAm age, which has
shown a consistent association throughout the range of aging and
disease type and process, appears to have an advantage as a bio-
marker [1, 7].
A few studies have compared the relationship between DNAm
age and telomere length. In a cross-sectional analysis of 1820 older
adults (age for two subsets, 62.1  6.5 years and 63.0  6.7 years),
the correlation between the Horvath DNAm age and telomere
length, assessed by a quantitative PCR (qPCR) method, was not
significant, regardless of adjustment for age, sex, leukocyte cell
composition, smoking, alcohol intake, and history of cancer
[35]. In the same study, only DNAm age acceleration, not telomere
length, was associated with a higher frailty index score from self-
rating of 34 health status or functionality conditions. In another
study of a long-term exposure to air pollution and biological aging
(age 61  8.9 years), there was only a moderate correlation
228 Unhee Lim and Min-Ae Song

between the Horvath DNAm age and qPCR-based telomere length

age (r ¼ 0.27), and the telomere length age showed a stronger
association with black carbon absorption levels [43]. Based on
these limited data, DNAm age appears to be weakly correlated
with telomere length in leukocytes of generally healthy humans
and may perform equally or better as an indicator of
age-associated functional decline.

5 Conclusions

DNA methylation age is emerging as a promising and well-

replicated marker of biological age. Further refinement of the
estimation is anticipated. The limited overlap in predictor CpGs
from the 27 K vs. 450 K platform [7] and even among differ-
ent 450 K-based estimators [11] suggests that a continuous
enhancement of the clock probes may be needed. For example,
the current EPIC array of over 850,000 CpGs has a significantly
improved genomic coverage of distal regulatory regions compared
to the 450 K array [44]. Methylation array data processing would
need to be standardized across studies, including the handling of
two-type probes in recent platforms, treatment of the genetic
sequence variation that coincides with methylation sites, and
adjustment for age-associated cell type composition. A better
understanding of the biology underlying the predictive CpGs may
allow a more efficient and less costly assessment of epigenetic age
based on a few CpGs, which would facilitate large epidemiologic
studies of various health outcomes [45]. Study population hetero-
geneity should be considered and carefully examined as there are
significant differences in the epigenetic age levels and acceleration
rates by sex and race/ethnicity [11, 46]. Overall, the epigenetic age
estimates are an exciting development with useful implications for
biomedical research of healthy aging and disease prevention and
control.

References
1. Fraga MF, Agrelo R, Esteller M (2007) Cross-
talk between aging and cancer: the epigenetic
language. Ann N Y Acad Sci 1100:60–74
2. Aunan JR, Cho WC, Soreide K (2017) The
biology of aging and cancer: A brief overview
of shared and divergent molecular hallmarks.
Aging Dis 8(5):628–642
3. Aune D, Chan DS, Vieira AR, Navarro Rosen-
blatt DA, Vieira R, Greenwood DC,
Kampman E, Norat T (2013) Red and pro-
cessed meat intake and risk of colorectal ade-
nomas: a systematic review and meta-analysis of
epidemiological studies. Cancer Causes Con-
trol 24(4):611–627
4. Christensen BC, Houseman EA, Marsit CJ,
Zheng S, Wrensch MR, Wiemels JL, Nelson
HH, Karagas MR, Padbury JF, Bueno R,
Sugarbaker DJ, Yeh RF, Wiencke JK, Kelsey
KT (2009) Aging and environmental expo-
sures alter tissue-specific DNA methylation
dependent upon CpG island context. PLoS
Genet 5(8):e1000602
5. Bell JT, Tsai PC, Yang TP, Pidsley R, Nisbet J,
Glass D, Mangino M, Zhai G, Zhang F,
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies
Valdes A, Shin SY, Dempster EL, Murray RM,
Grundberg E, Hedman AK, Nica A, Small KS,
Mu TC, Dermitzakis ET, McCarthy MI, Mill J,
Spector TD, Deloukas P (2012) Epigenome-
wide scans identify differentially methylated
regions for age and age-related phenotypes in
a healthy ageing population. PLoS Genet 8(4):
e1002629
6. Hannum G, Guinney J, Zhao L, Zhang L,
Hughes G, Sadda S, Klotzle B, Bibikova M,
Fan JB, Gao Y, Deconde R, Chen M,
Rajapakse I, Friend S, Ideker T, Zhang K
(2013) Genome-wide methylation profiles
reveal quantitative views of human aging
rates. Mol Cell 49(2):359–367
7. Horvath S (2013) DNA methylation age of
human tissues and cell types. Genome Biol 14
(10):R115
8. Teschendorff AE, Marabita F, Lechner M,
Bartlett T, Tegner J, Gomez-Cabrero D, Beck
S (2013) A beta-mixture quantile normaliza-
tion method for correcting probe design bias in
Illumina Infinium 450 k DNA methylation
data. Bioinformatics 29(2):189–196
9. Horvath S, Zhang Y, Langfelder P, Kahn RS,
Boks MP, van Eijk K, van den Berg LH, Ophoff
RA (2012) Aging effects on DNA methylation
modules in human brain and blood tissue.
Genome Biol 13(10):R97
10. Chen BH, Marioni RE, Colicino E, Peters MJ,
Ward-Caviness CK, Tsai PC, Roetker NS, Just
AC, Demerath EW, Guan W, Bressler J,
Fornage M, Studenski S, Vandiver AR, Moore
AZ, Tanaka T, Kiel DP, Liang L, Vokonas P,
Schwartz J, Lunetta KL, Murabito JM,
Bandinelli S, Hernandez DG, Melzer D,
Nalls M, Pilling LC, Price TR, Singleton AB,
Gieger C, Holle R, Kretschmer A,
Kronenberg F, Kunze S, Linseisen J,
Meisinger C, Rathmann W, Waldenberger M,
Visscher PM, Shah S, Wray NR, McRae AF,
Franco OH, Hofman A, Uitterlinden AG,
Absher D, Assimes T, Levine ME, Lu AT,
Tsao PS, Hou L, Manson JE, Carty CL,
LaCroix AZ, Reiner AP, Spector TD, Feinberg
AP, Levy D, Baccarelli A, van Meurs J, Bell JT,
Peters A, Deary IJ, Pankow JS, Ferrucci L,
Horvath S (2016) DNA methylation-based
measures of biological age: meta-analysis pre-
dicting time to death. Aging (Albany NY) 8
(9):1844–1865
11. Johnson KC, Houseman EA, King JE, Chris-
tensen BC (2017) Normal breast tissue DNA
methylation differences at regulatory elements
are associated with the cancer risk factor age.
Breast Cancer Res 19(1):81
12. Horvath S, Pirazzini C, Bacalini MG,
Gentilini D, Di Blasio AM, Delledonne M,
229
Mari D, Arosio B, Monti D, Passarino G, De
Rango F, D’Aquila P, Giuliani C, Marasco E,
Collino S, Descombes P, Garagnani P, Fran-
ceschi C (2015) Decreased epigenetic age of
PBMCs from Italian semi-supercentenarians
and their offspring. Aging (Albany NY) 7
(12):1159–1170
13. Armstrong NJ, Mather KA, Thalamuthu A,
Wright MJ, Trollor JN, Ames D, Brodaty H,
Schofield PR, Sachdev PS, Kwok JB (2017)
Aging, exceptional longevity and comparisons
of the Hannum and Horvath epigenetic clocks.
Epigenomics 9(5):689–700
14. Thompson RF, Atzmon G, Gheorghe C, Liang
HQ, Lowes C, Greally JM, Barzilai N (2010)
Tissue-specific dysregulation of DNA methyla-
tion in aging. Aging Cell 9(4):506–518
15. Day K, Waite LL, Thalacker-Mercer A, West A,
Bamman MM, Brooks JD, Myers RM, Absher
D (2013) Differential DNA methylation with
age displays both common and dynamic fea-
tures across human tissues that are influenced
by CpG landscape. Genome Biol 14(9):R102
16. Fagnoni FF, Vescovini R, Passeri G,
Bologna G, Pedrazzoni M, Lavagetto G,
Casti A, Franceschi C, Passeri M, Sansoni P
(2000) Shortage of circulating naive CD8(+)
T cells provides new insights on immunodefi-
ciency in aging. Blood 95(9):2860–2868
17. Maegawa S, Lu Y, Tahara T, Lee JT, Madzo J,
Liang S, Jelinek J, Colman RJ, Issa JJ (2017)
Caloric restriction delays age-related methyla-
tion drift. Nat Commun 8(1):539
18. Petkovich DA, Podolskiy DI, Lobanov AV, Lee
SG, Miller RA, Gladyshev VN (2017) Using
DNA methylation profiling to evaluate
biological age and longevity interventions.
Cell Metab 25(4):954–960.e6
19. Wang T, Tsui B, Kreisberg JF, Robertson NA,
Gross AM, Yu MK, Carter H, Brown-Borg
HM, Adams PD, Ideker T (2017) Epigenetic
aging signatures in mice livers are slowed by
dwarfism, calorie restriction and rapamycin
treatment. Genome Biol 18(1):57
20. Stubbs TM, Bonder MJ, Stark AK, Krueger F,
Team BIAC, von Meyenn F, Stegle O, Reik W
(2017) Multi-tissue DNA methylation age pre-
dictor in mouse. Genome Biol 18(1):68
21. Wagner KH, Cameron-Smith D, Wessner B,
Franzke B (2016) Biomarkers of aging: from
function to molecular biology. Nutrients 8(6):
E338
22. Fortney K, Dobriban E, Garagnani P,
Pirazzini C, Monti D, Mari D, Atzmon G,
Barzilai N, Franceschi C, Owen AB, Kim SK
(2015) Genome-wide scan informed by
age-related disease identifies loci for
230 Unhee Lim and Min-Ae Song
exceptional human longevity. PLoS Genet 11
(12):e1005728
23. Marioni RE, Shah S, McRae AF, Chen BH,
Colicino E, Harris SE, Gibson J, Henders AK,
Redmond P, Cox SR, Pattie A, Corley J,
Murphy L, Martin NG, Montgomery GW,
Feinberg AP, Fallin MD, Multhaup ML, Jaffe
AE, Joehanes R, Schwartz J, Just AC, Lunetta
KL, Murabito JM, Starr JM, Horvath S, Bac-
carelli AA, Levy D, Visscher PM, Wray NR,
Deary IJ (2015) DNA methylation age of
blood predicts all-cause mortality in later life.
Genome Biol 16:25
24. Christiansen L, Lenart A, Tan Q, Vaupel JW,
Aviv A, McGue M, Christensen K (2016) DNA
methylation age is associated with mortality in
a longitudinal Danish twin study. Aging Cell 15
(1):149–154
25. Perna L, Zhang Y, Mons U, Holleczek B, Saum
KU, Brenner H (2016) Epigenetic age acceler-
ation predicts cancer, cardiovascular, and
all-cause mortality in a German case cohort.
Clin Epigenetics 8:64
26. Houseman EA, Accomando WP, Koestler DC,
Christensen BC, Marsit CJ, Nelson HH,
Wiencke JK, Kelsey KT (2012) DNA methyla-
tion arrays as surrogate measures of cell mix-
ture distribution. BMC Bioinformatics 13:86
27. Horvath S, Levine AJ (2015) HIV-1 infection
accelerates age according to the epigenetic
clock. J Infect Dis 212(10):1563–1573
28. Johnson TE (2006) Recent results: biomarkers
of aging. Exp Gerontol 41(12):1243–1246
29. Levine ME, Hosgood HD, Chen B, Absher D,
Assimes T, Horvath S (2015) DNA methyla-
tion age of blood predicts future onset of lung
cancer in the women’s health initiative. Aging
(Albany NY) 7(9):690–700
30. Zheng Y, Joyce BT, Colicino E, Liu L,
Zhang W, Dai Q, Shrubsole MJ, Kibbe WA,
Gao T, Zhang Z, Jafari N, Vokonas P,
Schwartz J, Baccarelli AA, Hou L (2016)
Blood epigenetic age may predict Cancer inci-
dence and mortality. EBioMedicine 5:68–73
31. Ambatipudi S, Horvath S, Perrier F, Cuenin C,
Hernandez-Vargas H, Le Calvez-Kelm F,
Durand G, Byrnes G, Ferrari P, Bouaoun L,
Sklias A, Chajes V, Overvad K, Severi G,
Baglietto L, Clavel-Chapelon F, Kaaks R,
Barrdahl M, Boeing H, Trichopoulou A,
Lagiou P, Naska A, Masala G, Agnoli C,
Polidoro S, Tumino R, Panico S, Dolle M,
Peeters PHM, Onland-Moret NC, Sandanger
TM, Nost TH, Weiderpass E, Quiros JR,
Agudo A, Rodriguez-Barranco M, Huerta Cas-
tano JM, Barricarte A, Fernandez AM, Travis
RC, Vineis P, Muller DC, Riboli E, Gunter M,
Romieu I, Herceg Z (2017) DNA methylome
analysis identifies accelerated epigenetic ageing
associated with postmenopausal breast cancer
susceptibility. Eur J Cancer 75:299–307
32. Durso DF, Bacalini MG, Sala C, Pirazzini C,
Marasco E, Bonafe M, do Valle IF, Gentilini D,
Castellani G, Faria AMC, Franceschi C,
Garagnani P, Nardini C (2017) Acceleration
of leukocytes’ epigenetic age as an early tumor
and sex-specific marker of breast and colorectal
cancer. Oncotarget 8(14):23237–23245
33. Levine ME, Lu AT, Bennett DA, Horvath S
(2015) Epigenetic age of the pre-frontal cortex
is associated with neuritic plaques, amyloid
load, and Alzheimer’s disease related cognitive
functioning. Aging (Albany NY) 7
(12):1198–1211
34. Horvath S, Ritz BR (2015) Increased epige-
netic age and granulocyte counts in the blood
of Parkinson’s disease patients. Aging (Albany
NY) 7(12):1130–1142
35. Breitling LP, Saum KU, Perna L, Schottker B,
Holleczek B, Brenner H (2016) Frailty is asso-
ciated with the epigenetic clock but not with
telomere length in a German cohort. Clin Epi-
genetics 8:21
36. Zhang M, Tartaglia MC, Moreno D, Sato C,
McKeever P, Weichert A, Keith J, Robertson J,
Zinman L, Rogaeva E (2017) DNA methyla-
tion age-acceleration is associated with disease
duration and age at onset in C9orf72 patients.
Acta Neuropathol 134(2):271–279
37. Anton S, Leeuwenburgh C (2013) Fasting or
caloric restriction for healthy aging. Exp Ger-
ontol 48(10):1003–1005
38. Li Y, Daniel M, Tollefsbol TO (2011) Epige-
netic regulation of caloric restriction in aging.
BMC Med 9:98
39. Ishikawa N, Nakamura K, Izumiyama-
Shimomura N, Aida J, Matsuda Y, Arai T,
Takubo K (2016) Changes of telomere status
with aging: an update. Geriatr Gerontol Int 16
(Suppl 1):30–42
40. Haycock PC, Heydon EE, Kaptoge S, Butter-
worth AS, Thompson A, Willeit P (2014) Leu-
cocyte telomere length and risk of
cardiovascular disease: systematic review and
meta-analysis. BMJ 349:g4227
41. Martin-Ruiz CM, Baird D, Roger L,
Boukamp P, Krunic D, Cawthon R, Dokter
MM, van der Harst P, Bekaert S, de Meyer T,
Roos G, Svenson U, Codd V, Samani NJ,
McGlynn L, Shiels PG, Pooley KA, Dunning
AM, Cooper R, Wong A, Kingston A, von
Zglinicki T (2015) Reproducibility of telomere
length assessment: an international collabora-
tive study. Int J Epidemiol 44(5):1673–1683
 DNA Methylation as a Biomarker of Aging in Epidemiologic Studies 231

42. Zhang X, Zhao Q, Zhu W, Liu T, Xie SH,
Zhong LX, Cai YY, Li XN, Liang M, Chen W,
Hu QS, Zhang B (2017) The Association of
Telomere Length in peripheral blood cells with
Cancer risk: a systematic review and meta-
analysis of prospective studies. Cancer Epide-
miol Biomark Prev 26(9):1381–1390
43. Ward-Caviness CK, Nwanaji-Enwerem JC,
Wolf K, Wahl S, Colicino E, Trevisi L,
Kloog I, Just AC, Vokonas P, Cyrys J,
Gieger C, Schwartz J, Baccarelli AA,
Schneider A, Peters A (2016) Long-term expo-
sure to air pollution is associated with
biological aging. Oncotarget 7 Kobor MS, Tsao PS, Reiner AP, Edlefsen KL,
(46):74510–74525
44. Pidsley R, Zotenko E, Peters TJ, Lawrence
MG, Risbridger GP, Molloy P, Van Djik S,
Muhlhausler B, Stirzaker C, Clark SJ (2016)
Critical evaluation of the Illumina Methylatio-
nEPIC BeadChip microarray for whole-
genome DNA methylation profiling. Genome
Biol 17(1):208
45. Vidal-Bralo L, Lopez-Golan Y, Gonzalez A
(2016) Simplified assay for epigenetic age esti-
mation in whole blood of adults. Front Genet
7:126
46. Horvath S, Gurven M, Levine ME, Trumble
BC, Kaplan H, Allayee H, Ritz BR, Chen B, Lu
AT, Rickabaugh TM, Jamieson BD, Sun D,
Li S, Chen W, Quintana-Murci L, Fagny M,
Absher D, Assimes TL (2016) An epigenetic
clock analysis of race/ethnicity, sex, and coro-
nary heart disease. Genome Biol 17(1):171
 Chapter 13

Challenges and Opportunities in Social Epigenomics

and Cancer
Krishna Banaudha, Vineet Kumar, and Mukesh Verma

Abstract
Social epigenomics is an area of science that evaluates why and how different social factors and processes
affect different components of the epigenome. As it happens with most of the new areas in science, social
epigenetics being a relatively new area, only limited progress has been made. However, the potential of
implicating social epigenomics in improving health and health related policies is tremendous. Epidemio-
logic studies evaluating social, behavior, family, and environmental factors have helped understand social
inequality and develop the area of social epigenomics. Most of the information in social epidemiology has
been gathered from genetic studies. Now the time has come that we may apply similar approaches in social
epigenomics because technologies of determining methylation, histone, and noncoding RNA profiling are
well developed. The focus of this chapter is to understand the role of epigenetic regulation in social
experiences at various stages in life due to altered function of genes and affecting health in populations
with different races/ethnicity. Here we discuss the current challenges and opportunities in the field.

Key words Chromatin, Epigenetics, Health disparity, Methylation, Social epigenomics

Abbreviations

DNMT DNA methyl transferase

ER Estrogen receptor
HAT Histone acetyl transferase
HDAC Histone deacetylase
PR Progesterone receptor

1 Introduction: What Is Social Epigenomics and How Is It Related with Diseases

Social epigenomics and epidemiology seeks to understand the ways

in which social, political, cultural, and economic circumstances can
improve health by reducing disease burden in all populations. To
investigate how much work has been done in the social

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_13,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

233
234 Krishna Banaudha et al.

Table 1
Represent the number of publications in Social Epigenomics and cancer

Terms used Number of publications

Cancer 3,482,634
Epigenetics 20,306
Epigenomics 5320
Social epigenomics 159
Social epigenetics 558
Social epigenomics and cancer 24
Social epigenetics and cancer 68
Social epigenomics and breast cancer 3
Social epigenetics and breast cancer 10
Criteria: The PubMed database was searched up to May 2017

epigenomics field, we conducted a literature search in PubMed

using specific terms and noted the number of publications appeared
up to 25th May, 2017 (see Table 1). When the term “social epige-
nomics” was used, 159 publications appeared whereas “social epi-
genetics” showed 558 publications. Since “epigenetics” term has
been used in more publications compared to “epigenomics,” the
number of publication is much higher when “social epigenetics”
term was used. In comparison to social epigenomics (558 publica-
tions) in all diseases, only 68 publications were found in cancer field
which indicated that this area of science needed further research.
Social factors can be categorized into social, stress, isolation,
attachment, and lifestyle. The effect of social factors can be con-
ducted either on individual genes, clusters of many genes, epigen-
ome and profiling of epigenomic components. Social factors affect
different systems in the body. For example, in healthy individuals,
the immune system is biased toward antiviral activities, whereas in
social stress a shift occurs toward proinflammatory immune activa-
tion. Epigenetic regulation of the proinflammatory process has
been well characterized [1, 2]. It is suggested that monitoring
changes in the epigenetic signature of immune cells could represent
a promising diagnostic tool to detect individuals with diseases such
as cancer [1]. In addition, social factors affect the central nervous
system via changes in the hormonal and neurotransmitter signals
via catecholamines (dopamine and norepinephrine).
Here we describe an example where fine mapping of genetic
loci was conducted for body mass index (BMI) in multiple popula-
tions. From the existing knowledge of 36 BMI loci in White
Challenges and Opportunities in Social Epigenomics and Cancer 235

populations, screening of thousands of DNA samples from African

American, Hispanic/Latino, Asian, and American Indian/Alaskan
native was done by linear regression analysis on MetaboChip (Illu-
mina). Further Bayesian trans-ethnic meta-analysis identified
29 densely genotyped BMI loci across populations [3]. These
results indicated the generalizability of information from one ethnic
population to others. Such studies have not been conducted for
epigenetic marks on the genome.
Oxidative stress, substance abuse, lethargic lifestyle, inflamma-
tion, etc. are factors contributing to health disparity. During stress,
epigenetic components alter and contribute to epigenetic aging
(defined as changes in the epigenome with age in comparison to
chronological age) which in the long run may contribute to disease
development. Technically, such studies can be conducted which
may add to the existing knowledge in the social epigenomics field.
Phytochemicals have shown promise in reducing oxidative
stress by interacting with epigenetic components, especially DNA
and histone methylation, histone acetylation and miRNA expres-
sion [4]. Epigenetic-drift due to age reflects loss of epigenetic
maintenance marks and reduced cellular and molecular functions
due to age. Some of these changes can be reversed by different
natural foods and food bioactive compounds [5].
Diagnosis of cancer has psychosocial consequences affecting
quality of life and decline in health. Only few studies have been
conducted to identify factors affecting negative psychosocial con-
sequences post cancer diagnosis. In one study on Whites, African
American (AA) and Latinos indicated unmet social support as a
factor due to which AA and Latinos suffered more psychosocial
consequences than Whites after participating patients were diag-
nosed with breast cancer [6]. So far, epigenetic profiling in such
studies has not been initiated which may identify additional factors
contributing to psychosocial consequences. In this study, in-person
interview was conducted with breast cancer patients within
4 months of diagnosis. Psychological consequences between
race/ethnicity were determined by path analyses.
Social inequalities have been reported even in a country like
Israel with an advanced health system and universal health care
insurance. Among Arabs and Jews living in Israel, the prevalence
of obesity, low physical activity, and heart disease, stroke, and
diabetes is more in Arabs compared to Jews who have a high
incidence of different cancers [7]. In Brazil, populations with
lower schooling levels and lack of private health insurance had
higher prevalence of diabetes, hypertension, stroke, and
arthritis [8].
236 Krishna Banaudha et al.

2 Epigenomic Approaches in Social Epigenomic

Epigenetics regulates gene expression without altering the genome.

Since gene–environment interaction can be studied at epigenetic
level, it makes sense to utilize epigenetic approaches in understand-
ing the social factors in contributing to the disease outcome. Given
below is a brief description of main epigenetic components and
their roles in gene expression.

2.1 Epigenetic DNA methylation is the most studied component of epigenetics

Components regulatory machinery. Methylation involves the addition of a
methyl group to DNA at 50 position of a cytosine molecule, thereby
2.1.1 Methylation
modifying the function of a gene. Sometimes 5-methyl cytosine
(5mC) is referred to as the fifth base of DNA. Methyl groups on the
DNA project into the DNA major groove and inhibit transcription
of a gene. Mostly in the promoter regions of a gene, 5mC occurs in
the context of paired symmetrical methylation of a CpG site (some-
times referred to as a CpG island) in which a cytosine is located next
to a guanosine. DNA methyltransferase (DNMT) enzyme transfers
a methyl group to a cytosine nucleotide. Different DNMTs work
together as the de novo DNMTs and establish the methyl group
pattern on a sequence of DNA or as maintenance of DNMTs that
copy the methylation pattern on an existing strand of DNA to its
new partner following DNA replication. DNA methylation is
needed for the normal development. It also helps in suppressing
retrotransposon expression, thus maintaining genomic stability.
Hypermethylation occurs in genes involved in tumor cell invasion,
cell cycle control, DNA repair, and other processes which lead to
the development and progression of cancer. Transposon (SINE and
Alu) sequences are already methylated during normal development,
and during disease development, these regions get hypomethylated
by the activity of the enzyme DNA demethylase.

2.1.2 Histone Information in chromatin includes covalent modifications of his-

Modifications (Histone tones (H1, H2A, H2B, H3, and H4). Most of the cancer-
Codes) associated marks are located on H3. After cancer associated mod-
ifications of histones were studied, the effects of genetic mutations
in histone genes and their contribution in cancer development was
also investigated. In one such example, mutation of chromatin
histone H3 was observed in chondrocytes which contributed to
the pediatric cancer development [9]. Here, mutation of lysine to
methionine at 36 position of H3 protein resulted in inhibition of
normal methylation of this chromatin H3 protein. The process
occurred by interference of enzyme activity which methylates H3.
As a result, cancer-related genes are over-expressed and contributed
cancer-related characteristics to chondrocyte cells. This example
shows the integration of genetic and epigenetic information.
 Challenges and Opportunities in Social Epigenomics and Cancer 237

The most common histone modification is the acetylation of

histone by the enzyme histone acetyl transferase (HAT). Another
enzyme, histone deacetylase (HDAC) has the opposite properties
to HAT because it removes the acetyl group from histone whenever
cells need to do so.
The balance of HAT and HDAC activity is an epigenetic layer
with critical role in gene expression and disease development. The
levels of histone acetylation contribute to chromatin remodeling
and genomic stability. Acetylated histone tails make chromatin
relaxed and active for transcription whereas deacetylation has an
opposite effect. HDACs are considered excellent targets for cancer
treatment. Already the efficacy of a number of HDAC inhibitors has
been demonstrated in different systems and one of the HDAC
inhibitors, SAHA, has already been reached the bedside of cancer
patients after the Food and Drug Administration approved this
drug for the treatment of cutaneous T-cell lymphoma [10].

2.1.3 Chromatin Nucleosome positioning and chromatin accessibility can be deter-

Accessibility (DNase I mined by combining two technologies: next-generation sequenc-
Mapping) ing and enzymatic chromatin digestion with DNase I and MNase
(mung bean nuclease). This analysis provides high resolution infor-
mation about the heterochromatin and euchromatin states as well
as opportunities for transcription factors to initiate transcription.

2.1.4 miRNA MicroRNAs are integral part of different biological processes

including proliferation, differentiation, angiogenesis, and immune
response. Two major categories of miRNAs have been character-
ized. First category of miRNAs acts on cytoplasmic mRNAs (such
as miRNA-451, miRNA-31, and miRNA-150) and the second one
acts on nuclear gene transcription directly (one example is
miR-211) [11, 12]. All miRNAs are highly conserved and regulate
gene expression through an interference pathway. During RNA
interference (called RNAi), miRNAs bind to the complementary
mRNA and degrade the double stranded RNA. The most common
site for the binding of miRNA is 30 UTR. miRNA biogenesis takes
place in the nucleus and cytoplasm. The precursor of a miRNA is
several kilobases, whereas the processed miRNA is 19–22 nucleo-
tide long. A number of reports have indicated that inhibition of
miRNA can change the pattern of tumorigenesis or cancer progres-
sion, and therefore, its implication in cancer prevention is very high
[13–15]. Since the activity of miRNAs is based on sequence speci-
ficity, targeted intervention and therapy can be planned.

2.2 Methodologies The risk of cancer and several chronic diseases is determined by
environmental conditions before pregnancy and after about 2 years
following conception (preconception, periconception, and post-
conception followed by infant and baby on a life-stage scale).
Mental health issues and neurological and cognitive issues are also
238 Krishna Banaudha et al.

established during this period. Epigenetic codes are altered during

this time due to environmental changes (external community is the
environment for the mother while pregnant woman is the environ-
ment for the fetus). The community environment affecting health
includes availability of nutritional food and the level of social stress
experienced prior to or during pregnancy. When the developing
fetus gets a signal of limited nutrients, it begins to program the
epigenome accordingly, which requires making tradeoffs by select-
ing which organ gets the energy for optimum growth and develop-
ment. Damage done early in life thus carried forth throughout the
life span. Thus, the developmental origin of a disease helps us
understand how life history, sociology, and biology combine to
have a healthy life and social success at the earliest stages.

3 Significance of Epidemiological Cohorts in Understanding Social Epigenomics

Based on self-reported data and observation studies, effects of

social stresses have been studied in different populations. To under-
stand the underlying mechanism and developing intervention
approaches, epigemome-wide association studies can be planned
in prospective cohorts. For pilot studies, already collected samples
and associated information can be analyzed and then larger studies
can be planned in samples collected in the future. In this regard, the
Epidemiology and Genomics Research Program (EGRP) of the
National Cancer Institute (NCI) supports many cohorts which
can be utilized for such studies (https://epi.grants.cancer.gov/
cohorts.html).
As we discussed in this chapter, adverse social conditions during
early life are associated with increased risk of cancer later in life, in
one study, the hypothesis of priming socially disadvantaged
newborns for later risk of cancer was tested, and results indicated
differential methylation patterns of an imprinting gene among
children of mothers who did or did not have social resources [16].

4 Potential Contribution of Social Epigenomics in Making Health-Related Policies

Although health disparity exists in different cancer types, the most

studied cancers are breast cancer among women and prostate can-
cer among men. In this chapter, we will discuss more about breast
cancer social epigenomics as an example. According to American
Cancer Society, this cancer accounts for the second highest number
of deaths in the USA [17]. Pathological exams are the standard
diagnostic tools for breast cancer. Recently, molecular subtypes of
breast cancer have been identified, mostly based on the genomic
and epigenomic alterations and the presence or absence of different
receptors (estrogen receptor or ER, progesterone receptor or PR,
 Challenges and Opportunities in Social Epigenomics and Cancer 239

Risk Factors Mechanism Pathways

Histone Modificaon ACT/mToR

Geo-special and &
Social Inequality Chroman Accessibility
Income
Diet Mitochondrial Acvaon Implicaons
Populaon
Specific informaon Acetyl CoA
Treatment of TNBC By
H3K9Aco Heterochromatin Epigenetic Inhibitors
Obesity BMI (inactivation)
Diabetes Glycogens/Insulin RB
resistance P53
Apoptosis
Methylation Profiling PI3K
Cancer Environment miRNA Profiling SMAD
Genec Histone Modifications RTK
Behavior APC Inflammation
Methylation Profiling Angiogenesis
CVD Diet miRNA Profiling Signaling Pathways
Lifestyle Histone Modifications

Fig. 1 Social epigenetics risk factors, underlying mechanisms, and pathways in cancer and other diseases. In
cancer, the main risk factors are environment, genetic background, and behavior. The most studied
mechanisms involve profiling of methylation, histones, and miRNAs. The main pathways are also shown
with one example where triple negative breast cancer women were followed for their geographical location,
availability of food, and occurrence of diabetes and obesity. Mitochondrial activation was observed in these
participants with increased levels of acetyl CoA. It is known that histones get acetylated and affect gene
expression. Since the ACT/mTOR pathway gets activated in triple negative breast cancer patients, activation of
this pathway was also followed. For cardiovascular diseases, main pathways are inflammation, angiogenesis,
and different signaling pathways and all involve alterations in methylation, histone, and miRNA profiling

and tyrosine protein kinase erb-B2 or HER2/neu receptor). Dif-

ferent developmental stages of breast cancer are from normal epi-
thelium to atypical ductal hyperplasia (ADH), ductal carcinoma in
situ (DCIS), invasive ductal carcinoma (IDC), and metastatic breast
cancer. HER2 amplification/overexpression has been observed in
benign breast lesion and represents a high-risk population
[18]. The incidence of breast cancer is higher among BRCA1
positive and triple negative individuals (without expression of ER,
PR, and HER2/neu) in African Americans compared to Caucasian
women [19]. Triple negative breast (TNB) cancer cells represent
aggressive breast cancer and these cells generally do not respond to
traditional chemotherapy for breast cancer, especially in African
American women (Fig. 1).
It is expected that characterization of epigenetic components in
this group of breast cancer may provide new approaches for cancer
intervention and treatment resulting in improved survival. In one
epidemiologic study, genome-wide methylation profiling of breast
cancer samples was conducted and a correlation of higher promoter
methylation with hormone receptor positive status was observed.
Epigenetically regulated genes were used as a training dataset and
for prediction of breast cancer risk in different racial and ethnic
240 Krishna Banaudha et al.

groups. Results indicated the generalizability of selected genes

which could identify high-risk populations in prospective
studies [20].
Another group conducted genome-wide methylation studies in
healthy women so that reference profiling database can be created
and organized to compare with the disease-associated profiling, and
thus finally identifying racial differences associated with breast can-
cer [21]. Further investigation using pathway analysis of samples
from 61 European Americans (EA) and 22 African Americans
(AA) indicated that differentially methylated regions were asso-
ciated with cell death and survival, cellular development, and cell-
to-cell signaling. More intergenic hypermethylated CpG islands
were found in AAs, when compared to age-matched EAs.
We expect that the information in social epigenetics and epide-
miology might be useful in the future, first, to produce knowledge
influencing social circumstances on health, especially social inequal-
ity in health, then, to leverage what we learn to improve health and
reduce health inequality locally, nationally, and internationally in
different population groups, and finally, to translate our knowledge
and experience to policy makers, advocacy groups, social media,
and the public, reinforcing the message that epigenetic social deter-
minants and patterns of health are crucial drivers to improve popu-
lation health.
The policies of the government and the private sector, particu-
larly at the community level, can create a supporting environment
that allows for targeted behavior interventions in healthy
directions.

5 Challenges and Research Opportunities

Most of the work in social epigenomics has been conducted using

methylation markers, but histone profiling in different molecular
subtypes has not been conducted which could be utilized to under-
stand etiologic factors contributing to disease development. Simi-
larly, miRNA profiling and chromatin accessibility patterns in
different racial groups should be characterized to identify new
molecular markers which could be used to identify and reduce
health disparity. Currently, we do not know whether additional
molecular subtypes of different cancers exist which could be used
for diagnosis and prognosis of different cancer types in different
populations.
Different databases on racial and socioeconomic disparities are
maintained by National Surgical Quality Improvement Program,
Nationwide Inpatient Sample Database, and the Surveillance, Epi-
demiology, and End Results. However, challenges in the generaliz-
ability of these databases to racial and socioeconomic disparities
 Challenges and Opportunities in Social Epigenomics and Cancer 241

have been reported, suggesting a need for creating a universal

database [22].
Epigenetics helps us explain biological changes that increase
our susceptibility to diseases, including cancer, and even the next
generation’s social success over their life course. It allows us to
rethink that biological and social disadvantages are made worse by
adverse environment throughout the life. This also suggests that we
should continue improving our environment to improve health and
maintain social equality.
A number of research areas that need further research include
(1) identifying population-level epigenomic profiling in various
health disparities populations in relation to various social contexts;
(2) studying epigenomic alterations using exosomes isolated from
health disparity populations; (3) effects of epigenomic variations
affected due to exposure to social contextual factors and early-life
adverse experiences and mechanisms that contributes to social
inequalities in disease risk; (4) evaluating transgenerational effects
and inheritance of epigenetic alterations in response to social stres-
sors (also understanding the underlying mechanisms and pathways
and ways to improve health); (5) validating findings of social epi-
genomics from one population in relation to that from other popu-
lations to achieve generalizability, and (6) identifying mechanisms
by which psychosocial support interventions with improved health
outcomes affect different components of the epigenome (especially
miRNA and histones) in epidemiologic studies.
In addition, one of the technical challenges is in the area of
extracting genome-wide chromatin characteristics from clinical
samples because clinical samples, although suitable to identify reg-
ulatory marks, are in limited amounts, and therefore, a large num-
ber of nuclei cannot be isolated from them. A novel approach has
been proposed where chromatin accessibility can be determined
without isolating nuclei, although this method is suitable only for
frozen tissues [23].

6 Concluding Remarks

Although underdeveloped, social epigenomics shows promise of

identifying etiologic factors contributing to cancer development in
different populations. Further research may provide new guidelines
and policies which could be used to improve health. We expect that
this chapter stimulates thinking about how epigenetics and social
equity might be integrated to better confront the root causes of
alleviating public health and social problems.
242 Krishna Banaudha et al.
Acknowledgments
We are thankful to the program staff for reading the manuscript and
providing suggestions to improve the manuscript.
References
1. Raghuraman S, Donkin I, Versteyhe S,
Barres R, Simar D (2016) The emerging role
of epigenetics in inflammation and immuno-
metabolism. Trends Endocrinol Metab 27
(11):782–795
2. Dabritz J, Menheniott TR (2014) Linking
immunity, epigenetics, and cancer in inflamma-
tory bowel disease. Inflamm Bowel Dis 20
(9):1638–1654
3. Fernandez-Rhodes L, Gong J, Haessler J,
Franceschini N, Graff M, Nishimura KK,
Wang Y, Highland HM, Yoneyama S, Bush
WS, Goodloe R, Ritchie MD, Crawford D,
Gross M, Fornage M, Buzkova P, Tao R,
Isasi C, Aviles-Santa L, Daviglus M, Mackey
RH, Houston D, Gu CC, Ehret G Nguyen
KH, Lewis CE, Leppert M, Irvin MR, Lim U,
Haiman CA, Le Marchand L, Schumacher F,
Wilkens L, Lu Y, Bottinger EP, Loos RJL, Sheu
WH, Guo X, WJ L, Y H, Hung YJ, Absher D,
Wu IC, Taylor KD, Lee IT, Liu Y, Wang TD,
Quertermous T, Juang JJ, Rotter JI, Assimes T,
Hsiung CA, Chen YI, Prentice R, Kuller LH,
Manson JE, C K, Smokowski P, Robinson WR,
Gordon-Larsen P, Li R, Hindorff L, Buyske S,
Matise TC, Peters U, North KE (2017) Trans-
ethnic fine-mapping of genetic loci for body
mass index in the diverse ancestral populations
of the Population Architecture using Genomics
and Epidemiology (PAGE) study reveals evi-
dence for multiple signals at established loci.
Hum Genet 136(6):771–800
4. Li W, Guo Y, Zhang C, Wu R, Yang AY,
Gaspar J, Kong AN (2016) Dietary phyto-
chemicals and cancer chemoprevention: a per-
spective on oxidative stress, inflammation, and
epigenetics. Chem Res Toxicol 29
(12):2071–2095
5. Li Y, Tollefsbol TO (2016) Age-related epige-
netic drift and phenotypic plasticity loss: impli-
cations in prevention of age-related human
diseases. Epigenomics 8(12):1637–1651
6. Tejeda S, Stolley MR, Vijayasiri G, Campbell
RT, Ferrans CE, Warnecke RB, Rauscher GH
(2017) Negative psychological consequences
of breast cancer among recently diagnosed eth-
nically diverse women. Psychooncology.
https://doi.org/10.1002/pon.4456
7. Muhsen K, Green MS, Soskolne V, Neumark Y
(2017) Inequalities in non-communicable dis-
eases between the major population groups in
Israel: achievements and challenges. Lancet
389(10088):2531–2541
8. Malta DC, Bernal RT, de Souza MF, Szwarc-
wald CL, Lima MG, Barros MB (2016) Social
inequalities in the prevalence of self-reported
chronic non-communicable diseases in Brazil:
national health survey 2013. Int J Equity
Health 15(1):153
9. Fang D, Gan H, Lee JH, Han J, Wang Z,
Riester SM, Jin L, Chen J, Zhou H, Wang J,
Zhang H, Yang N, Bradley EW, Ho TH, Rubin
BP, Bridge JA, Thibodeau SN, Ordog T,
Chen Y, van Wijnen AJ, Oliveira AM, Xu RM,
Westendorf JJ, Zhang Z (2016) The histone
H3.3K36M mutation reprograms the epigen-
ome of chondroblastomas. Science 352
(6291):1344–1348
10. Ropero S, Esteller M (2007) The role of his-
tone deacetylases (HDACs) in human cancer.
Mol Oncol 1(1):19–25
11. Salmanidis M, Pillman K, Goodall G, Bracken
C (2014) Direct transcriptional regulation by
nuclear microRNAs. Int J Biochem Cell Biol
54:304–311
12. Chitnis NS, Pytel D, Bobrovnikova-Marjon E,
Pant D, Zheng H, Maas NL, Frederick B,
Kushner JA, Chodosh LA, Koumenis C,
Fuchs SY, Diehl JA (2012) miR-211 is a pro-
survival microRNA that regulates chop expres-
sion in a PERK-dependent manner. Mol Cell
48(3):353–364
13. Hong CC, Chen PS, Chiou J, Chiu CF, Yang
CY, Hsiao M, Chang YW, Yu YH, Hung MC,
Hsu NW, Shiah SG, Hsu NY, Su JL (2014)
miR326 maturation is crucial for VEGF-C-
driven cortactin expression and esophageal
cancer progression. Cancer Res 74
(21):6280–6290
14. Wang W, Ren F, Wu Q, Jiang D, Li H, Shi H
(2014) MicroRNA-497 suppresses angiogene-
sis by targeting vascular endothelial growth
factor A through the PI3K/AKT and MAPK/
ERK pathways in ovarian cancer. Oncol Rep 32
(5):2127–2133
15. Xu J, Wang T, Cao Z, Huang H, Li J, Liu W,
Liu S, You L, Zhou L, Zhang T, Zhao Y (2014)
 Challenges and Opportunities in Social Epigenomics and Cancer
MiR-497 downregulation contributes to the
malignancy of pancreatic cancer and associates
with a poor prognosis. Oncotarget 5
(16):6983–6993
16. King KE, Kane JB, Scarbrough P, Hoyo C,
Murphy SK (2016) Neighborhood and family
environment of expectant mothers may influ-
ence prenatal programming of adult cancer
risk: discussion and an illustrative DNA meth-
ylation example. Biodemography Soc Biol 62
(1):87–104
17. American Cancer Society (2017) Global facts
and figures 2017. p 10. https://www.cancer.
org/content/dam/cancer-org/research/can
cer-facts-and-statistics/annual-cancer-facts-
and-figures/2017/cancer-facts-and-figures-
2017.pdf
18. Acharya S, Xu J, Wang X, Jain S, Wang H,
Zhang Q, Chang CC, Bower J, Arun B,
Seewaldt V, Yu D (2016) Downregulation of
GLUT4 contributes to effective intervention
of estrogen receptor-negative/HER2-overex-
pressing early stage breast disease progression
by lapatinib. Am J Cancer Res 6(5):981–995
19. Dietze EC, Sistrunk C, Miranda-Carboni G,
O’Regan R, Seewaldt VL (2015) Triple-
negative breast cancer in African-American
243
women: disparities versus biology. Nat Rev
Cancer 15(4):248–254
20. Benevolenskaya EV, Islam AB, Ahsan H,
Kibriya MG, Jasmine F, Wolff B, Al-Alem U,
Wiley E, Kajdacsy-Balla A, Macias V, Rauscher
GH (2016) DNA methylation and hormone
receptor status in breast cancer. Clin Epige-
netics 8:17
21. Song MA, Brasky TM, Marian C, Weng DY,
Taslim C, Dumitrescu RG, Llanos AA, Freu-
denheim JL, Shields PG (2015) Racial differ-
ences in genome-wide methylation profiling
and gene expression in breast tissues from
healthy women. Epigenetics 10
(12):1177–1187
22. Kamali P, Zettervall SL, Wu W, Ibrahim AM,
Medin C, Rakhorst HA, Schermerhorn ML,
Lee BT, Lin SJ (2017) Differences in the
reporting of racial and socioeconomic dispari-
ties among three large national databases for
breast reconstruction. Plast Reconstr Surg 139
(4):795–807
23. Grontved L, Bandle R, John S, Baek S, Chung
HJ, Liu Y, Aguilera G, Oberholtzer C, Hager
GL, Levens D (2012) Rapid genome-scale
mapping of chromatin accessibility in tissue.
Epigenetics Chromatin 5(1):10
 Part III

Methods Used in Cancer Epigenomics

 Chapter 14

Epigenetic and Genetic Regulation of PDCD1 Gene

in Cancer Immunology
Alok Mishra and Mukesh Verma

Abstract
Utilizing biology of PD-1: PD-L1 interaction related pathways for cancer immunotherapy is an emerging
concept in cancer research. However, there is limited literature on epigenetic regulation of PD1 gene
(PDCD1). Promising data from clinical trials of PD/PDl-1 immunotherapy in melanoma, renal cancers,
colorectal and lung cancers has generated a lot of hope for successful treatment of patients. Immunotherapy
in cancers has a significant role in strategizing NCI’s Cancer Moonshot Program of US NIH and FDA
policies. The cost of the treatment by immunotherapy is extremely high. This preview presents a concise
compilation of current knowledge on how the PD-1 gene is regulated in different cancers and infections.
We have also discussed about epigenetic regulation of PDCD1 gene, especially the effect of different
epigenetic inhibitors of DNA methylation and histone modifications at different steps in PD-1 regulation.

Key words Epigenetics, Immunotherapy, PD/PDL-1 and immune check points, Oral cancer

Abbreviations

CTCF CCCTC-Binding Factor

PD-1 Programed Cell Death-1
TSS Transcription start site

1 Introduction: PDCD1 Gene

Programed Cell Death-1 (PD-1) is a cell surface protein of immu-

noglobin family that is encoded by PDCD1 gene. It is located on
human chromosome 2 with approximately 9 Kb size [1].
The ligand of this protein, called Programmed death ligand 1
(PD-L1, B7-H1, and CD274), is seen upregulated in many can-
cers. In general, overexpressed PDL-1 protects cancer cells by
suppressing the activity of receptor PD-1 expressing adjoining
tumor-infiltrating effector CD4/CD8 T cells [2].

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_14,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

247
248 Alok Mishra and Mukesh Verma

Manipulation of PD-1: PD-L1 signaling is an emerging con-

cept in cancer immunotherapy [3, 4]. Very significantly, in the
mismatch repair gene (MMR) model where somatic mutations are
accumulated in the MMR related genes, subjects became sensitive
to PD-1 immune checkpoint blockade using the anti-PD-1 anti-
body pembrolizumab [5]. This observation was made in several
cancers irrespective of genetic background. These MMR-deficient
cancers generally accumulate mutation-associated neoantigens
(MANAs) which are recognized by specific tumor types. The impli-
cation of these results in standard of care might be possible because
such studies would tie immunity, cancer genetics, and therapeutics,
especially in patients who are deficient of MMR and refractory to
other treatment. Along with different cancers, PDCD1 polymor-
phism and transcriptional regulation have been reported in other
diseases also, such as systemic lupus erythematosus (SLE), an auto-
immune disease [6].
In preclinical models, an increased immune-mediated antitu-
mor activity between PD-1 and PD-L1 has been observed
[3]. Investigations on transcriptional regulation of this gene are
limited in number so far. This review will give overall simplistic
concepts of the current scenario followed by basics experimental
assays of transcriptional and epigenetic regulation.

2 Genetic Regulation of PD-1 Gene

T cell models have been utilized to characterize the promoter-

enhancer region of PDCD1 gene. Between 26 and +18 Kb
from the transcription start site (TSS), cytokine induced STAT
family of proteins and insulators (CTCF) are reported to bind to
DNA on this gene. At least 10 transcription factors and 8 -
cis-regulatory modules for transcriptional regulation have been
identified with two conserved regions, CR-B and CR-C
[7]. Many assays elucidated that CR-C is more critical when com-
pared to CR-B in regulating expression. These regulatory regions
are located at 0.1 Kb and 1.1 Kb upstream of the transcription start
site (TSS). All the regulatory modules in DNA are bound to multi-
ple nuclear transcription factors to orchestrate transcription of
PDCD1 gene. A CR-B is bound to AP-1 while CR-C contains a
binding site for interferon-stimulated response element (ISRE),
nuclear factor of activated T cells (NFAT)c1, FoxO1, and NF-κB.
Thus, myriad of prominent transcription factors regulate PDCD-1
genes at transcriptional and epigenetic level, as can be seen in Fig. 1.
TCR activation in LCMV infection represents one of the path-
ways through which NFATc gets manipulated that further induces
downstream PDCD1 transcriptional program. Notch2 integrates
signaling by the transcription factors RBP-J and CREB1 to pro-
mote T cell cytotoxicity [8]. The expression of c-Fos in T cells
 PDCD1 Gene Regulation 249

Fox
+1
-30KB
+17KB IRF9

CTCF NFAT Notch NFAT T-bet TSS NFAT CTCF

c1 c1 C-1
Blimp
STAT STAT
STAT
c-Fos
NF-kB

Fig. 1 Transcriptional modules of PDCD1 gene and its regulatory regions

subsequently induces PDCD1 expression in response to tumor

progression and is essential cue for repression of tumor growth
[9]. PD-1 gene regulation occurs in part via the recruitment of
NFATc1 at the PDCD1 locus and in T cell stimulation [10].
Among the suppressor of PD-1 gene, T-box expressed in T cells
(T-bet) was reported first [11]. T-bet is a T cell-associated tran-
scription factor which is mainly expressed in Hodgkin’s lymphoma
and proposed to play an important role in many cells of the adaptive
and innate immune system [12]. High level expression of PD-1 on
T cells has been shown to be associated with chronic viral infections
[13]. In some viral infections, the transcription factor Blimp-1
represses CD8 T cell expression of PD-1 using a transcriptional
loop [13]. Downregulation of PDCD1 gene via FOX0 mediated
TBet inhibition is also reported in many systems [14]. Generally,
FOXO regulates CD8+ T cell trafficking and homeostasis.
In human papilloma virus (HPV) mediated head and neck
squamous cell carcinoma (HNSCC), PD-1-expressing tumor-
infiltrating T cells can be used as prognostic biomarker [15]. In
this study, HPV (+) and PD-1 (+) T cells infiltrated more and
showed a correlation with disease outcome compared to samples
with HPV ( ) PD-1 ( ) cells. Mishra et al. has shown a HPV’s role
in differentiation of oral cancer and better prognosis [16]. There-
fore, PD-1 expression and HPV infection might be interlinked and
could be used for measuring the disease outcome.

3 Epigenetic Regulation of PDCD1 Gene

The role of PD-1 in epigenetic reprogramming of chronic infection

has been demonstrated. For example, Kaufman’s lab reported that
epigenetic program at the PD-1 locus becomes fixed after pro-
longed exposure to the HIV virus [17]. Results from this study
showed DNA methylation of the PD-1 regulatory regions in
HIV-specific CD8 cells. A significant outcome of Kaufman’s study
is exploring an alternative approach to PD-1 antibody blockade by
250 Alok Mishra and Mukesh Verma

reprogramming of epigenetic modifications. McPherson et al. also

reported that epigenetic modification of the PD-1 (PDCD1) pro-
moter (the presence of 5 hydroxylmethylcytosine, instead of
5-methylcytosine) in effector CD4+ T cells tolerated by peptide
immunotherapy, and epigenetic changes at the PDCD1 locus are
crucial in determining the tolerating potential of TCR-ligation
[18]. This was the first report demonstrating the enrichment of
5 hydroxylmethylcytosine at the PDCD1 promoter in naive CD4+
cells. Previously, the role of 5 hydroxylmethylcytosine was demon-
strated only during embryonic development. DNA demethylation
in PDCD1 gene promoter induced by 5-azacytidine activates PD-1
expression on Molt-4 cells [19]. PDCD1 is regulated at histone
modification level which is shown by the fact that LSD1 mediates
silencing of PD-1 expression following acute immune activation,
and histone H3K4me1/me2 demethylase LSD1 mediates epige-
netic changes at the PD-1 locus [7]. CD8+ Teff cells with low PD-1
expression were reported to have elevated levels of the repressive
H3K27me3 PTM at the PDCD1 promoter [20]. Active
(H3K4me3) and repressive (H3K27me3) histone marks at the
PDCD1 promoter by ChIP-PCR [18].
Orskov et al. demonstrated that treatment of myelodysplastic
syndrome/acute lymphoblastic leukemia (ALL) patients with
demethylating agent azacytidine resulted in demethylation of
PDCD1 gene promoter in 40% of subjects [21]. Many investigators
recommended that a better management can be achieved by com-
bining activation of the PD-1 checkpoints by epigenetic inhibitors
with other PD-1 pathway inhibitors (nonepigenetic inhibitors).

4 Selected Methods for Studying Gene Regulation

4.1 Gel Shift Assays 1. Nuclear extract was prepared by Thermo Fisher Kit although
(EMSA) other similar kits also work very well (e.g., NE-PER Nuclear
and Cytoplasmic Extraction Reagents (78,833; Thermo Fisher
Scientific Life Sciences).
2. Addition of phosphatase inhibitor cocktail (Complete Mini
11,836,153,001; Roche, Indianapolis, IN, USA) was done in
extraction buffers.
3. Consensus oligonucleotides of transcription factors are sup-
plied by many vendors in readymade condition (e.g., Santa
Cruz Biotechnology).
4. Oligos were labeled with γ-[32P]-ATP (e.g., NEG035C; Per-
kin Elmer, Waltham, MA, USA) with T4 polynucleotide kinase
kit (e.g., U2010; Promega, Madison, WI, USA).
 PDCD1 Gene Regulation 251

5. The binding reactions were performed to determine the speci-

ficity of DNA probes by using the heterologous cognate
sequence of the Oct-1/sp-1 binding site.
6. A competition assay using excess cold of transcription factors in
question was performed, to demonstrate specificity.

4.2 RT-qPCR 1. Trizol (15596-026; Sigma-Aldrich, St. Louis, MO, USA) or

any other kit from different vendor were used for RNA
isolation.
2. DNA was removed by using Turbo DNA-free kit (1907 M;
Thermo Fisher Scientific, Waltham, MA, USA).
3. cDNA preparation was performed either by RT based enzyme
kit (e.g., Ready-To-Go You-Prime First-Strand Beads
(27-9264-01; GE Healthcare, Pittsburgh, PA, USA) or by
PCR-based methods from total RNA (1–2 μg).
4. The quantitative determination of PCR product was done by
SYBER Green dye chemistry or Taqman primer-probe. qPCR
Primers sequences for genes are described in NIH website:
primerdepot.nci.nih.gov.
5. All experiments were run with 3 technical and 3 biologic
replicates.

4.3 Bisulfite 1. Genomic DNA (2–5 μg) was modified with EZ DNA Methyl-
Modification and ation-Gold™ Kit (Zymo Research, Orange, CA) or any other
Methylation-Specific kit with similar reagents.
PCR (MSP) 2. Bisulfite-modified DNA (2–5 μL) was then used as template
DNA for PCR reaction.
3. The total reaction volume for methylation-specific PCR (MSP)
is 50 μL containing 50–100 ng of bisulfite-modified DNA,
20 pmol of each primer, 25 mM dNTPs, 1 U Taq polymerase,
1 PCR buffer (e.g., MBI Fermentas, Vilnius, Lithuania).
4. For the MSP assays, the sequences of methylated and non-
methylated amplicon were kept around 150–200 bp.
5. The cycling conditions were following: denaturation at 95  C
for 5 min, followed by 35 cycles of 95  C for 30 s, 60  C for
30 s, and 72  C for 30 s, with a final extension at 72  C for
4 min. PCR products can be analyzed by electrophoresis.

4.4 Chromatin 1. Chromatin isolation from cancer/immune cells was performed

Immunoprecipitation with a chromatin immunoprecipitation (ChIP) assay kit as per
(ChIP) Assay the manufacturer’s instructions (17-295; EMD Millipore, Bill-
erica, MA, USA).
2. Chromatin solution (1 mL) was immunoprecipitated with the
antibodies for pull down, control experiments need: anti-RNA
252 Alok Mishra and Mukesh Verma

polymerase II (sc-899; Santa Cruz Biotechnology, Santa Cruz,

CA, USA), anti-AcH3 (2μg).
3. For the negative control, IgG was used in an equal quantity.
4. DNA after immunoprecipitation was used as a template for
PCR methods. 1–3% of the chromatin solution was used for
the input DNA as a control.
5. The primer sequences for transcription factors in PD PDCD-1
promoter for the analysis of the binding sites are designed and
PCR was performed.
6. The amplified DNA was analyzed on a 1.5% agarose gel with
ethidium bromide staining for qualitative assays.
7. All the experiments were performed in triplicate.

4.5 Nuclear Run on 1. To determine gene transcriptional rate, cells were treated then
Assay of Rate of Gene quenched in ice-cold phosphate buffered saline, pH 7.4 (PBS)
Transcription on ice, washed and lysed in Run-On Lysis Buffer.
2. Next, nuclei are collected by centrifugation at (500  g, 5 min)
at 4  C and suspended in buffer.
3. 100 μL of prepared nuclei and 100 μL of Run-on Reaction
Buffer were mixed; samples were incubated 30 min at 30 to
extract RNA using Trizol (Invitrogen).
4. Gene containing cDNA and probes were linearized and purified.
5. Probes were further denatured and subjected to slot-blot onto
Hybond N+ membrane. (Membranes are first prehybridized
and hybridized, washed in low stringency solution in and in
high stringency solution. Membrane is radiographed.

5 Conclusion

PD-1 regulates T cell function and different mechanisms have been

proposed about how this regulation occurs. A number of cis-DNA
elements, epigenetic regulatory components, including histone and
nonhistone proteins, and transcription factors contribute in regula-
tion of PD-1. Therapeutic PD-1 blockade has already been proven
an effective strategy for controlling a number of cancers. Under-
standing the epigenetic and genetic regulation of PD-1 may be
useful for developing novel immune based therapies in different
tumor types and other diseases.

References
1. Shinohara T, Taniwaki M, Ishida Y,
Kawaichi M, Honjo T (1994) Structure and
chromosomal localization of the human PD-1
gene (PDCD1). Genomics 23(3):704–706
2. Dong H, Strome SE, Salomao DR, Tamura H,
Hirano F, Flies DB, Roche PC, Lu J, Zhu G,
Tamada K, Lennon VA, Celis E, Chen L
(2002) Tumor-associated B7-H1 promotes

T-cell apoptosis: a potential mechanism of
immune evasion. Nat Med 8(8):793–800
3. Brahmer JR, Tykodi SS, Chow LQ, Hwu WJ,
Topalian SL, Hwu P, Drake CG, Camacho LH,
Kauh J, Odunsi K, Pitot HC, Hamid O,
Bhatia S, Martins R, Eaton K, Chen S, Salay
TM, Alaparthy S, Grosso JF, Korman AJ,
Parker SM, Agrawal S, Goldberg SM, Pardoll
DM, Gupta A, Wigginton JM (2012) Safety
and activity of anti-PD-L1 antibody in patients
with advanced cancer. N Engl J Med 366
(26):2455–2465
4. Taneja SS (2012) Re: safety and activity of anti-
PD-L1 antibody in patients with advanced can-
cer. J Urol 188(6):2148–2149
5. Le DT, Durham JN, Smith KN, Wang H, Bart-
lett BR, Aulakh LK, Lu S, Kemberling H,
Wilt C, Luber BS, Wong F, Azad NS, Rucki
AA, Laheru D, Donehower R, Zaheer A, Fisher
GA, Crocenzi TS, Lee JJ, Greten TF, Duffy
AG, Ciombor KK, Eyring AD, Lam BH,
Joe A, Kang SP, Holdhoff M, Danilova L,
Cope L, Meyer C, Zhou S, Goldberg RM,
Armstrong DK, Bever KM, Fader AN,
Taube J, Housseau F, Spetzler D, Xiao N, Par-
doll DM, Papadopoulos N, Kinzler KW, Eshle-
man JR, Vogelstein B, Anders RA, Diaz LA Jr
(2017) Mismatch repair deficiency predicts
response of solid tumors to PD-1 blockade.
Science 357(6349):409–413
6. Prokunina L, Castillejo-Lopez C, Oberg F,
Gunnarsson I, Berg L, Magnusson V, Brookes
AJ, Tentler D, Kristjansdottir H, Grondal G,
Bolstad AI, Svenungsson E, Lundberg I,
Sturfelt G, Jonssen A, Truedsson L, Lima G,
Alcocer-Varela J, Jonsson R, Gyllensten UB,
Harley JB, Alarcon-Segovia D, Steinsson K,
Alarcon-Riquelme ME (2002) A regulatory
polymorphism in PDCD1 is associated with
susceptibility to systemic lupus erythematosus
in humans. Nat Genet 32(4):666–669
7. Bally AP, Austin JW, Boss JM (2016) Genetic
and epigenetic regulation of PD-1 expression. J
Immunol 196(6):2431–2437
8. Maekawa Y, Minato Y, Ishifune C, Kurihara T,
Kitamura A, Kojima H, Yagita H, Sakata-
Yanagimoto M, Saito T, Taniuchi I, Chiba S,
Sone S, Yasutomo K (2008) Notch2 integrates
signaling by the transcription factors RBP-J
and CREB1 to promote T cell cytotoxicity.
Nat Immunol 9(10):1140–1147
9. Xiao G, Deng A, Liu H, Ge G, Liu X (2012)
Activator protein 1 suppresses antitumor T-cell
function via the induction of programmed
death 1. Proc Natl Acad Sci U S A 109
(38):15419–15424
10. Oestreich KJ, Yoon H, Ahmed R, Boss JM
(2008) NFATc1 regulates PD-1 expression
PDCD1 Gene Regulation 253
upon T cell activation. J Immunol 181
(7):4832–4839
11. Kao C, Oestreich KJ, Paley MA, Crawford A,
Angelosanto JM, Ali MA, Intlekofer AM, Boss
JM, Reiner SL, Weinmann AS, Wherry EJ
(2011) Transcription factor T-bet represses
expression of the inhibitory receptor PD-1
and sustains virus-specific CD8+ T cell
responses during chronic infection. Nat Immu-
nol 12(7):663–671
12. Lazarevic V, Glimcher LH, Lord GM (2013)
T-bet: a bridge between innate and adaptive
immunity. Nat Rev Immunol 13(11):777–789
13. Lu P, Youngblood BA, Austin JW, Mohammed
AU, Butler R, Ahmed R, Boss JM (2014)
Blimp-1 represses CD8 T cell expression of
PD-1 using a feed-forward transcriptional cir-
cuit during acute viral infection. J Exp Med
211(3):515–527
14. Rao RR, Li Q, Gubbels Bupp MR, Shrikant PA
(2012) Transcription factor Foxo1 represses T-
bet-mediated effector functions and promotes
memory CD8(+) T cell differentiation. Immu-
nity 36(3):374–387
15. Badoual C, Hans S, Merillon N, Van
Ryswick C, Ravel P, Benhamouda N,
Levionnois E, Nizard M, Si-Mohamed A,
Besnier N, Gey A, Rotem-Yehudar R, Pere H,
Tran T, Guerin CL, Chauvat A, Dransart E,
Alanio C, Albert S, Barry B, Sandoval F,
Quintin-Colonna F, Bruneval P, Fridman
WH, Lemoine FM, Oudard S, Johannes L,
Olive D, Brasnu D, Tartour E (2013) PD-1-
expressing tumor-infiltrating T cells are a favor-
able prognostic biomarker in HPV-associated
head and neck cancer. Cancer Res 73
(1):128–138
16. Mishra A, Bharti AC, Varghese P, Saluja D, Das
BC (2006) Differential expression and activa-
tion of NF-kappaB family proteins during oral
carcinogenesis: role of high risk human papil-
lomavirus infection. Int J Cancer 119
(12):2840–2850
17. Youngblood B, Noto A, Porichis F, Akondy
RS, Ndhlovu ZM, Austin JW, Bordi R, Proco-
pio FA, Miura T, Allen TM, Sidney J, Sette A,
Walker BD, Ahmed R, Boss JM, Sekaly RP,
Kaufmann DE (2013) Cutting edge: pro-
longed exposure to HIV reinforces a poised
epigenetic program for PD-1 expression in
virus-specific CD8 T cells. J Immunol 191
(2):540–544
18. McPherson RC, Konkel JE, Prendergast CT,
Thomson JP, Ottaviano R, Leech MD, Kay O,
Zandee SE, Sweenie CH, Wraith DC, Meehan
RR, Drake AJ, Anderton SM (2014) Epige-
netic modification of the PD-1 (Pdcd1) pro-
moter in effector CD4(+) T cells tolerized by
254 Alok Mishra and Mukesh Verma
peptide immunotherapy. Elife 3. https://doi.
org/10.7554/eLife.03416
19. Zhang M, Xiao XQ, Jiang YF, Liang YS, Peng
MY, Xu Y, Gong GZ (2011) DNA demethyla-
tion in PD-1 gene promoter induced by
5-azacytidine activates PD-1 expression on
Molt-4 cells. Cell Immunol 271(2):450–454
20. Youngblood B, Oestreich KJ, Ha SJ,
Duraiswamy J, Akondy RS, West EE, Wei Z,
Lu P, Austin JW, Riley JL, Boss JM, Ahmed R
(2011) Chronic virus infection enforces
demethylation of the locus that encodes PD-1
in antigen-specific CD8(+) T cells. Immunity
35(3):400–412
21. Orskov AD, Treppendahl MB, Skovbo A,
Holm MS, Friis LS, Hokland M, Gronbaek K
(2015) Hypomethylation and up-regulation of
PD-1 in T cells by azacytidine in MDS/AML
patients: a rationale for combined targeting of
PD-1 and DNA methylation. Oncotarget 6
(11):9612–9626
 Chapter 15

Methylation and MicroRNA Profiling to Understand

Racial Disparities of Prostate Cancer
Hirendra Nath Banerjee, William Kahan, Vineet Kumar,
and Mukesh Verma

Abstract
Prostate cancer is a serious disease in terms of its high incidence and mortality rate in the USA and around
the world. The prostate specific antigen (PSA) has been used for prostate cancer diagnosis and follow-up of
treatment but a number of challenges remain. Epigenetic biomarkers, especially methylation and micro-
RNA (miR) biomarkers provide an opportunity for diagnosis, prognosis, and recurrence of prostate cancer.
Differential global methylation has shown some promising results. In this chapter, the emphasis is given on
those biomarkers which can be assayed noninvasively in a prospective study and in a clinic. Challenges in the
field, especially the validation of potential biomarkers, and their potential solutions are provided in this
chapter.

Key words Biomarker, Epigenetics, Epidemiology, Methylation, Prostate cancer, Survival, Treatment

Abbreviations

BPH Benign prostate hyperplasia

EMR Electronic medical records
HDM Histone demethylase
HMT Histone methyltransferase
MS-MLPA Methylation-specific multiplex ligation probe amplification
PBMC Peripheral mononuclear blood cells

1 Introduction: Prostate Cancer Incidence, Prevalence, and Risk Factors

Contributing to Disease Development

Prostate cancer is the second lethal disease in Western countries and

causes about 300,000 deaths annually worldwide [1]. According to
recent estimates, it accounts for 14.4% of all new cases of cancer in

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_15,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

255
256 Hirendra Nath Banerjee et al.

men worldwide [2]. The disease is extremely heterogeneous and

can present as indolent or aggressive disease, depending on the
racial and ethnic background. Factors contributing to the develop-
ment of prostate cancer include age, family history, race, obesity,
diet, and other environmental factors. In old age (above 80 years)
the incidence rate is about 80%. Although biomarkers exist for
prostate cancer diagnosis, they either have poor sensitivity and
specificity or they cannot detect prostate cancer early enough to
make strategies for proper treatments. Only prostate specific anti-
gen (PSA) is a biomarker which is used extensively in the clinic and
it can be only used in those cases where the levels of PSA are more
than 4 ng/ml. Different forms of PSA (free PSA, total PSA, PSA
velocity) have been characterized but the advantage of one over
others is not convincing [3].
In the last decade, reasonable progress has been made of epige-
netic biomarkers in prostate cancer. We have summarized the latest
findings in this area by literature search in the PubMed and eval-
uated the progress in the field. Using different terms in prostate
cancer and epigenetics fields, the PubMed was searched up to May
25, 2017 and results are shown in Table 1. As indicated, more than
20,000 publications have appeared in epigenetics field and about
8000 have a focus on cancer. Among cancers, 417 articles cover risk
assessment, diagnosis, prognosis, recurrence, treatment, and sur-
vival of prostate cancer. Methylation in prostate cancer has been
studied the most publications (1554 publications) compared to
histone (1408 publications), micro RNA (1256 publications), or
chromatin accessibility (17 publications). In one epidemiologic
study, methylation levels of prostate cancer tumor showed an asso-
ciation with cigarette smoking [4]. In this study, 523 men were
evaluated for the presence of the disease and methylation profiling.
In this chapter, we have discussed about those publications which
have clinical implications. To understand the epigenetic etiology of
prostate cancer, only 17 publications cover epidemiologic studies,
whereas genomics and nonepigenetic factors cover a much larger
number of publications (mostly, genome-wide association studies
and screening trials/studies). We could not see such epidemiologic
studies where all components of epigenetics regulation are studied
in the same population.

2 Epigenetic Regulation of Prostate Cancer-Associated Genes

Cancer is a genetic and epigenetic disease and epigenetic regulation

has been observed in all major tumor types studied to date includ-
ing prostate cancer [5–7]. The four major components of epige-
netics are DNA methylation, histone modifications, noncoding
RNA (mostly microRNAs) expression and chromatin modulation
[3, 8–12]. Because of the limitations of histopathological
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . . 257

Table 1
Publications in epigenetics and prostate cancer

Terms used Number of publications

Epigenetics 20,344
Cancer 3,483,939
Epigenetics and cancer 7988
Prostate cancer 145,630
Prostate cancer epigenetics 417
Methylation 93,104
Cancer and methylation 33,452
Prostate cancer and methylation 1554
Histone 91,928
Histone and cancer 29,425
Histone and prostate cancer 1408
Micro RNA 58,623
Micro RNA and cancer 26,111
Micro RNA and prostate cancer 1256
Chromatin accessibility 2434
Chromatin accessibility and cancer 561
Chromatin accessibility and prostate cancer 17
Prostate cancer epidemiology 23,293
Prostate cancer epidemiology and epigenetics 52

examinations and the heterogeneous nature of tumors, there is a

need of prostate cancer disease stratification and methylation
profiling can help complementing this need. Methylation changes
are stable changes and can be detected in biofluids such as blood
and plasma. Biofluids (plasma and blood) may be considered a
noninvasive sample compared to prostate tissues. Methylation mar-
kers which can be used for risk prediction, detection, diagnosis, and
prognosis of prostate cancer have been reported [6, 13]. Methyla-
tion biomarkers are easy to assay and high throughput technologies
have been developed for assaying a large number of samples with
high specificity and sensitivity. Most of the methylation biomarkers
get hypermethylated with the development of the disease. How-
ever, retrotransposons are hypermethylated in normal healthy indi-
viduals and these repeated sequences (LINE-1 and Alu) get
hypomethylated as the disease progresses [7]. A few selected epige-
netic biomarkers and their characteristics are shown in Table 2.
258 Hirendra Nath Banerjee et al.

Table 2
Biomarkers of prostate cancer and their characteristics

Biomarkers Comments
GSTP1, RASF1, Ap1 These methylation biomarkers can distinguish benign from
cancerous tissues [14]; among these biomarkers GSTP1 has
been studied the most which is involved in detoxification and it
protects cells from DNA damage [15]
HSPB1, CCND2, TIG1, DPYS, These biomarkers predicted aggressiveness of prostate cancer
PITX2, MAL [16]
APC Hypermethylated in all stages of prostate cancer development,
commonly assessed with GSTP1; the gene is involved in several
cellular processes such as the Wnt signaling pathway. Cell
migration and adhesion [17, 18]
RASSF1A Hypermethylated in early stages of the disease and involved in cell
cycle regulation and apoptosis [17, 18]
Different miRNAs A few miRNA were identified which interacted epigenetically
with the androgen receptor (AR) in patients with prostate
cancer [13]
miR-21 miR-21 could distinguish benign from cancer in PBMC [19]
miR-141 Over-expressed in metastasis; can be measured in body fluids;
member of miR-200 family which regulates transition from
epithelia to mesenchyma [20]
DNA methylation regions OPCML, DNA Methylation Regions (DMRs) were used to correlate with
ELAVL2, EXT1, IRX5 Gleason score and predicting recurrence of prostate cancer
[21]
Abnormal noncoding RNA Biomarker of drug resistance and metastasis of prostate cancer [1]
expression
Hypermethylation of GSTP1, Biomarkers of recurrence [22]
RARb2, CD44, and PTGS2
EZH2 Histone ethyltransferase that methylates H3K27; overexpression
during prostate cancer progression [23]
Global levels of H3K18Ac Aberrant expression during prostate cancer progression;
modification of histones associated with active gene expression
[24]
Notes: Different studies are shown in separate rows. Along with methylation markers, other epigenetic biomarkers and
their actions are included in this table

Recently, the role of miRNAs in diagnosis and prognosis has

been investigated. Yang et al. demonstrated that microRNA-21
(miR-21) was present at higher levels in the peripheral mononu-
clear blood cells (PBMC) of prostate cancer patients than in normal
healthy individuals [19, 20]. In this epidemiologic study, levels of
miR-21 correlated with the Gleason score, clinical stages, bone
metastasis, and tumor recurrence. Samples from 97 healthy
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . . 259

volunteers, 92 pathologically verified prostate cancer patients, and

85 with benign prostate hyperplasia (BPH) were analyzed by
reverse transcriptase polymerase chain reaction (RTPCR) followed
by relative operating characteristic (ROC) curve analysis to get the
diagnostic value of prostate cancer, by Kaplan–Meier curve to
determine miRNA levels, and by Cox proportional hazard risk
regression analysis to screen the independent factors in patients.
In noncoding RNAs, there is no open reading frame and their
potential role in prostate cancer development has been proposed
recently in androgen receptor positive cases [1]. Abnormal expres-
sion of few noncoding RNAs was observed in cell proliferation,
drug resistance, and metastasis. miR-200c and miR-205 were dif-
ferentially expressed in normal and metastatic prostate cancer cells
[25]. Other examples of miRNAs and their contribution in prostate
cancer are shown in Table 2.
Histone modifications in prostate cancer have not been studied
extensively in humans, however, in prostate cancer cell line few
experiments were conducted showing the epigenetic regulation of
prostate cancer by protein arginine N-methyltransferase
6 (PRMT6) altering histone H3R2me2a levels and apoptotic prop-
erties of cells [26]. Further experimentation with androgen depri-
vation indicated the potential of clinical management of castration
resistant prostate cancer.
Histone methylation affects gene transcription by the activity of
histone methyltransferase (HMT) and histone demethylase
(HDM). Methylation at H3K4 or H3K36 represents euchromatin
(active transcription), and H3K9 and H3K36 represent hetero-
chromatin (repressed transcription) [24]. One investigator demon-
strated that one HMT, called SET9, improved gene expression by
inducing histone H3K4me1 and obstructing H3K9 methylation
and the nucleosome in cancer patients [27]. SET9 was proposed for
N-C interdomain cooperation which is an integral part of androgen
receptor transcription.

3 Methods in Determining Differential Profiling of Selected Methylation Genes

Associated with Prostate Cancer and Methods for Next Generation Sequencing

A comparison of two techniques, (1) Methylation sensitive PCR

with high resolution melting curve analysis (MS-HRM), and
(2) InfiniumHumanMethylation 450 BeadChip (HM450) indi-
cated comparable results of hypermethylation of GSTP1, APC,
and RASSF1 genes in prostate cancer tissue samples [14]. In
another study, methylation-specific multiplex ligation probe ampli-
fication (MS-MLPA) identified five genes which were hypermethy-
lated in prostate cancer: GSTP1, PARB, RASF1, SCGB3A1, and
CCND2 [28].
260 Hirendra Nath Banerjee et al.

The following key steps were carried out to determine methyl-

ation profiling:
1. For DNA methylation analysis, 500 ng of genomic DNA was
bisulfite treated using the EZ DNA Methylation kit (Zymo
Research).
2. Bisulfite treated DNA was purified according to the manufac-
turer’s protocol and eluted to a final volume of 46 μl.
3. Multiplex PCR Optimization in silico designed assays were
initially divided into multiple groups based on the amplicon
size, primer Tm, GC content, and ΔG values, while also avoid-
ing overlapping primer pairs.
4. Gradient PCR was performed at two different magnesium
concentrations (1.5 mM and 3.0 mM), followed by capillary
electrophoresis of the PCR products using the QIAxcel
Advanced System (Qiagen).
5. Final multiplex PCR conditions were determined based on the
optimal annealing temperature (Ta), magnesium concentra-
tion, and overall amplification efficiency.
6. Multiplex PCR on Samples Seven Multiplex PCRs were per-
formed using 0.5 units of Qiagen HotStarTaq, 0.2 μM primers,
and 2 μl of bisulfite-treated DNA in a 20 μl reaction, using the
following cycling conditions: 95  C 15 min; 45x (95  C 30s;
Ta C 30s; 68  C 30 s); 68  C 5 min; 8  C forever, where the
annealing temperature for each multiplex varied from
53–63  C.
7. QC of PCR products was performed using the QIAxcel
Advanced System.
8. Prior to library preparation, PCR products were pooled and
purified using QIAquick PCR Purification Kit columns
(Qiagen).
9. Library Preparation and Sequencing Libraries were prepared
using the KAPA Library Preparation Kit for Ion Torrent plat-
forms (Cat# KK8310) and Ion Xpress™ Barcode Adapters
(Thermo Fisher). Next, library molecules were purified using
Agencourt AMPure XP beads (Beckman Coulter) and quanti-
fied using the Qiagen QIAxcel Advanced System.
10. Barcoded samples were then pooled in an equimolar fashion
before template preparation and enrichment were performed
on the Ion Chef™ system (Thermo Fisher) using Ion 520™
and Ion 530™ Chef reagents. Following this step, enriched,
template-positive library molecules were then sequenced on
the Ion S5™ sequencer using Ion 530™ sequencing chips
(Thermo Fisher).
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . . 261

11. Data Analysis FASTQ files from the Ion Torrent S5 server were
aligned to the local reference database using open source Bis-
mark Bisulfite Read Mapper with the Bowtie2 alignment
algorithm.
12. Methylation levels were calculated in Bismark by dividing the
number of methylated reads by the total number of reads,
considering all CpG sites covered by a minimum of 100 total
reads. An R-square value of >0.9 was required for validation.

4 Case Study: A Comparison of Differential Methylation Profiling in African

American (AA) and Comparison with Caucasian (CA) Population

A study was conducted by our laboratory (HNB) to analyze differ-

ential methylation pattern in the CpG islands of promoters of
several genes known to be associated with prostate cancer in the
genomic DNA isolated from AA and CA patients and analyzed
using the above mentioned method. The result showed significant
changes in methylation in the following genes in these two ethnic
groups: CD44, MAGE-A1, GSTP1, RASSF1.
Global hypomethylation is commonly linked to activation of
proto-oncogenes and chromosomal instability. It is associated with
metastasis also [7, 29]. We determined methylation profiling in AA
and CA individuals to investigate racial differences associated with
risk of prostate cancer. Figure 1a,b shows the differential gene
expression of MiR let-7c from prostate cancer matched samples of
AA and CA patients (RNU1A1 as internal control), the data shows
significant loss of MiR let-7c in both the races, however, much
more significant loss in AA patient. Similar data was obtained
from analysis of other patients too, implying the fact that loss of
functionality of the miRs epigenetically causes increased aggressive-
ness of prostate cancer (probably more in AA) resulting in EMT and
cancer stem-like cell formation.
Although several protocols exist in the literature for microarray
analysis, which distinguishes cancer-associated miRNAs from nor-
mal miRNAs, a general protocol is described below.
1. A high quality RNA is needed for microarray analysis. RNA
from normal and prostate cancer cells was isolated using TRI-
zol kit from Invitrogen (CA, USA).
2. A database of human and mouse miRNA was evaluated to
select conserved miRNAs with or without 18 nucleotide
stretches to synthesize appropriate probes as discussed [25].
3. Designed and synthesized miRNA antisense DNAs and unique
control probes (calculated the appropriate number of unique
probes based on the number of samples being analyzed).
262 Hirendra Nath Banerjee et al.

a Expression of Let7c in African American Patient A (ΔΔCT)

70

60
Comparative Expression (AU)

50

40

30

20

10

0
Patient A Normal Patient A Tumor

b Expression of Let7c in Caucasian Patient 1 (ΔΔCT)

0.008

0.007
Comparative Expression (AU)

0.006

0.005

0.004

0.003

0.002

0.001

0
Patient 1 Normal Patient 1 Tumor

Fig. 1 miR let-7c levels in AA and CA samples. (a) and (b) show the differential gene expression of miR let-7c
from prostate cancer matched samples of AA and CA patients (RNU1A1 was used as an internal control), the
data shows significant loss of miR let-7c in both races, however, much more significant loss in AA patient,
similar data was obtained from analysis of other patients too implying the fact that loss of functionality of the
miRs epigenetically causes increased aggressiveness of prostate cancer (probably more in AA) resulting in
EMT and cancer stem cells like cells formation.

4. All sample and control probes were printed on Hybond N+

membranes.
5. Spotted 0.25 pmol of each probe and cross-linked with a UV
cross-linker.
6. From the total RNA, small RNA was isolated and purified by
gel electrophoresis. This process was done for samples from
normal healthy and cancer patient cells.
7. Dephosphorylation of the phosphate was done by phosphatase
treatment labeling by kinase in appropriate buffer.
8. The product was purified by passing through G-25 splin
colums and used for hybridization.
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . . 263

9. Hybridization of labelled RNAs was done on spotted mem-

branes for 16 to 24 h and images were scanned to collect
quantitative numbers and identifying cancer-associated
miRNAs.

5 Cohort Consortia with Resources to Conduct Prostate Cancer Epigenetic

and Epidemiology Studies

Several cohorts exist which maintain exposure, lifestyle, family

history, electronic medical records (EMRs) with clinical informa-
tion about individuals with different populations, and biospecimens
[30–32]. These cohorts are followed longitudinally and observed
for disease development (including prostate cancer). Epigenetic
data was generated from different cohorts in a program called
Roadmap Epigenomics [33]. One group conducted genome-wide
methylation analysis of benign and prostate cancer tissue samples
and showed differentially expressed methylated regions, transcrip-
tion factor binding sites, and an enrichment of enhancer of zeste
homolog 2 binding in gene regulatory regions [34]. Validation of
these results is being conducted. miR-150 was found a predictor of
prostate cancer survival [35].
In another study, changes in global DNA methylation and
cancer incidence and mortality was studied by taking 1259 pro-
spective methylation measurements from biospecimens taken up to
four times from 583 participants. Higher Alu methylation was
observed among participants who were younger and had lower
BMI compared to older participants. Furthermore, time-
dependent LINE-1 methylation was found to be associated with
prostate cancer [36]. In one report, the significance of miR-125 in
prostate cancer was demonstrated to facilitate treatment plan and
response to treatment [37]. Most of the miRNAs associated with
prostate cancer show higher levels compared to miRNAs from
healthy individuals, but miR-125 levels go down with histological
grade, high preoperative PSA levels, pathological stage, high Glea-
son Score, lymph node metastasis, and biochemical
recurrence [37].
One more example of miRNAs downregulation in cancer is
that of miR-1207-3p [38]. In Serbian population, small nucleotide
polymorphisms located in different miRNA genes were character-
ized and association with prostate cancer was evaluated [39]. Key
miRNAs in this study were hsa-MiR-499, hsa-MiR-196a2, and
hsa-MiR-27a. In another study, a group of 14 miRNAs was identi-
fied in a retrospective cohort where levels of these miRNAs corre-
lated with low grade prostate cancer. This information is very
significant in the treatment of patients who are at low risk of
developing prostate cancer [40].
264 Hirendra Nath Banerjee et al.

6 Challenges and Research Opportunities

A number of challenges exist in the field of epigenetic biomarkers

and their utility in prostate cancer risk prediction, diagnosis, prog-
nosis, and follow-up recurrence. Few of the challenges are discussed
below. After prostate cancer is diagnosed, one of the treatments is
radical prostatectomy. However, in some cases, recurrence of the
cancer was observed. It is estimated that about 30% of prostate
cancer would develop the disease after prostatectomy [3]. Although
few methylation biomarkers (GSTP1, RARb2, CD44, and PTGS2)
predicted recurrence of the disease, the validation of these biomar-
kers is still awaited [22]. Risk factors for the recurrence of prostate
cancer are also not well characterized. Challenges and research
opportunities exist in the integration of genomic information into
epigenetic knowledge in prostate cancer diagnosis and prognosis.
In spite of the extensive use of PSA in prostate cancer diagnosis,
there are no distinct cutoff levels of PSA for diagnosis. In a few
cases, higher levels of PSA did not reflect the degree of advance-
ment of the disease. Furthermore, serum PSA sometimes reflect
benign prostatic hyperplasia and not prostate cancer. Also, serum
PSA levels did not distinguish indolent disease with the aggressive
prostate cancer at the time of diagnosis [3]. In older patients
(80 years or older), it is difficult for a clinician to explain any survival
benefit of prostate cancer treatment based on PSA levels. Lastly,
response to treatment is difficult to predict if the bases of diagnosis
is serum PSA levels. A meta-analysis of six screening trials did not
show any usefulness of PSA screening to predict cancer
mortality [41].
Additional prospective studies are needed to identify and vali-
date more epigenetic biomarkers which can be used for the risk
assessment, diagnosis, and prognosis because prostate cancer is a
health and economic burden in the aging population, especially in
the USA.

Acknowledgments

We are thankful to Dr. L. Yan of EpigenDX Corporation (MA,

USA). Portion of this work was supported by NIH-NIGMS
grant# T34GM100831 and NIH-NCI grant# R01CA164318-
03S1 to HNB.
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . .
References
1. Ma G, Tang M, Wu Y, Xu X, Xu R (2016)
LncRNAs and miRNAs: potential biomarkers
and therapeutic targets for prostate cancer. Am
J Transl Res 8(12):5141–5150
2. Srivastava A, Goldberger H, Afzal Z, Suy S,
Collins SP, Kumar D (2015) Detection of cir-
culatory microRNAs in prostate cancer. Meth-
ods Mol Biol 1238:523–538
3. Chiam K, Ricciardelli C, Bianco-Miotto T
(2014) Epigenetic biomarkers in prostate can-
cer: current and future uses. Cancer Lett 342
(2):248–256
4. Shui IM, Wong CJ, Zhao S, Kolb S, Ebot EM,
Geybels MS, Rubicz R, Wright JL, Lin DW,
Klotzle B, Bibikova M, Fan JB, Ostrander EA,
Feng Z, Stanford JL (2016) Prostate tumor
DNA methylation is associated with cigarette
smoking and adverse prostate cancer out-
comes. Cancer 122(14):2168–2177
5. Verma M (2016) Genome-wide association
studies and epigenome-wide association stud-
ies go together in cancer control. Future Oncol
12(13):1645–1664
6. Blute ML, Damaschke NA Jr, Jarrard DF
(2015) The epigenetics of prostate cancer diag-
nosis and prognosis: update on clinical applica-
tions. Curr Opin Urol 25(1):83–88
7. Brothman AR, Swanson G, Maxwell TM,
Cui J, Murphy KJ, Herrick J, Speights VO,
Isaac J, Rohr LR (2005) Global hypomethyla-
tion is common in prostate cancer cells: a quan-
titative predictor for clinical outcome? Cancer
Genet Cytogenet 156(1):31–36
8. Mishra A, Verma M (2012) Epigenetics of solid
cancer stem cells. Methods Mol Biol
863:15–31
9. Sethi S, Kong D, Land S, Dyson G, Sakr WA,
Sarkar FH (2013) Comprehensive molecular
oncogenomic profiling and miRNA analysis of
prostate cancer. Am J Transl Res 5(2):200–211
10. Severi G, Southey MC, English DR, Jung CH,
Lonie A, McLean C, Tsimiklis H, Hopper JL,
Giles GG, Baglietto L (2014) Epigenome-wide
methylation in DNA from peripheral blood as a
marker of risk for breast cancer. Breast Cancer
Res Treat 148(3):665–673
11. Shen J, LeFave C, Sirosh I, Siegel AB, Tycko B,
Santella RM (2015) Integrative epigenomic
and genomic filtering for methylation markers
in hepatocellular carcinomas. BMC Med Genet
8:28
12. Smolle M, Uranitsch S, Gerger A, Pichler M,
Haybaeck J (2014) Current status of long
non-coding RNAs in human cancer with
265
specific focus on colorectal cancer. Int J Mol
Sci 15(8):13993–14013
13. Paone A, Galli R, Fabbri M (2011) Micro-
RNAs as new characters in the plot between
epigenetics and prostate cancer. Front Genet
2:62
14. Skorodumova LO, Babalyan KA, Sultanov R,
Vasiliev AO, Govorov AV, Pushkar DY, Prileps-
kaya EA, Danilenko SA, Generozov EV, Larin
AK, Kostryukova ES, Sharova EI (2016)
GSTP1, APC and RASSF1 gene methylation
in prostate cancer samples: comparative analysis
of MS-HRM method and Infinium Human-
Methylation450 BeadChip beadchiparray diag-
nostic value. Biomed Khim 62(6):708–714
15. Jeronimo C, Henrique R, Hoque MO,
Mambo E, Ribeiro FR, Varzim G, Oliveira J,
Teixeira MR, Lopes C, Sidransky D (2004) A
quantitative promoter methylation profile of
prostate cancer. Clin Cancer Res 10
(24):8472–8478
16. Ahmad AS, Vasiljevic N, Carter P, Berney DM,
Moller H, Foster CS, Cuzick J, Lorincz AT
(2016) A novel DNA methylation score accu-
rately predicts death from prostate cancer in
men with low to intermediate clinical risk fac-
tors. Oncotarget 7(44):71833–71840
17. Ellinger J, Haan K, Heukamp LC, Kahl P,
Buttner R, Muller SC, von Ruecker A, Bastian
PJ (2008) CpG island hypermethylation in cell-
free serum DNA identifies patients with loca-
lized prostate cancer. Prostate 68(1):42–49
18. Rosenbaum E, Hoque MO, Cohen Y,
Zahurak M, Eisenberger MA, Epstein JI, Par-
tin AW, Sidransky D (2005) Promoter hyper-
methylation as an independent prognostic
factor for relapse in patients with prostate can-
cer following radical prostatectomy. Clin Can-
cer Res 11(23):8321–8325
19. Yang B, Liu Z, Ning H, Zhang K, Pan D,
Ding K, Huang W, Kang XL, Wang Y, Chen
X (2016) MicroRNA-21 in peripheral blood
mononuclear cells as a novel biomarker in the
diagnosis and prognosis of prostate cancer.
Cancer Biomark 17(2):223–230
20. Mitchell PS, Parkin RK, Kroh EM, Fritz BR,
Wyman SK, Pogosova-Agadjanyan EL,
Peterson A, Noteboom J, O’Briant KC,
Allen A, Lin DW, Urban N, Drescher CW,
Knudsen BS, Stirewalt DL, Gentleman R, Ves-
sella RL, Nelson PS, Martin DB, Tewari M
(2008) Circulating microRNAs as stable
blood-based markers for cancer detection.
Proc Natl Acad Sci U S A 105
(30):10513–10518
266 Hirendra Nath Banerjee et al.
21. Wu Y, Davison J, Qu X, Morrissey C, Storer B,
Brown L, Vessella R, Nelson P, Fang M (2016)
Methylation profiling identified novel differen-
tially methylated markers including OPCML
and FLRT2 in prostate cancer. Epigenetics 11
(4):247–258
22. Woodson K, O’Reilly KJ, Ward DE, Walter J,
Hanson J, Walk EL, Tangrea JA (2006) CD44
and PTGS2 methylation are independent prog-
nostic markers for biochemical recurrence
among prostate cancer patients with clinically
localized disease. Epigenetics 1(4):183–186
23. Bianco-Miotto T, Chiam K, Buchanan G,
Jindal S, Day TK, Thomas M, Pickering MA,
O’Loughlin MA, Ryan NK, Raymond WA,
Horvath LG, Kench JG, Stricker PD, Marshall
VR, Sutherland RL, Henshall SM, Gerald WL,
Scher HI, Risbridger GP, Clements JA, Butler
LM, Tilley WD, Horsfall DJ, Ricciardelli C,
BioResource APC (2010) Global levels of spe-
cific histone modifications and an epigenetic
gene signature predict prostate cancer progres-
sion and development. Cancer Epidemiol Bio-
mark Prev 19(10):2611–2622
24. Seligson DB, Horvath S, Shi T, Yu H, Tze S,
Grunstein M, Kurdistani SK (2005) Global
histone modification patterns predict risk of
prostate cancer recurrence. Nature 435
(7046):1262–1266
25. Tang X, Tang X, Gal J, Kyprianou N, Zhu H,
Tang G (2011) Detection of microRNAs in
prostate cancer cells by microRNA array. Meth-
ods Mol Biol 732:69–88
26. Almeida-Rios D, Graca I, Vieira FQ, Ramalho-
Carvalho J, Pereira-Silva E, Martins AT,
Oliveira J, Goncalves C, Costa BM,
Henrique R, Jeronimo C (2016) Histone
methyltransferase PRMT6 plays an oncogenic
role of in prostate cancer. Oncotarget 7
(33):53018–53028
27. Gaughan L, Stockley J, Wang N, McCracken
SR, Treumann A, Armstrong K, Shaheen F,
Watt K, McEwan IJ, Wang C, Pestell RG, Rob-
son CN (2011) Regulation of the androgen
receptor by SET9-mediated methylation.
Nucleic Acids Res 39(4):1266–1279
28. Gurioli G, Salvi S, Martignano F, Foca F,
Gunelli R, Costantini M, Cicchetti G, De
Giorgi U, Sbarba PD, Calistri D, Casadio V
(2016) Methylation pattern analysis in prostate
cancer tissue: identification of biomarkers
using an MS-MLPA approach. J Transl Med
14(1):249
29. Yegnasubramanian S, Haffner MC, Zhang Y,
Gurel B, Cornish TC, Wu Z, Irizarry RA,
Morgan J, Hicks J, TL DW, Isaacs WB, Bova
GS, De Marzo AM, Nelson WG (2008) DNA
hypomethylation arises later in prostate cancer
progression than CpG island hypermethylation
and contributes to metastatic tumor heteroge-
neity. Cancer Res 68(21):8954–8967
30. Hashim D, Boffetta P, Galsky M, Oh W,
Lucchini R, Crane M, Luft B, Moline J,
Udasin I, Harrison D, Taioli E (2016) Prostate
cancer characteristics in the world trade center
cohort, 2002–2013. Eur J Cancer Prev.
https://doi.org/10.1097/CEJ.
0000000000000315
31. Chen R, Sjoberg DD, Huang Y, Xie L, Zhou L,
He D, Vickers AJ, Sun Y, Chinese Prostate
Cancer, Prostate Biopsy Collaborative Group
(2017) Prostate specific antigen and prostate
cancer in Chinese men undergoing initial pros-
tate biopsies compared with western cohorts. J
Urol 197(1):90–96
32. Carrick DM, Black A, Gohagan JK, Khan A,
Pettit K, Williams C, Yu K, Yurgalevitch S,
Huang WY, Zhu C (2015) The PLCO biore-
pository: creating, maintaining, and adminis-
tering a unique biospecimen resource. Rev
Recent Clin Trials 10(3):212–222
33. Mullard A (2015) The roadmap Epigenomics
project opens new drug development avenues.
Nat Rev Drug Discov 14(4):223–225
34. Kirby MK, Ramaker RC, Roberts BS, Las-
seigne BN, Gunther DS, Burwell TC, Davis
NS, Gulzar ZG, Absher DM, Cooper SJ,
Brooks JD, Myers RM (2017) Genome-wide
DNA methylation measurements in prostate
tissues uncovers novel prostate cancer diagnos-
tic biomarkers and transcription factor binding
patterns. BMC Cancer 17(1):273
35. Dezhong L, Xiaoyi Z, Xianlian L, Hongyan Z,
Guohua Z, Bo S, Shenglei Z, Lian Z (2015)
miR-150 is a factor of survival in prostate can-
cer patients. J BUON 20(1):173–179
36. Joyce BT, Gao T, Zheng Y, Liu L, Zhang W,
Dai Q, Shrubsole MJ, Hibler EA,
Cristofanilli M, Zhang H, Yang H, Vokonas P,
Cantone L, Schwartz J, Baccarelli A, Hou L
(2016) Prospective changes in global DNA
methylation and cancer incidence and mortal-
ity. Br J Cancer 115(4):465–472
37. Xu S, Yi XM, Zhang ZY, Ge JP (2016) Zhou
WQ, miR-129 predicts prognosis and inhibits
cell growth in human prostate carcinoma. Mol
Med Rep 14(6):5025-5032
38. Das DK, Naidoo M, Ilboudo A, Park JY, Ali T,
Krampis K, Robinson BD, Osborne JR, Ogun-
wobi OO (2016) miR-1207-3p regulates the
androgen receptor in prostate cancer via
FNDC1/fibronectin. Exp Cell Res 348
(2):190–200
39. Nikolic Z, Savic Pavicevic D, Vucic N,
Cidilko S, Filipovic N, Cerovic S, Vukotic V,
 Methylation and MicroRNA Profiling to Understand Racial Disparities of. . . 267

Romac S, Brajuskovic G (2015) Assessment of microRNA levels associate with absence of

association between genetic variants in micro-
RNA genes hsa-miR-499, hsa-miR-196a2 and
hsa-miR-27a and prostate cancer risk in Ser-
bian population. Exp Mol Pathol 99
(1):145–150
40. Mihelich BL, Maranville JC, Nolley R, Peehl
DM, Nonn L (2015) Elevated serum
high-grade prostate cancer in a retrospective
cohort. PLoS One 10(4):e0124245
41. Djulbegovic M, Beyth RJ, Neuberger MM,
Stoffs TL, Vieweg J, Djulbegovic B, Dahm P
(2010) Screening for prostate cancer: system-
atic review and meta-analysis of randomised
controlled trials. BMJ 341:c4543
 Chapter 16

Analysis of DNA Hypermethylation in Pancreatic Cancer

Using Methylation-Specific PCR and Bisulfite Sequencing
Bin Liu and Christian Pilarsky

Abstract
Pancreatic ductal adenocarcinoma (PDAC) is an aggressive tumor and the fourth common cause of cancer
death in the Western world. The lack of effective therapeutic strategies is attributed to the late diagnosis of
this disease. Methylation markers could improve early detection and help in the surveillance of PDAC after
treatment. Analysis of hypermethylation in the tumor tissue and tumor-derived exosomes might help to
identify new therapeutic strategies and aid in the understanding of the pathophysiological changes occur-
ring in pancreatic cancer. There are several methods for the detection of methylation events. Whereas
methylation-specific PCR (MSP-PCR) is the method of choice, the cost reductions in DNA sequencing
enables researchers to add bisulfite sequencing (BSS) to their repertoire if a small number of genes will be
tested in a larger set of patients’ samples. During the last years, several techniques to isolate and analyze
DNA methylation have been proposed, but DNA modification using sodium bisulfite is still the gold
standard.

Key words DNA hypermethylation, Pancreatic cancer, Methylation-specific PCR, Bisulfite sequenc-
ing, Plasma, Tissue samples

1 Introduction

Pancreatic cancer is still one of the most malignant and aggressive

types of cancer in humans with a very dismal prognosis. In the USA,
40,000 new cases are diagnosed each year, making pancreatic can-
cer the fourth male and the fifth female leading cause of cancer-
related deaths [1]. The most abundant form of exocrine pancreatic
cancer is ductal adenocarcinoma (PDAC) [2]. Over the last dec-
ades, only small improvements could be made in the therapy of this
disease, which is mainly due to the delayed appearance of symptoms
causing a late diagnosis. Approximately 85% of the patients show an
organ-overlapping growth of the tumor when the disease is discov-
ered and only the remaining patients have an opportunity for
curative surgical treatment. Therefore, the actual 5 year survival
rate after surgical resection is about 20%, and for all patients about

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_16,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

269
270 Bin Liu and Christian Pilarsky

7% [1]. Over the last years, chemotherapy of pancreatic cancer has

improved the survival of patients. Together with the successful
DNA sequencing projects, it has become clear that pancreatic
cancers patients can be classified into smaller subgroups which
might be more susceptible for certain types of disease
[3–5]. While the search for the best early detection markers of
pancreatic cancer is still ongoing, it has become clear that tumor-
derived exosomes might be extremely useful for pancreatic cancer
diagnostics [6, 7]. Exosomes contain different cellular macromole-
cules and therefore also DNA [8], making it feasible to interrogate
methylation from DNA derived from Exosomes.
Epigenetics as an area of scientific research has been defined as
the study of heritable changes in gene expression without modifi-
cation of the underlying DNA sequence [9]. As they are remem-
bered with cell divisions, these modifications are referred to as
non-DNA sequence-based heritability. Epigenetic regulations are
important mechanisms and include DNA methylation, histone
modification, chromatin remodeling, and noncoding ribonucleic
acids. These epigenetic regulations can alter chromatin structure
and promoter accessibility, and thus lead to aberrant gene expres-
sion. DNA methylation is one of the key mechanisms of epigenetic
regulation in pancreatic cancer. DNA hypermethylation of the
coding areas of the human genome is a hallmark in cancer develop-
ment and was identified in a series of landmark investigations in the
late twentieth century [10, 11]. Since then DNA hypermethylation
has been investigated in nearly all cancers, and it has been shown
that DNA hypermethylation might be a useful tumor marker
[11]. Moreover, based on data analysis, it has been assumed that
hypermethylation of genes might be an early event in tumorigenesis
[12]. DNA hypermethylation of tumor suppressor gene promoters
is thought to be a major epigenetic mechanism in tumorigenesis. It
is carried out by the only known enzymes, DNA methyltransferases
(DNMTs). There are three active mammalian DNMTs (DNMT1,
DNMT3A, and DNMT3B) and one regulatory protein
(DNMT3L) [13]. Evidence has emerged that there is an inverse
correlation between DNA methylation and histone H3K4 methyl-
ation, and a strong correlation between DNA methylation and
H3K36me3, the latter one suggesting that DNMTs can recognize
histone modifications and be recruited to specific
nucleosomes [14].
Hypermethylation has been shown to occur already in pancre-
atic intraepithelial neoplasia (PaNIN) lesions indicating that epige-
netic changes might be interesting candidates for the development
of early diagnosis marker [15, 16]. Methylation marker candidates
might be identified in different ways, either directly by using small
scale analysis of the methylome [17, 18] or by bioinformatics
analysis of gene expression data, linking the observed under expres-
sion of genes with data from other sources. Next generation
 Analysis of DNA Hypermethylation in Pancreatic Cancer Using Methylation. . . 271

sequencing provides a new approach into the methylome for the

identification of new markers and insight into the basic changes of
tumor development [19–21]. Since sequencing of the complete
human methylome is still cost and time intensive, other large-
scale methods for the detection of promoter methylation can be
used to characterize the methylome of tumor cells. Illumina’s
Infinium HumanMethylation450 BeadChip is now the method of
choice to investigate the methylation status for over 450,000 sites
[22–24]. The availability of such tools for the large-scale character-
ization leads to the need of post discovery validation of the identi-
fied methylated sites. This validation can be done by different
techniques, but MSP-PCR and BSS remain quick and easy methods
for such purposes.
In pancreatic cancer several studies have investigated hyper-
methylation in tumor tissue and body fluids revealing more than
100 possible marker genes available for testing in different settings
[15, 25–42]. Genome-wide studies of CpG islands have uncovered
thousands of loci where differential methylation can segregate pan-
creatic tumor tissue from normal tissue. However, most of these
studies have focused on the methylation status of promoters and
CpG islands, but few on the changes of DNA methylation for
predicting pancreatic patient survival state. However, first studies
could show that hypermethylation of CpG sites of the gene
FAM150A correlated with aggressive cancer and poor survival in
pancreatic cancer [43, 44]. Still, a major impediment is the low
number of primary samples analyzed. Therefore, new studies are
needed to investigate these markers in a large number of samples of
PDAC, other form of pancreatic cancers, and chronic pancreatitis
to establish reliable methylation markers for early diagnosis, clinical
monitoring, and prognosis.

2 Materials

2.1 Tissue 1. PDAC tissue can be used from different sources like fresh frozen
and Exosomes or formalin fixed paraffin embedded. However, due to the het-
erogeneity of PDAC it is of outmost importance that each tissue
sample should be evaluated by a trained pathologist.
2. Blood plasma for the preparation of exosomes can be obtained
easily from patients during routine blood draws. It is critical that
the plasma is free from white blood cells. It is recommended that
the plasma should be centrifuged twice before storage.

2.2 Isolation 1. QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany).

and Modification 2. QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany).
of DNA
3. Total Exosome Isolation Reagent (available in special composi-
tions for cell culture media, serum, and plasma) (Thermo Fisher
Scientific, Darmstadt, Germany).
272 Bin Liu and Christian Pilarsky

4. EZ DNA Methylation-Gold Kit (Zymo Research, Orange, CA,

USA). In recent years this technology has become the mainstay
for methylation analysis and the EZ DNA Methylation-Gold Kit
has been the best performer.

2.3 PCR For primer design several tools are available. However, we have had
our best experience with MethPrimer (http://www.urogene.org/
methprimer/index1.html). MethPrimer enables the researcher to
select primers either for MSP-PCR or BSS. Another option is the
usage of already described primer combinations. It might be feasi-
ble to use the computational modified DNA, i.e., from Methprimer
to generate own primers with the use of other programs in which
the parameter can be better controlled like Primer 3 (http://
bioinfo.ut.ee/primer3-0.4.0/primer3/input.htm). To identify
the ideal sequence for PCR it might also be worthwhile to analyze
the primers and the target sequences with a methBLAST (http://
medgen.ugent.be/methBLAST/) to identify sequence homolo-
gies. All primers should be tested on fully methylated DNA,
which can be obtained from Millipore (Billerica, MA, USA).
For all the experiments routine lab ware is needed, but the
source is not of important as long as a Tier1 provider is chosen.
The performance of enzymes, chemicals, plasticware, and equip-
ment from such high-quality providers is nearly identical. Beware of
your source of water; sloppily prepared water is the number one
cause of contamination in reactions and therefore the number one
reason why experiments fail. Performing a large number of PCR
experiments requires high standard of cleanliness to reduce the risk
of cross-contaminants to a bare minimum.

3 Method

3.1 DNA-Isolation 1. Add 200 μl Plasma to the microcentrifuge tube. If the sample
from Plasma volume is less than 200 μl, add the appropriate volume of PBS
(see Note 1).
2. Add 200 μl Buffer AL to the sample. Mix thoroughly by pulse-
vortexing for 15 s.
3. Incubate at 56
C for 10 min.
4. Add 200 μl ethanol (96–100%) to the sample and mix again by
pulse-vortexing for 15 s. After mixing, briefly centrifuge the
1.5 ml microcentrifuge tube to remove drops from the inside
of the lid (see Note 2).
5. Carefully apply the mixture from step 5 to the QIAamp Mini
spin column (in a 2 ml collection tube) without wetting the rim.
Close the cap, and centrifuge at 6000  g for 1 min. Place the
QIAamp Mini spin column in a clean 2 ml collection tube
(provided), and discard the tube containing the filtrate (see
Note 3).
 Analysis of DNA Hypermethylation in Pancreatic Cancer Using Methylation. . . 273

6. Open the QIAamp Mini spin column and add 500 μl Buffer
AW1 without wetting the rim. Close the cap and centrifuge at
6000  g for 1 min. Place the QIAamp Mini spin column in a
clean 2 ml collection tube, and discard the collection tube con-
taining the filtrate.
7. Carefully open the QIAamp Mini spin column and add 500 μl
Buffer AW2 without wetting the rim. Close the cap and centri-
fuge at 20,000  g for 3 min.
8. Place the QIAamp Mini spin column in a new 2 ml collection
tube (not provided) and discard the old collection tube with the
filtrate. Centrifuge at 20,000  g for 1 min.
9. Place the QIAamp Mini spin column in a clean 1.5 ml micro-
centrifuge tube and discard the collection tube containing the
filtrate. Carefully open the QIAamp Mini spin column and add
200 μl Buffer AE or distilled water. Incubate at room tempera-
ture (15–25
C) for 1 min, and then centrifuge at 6000  g for
1 min (see Note 4).

3.2 DNA-Isolation 1. Excise the tissue sample or remove it from storage. Determine
from Frozen or the amount of tissue. Do not use more than 25 mg (see Note 5).
Formalin Fixed 2. If samples are large, mechanically disrupt the tissue sample (see
Paraffin Embedded Note 6).
Tissue 3. Add 20 μl proteinase K (from the QIAamp® DNA Mini Kit),
mix by vortexing, and incubate at 56
C until the tissue is
completely lysed. Vortex occasionally during incubation to dis-
perse the sample, or place in a shaking water bath or on a rocking
platform (see Note 7).
4. Briefly centrifuge the 1.5 ml microcentrifuge tube to remove
drops from the inside of the lid.
5. Add 200 μl Buffer AL to the sample, mix by pulse-vortexing for
15 s, and incubate at 70
C for 10 min. Briefly centrifuge the
1.5 ml microcentrifuge tube to remove drops from inside the lid.
It is essential that the sample and Buffer AL are mixed thor-
oughly to yield a homogeneous solution.
6. Add 200 μl ethanol (96–100%), mix by pulse-vortexing for 15 s.
After mixing, briefly centrifuge the 1.5 ml microcentrifuge tube
to remove drops from inside the lid. Follow the protocol for
plasma DNA isolation from step 6.

3.3 DNA-Isolation For the isolation of Exosomes, the Total Exosome Isolation
from Exosomes Reagent (available in special compositions for cell culture media,
serum, and plasma) can be used. This enables a quick and easy
isolation of Exosomes for various means (see Note 8).
1. Harvest cell culture media.
2. Centrifuge the cell media at 2000  g for 30 min to remove
cells and debris.
274 Bin Liu and Christian Pilarsky

3. Transfer the supernatant containing the cell-free culture media

to a new tube without disturbing the pellet.
4. Transfer the 1 volume of cell-free culture media to a new tube
and add 0.5 volumes of the Total Exosome Isolation (from cell
culture media) reagent.
5. Mix the culture media–reagent mixture well by vortexing, or
pipetting up and down until there is a homogenous solution.
6. Incubate samples at 2–8
C overnight.
7. After incubation, centrifuge the samples at 10,000  g for 1 h
at 2–8
C.
8. Aspirate and discard the supernatant. Exosomes are contained
in the pellet at the bottom of the tube (not visible in most
cases).
9. Resuspend the pellet in a convenient volume of 1 PBS or
similar buffer. The Exosomes are now ready for downstream
applications (see Note 9).
10. Pipet 25 μl QIAGEN Protease into a 1.5 ml microcentrifuge
tube (see Note 10).
11. Add 200 μl of Exosome containing PBS from step 9 into the
microcentrifuge tube.
12. Add 200 μl Buffer AL (containing 28 μg/ml of carrier RNA).
Close the cap and mix by pulse-vortexing for 15 s (see
Note 11).
13. Incubate at 56
C for 15 min in a heating block.
14. Add 250 μl of precooled ethanol (96–100%) to the sample,
close the cap and mix thoroughly by pulse-vortexing for 15 s.
Incubate the lysate with the ethanol for 5 min at room temper-
ature (15–25
C).
15. Carefully apply all of the lysate from step 14 onto the QIAamp
MinElute column without wetting the rim. Close the cap and
centrifuge at 6000  g (8000 rpm) for 1 min. Place the
QIAamp MinElute column in a clean 2 ml collection tube,
and discard the collection tube containing the filtrate.
16. Carefully open the QIAamp MinElute column, and add 500 μl
of Buffer AW1 without wetting the rim. Close the cap and
centrifuge at 6000  g for 1 min. Place the QIAamp MinElute
column in a clean 2 ml collection tube, and discard the collec-
tion tube containing the filtrate.
17. Carefully open the QIAamp MinElute column, and add 500 μl
of Buffer AW2 without wetting the rim. Close the cap and
centrifuge at 6000  g for 1 min. Place the QIAamp MinElute
column in a clean 2 ml collection tube, and discard the collec-
tion tube containing the filtrate.
 Analysis of DNA Hypermethylation in Pancreatic Cancer Using Methylation. . . 275

18. Carefully open the QIAamp MinElute column and add 500 μl
of ethanol (96–100%) without wetting the rim. Close the cap
and centrifuge at 6000  g (8000 rpm) for 1 min. Discard the
collection tube containing the filtrate (see Note 12).
19. Place the QIAamp MinElute column in a clean 2 ml collection
tube. Centrifuge at full speed (20,000  g) for 3 min to dry the
membrane completely.
20. Place the QIAamp MinElute column into a new 2 ml collection
tube, open the lid, and incubate the assembly at 56
C for
3 min to dry the membrane completely.
21. Place the QIAamp MinElute column in a clean 1.5 ml micro-
centrifuge tube, and discard the collection tube with the fil-
trate. Carefully open the lid of the QIAamp MinElute column,
and apply 20–150 μl of Buffer AVE or RNase-free water to the
center of the membrane. Close the lid and incubate at room
temperature for 1 min. Centrifuge at full speed (20,000  g)
for 1 min (see Note 13). The DNA is now ready for down-
stream applications.

3.4 Bisulfite For the bisulfite modification, samples containing 500 pg to 2 μg of

Modification DNA can be used. For optimal results, the amount of input DNA
should be from 200 to 500 ng.
1. Determine the concentration of the DNA you have prepared
using a photometer to determine the absorbance at 260 nm.
2. Prepare the conversion Reagent. Add 900 μl water, 300 μl of
M-Dilution buffer, and 50 μl M-Dissolving buffer to a tube of
CT conversion reagent.
3. Mix at room temperature with frequent vortexing or shaking
for 10 min. Note: It is normal to see trace amounts of undis-
solved reagent in the CT conversion reagent (see Note 14).
4. Preparation of M-Wash Buffer—Add 24 ml of 100% ethanol to
the 6 ml M-Wash buffer concentrate (D5005) or 96 ml of
100% ethanol to the 24 ml M-Wash buffer concentrate
(D5006) before use.
5. Add 130 μl of the CT conversion reagent to 20 μl of your DNA
sample in a PCR tube.
Place the sample tube in a thermal cycler and perform the
following steps (see Note 15):
98
C for 10 min.
64
C for 2.5 h.
4
C storage up to 20 h.
6. Add 600 μl of M-Binding buffer to a Zymo-Spin IC Column
and place the column into a provided collection tube.
276 Bin Liu and Christian Pilarsky

7. Load the sample (from step 2) into the Zymo-SpinTM IC

Column containing the M-Binding buffer. Close the cap and
mix by inverting the column several times.
8. Centrifuge at 20,000  g for 30 s. Discard the flow-through.
9. Add 100 μl of M-Wash buffer to the column. Centrifuge at
20,000  g for 30 s.
10. Add 200 μl of M-Desulfonation buffer to the column and let
stand at room temperature (20–30
C) for 15–20 min. After
the incubation, centrifuge at 20,000  g for 30 s.
11. Add 200 μl of M-Wash buffer to the column. Centrifuge at
20,000  g for 30 s. Add another 200 μl of M-Wash buffer and
centrifuge at 20,000  g for an additional 30 s.
12. Place the column into a 1.5 ml microcentrifuge tube. Add 10 μl
of M-Elution buffer directly to the column matrix. Centrifuge
for 30 s at 20,000  g to elute the DNA (see Note 16).

3.5 Results We have isolated, modified and amplified DNA from the various
sources including formalin fixed paraffin embedded (FFPE) tissue
from 15 years ago. We were also able to demonstrate the changes in
methylated genes between different types of pancreatic cancer
[45]. It is however easier to use DNA isolated from frozen tissue,
since the DNA quality is higher even after long time storage.
We have compared the results of the methylation of the
ZNF154 promotor site from DNA isolated from the Panc-1 cell
line and Exosomes derived from it (see Fig. 1).

4 Notes

1. To avoid the lysis of white blood cells in the samples several

precautions have to be made. The plasma should be drawn
using a Vacutainer and can be stored up to 4 h before centrifu-
gation. The centrifugation should be performed at þ4
C
without brakes. Plasma should be centrifuged twice and aspira-
tion of cells should be avoided. It is possible to add QIAGEN
Protease (or proteinase K) to samples that have already been
dispensed into microcentrifuge tubes. In this case, it is impor-
tant to ensure proper mixing after adding the enzyme.
2. If the sample volume is larger than 200 μl, increase the amount
of QIAGEN Protease (or proteinase K), Buffer AL and Ethanol
proportionally. Do not add QIAGEN Protease or proteinase K
directly to Buffer AL. Close each spin column in order to avoid
aerosol formation during centrifugation.
3. Incubating the QIAamp Mini spin column loaded with Buffer
AE or water for 5 min at room temperature before centrifuga-
tion generally increases DNA yield. A second elution step with
Fig. 1 Results from BSS of the ZNF154 promoter from Panc-1 cell line nuclear genomic DNA (upper panel) and
exomic DNA (lower panel). Ten bacterial clones were sequenced to cover part of the CpG island of the ZNF154
promoter. Interestingly, not all methylation events observed in the nuclear genomic DNA can be found in the
exomic DNA. Therefore, primers for MSP have to be designed for the amplification of the DNA of interest
278 Bin Liu and Christian Pilarsky

a further 200 μl Buffer AE will increase yields by up to 15%.

Volumes of more than 200 μl should not be eluted into a 1.5 ml
microcentrifuge tube because the spin column will come into
contact with the eluate, leading to possible aerosol formation
during centrifugation. Elution with volumes of less than 200 μl
increases the final DNA concentration in the eluate signifi-
cantly, but slightly reduces the overall DNA yield.
4. For long-term storage of DNA, eluting in Buffer AE and
storing at 20
C is recommended, since DNA stored in
water is subject to acid hydrolysis. UV spectroscopy is the
main method to determine DNA concentrations. However,
during purification of genomic DNA contaminants such as
RNA and small single stranded DNA are copurified. This will
lead to a high divergence in the measured concentration of the
DNA. If high-throughput techniques for methylation analysis
are used, the DNA concentration should be determined more
carefully. It is not sufficient to ascertain the DNA concentration
by UV spectroscopy. Instead a combination of gel electropho-
resis and Picogreen (Invitrogen, Carlsbad, CA) should be used.
5. The QIAamp DNA Mini Kit can also be used to isolate DNA
from fixed tissues. However, the length of DNA isolated from
fixed tissues is usually <650 bp, depending on the type and age
of the sample and the quality of the fixative used [46]. Use of
fixatives such as alcohol and formalin are recommended. Fixa-
tives that cause cross-linking, such as osmium tetroxide, are not
recommended as it can be difficult to obtain amplifiable DNA
from tissue fixed with these agents. Cut slices of the embedded
tissue and collect them in a 1.5 ml microcentrifuge tube and
proceed with step 3. It is not necessary to remove the paraffin
in advance since it will melt during the incubation at 56
C.
6. Some tissues require undiluted Buffer ATL for complete lysis.
In this case, grinding in liquid nitrogen is recommended. Sam-
ples cannot be homogenized directly in Buffer ATL, which
contains detergent.
7. Proteinase K must be used. QIAGEN Protease has reduced
activity in the presence of Buffer ATL. Lysis time varies
depending on the type of tissue processed. Lysis is usually
complete in 1–3 h. Lysis overnight is possible and does not
influence the preparation. In order to ensure efficient lysis, a
shaking water bath or a rocking platform should be used. If not
available, vortexing 2–3 times per hour during incubation is
recommended.
8. If you start with Exosomes from cell culture media, please be
aware of the Exosome free fetal bovine serum which can be
obtained from various sources. The method to prepare the
Analysis of DNA Hypermethylation in Pancreatic Cancer Using Methylation. . . 279

Exosomes is nearly identical between the different kits and we

give the example for preparation from cell cultures.
9. Keep isolated exosomes at 2–8
C for up to 1 week, or at
20
C for long-term storage.
10. To isolate DNA, use the QIAamp MinElute Virus Spin Kit.
11. In order to ensure efficient lysis, it is essential that the sample
and Buffer AL are mixed thoroughly to yield a homogeneous
solution. Do not add QIAGEN Protease direct to Buffer AL.
12. Ethanol carryover into the eluate may cause problems in down-
stream applications. Some centrifuge rotors may vibrate upon
deceleration, resulting in the flow-through, which contains
ethanol, contacting the QIAamp MinElute column. Removing
the QIAamp MinElute column and collection tube from the
rotor may also cause flow-through to come into contact with
the QIAamp MinElute column.
13. Ensure that the elution buffer is equilibrated to room temper-
ature. If elution is done in small volumes (<50 μl), the elution
buffer must be dispensed onto the center of the membrane for
complete elution of bound RNA and DNA.
14. Each tube of CT Conversion Reagent is designed for ten
separate DNA treatments. Storage: The CT Conversion
Reagent is light sensitive; so minimize its exposure to light.
For best results, the CT Conversion Reagent should be used
immediately following preparation. If not used immediately,
the CT Conversion Reagent solution can be stored overnight
at room temperature, one week at 4
C, or up to 1 month at
20
C. Stored CT Conversion Reagent solution must be
warmed to 37
C, then vortexed prior to use. Do not use old
Conversion reagent.
15. For DNA volumes >20 μl, an adjustment needs to be made
during the preparation of the CT Conversion Reagent. The
amount of water is decreased 100 μl for each 10 μl increase in
DNA sample volume. For example, for a 40 μl DNA sample,
700 μl of water is added to make the CT Conversion Reagent.
The maximum DNA sample volume to be used for each con-
version reaction is 50 μl. Do not adjust the volumes of either
the M-Dissolving Buffer or M-Dilution Buffer. The capacity of
the collection tube with the column inserted is 800 μl. Empty
the collections tube whenever necessary to prevent contamina-
tion of the column contents by the flow-through. Alternatively,
water or TE (pH  6.0) can be used for elution if required for
your experiments.
16. The DNA is ready for immediate analysis or can be stored at or
below 20
C for later use. For long-term storage, store at or
below 70
C. We recommend using 1–4 μl of eluted DNA for
280 Bin Liu and Christian Pilarsky

each PCR, however, up to 10 μl can be used if necessary. The

elution volume can be >10 μl depending on the requirements
of your experiments, but small elution volumes will yield more
concentrated DNA. Do not store the modified DNA for a
longer time, since it tends to degrade. We have obtained our
best results with modified DNA stored for less than a month at
20
C.

Acknowledgments

Thanks to Alfred E. Neumann for fruitful discussions.

References

1. Siegel RL, Miller KD, Jemal A (2016) Cancer
statistics, 2016. CA Cancer J Clin 66(1):7–30
2. Schneider G, Siveke JT, Eckel F, Schmid RM
(2005) Pancreatic cancer: basic and clinical
aspects. Gastroenterology 128(6):1606–1625
3. Bailey P, Chang DK, Nones K, Johns AL, Patch
AM, Gingras MC, Miller DK, Christ AN,
Bruxner TJ, Quinn MC, Nourse C, Murtaugh
LC, Harliwong I, Idrisoglu S, Manning S,
Nourbakhsh E, Wani S, Fink L, Holmes O,
Chin V, Anderson MJ, Kazakoff S,
Leonard C, Newell F, Waddell N, Wood S,
Xu Q, Wilson PJ, Cloonan N, Kassahn KS,
Taylor D, Quek K, Robertson A, Pantano L,
Mincarelli L, Sanchez LN, Evers L, Wu J,
Pinese M, Cowley MJ, Jones MD, Colvin EK,
Nagrial AM, Humphrey ES, Chantrill LA,
Mawson A, Humphris J, Chou A, Pajic M,
Scarlett CJ, Pinho AV, Giry-Laterriere M,
Rooman I, Samra JS, Kench JG, Lovell JA,
Merrett ND, Toon CW, Epari K, Nguyen
NQ, Barbour A, Zeps N, Moran-Jones K,
Jamieson NB, Graham JS, Duthie F, Oien K,
Hair J, Grutzmann R, Maitra A, Iacobuzio-
Donahue CA, Wolfgang CL, Morgan RA,
Lawlor RT, Corbo V, Bassi C, Rusev B,
Capelli P, Salvia R, Tortora G,
Mukhopadhyay D, Petersen GM, Australian
Pancreatic Cancer Genome I, Munzy DM,
Fisher WE, Karim SA, Eshleman JR, Hruban
RH, Pilarsky C, Morton JP, Sansom OJ,
Scarpa A, Musgrove EA, Bailey UM,
Hofmann O, Sutherland RL, Wheeler DA,
Gill AJ, Gibbs RA, Pearson JV, Waddell N,
Biankin AV, Grimmond SM (2016) Genomic
analyses identify molecular subtypes of pancre-
atic cancer. Nature 531(7592):47–52
4. Conroy T, Desseigne F, Ychou M, Bouche O,
Guimbaud R, Becouarn Y, Adenis A, Raoul JL,
Gourgou-Bourgade S, de la Fouchardiere C,
Bennouna J, Bachet JB, Khemissa-Akouz F,
Pere-Verge D, Delbaldo C, Assenat E,
Chauffert B, Michel P, Montoto-Grillot C,
Ducreux M, Groupe Tumeurs Digestives
of U, Intergroup P (2011) FOLFIRINOX ver-
sus gemcitabine for metastatic pancreatic can-
cer. N Engl J Med 364(19):1817–1825
5. Von Hoff DD, Ervin T, Arena FP, Chiorean
EG, Infante J, Moore M, Seay T, Tjulandin SA,
Ma WW, Saleh MN, Harris M, Reni M,
Dowden S, Laheru D, Bahary N, Ramanathan
RK, Tabernero J, Hidalgo M, Goldstein D, Van
Cutsem E, Wei X, Iglesias J, Renschler MF
(2013) Increased survival in pancreatic cancer
with nab-paclitaxel plus gemcitabine. N Engl J
Med 369(18):1691–1703
6. Melo SA, Luecke LB, Kahlert C, Fernandez
AF, Gammon ST, Kaye J, LeBleu VS, Mitten-
dorf EA, Weitz J, Rahbari N, Reissfelder C,
Pilarsky C, Fraga MF, Piwnica-Worms D, Kal-
luri R (2015) Glypican-1 identifies cancer exo-
somes and detects early pancreatic cancer.
Nature 523(7559):177–182
7. Madhavan B, Yue S, Galli U, Rana S, Gross W,
Muller M, Giese NA, Kalthoff H, Becker T,
Buchler MW, Zoller M (2015) Combined eval-
uation of a panel of protein and miRNA serum-
exosome biomarkers for pancreatic cancer
diagnosis increases sensitivity and specificity.
Int J Cancer 136(11):2616–2627
8. Yang S, Che SP, Kurywchak P, Tavormina JL,
Gansmo LB, Correa de Sampaio P, Tachezy M,
Bockhorn M, Gebauer F, Haltom AR, Melo
SA, LeBleu VS, Kalluri R (2017) Detection of
mutant KRAS and TP53 DNA in circulating
exosomes from healthy individuals and patients
with pancreatic cancer. Cancer Biol Ther 18
(3):158–165
9. Karpathakis A, Dibra H, Thirlwell C (2013)
Neuroendocrine tumours: cracking the
 Analysis of DNA Hypermethylation in Pancreatic Cancer Using Methylation. . .
epigenetic code. Endocr Relat Cancer 20(3):
R65–R82
10. Nakhasi HL, Lynch KR, Dolan KP, Unterman
RD, Feigelson P (1981) Covalent modification
and repressed transcription of a gene in hepa-
toma cells. Proc Natl Acad Sci U S A 78
(2):834–837
11. Kulis M, Esteller M (2010) DNA methylation
and cancer. Adv Genet 70:27–56
12. Wissmann C, Wild PJ, Kaiser S, Roepcke S,
Stoehr R, Woenckhaus M, Kristiansen G,
Hsieh J-C, Hofstaedter F, Hartmann A,
Knuechel R, Rosenthal A, Pilarsky C (2003)
WIF1, a component of the Wnt pathway, is
down-regulated in prostate, breast, lung, and
bladder cancer. J Pathol 201(2):204–212
13. Denis H, Ndlovu MN, Fuks F (2011) Regula-
tion of mammalian DNA methyltransferases: a
route to new mechanisms. EMBO Rep 12
(7):647–656
14. Hodges E, Smith AD, Kendall J, Xuan Z,
Ravi K, Rooks M, Zhang MQ, Ye K,
Bhattacharjee A, Brizuela L, McCombie WR,
Wigler M, Hannon GJ, Hicks JB (2009) High
definition profiling of mammalian DNA meth-
ylation by array capture and single molecule
bisulfite sequencing. Genome Res 19
(9):1593–1605
15. Dutruel C, Bergmann F, Rooman I,
Zucknick M, Weichenhan D, Geiselhart L,
Kaffenberger T, Rachakonda PS, Bauer A,
Giese N, Hong C, Xie H, Costello JF,
Hoheisel J, Kumar R, Rehli M,
Schirmacher P, Werner J, Plass C, Popanda O,
Schmezer P (2013) Early epigenetic downre-
gulation of WNK2 kinase during pancreatic
ductal adenocarcinoma development. Onco-
gene. https://doi.org/10.1038/onc.2013.
312
16. Sato N, Fukushima N, Hruban RH, Goggins
M (2008) CpG island methylation profile of
pancreatic intraepithelial neoplasia. Mod
Pathol 21(3):238–244
17. Lofton-Day C, Model F, Devos T, Tetzner R,
Distler J, Schuster M, Song X, Lesche R,
Liebenberg V, Ebert M, Molnar B,
Grützmann R, Pilarsky C, Sledziewski A
(2008) DNA methylation biomarkers for
blood-based colorectal cancer screening. Clin
Chem 54(2):414–423
18. Tan AC, Jimeno A, Lin SH, Wheelhouse J,
Chan F, Solomon A, Rajeshkumar NV,
Rubio-Viqueira B, Hidalgo M (2009) Charac-
terizing DNA methylation patterns in pancre-
atic cancer genome. Mol Oncol 3
(5–6):425–438
281
19. Murphy PJ, Cipriany BR, Wallin CB, Ju CY,
Szeto K, Hagarman JA, Benitez JJ, Craighead
HG, Soloway PD (2013) Single-molecule anal-
ysis of combinatorial epigenomic states in nor-
mal and tumor cells. Proc Natl Acad Sci U S A
110(19):7772–7777
20. Lister R, Pelizzola M, Dowen RH, Hawkins
RD, Hon G, Tonti-Filippini J, Nery JR,
Lee L, Ye Z, Ngo QM, Edsall L, Antosiewicz-
Bourget J, Stewart R, Ruotti V, Millar AH,
Thomson JA, Ren B, Ecker JR (2009)
Human DNA methylomes at base resolution
show widespread epigenomic differences.
Nature 462(7271):315–322
21. Stirzaker C, Taberlay PC, Statham AL, Clark SJ
(2013) Mining cancer methylomes: prospects
and challenges. Trends Genet. https://doi.
org/10.1016/j.tig.2013.11.004
22. Slieker RC, Bos SD, Goeman JJ, Bovée JV,
Talens RP, van der Breggen R, Suchiman
HED, Lameijer E-W, Putter H, van den
Akker EB, Zhang Y, Jukema JW, Slagboom
PE, Meulenbelt I, Heijmans BT (2013) Identi-
fication and systematic annotation of tissue-
specific differentially methylated regions using
the Illumina 450k array. Epigenetics Chroma-
tin 6(1):26
23. Sánchez-Vega F, Gotea V, Petrykowska HM,
Margolin G, Krivak TC, Deloia JA, Bell DW,
Elnitski L (2013) Recurrent patterns of DNA
methylation in the ZNF154, CASP8, and VHL
promoters across a wide spectrum of human
solid epithelial tumors and cancer cell lines.
Epigenetics 8(12)
24. Morris TJ, Butcher LM, Feber A, Teschendorff
AE, Chakravarthy AR, Wojdacz TK, Beck S
(2013) ChAMP: 450k chip analysis methyla-
tion pipeline. Bioinformatics. https://doi.org/
10.1093/bioinformatics/btt684
25. Wehrum D, Grützmann R, Hennig M, Saeger
H-D, Pilarsky C (2008) Recent patents
concerning diagnostic and therapeutic applica-
tions of aberrantly methylated sequences in
pancreatic cancer. Recent Pat DNA Gene Seq
2(2):97–106
26. Thun M, Jemal A, Desantis C, Blackard B,
Ward E (2009) An overview of the cancer bur-
den for primary care physicians. Prim Care 36
(3):439–454
27. Kuroki T, Yendamuri S, Trapasso F,
Matsuyama A, Aqeilan RI, Alder H, Rattan S,
Cesari R, Nolli ML, Williams NN, Mori M,
Kanematsu T, Croce CM (2004) The tumor
suppressor gene WWOX at FRA16D is
involved in pancreatic carcinogenesis. Clin
Cancer Res 10(7):2459–2465
282 Bin Liu and Christian Pilarsky
28. Zhao G, Qin Q, Zhang J, Liu Y, Deng S, Liu L,
Wang B, Tian K, Wang C (2013) Hypermethy-
lation of HIC1 promoter and aberrant expres-
sion of HIC1/SIRT1 might contribute to the
carcinogenesis of pancreatic cancer. Ann Surg
Oncol 20(Suppl 3):301–311
29. Yao F, Sun M, Dong M, Jing F, Chen B, Xu H,
Wang S (2013) NPTX2 hypermethylation in
pure pancreatic juice predicts pancreatic neo-
plasms. Am J Med Sci 346(3):175–180
30. Yang L, Yang H, Li J, Hao J, Qian J (2013)
ppENK gene methylation status in the devel-
opment of pancreatic carcinoma. Gastroenterol
Res Pract 2013:130927
31. Yamamura A, Miura K, Karasawa H,
Morishita K, Abe K, Mizuguchi Y, Saiki Y,
Fukushige S, Kaneko N, Sase T, Nagase H,
Sunamura M, Motoi F, Egawa S, Shibata C,
Unno M, Sasaki I, Horii A (2013) Suppressed
expression of NDRG2 correlates with poor
prognosis in pancreatic cancer. Biochem Bio-
phys Res Commun 441(1):102–107
32. Wang P, Chen L, Zhang J, Chen H, Fan J,
Wang K, Luo J, Chen Z, Meng Z, Liu L
(2013) Methylation-mediated silencing of the
miR-124 genes facilitates pancreatic cancer
progression and metastasis by targeting Rac1.
Oncogene. https://doi.org/10.1038/onc.
2012.598
33. Thu KL, Radulovich N, Becker-Santos DD,
Pikor LA, Pusic A, Lockwood WW, Lam WL,
Tsao M-S (2013) SOX15 is a candidate tumor
suppressor in pancreatic cancer with a potential
role in Wnt/β-catenin signaling. Oncogene.
https://doi.org/10.1038/onc.2012.595
34. Park JS, Park YN, Lee KY, Kim JK, Yoon DS
(2013) P16 hypermethylation predicts surgical
outcome following curative resection of mid/-
distal bile duct cancer. Ann Surg Oncol 20
(8):2511–2517
35. Zhao L, Cui Q, Lu Z, Chen J (2012) Aberrant
methylation of RASSF2A in human pancreatic
ductal adenocarcinoma and its relation to clini-
copathologic features. Pancreas 41
(2):206–211
36. Zhang L, Gao J, Li Z, Gong Y (2012) Neuro-
nal pentraxin II (NPTX2) is frequently down-
regulated by promoter hypermethylation in
pancreatic cancers. Dig Dis Sci 57
(10):2608–2614
37. Wu Y, Li J, Sun CY, Zhou Y, Zhao YF, Zhang
SJ (2012) Epigenetic inactivation of the canon-
ical Wnt antagonist secreted frizzled-related
protein 1 in hepatocellular carcinoma cells.
Neoplasma 59(3):326–332
38. Li M, Zhao ZW (2012) Clinical implications of
mismatched repair gene promoter methylation
in pancreatic cancer. Med Oncol 29
(2):970–976
39. Hong S-M, Omura N, Vincent A, Li A,
Knight S, Yu J, Hruban RH, Goggins M
(2012) Genome-wide CpG island profiling of
intraductal papillary mucinous neoplasms of
the pancreas. Clin Cancer Res 18(3):700–712
40. Heichman KA, Warren JD (2012) DNA meth-
ylation biomarkers and their utility for solid
cancer diagnostics. Clin Chem Lab Med 50
(10):1707–1721
41. Giovannetti E, Erozenci A, Smit J, Danesi R,
Peters GJ (2012) Molecular mechanisms
underlying the role of microRNAs (miRNAs)
in anticancer drug resistance and implications
for clinical practice. Crit Rev Oncol Hematol
81(2):103–122
42. Park JK, Ryu JK, Yoon WJ, Lee SH, Lee GY,
Jeong K-S, Kim Y-T, Yoon YB (2012) The role
of quantitative NPTX2 hypermethylation as a
novel serum diagnostic marker in pancreatic
cancer. Pancreas 41(1):95–101
43. Mishra NK, Guda C (2017) Genome-wide
DNA methylation analysis reveals molecular
subtypes of pancreatic cancer. Oncotarget.
https://doi.org/10.18632/oncotarget.15993
44. Thompson MJ, Rubbi L, Dawson DW, Dona-
hue TR, Pellegrini M (2015) Pancreatic cancer
patient survival correlates with DNA methyla-
tion of pancreas development genes. PLoS One
10(6):e0128814
45. Biewusch K, Heyne M, Grützmann R, Pilarsky
C (2012) DNA methylation in pancreatic can-
cer: protocols for the isolation of DNA and
bisulfite modification. Methods Mol Biol
863:273–280
46. Resnick RM, Cornelissen MT, Wright DK,
Eichinger GH, Fox HS, ter Schegget J,
Manos MM (1990) Detection and typing of
human papillomavirus in archival cervical can-
cer specimens by DNA amplification with con-
sensus primers. J Natl Cancer Inst 82
(18):1477–1484
 Chapter 17

Pyrosequencing Methylation Analysis

Matthew Poulin, Jeffrey Y. Zhou, Liying Yan, and Toshi Shioda

Abstract
Pyrosequencing, a real-time sequencing technology, is considered a “gold standard” for quantitative allele
quantification at single base resolution. Quantitative bisulfite Pyrosequencing determines DNA methyla-
tion level by analyzing artificial “C/T” SNPs at CpG sites within a specific Pyrosequencing assay. The
bisulfite Pyrosequencing methylation assay design is DNA strand specific and the primer design should not
contain any CpG sites and should be free of high-frequency mutations. Additionally Pyrosequencing assays
must be tested for preferential amplification during bisulfite PCR to ensure the sequencing quantification
accuracy and reproducibility. Pyrosequencing analysis gives a reproducible measurement of average meth-
ylation at several CpG sites within the Pyrosequencing assay directly from a PCR product, rapidly and
accurately for many samples at a time. It is therefore well suited for clinical research, validation of whole-
genome methylation screening results, and global methylation analysis using repetitive elements including
LINE-1, Alu, and Sat2. Pyrosequencing reproducibility and accuracy result in low measurement variance,
thereby increasing the likelihood of early detection of small changes in methylation levels that may become
apparent in response to treatment. For example, the high reproducibility of the LINE-1 assay is important
for detecting the relatively small daily changes in methylation levels associated with hypomethylation. This
enables detection of differences in patterns between normal and disease tissue such as in tumor suppresser
genes, and to determine global methylation changes in response drug treatments. Relatively low cost and
easy automation allows the researcher to increase the experiment’s sample population to detect trends that
would otherwise not have a sufficient sampling basis for statistical significance.

Key words DNA methylation, Pyrosequencing, Bisulfite PCR, Whole-genome methylation, Hypo-
methylation, Tumor suppressor genes, Response to drug treatment

1 Introduction

Pyrosequencing is a second-generation DNA sequencing method

first developed in the 1990s utilizing the sequencing-by-synthesis
principle [1]. “Pyro-”, meaning “light” in Greek, refers to the
technology’s basis in the real-time stoichiometric detection of
light released by the iterative addition of synthetic nucleotides to
a template strand. This feature positions Pyrosequencing technol-
ogy well for quantitative applications such as determining allele
frequencies in heterogeneous samples [2]. Bisulfite Pyrosequencing

Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1_17,
© Springer Science+Business Media, LLC, part of Springer Nature 2018

283
284 Matthew Poulin et al.

is one particular application that allows for the proportional mea-

surement of DNA methylation at a single base resolution in a
genomic locus, and is regarded by many to be the “gold standard”
for quantitative DNA methylation analysis [3].
Despite the rising popularity of high-throughput next-genera-
tion sequencing technologies and whole-genome methods of
methylation analysis (e.g., WGBS, RRBS, array-based methyla-
tion), current technological limitations, lack of concordance
among different whole-genome methylation analysis platforms
[4], complications in data normalization, bias correction, batch
effect, and statistical analysis model selection for differentially
methylated individual CpGs and regions often necessitates valida-
tion of results [5]. At the present day, validation of results generated
by whole-genome methylation studies has an important role ful-
filled by bisulfite Pyrosequencing due to the technology’s relative
convenience, high reproducibility, and cost-effectiveness.
This chapter begins with a discussion of the basic science of
Pyrosequencing. Then, we move on to discuss the application of
Pyrosequencing technology to DNA methylation analysis, examine
nuances of designing a Pyrosequencing methylation assay, and
discuss common pitfalls. Finally, we give some case studies and
clinical applications of how bisulfite Pyrosequencing is being used
to answer questions about methylation and disease.

2 Principle of Pyrosequencing Technology

Pyrosequencing is a real-time sequence-by-synthesis technology.

To determine a DNA sequence, an enzymatic cascade reaction
generates a light signal (Relative Light Unit—RLU) upon incor-
poration of a nucleotide. Synthetic deoxynucleotides are dispensed
iteratively by the pyrosequencer in a preprogrammed sequence, and
upon addition of a complementary nucleotide by Klenow DNA
polymerase, the sequencing primer is extended and an inorganic
pyrophosphate (PPi) is released (Fig. 1). ATP sulfurylase is then
used to convert the PPi to ATP which is then used by firefly
luciferase to generate light [2]. This is a stoichiometric reaction
and the number of photons produced is proportional to the num-
ber of PPi produced and hence the number of incorporated nucleo-
tides. Unincorporated nucleotides are degraded with apyrase
before the next nucleotide is added. In this way, the sequence
information on an interrogated region is generated quantitatively
in a real-time manner (Fig. 1).
The released light is captured by a CCD camera in the pyrose-
quencer machine, and the magnitude of light (RLU) is recorded
upon each dispensation cycle and plotted on a Pyrogram™. In the
situation where a SNP is present in the sequence, signal from the
wild-type allele decreases while signal from the variant allele
 Pyrosequencing Methylation Analysis 285

Fig. 1 Principle of Pyrosequencing—generation of pyrogram

increases stoichiometrically. The allele frequencies of each variant

are determined by the machine software by measuring the relative
peak heights on the Pyrogram™ and calculating the ratio between
both alleles.
Typical sample preparation for general Pyrosequencing experi-
ment consists of a single round of DNA amplification by PCR. The
ideal length of a target amplicon is between 100 and 250 base pairs,
and one of the PCR primers must be biotinylated to permit capture
during Pyrosequencing sample preparation. The Pyrosequencing
step itself requires the PCR product and sequencing primer, and
the duration of a typical sequencing run is between 20 min to an
hour, depending on the length of the PCR product and number of
nucleotide dispensations needed.

3 Methods of Bisulfite Pyrosequencing

3.1 Overview Bisulfite Pyrosequencing is a special application of Pyrosequencing

technology that allows for the measurement of percent methylation
of each CpG site in a PCR amplicon. This is accomplished by
chemically transforming each CpG site into an artificial C/T SNP
based on methylation status, and effectively performing allele-
specific quantification to determine what fraction of the sample is
methylated or unmethylated at each given CpG site.
286 Matthew Poulin et al.

mC mC
1. Bisulfite conversion
C U
2. PCR amplification
mC C
3. Pyrosequencing U T

Degree of methylation is
analyzed as a ”C/T SNP” 75%
25%
using the AQ mode in the
software
C% = C/(C+T)

C T

Fig. 2 Determination of percent methylation in Pyrosequencing

In detail, CpG sites of genomic DNA are first chemically con-

verted by sodium bisulfite modification and then amplified by PCR.
In this process, cytosine is converted to uracil (U), whereas methy-
lated cytosine (5mC) is protected by the methyl group and remains
unchanged. In the subsequent PCR, uracil is amplified and turned
into thymine (T), and 5mC is amplified as C. In the Pyrogram™,
5mC and C are therefore represented as C and T peaks, respectively.
These peak heights are proportional to the number of methylated
alleles at each CpG site (Fig. 2). The methylation level at each CpG
site being sequenced is calculated as the percentage of the methy-
lated alleles divided by the sum of all methylated and unmethylated
alleles. The mean methylation level is calculated using methylation
levels of all measured CpG sites within the targeted region of each
gene.

3.2 Assay Design Pyrosequencing assays are based on the PCR amplification of a
specific region of DNA. These assays can focus upon single nucleo-
tide polymorphisms (SNPs) in unmodified genomic DNA, or upon
CpG sites in bisulfite-treated DNA. Bisulfite Pyrosequencing assay
is strand-specific, and its sequencing window for quantitative deter-
mination of DNA methylation is typically 150–250 nucleotides
wide. When designing Pyrosequencing assays for methylation anal-
ysis, two important considerations must be taken into account.
The first is that CpG sites should be avoided when designing
the amplification primers (yellow highlighted portion of Fig. 3).
Because the cytosine of the CpG site is treated as a C/T SNP, it will
vary depending on methylation status of the CpG site. Designing
PCR primers that contain CpG sites could lead to the preferential
amplification of either the methylated or unmethylated state of the
amplicon, thus causing PCR bias. This is more important for PCR
amplifying primers than sequencing primers. Sequencing primers
 Pyrosequencing Methylation Analysis 287

RPB (biotin
FP Seq
labelled primer)
Assay

Genomic DNA Sequence

TTTAGGGGCTCTTTGGTGAAGAGTTTTATGGCGTCAGAGAAGGGTTGTAGTAGCCCG
TAGGGGCCTACAACGTTGGGGCCTTTGCGTAGTTGTATATAGCCTAGAATTTTTCGT
TCGGTAAGCATTAGGAATGCCATTGCGATTAGAATGGGTACAATGAGGAGTAGG

Bisulfite Converted DNA Sequence

Fair Sequencing Primer Good Sequencing Primer
TTTAGGGGTTTTTTGGTGAAGAGTTTTATGGYGTTAGAGAAGGGTTGTAGTAGTTYG
TAGGGGTTTATAAYGTTGGGGTTTTTGYGTAGTTGTATATAGTTTAGAATTTTTYGT
TYGGTAAGTATTAGGAATGTTATTGYGATTAGAATGGGTATAATGAGGAGTAGG

Fig. 3 Pyrosequencing methylation assay design

may overlap with CpG sites in the 50 portion of primer, but care
must be taken to ensure that CpG sites are not present near the 30
portion of the sequencing primer, as this may more severely impact
the primers ability to hybridize to its sequence within the amplicon.
As long as the 30 region of the sequencing primer can form a strong
clamp to allow for extension by the DNA polymerase in the Pyr-
osequencing enzyme cocktail, a few mismatches in the 50 half of the
sequencing primer are tolerated.
Secondly, designing primers that contain non-CpG cytosines
help reduce the unwanted background of any unconverted cyto-
sines due to incomplete bisulfite conversion (bold and underlined
nucleotides in Fig. 3). Sodium bisulfite modification, as mentioned
above, is a thermodynamic chemical reaction. As with any chemical
reaction, no reaction will reach total 100% completion when equi-
librium is reached. There will always be a small fraction of the
cytosines that will not be converted. The degree to which this
occurs can affect the results to varying degrees depending on the
sensitivity one is trying to discern between individual samples. By
designing primers that contain thymidines that result from the
bisulfite conversion of non-CpG cytosines, one can reduce the
background of this small population of incompletely converted
DNA by preferentially amplifying the converted DNA. This is
especially useful when designing the Pyrosequencing primer. As
mentioned above, the 30 portion of the sequencing primer must
form a strong clamp onto the sequencing template for the DNA
polymerase to initiate the sequencing reaction. If sequencing pri-
mers are carefully designed with converted cytosines in the 30
portion of oligonucleotide, especially the 30 most nucleotide (blue
288 Matthew Poulin et al.

arrows in Fig. 3), the reduction of any background from incom-

plete conversion can be reduced to nearly zero.
There are many PCR primer generating programs available, but
few take into account the effect that bisulfite treatment of DNA
reduces the genetic diversity by ¼ by the conversion of non-CpG
cytosines to thymidine. Another issue that is rarely considered by
most conventional PCR primer generating programs is the single
stranded nature of the template used in Pyrosequencing and the
fact that the sequencing reaction takes place at near room tempera-
ture. The template that can result from conventional programs will
often form strong loop structures that will inhibit Pyrosequencing
or cause an unwanted background because the 30 end of the loop
can act as a sequencing primer as it folds back onto itself and
extends into the template, resulting in a sequence that will interfere
with the expected sequence.

3.3 PCR PCR amplification needs to be optimized for any quantitative

Amplification bisulfite sequencing analysis including direct bisulfite sequencing,
bisulfite subcloning sequencing, or bisulfite Pyrosequencing. It is
of critical importance that there is no preferential amplification of
either high or low methylated DNA template. The accurate quan-
tification of the percent methylation within an assay depends on all
levels of methylation to amplify equally so that, following amplifi-
cation, the relative amounts of the C/T SNP within the CpG site
are represented as they are in the preamplified DNA. The most
critical parameter for optimization is the annealing temperature of
the primers during PCR. Gradient PCR, in which each column or
row of a PCR block has a slightly higher temperature than the
previous column, shows what annealing temperature is best suited
for a specific assay. The annealing temperature is then tested for
PCR bias on a set of samples that has varying known amounts of
methylated DNA. This set of varying methylation samples is
referred to as mixing DNA. The Pyrosequencing results on this
“mixing” DNA are plotted against the expected methylation values
and a linear regression plot is generated. An optimal Pyrosequen-
cing assay will have an R-squared value of greater than 0.95, while
assays with values greater than 0.9 are considered acceptable. A
majority of PCR amplifications of Pyrosequencing assays have a
Mg2+ concentration of 1.5–3.0 mM. However, a Mg2+ concentra-
tion of 0–1.5 mM can be used in some assays that show a slightly
high background, as this will increase the stringency of the primer
annealing during PCR. Additional additives such as DMSO or
betaine may also be included in PCR reactions of amplicons that
have a high G/C or A/T content or if there are other issues with
the PCR amplification process.

3.4 Data Analysis Pyrosequencing calculates level of DNA methylation at each CpG
by quantifying the relative light unit (RLU) of C and T peaks when
 Pyrosequencing Methylation Analysis 289

sequencing from the forward direction, or A and G peaks when

sequencing from the reverse direction (Fig. 1c). Once bisulfite
Pyrosequencing data is obtained, the Pyrosequencing analysis soft-
ware compares peak heights of a “C” and a “T” before a “G” in the
CpG context. The “C” signal indicates the presence of a bisulfite-
resistant cytosine, which reflects 50 -methylation or other forms of
covalent modifications at the 50 position such as hydroxymethyla-
tion, formylation, or carboxylation [1]. The “T” signal reflects
bisulfite-converted, hence, unmodified cytosines. It is therefore
important to note that incomplete bisulfite conversion is a major
source of false-positive detection of DNA methylation [2]. The
C
CþT ratio of peak heights reflects the ratio of cytosine modifications
and this represents the percent methylation at a CpG site. The
Pyrosequencing CpG methylation analysis module of Q96, Q24,
or Q48 instrument software (Qiagen) automatically provides the
percent methylation of each CpG site being sequenced along with
the quality scores of blue, yellow, or red. A methylation value that
receives a blue score indicates a high sequencing quality where there
is a 90% match between the actual and the reference sequence as
well as less than a 4% incomplete bisulfite modification. A yellow
score stands for intermediate sequencing quality where there is a
75–90% match between the actual and the reference sequence or a
4–7% incomplete bisulfite modification. Red scores stand for failed
Pyrosequencing analysis, which means that either the sequencing
results do not meet the expect target sequence, or that there is >7%
incomplete bisulfite modification. If a new or unexpected mutation
is found in the sequence within an assay, a red score will also result.
This is beneficial in that, the mutation can then be entered into the
assay, and passing scores may result.
It should be noted that the Pyrosequencing assays can be
designed in the opposite direction, and in this case, we analyze
the reverse complement. Therefore, a G/A SNP is analyzed follow-
G
ing a “C” and the ratio of GþA represents the percent methylation.

4 Applications of Bisulfite Pyrosequencing

Aberrant DNA methylation is observed with various diseases such

as cancer. Changes in DNA methylation at regulatory regions
including promoters, enhancers, and transcriptional factor binding
sites may influence transcription of genes in various ways. Malig-
nant cells often show global reduction in DNA methylation asso-
ciated with overexpression of affected genes, whereas expression of
various tumor suppressor genes is reduced due to localized DNA
hypermethylation.
Bisulfite Pyrosequencing is widely used in quantifying DNA
methylation in FFEP (formaldehyde-fixed, paraffin-embedded)
290 Matthew Poulin et al.

tissues, although it is also applicable to newer techniques such as

the liquid-based cytology of cervical cancers [6]. Bisulfite Pyrose-
quencing is useful to validate DNA methylation data generated by
bead-based microarray [6], Illumina 450K array or EPIC array [7],
Reduced Representation Bisulfite Sequencing (RRBS) [8, 9], or
Whole Genome Bisulfite Sequencing (WGBS) [10].

4.1 Assessment of DNA hypermethylation often contributes to silencing tumor sup-

CpG Methylation in pressor genes in cancer cells [9]. Somatic promoter hypermethyla-
Tumor Suppressor tion of the MLH1 tumor suppressor gene involved in DNA
Genes mismatch repair occurs in up to 15% of colorectal cancers of
Lynch syndrome patients [11]. Hypermethylation of the MGMT
gene negatively impacts prognosis of glioblastoma patients
[12]. Bisulfite Pyrosequencing played critical roles in discovery
and validation of hypermethylated state if the MLH1 and MGMT
tumor suppressor genes.

4.1.1 DNA Methylation of DAPK1 is a proapoptotic tumor suppressor gene encoding Death-
DAPK1 Gene Associated Protein Kinase 1 [13]. Silencing of DAPK1 by hyper-
methylation has been reported for many tumors such as oral squa-
mous carcinomas [14], non-small-cell lung cancers [15], gastric
cancer [16], colorectal cancers [17], urinary bladder cancers [18],
cervical cancers [13], and hematological malignancies
[14, 18]. Hypermethylation of DAPK1 has been shown to be an
independent prognostic factor in predicting shortened overall sur-
vival of several malignancies, including diffuse large B-cell lym-
phoma (DLBCL) [19].
The rs13300553 A/G SNP in the first intron of DAPK1 linked
to the germline allele-specific expression of DAPK1 in chronic
lymphocytic leukemia has been reported [18]. Kristensen et al.
examined allele-specific DAPK1 methylation in DLBCL tissues
harboring various rs13300553 SNPs—namely, 48 AA, 28 GG,
and 67 AG [20]. Bisulfite Pyrosequencing was used for both
allele-specific CpG methylation assay and SNP determination.
They detected no significant association between DAPK1 methyla-
tion and the rs13300553 SNPs. Patient or disease characteristics,
including the response rate to the standard R-CHOP treatment
(rituximab, cyclophosphamide, doxorubicin, vincristine, and pred-
nisone), were not significantly different according to DAPK1 meth-
ylation state, either. However, long-term survival analysis revealed a
significant association of shorter survival with the AA allele
( p ¼ 0.016). Among the heterozygous (A/G) patients, signifi-
cantly shorter survival was associated with DNA hypermethylation
of the A allele ( p ¼ 0.006). These results suggested that prognosis
prediction of DLBCL patients based on DAPK1 gene DNA meth-
ylation state should include the genetic variance of DAPK1 into
consideration. Since bisulfite Pyrosequencing can interrogate both
 Pyrosequencing Methylation Analysis 291

DNA methylation state and genomic DNA SNPs simultaneously in

a single sequencing run as demonstrated by Kristensen et al., this
technique has a unique advantage over other techniques of DNA
methylation analysis in evaluation of clinically important CpG
methylation biomarkers.
The same group of investigators later revealed that the DAPK1
methylation state of cell-free circulating DNA in plasma of DLBCL
patients reflected therapeutic response [21]. DAPK1 methylation
was determined by bisulfite Pyrosequencing, but this time allelic
discrimination was not included in the study. Aberrant hyper-
methylation of the DAPK1 gene was dramatically reduced to nor-
mal levels during the R-CHOP treatment. After completion of
treatment, patients belonging to clinical “Complete Response”
group showed persistently low, normal levels of DAPK1 methyla-
tion in cell-free circulating DNA. In contrast, in patients of “Pro-
gressive Disease” group, plasma DAPK1 methylation increased
immediately after completion of the treatment. Methylation status
of another prognostic biomarker gene DBC1 also decreased upon
treatment, but it tended to increase after treatment regardless of the
prognosis. This example demonstrates the clinical value of moni-
toring methylation state of epigenetic biomarker genes in cell-free
plasma DNA for noninvasive and real-time evaluation of therapeu-
tic responses. Highly specific and quantitative evaluation of target
DNA methylation accomplished by bisulfite Pyrosequencing will
thus play important roles in future laboratory tests to support
cancer therapy.

4.2 Global In addition to examining the methylation of gene-specific CpG

Methylation Analysis sites within an assay, Pyrosequencing can be used to assess the
level of methylation globally throughout the genome.
Two methods of Pyrosequencing technology can be applied to
determine global methylation levels: analysis of CpGs in repetitive
DNA elements [22, 23] and analysis of CpG sites sensitive to
cleavage by restriction enzymes [24].

4.2.1 Global Methylation Repetitive elements make up more than 45% of the entire human
Analysis: Repetitive genome. Evidences suggest that hypomethylation of long inter-
Elements (LINE-1 or Alu) spersed nucleotide elements (LINE-1) may be associated with the
risk of various cancers [25, 26]. Aberrant LINE-1 methylation was
also observed in Prader–Willi syndrome (PWS) [27]. Yang et al.
(2004) developed a method for assessing genome-wide changes in
methylation based upon Pyrosequencing assays designed within
repetitive DNA elements [28]. Alu and LINE-1 elements are
numerous in the genome and are usually highly methylated. They
designed PCR primers that amplified ~150 bp fragments of Alu or
sequences. The sensitivity of the approach for detecting changes in
methylation was assessed by examining the global methylation of
three colon cancer cell lines which were treated with the
292 Matthew Poulin et al.

methylation inhibiting agent 5-aza-20 deoxycytidine (DAC). When

they compared Pyrosequencing with COBRA and direct sequenc-
ing they found general agreement in the change in methylation
between control and treated cells. This technique requires less
DNA and is far less labor intensive than previous methods. Since
it is extremely reproducible, this method was used for determining
global methylation changes between controls and cases in post-
traumatic stress disorder (PTSD) study [29].

4.2.2 Global Methylation The second method of analyzing global methylation levels was
Analysis: LUMA Analysis developed by Karimi et al. and is called LUMA for luminometric
methylation assay [24]. It involves analyzing CpG sites globally
through cleavage of genomic DNA by the CpG methylation-
sensitive restriction enzyme HpaII and its methylation-insensitive
isoschizomer MspI in parallel reactions. EcoRI is included in all
reactions as a normalization control. MspI and HpaII leave 50 -CG
overhangs that can be extended in the Pyrosequencing reaction to
give a single GC peak using a mixture of these two nucleotides in a
single dispensation. The EcoRI enzyme generates 50 -AATT over-
hangs to give TT and AA peaks as controls for variation in DNA
amount. Both overhangs are then analyzed using Pyrosequencing
technology. The software generates peak height values that can be
used to calculate the degree of global methylation.

4.3 Validation of Because the length of genomic DNA covered by a single bisulfite
Genome-Wide CpG Pyrosequencing assay is only up to 150–200 nucleotides, this
Methylation Analysis approach is not suitable for a genome-wide assessment of the
DNA methylome. Some of the deep sequencing methods of
genome-wide DNA methylation analysis such as BS-seq, RRBS,
and PBAT are based on bisulfite conversion of unmodified cytosine
to uracil while other methods including MeDIP-seq or MBD-seq
are dependent on physical enrichment of methylcytosines using
specific binding proteins conjugated to beads [4]. Because the
enrichment-based methods do not have nucleotide base-level reso-
lution, bisulfite Pyrosequencing provides important opportunities
to validate and quantify CpG methylation at regions identified by
deep sequencing.

4.3.1 Validation of MeDIP-seq and MBD-seq are dependent on enrichment of DNA

MBD-Seq by Bisulfite fragments containing methylcytosines [30]. The figure shown
Pyrosequencing below is an example of bisulfite Pyrosequencing validation of
MBD-seq data; our unpublished study). In an experiment involv-
ing 12 male mice, 6 of them were exposed to Bisphenol A (BPA)
during their intra-uterine development, and 6 others were exposed
to vehicle (DMSO). After they developed into adults, their adipose
tissues were subjected to DNA methylation analysis using
MBD-seq (in which DNA fragments containing methylated cyto-
sines are enriched by a human Methyl Binding Domain-containing
 Pyrosequencing Methylation Analysis 293

recombinant protein conjugated to agarose beads) and mRNA

expression analysis using RNA-seq. Whereas all six BPA group
animals showed DNA hypomethylation at the transcription initia-
tion site (TSS) of the fggy gene encoding a carbohydrate kinase,
three of the vehicle-exposed animals showed strong DNA hyper-
methylation, and the remaining three vehicle-exposed animals
showed DNA hypomethylation. Bisulfite Pyrosequencing con-
firmed the MBD-seq results, and it also revealed that the remark-
able differential DNA methylation at around the fggy gene. TSS
was observed with five most proximal CpG sites within about
300 nucleotides upstream of the TSS whereas three CpG sites
around 670 nucleotides were generally hypermethylated in all ani-
mals. The degrees of DNA methylation at around fggy gene
showed strong inverse correlation with mRNA expression of this
gene, supporting the notion that expression of fggy gene is regu-
lated by promoter DNA methylation. Thus, genome-wide DNA
methylation profiling by deep sequencing followed by validation
using bisulfite Pyrosequencing of selected, differentially methylated
regions and mRNA expression analysis is a powerful approach to
obtain biologically meaningful epigenetic alterations.

5 Conclusion

DNA methylation is an important epigenetic marker at the inter-

face of genetic and environmental factors such as development, age,
pollution levels, and varieties of human diseases including cancers.
Sequencing by synthesis using the bisulfite Pyrosequencing has
been demonstrated to be a useful tool for determining DNA meth-
ylation levels. From a clinical and diagnostic perspective, Pyrose-
quencing makes the discovery of epigenetic control regions
possible since its quantitative sequencing at a single nucleotide
resolution allows the quantification of DNA methylation level in
patients with cancers or other diseases. For example, MGMT pro-
moter methylation is predictive of response to radiotherapy and
prognostic in the absence of adjuvant alkylating chemotherapy for
glioblastoma [31]. LINE-1 hypomethylation in plasma cfDNA can
be used as a biomarker for colorectal cancer [32] and for breast
cancer [26].
The short read Pyrosequencing platform, commercially avail-
able through Qiagen-Pyrosequencing, has been demonstrated to
be useful in quantifying DNA methylation in a specific region of a
gene or DNA fragments. Whether short read pyrosequencing
becomes commonplace in diagnostic in clinical laboratories remains
to be seen. The shorter sequences achieved in comparison to San-
ger sequencing means that careful target selection is critical. The
published literature makes a strong case that quantitatively
294 Matthew Poulin et al.

determined short sequences can provide highly informative and

clinically relevant information.
Laboratories looking to move forward with sequencing as a
routine diagnostic procedure will need to carefully compare the
financial costs of equipment and reagents, the turnaround time,
the throughput, the assay specificity and reproducibility required
for their purposes to decide whether bisulfite Pyrosequencing
sequencing or NGS systems best meet their goals.
To combine NextGen bisulfite sequencing for biomarker
screening with Pyrosequencing for biomarker validation, wide-
spread adoption of Pyrosequencing in clinical laboratories may be
required. This dual approach would provide a great deal of diag-
nostic information available directly from patient specimens in a
matter of hours, and should be an attractive combination for diag-
nostic laboratories.

References
1. Kwiatkowski M, Fredriksson S, Isaksson A,
Nilsson M, Landegren U (1999) Inversion of
in situ synthesized oligonucleotides: improved
reagents for hybridization and primer exten-
sion in DNA microarrays. Nucleic Acids Res
27(24):4710–4714
2. Alderborn A, Kristofferson A, Hammerling U
(2000) Determination of single-nucleotide
polymorphisms by real-time pyrophosphate
DNA sequencing. Genome Res 10
(8):1249–1258
3. England R, Pettersson M (2005) Pyro
Q-CpG™: quantitative analysis of methylation
in multiple CpG sites by Pyrosequencing®.
Nat Methods 2005:2. https://doi.org/10.
1038/nmeth800
4. Harris RA, Wang T, Coarfa C, Nagarajan RP,
Hong C, Downey SL, Johnson BE, Fouse SD,
Delaney A, Zhao YJ, Olshen A, Ballinger Y,
Zhou X, Forsberg KJ, Gu J, Echipare L,
O’Geen H, Lister R, Pelizzola M, Xi Y, Epstein
CB, Bernstein BE, Hawkins RD, Ren B,
Chung WY, Gu HC, Bock C, Gnirke A,
Zhang MQ, Haussler D, Ecker J, Li W, Farn-
ham PJ, Waterland RA, Meissner A, Marra MA,
Hirst M, Milosavljevic A, Costello JF (2010)
Comparison of sequencing-based methods to
profile DNA methylation and identification of
monoallelic epigenetic modifications. Nat Bio-
technol 28(10):1097–1105
5. Sun Z, Cunningham J, Slager S, Kocher JP
(2015) Base resolution methylome profiling:
considerations in platform selection, data pre-
processing and analysis. Epigenomics 7
(5):813–828
6. Clarke MA, Luhn P, Gage JC, Bodelon C,
Dunn ST, Walker J, Zuna R, Hewitt S, Killian
JK, Yan L, Miller A, Schiffman M, Wentzensen
N (2017) Discovery and validation of candi-
date host DNA methylation markers for detec-
tion of cervical precancer and cancer. Int J
Cancer 141(4):701–710
7. Roessler J, Ammerpohl O, Gutwein J,
Hasemeier B, Anwar SL, Kreipe H, Lehmann
U (2012) Quantitative cross-validation and
content analysis of the 450k DNA methylation
array from Illumina, Inc. BMC Res Notes
5:210. https://doi.org/10.1186/1756-
0500-5-210
8. Day SE, Coletta RL, Kim JY, Campbell LE,
Benjamin TR, Roust KR, De Filippis EA,
Dinu V, Shaibi GQ, Mandarino LJ, Coletta
DK (2016) Next-generation sequencing meth-
ylation profiling of subjects with obesity iden-
tifies novel gene changes. Clin Epigenetics
8:77
9. Kucuk C, Hu X, Jiang B, Klinkebiel D,
Geng H, Gong Q, Bouska A, Iqbal J,
Gaulard P, McKeithan TW, Chan WC (2015)
Global promoter methylation analysis reveals
novel candidate tumor suppressor genes in nat-
ural killer cell lymphoma. Clin Cancer Res 21
(7):1699–1711
10. Crary-Dooley FK, Tam ME, Dunaway KW,
Hertz-Picciotto I, Schmidt RJ, LaSalle JM
(2015) A comparison of existing global DNA
methylation assays to low-coverage whole-
genome bisulfite sequencing for epidemiologi-
cal studies. Epigenetics 12(3):206–214
11. Moreira L, Munoz J, Cuatrecasas M,
Quintanilla I, Leoz ML, Carballal S, Ocaña T,

Lopez-Ceron M, Pellise M, Castellvi-Bel S,
Jover R, Andreu M, Carracedo A, Xicola RM,
Llor X, Boland CR, Goel A, Castells A,
Balaguer F, Gastrointestinal Oncology Group
of the Spanish Gastroenterological Association
(2015) Prevalence of somatic mutl homolog
1 promoter hypermethylation in Lynch syn-
drome colorectal cancer. Cancer 121
(9):1395–1404
12. Villani V, Casini B, Pace A, Prosperini L, Car-
apella CM, Vidiri A, Fabi A, Carosi M (2015)
The prognostic value of pyrosequencing-
detected MGMT promoter hypermethylation
in newly diagnosed patients with glioblastoma.
Dis Markers 2015:604719. https://doi.org/
10.1155/2015/604719
13. Agodi A, Barchitta M, Quattrocchi A,
Maugeri A, Vinciguerra M (2015) DAPK1
promoter methylation and cervical cancer risk:
a systematic review and a meta-analysis. PLoS
One 10(8):e0135078
14. Frazzi R, Zanetti E, Pistoni M, Tamagnini I,
Valli R, Braglia L, Merli F (2017) Methylation
changes of SIRT1, KLF4, DAPK1 and SPG20
in B-lymphocytes derived from follicular and
diffuse large B-cell lymphoma. Leuk Res
57:89–96
15. Esteller M (2003) Profiling aberrant DNA
methylation in hematologic neoplasms: a view
from the tip of the iceberg. Clin Immunol 109
(1):80–88
16. Chim CS, Kwong YL, Liang R (2008) Gene
hypermethylation in multiple myeloma: lessons
from a cancer pathway approach. Clin Lym-
phoma Myeloma 8(6):331–339
17. Leong KJ, Beggs A, James J, Morton DG,
Matthews GM, Bach SP (2014) Biomarker-
based treatment selection in early-stage rectal
cancer to promote organ preservation. Br J
Surg 101(10):1299–1309
18. Wei QX, Claus R, Hielscher T, Mertens D,
Raval A, Oakes CC, Tanner SM, de la
Chapelle A, Byrd JC, Stilgenbauer S, Plass C
(2013) Germline allele-specific expression of
DAPK1 in chronic lymphocytic leukemia.
PLoS One 8(1):e55261
19. Amara K, Trimeche M, Ziadi S, Laatiri A,
Hachana M, Korbi S (2008) Prognostic signif-
icance of aberrant promoter hypermethylation
of CpG islands in patients with diffuse large
B-cell lymphomas. Ann Oncol 19
(10):1774–1786
20. Kristensen LS, Treppendahl MB, Asmar F, Gir-
kov MS, Nielsen HM, Kjeldsen TE,
Ralfkiaer E, Hansen LL, Gronbaek K (2013)
Investigation of MGMT and DAPK1 methyla-
tion patterns in diffuse large B-cell lymphoma
Pyrosequencing Methylation Analysis 295
using allelic MSP-pyrosequencing. Sci Rep
3:2789. https://doi.org/10.1038/srep02789
21. Kristensen LS, Hansen JW, Kristensen SS,
Tholstrup D, Harslof LB, Pedersen OB, De
Nully Brown P, Gronbaek K (2016) Aberrant
methylation of cell-free circulating DNA in
plasma predicts poor outcome in diffuse large
B cell lymphoma. Clin Epigenetics 8(1):95
22. Kurdyukov S, Bullock M (2016) DNA methyl-
ation analysis: choosing the right method. Biol-
ogy (Basel) 5(1):3
23. Tabish AM, Baccarelli AA, Godderis L, Barrow
TM, Hoet P, Byun HM (2015) Assessment of
changes in global DNA methylation levels by
pyrosequencing® of repetitive elements. Meth-
ods Mol Biol 1315:201–207
24. Karimi M, Luttropp K, Ekstrom TJ (2011)
Global DNA methylation analysis using the
luminometric methylation assay. Methods
Mol Biol 791:135–144
25. Barry KH, Moore LE, Liao LM, Huang WY,
Andreotti G, Poulin M, Berndt SI (2015) Pro-
spective study of DNA methylation at LINE-1
and Alu in peripheral blood and the risk of
prostate cancer. Prostate 75(15):1718–1725
26. Rauscher GH, Kresovich JK, Poulin M, Yan L,
Macias V, Mahmoud AM, Al-Alem U,
Kajdacsy-Balla A, Wiley EL, Tonetti D, Ehrlich
M (2015) Exploring DNA methylation
changes in promoter, intragenic, and intergenic
regions as early and late events in breast cancer
formation. BMC Cancer 15:816
27. Manzardo AM, Butler MG (2016) Examina-
tion of global methylation and targeted
imprinted genes in Prader-Willi syndrome. J
Clin Epigenet 2(3):pii: 26. https://doi.org/
10.21767/2472-1158.100026
28. Yang AS, Estécio MR, Doshi K, Kondo Y,
Tajara EH, Issa JP (2004) A simple method
for estimating global DNA methylation using
bisulfite PCR of repetitive DNA elements.
Nucleic Acids Res 32(3):e38
29. Rusiecki JA, Chen LG, Srikantan V, Zhang L,
Yan LY, Poulin ML, Baccarelli A (2012) DNA
methylation in repetitive elements and post-
traumatic stress disorder: a case–control study
of US military service members. Epigenomics 4
(1). https://doi.org/10.2217/epi.11.116
30. Clark C, Palta P, Joyce CJ, Scott C, Grundberg E,
Deloukas P, Palotie A, Coffey AJ (2012) A com-
parison of the whole genome approach of
MeDIP-Seq to the targeted approach of the Infi-
nium HumanMethylation450 BeadChip® for
methylome profiling. PLoS One 7(11):e50233
31. Rivera RA, Pelloski CE, Gilbert MR,
Colman H, De La Cruz C, Sulman EP, Bekele
BN, Aldape KD (2010) MGMT promoter
296 Matthew Poulin et al.
methylation is predictive of response to radio-
therapy and prognostic in the absence of adju-
vant alkylating chemotherapy for glioblastoma.
Neuro-Oncology 12(2):116–121
32. Nagai Y, Sunami E, Yamamoto Y, Hata K,
Okada S, Murono K, Yasuda K, Otani K,
Nishikawa T, Tanaka T, Kiyomatsu T,
Kawai K, Nozawa H, Ishihara S, Hoon DS,
Watanabe T (2017) LINE-1 hypomethylation
status of circulating cell-free DNA in plasma as
a biomarker for colorectal cancer. Oncotarget 8
(7):11906–11916
 INDEX
A D
Acetylation........................ 29, 59, 64, 66, 70, 71, 90, 91,
93, 126, 127, 145, 164–166, 177, 186, 204, 211,
235, 237
Acute leukemia ...................................... 87, 88, 90–92, 96
Aging ................................... 21, 179, 219–228, 235, 264
Antigen presentation machinery (APM) ............ 208, 210
5-Aza-2-deoxycytidine (5-AC)......................63, 183, 210
B DNA methyltransferase (DNMT)............. 58, 59, 63–65,
Bacteria ............................. 38, 40–42, 47, 142–145, 147,
148, 150, 151, 153, 277
Basal-liked breast cancer .....................21, 22, 24–26, 207
Biomarkers.................................. v, 3–5, 7–12, 14, 43, 44,
46, 47, 76, 95, 96, 103–105, 107–109, 111, 112,
161, 162, 164, 166, 194, 219–228, 256, 258,
264, 291, 293, 294
Bisulfite sequencing (BSS)................... 89, 191–193, 220,
269–280, 287, 294
Breast cancer..........................4–6, 19–30, 106, 124, 149,
150, 181–183, 186, 206, 207, 225, 226, 234,
235, 238–240, 293
C Epigenetic clock ................................................... 223, 224
Cancer................................... 3, 19, 35, 58, 88, 103, 121,
142, 158, 178, 203, 219, 234, 247, 255, 269, 289
Chemokines..................................................204–207, 212
Chromatin ....................................... 5, 21, 29, 43, 59, 60,
64, 66, 70, 71, 90, 91, 93–96, 126, 127, 132, 145,
146, 158, 159, 165, 179, 184, 186, 189, 193,
194, 236, 237, 240, 241, 251, 252, 256, 257
Circadian genes ............................................175, 178–188
Circadian rhythm ..............................................v, 173–194
Class II major histocompatibility complex transactivator
(CIITA)..................................................... 210, 211
Colorectal cancer (CRC) ....................... 7–9, 35–48, 109,
124, 126, 145–149, 160, 163–164, 182, 183,
186, 187, 211, 225, 226, 290, 293
CpG sites ............................ 5, 23, 27, 89, 180, 181, 183,
204, 261, 271, 286, 287, 291–293
Cytokines ................ 39, 41, 42, 106, 204–209, 212, 248
Ramona G. Dumitrescu and Mukesh Verma (eds.), Cancer Epigenetics for Precision Medicine: Methods and Protocols,
Methods in Molecular Biology, vol. 1856, https://doi.org/10.1007/978-1-4939-8751-1,
© Springer Science+Business Media, LLC, part of Springer Nature 2018
297
Diet ............................................ v, 36, 38, 39, 41, 42, 47,
112, 121–133, 141–153, 158, 164, 173, 256
DNA hypermethylation .........................4, 5, 7, 8, 10, 26,
29, 75, 123, 160, 161, 167, 182, 269–280, 289,
290, 293
DNA methylation ........................................ 3, 20, 43, 58,
89, 111, 122, 142, 158, 179, 204, 219, 236, 256,
270, 284
67, 69–70, 89, 94–96, 123–125, 132, 159, 160,
163, 167, 181, 183, 236, 270
E
Early epigenetic markers ............................................. 3–14
Epidemiology ...................................................... 122, 124,
148, 160, 180, 191, 219–228, 233, 238–241,
256–258, 263
Epidermal growth factor receptor (EGFR) ........... 22, 23,
46, 58, 60, 69, 72, 73
Epigenetic changes............................. v, 3, 5, 7, 8, 11–13,
19–30, 43, 58, 88, 112, 121–133, 151, 157–167,
203–212, 220, 222, 250, 270
Epigenetic diet .............................................................. 153
Epigenetics ................................... v, 3–14, 19–30, 35–48,
58–76, 87–96, 105, 112, 121–133, 141–153,
157–167, 173–194, 203–212, 219, 223–226,
228, 234–239, 241, 247–252, 256–258, 263,
264, 270, 293
Epigenome studies ........................................... 27–29, 222
ERBB2/HER2-enriched................................... 22–25, 27
Ethanol metabolism ............................................. 158–160
G
Gastric cancer (GC) ................................. 9–10, 151, 152,
182, 206–209, 211, 290
Genetic mutations..........................................88, 159, 236
Genetic variants ........................................... 131, 161, 164
Genome-wide methylation ................................... 28, 180,
220–223, 239, 240, 263
 CANCER EPIGENETICS FOR PRECISION MEDICINE: METHODS
298 Index
H O
Health disparity ...................................235, 238, 240, 241
Heavy alcohol consumption ....................... 158, 163, 164
Hematopoiesis.................................................... 89, 91, 93
Histone deacetylase (HDAC).................... 58, 59, 64, 90,
126, 132, 145, 146, 150, 159, 163, 165, 167,
186, 211, 237
Histone deacetylase inhibitors (HDACi) ........ 58, 63–66,
69–70, 72, 73, 95, 96, 126, 127, 132, 145, 150,
209–211, 237
Histone modifications.................................. 3, 27, 29, 43,
44, 58–60, 66, 75, 90, 91, 122, 126–127, 131,
132, 142, 146, 148, 152, 158, 164–167, 179,
186–189, 193, 194, 204, 236, 237, 250, 256,
259, 270
Human leukocyte antigen (HLA)...............204, 208–210
Hypomethylation ......................................... 5, 13, 20, 28,
29, 89, 123, 125, 158, 159, 163, 167, 182, 204,
208, 219, 261, 291, 293
I R
Immune check points .........................42, 73, 75, 76, 248
Immune escape............................................ 203, 208, 212
Immunotherapy .................. 42, 69, 73, 75, 76, 248, 250
Inflammation ........................................38, 40, 42, 45, 48,
104, 143, 144, 151, 152, 166, 181, 203, 204,
206–208, 212, 235, 239
L
Long interspersed nucleotide element-1 (LINE-1)
assay........................ 163, 180, 257, 263, 291, 293
Luminal A .................................................. 22–24, 27, 225
Luminal B ........................................................... 22–24, 27
Lung cancer (LC) ...........................................12, 58, 109,
127, 183, 205, 226, 290
M
Methylation-specific PCR (MSP).............. 132, 191–193,
251, 269–280
Microbiome ..........................................v, 35–48, 141–153
MicroRNAs (miRNAs) ....................................... 7, 26, 43,
60, 91, 103–113, 122, 148, 166–167, 184, 235,
237, 255–264
N
Natural killer (NK) cells....................................61, 73, 75,
204, 209, 211
Non-small cell lung cancer (NSCLC).............. 58, 61–64,
66–73, 75, 207, 290
Normal like breast cancer ............................................... 26
Nutriepigenomics................................................. 131, 132
Nutrition............................................. 121–128, 131–133,
142, 145, 147, 150, 152, 161, 238
AND PROTOCOLS
One-carbon metabolism (OCM) ....................... 124, 125,
158–161, 164
Oral cancer ........................................................... 165, 249
Overall response rate (ORR) .......................................... 73
Overall survival (OS) ........................................22, 25, 26,
58, 61, 62, 70, 73, 94, 187, 207, 290
P
Pancreatic cancer ....................11, 12, 206, 207, 269–280
Plasma .......................4, 9–11, 13, 44, 46, 107–109, 111,
148, 166, 210, 257, 271–273, 276, 291, 293
Precision medicine ...........................................v, 3–14, 19,
30, 58–76, 111–113, 142–153, 167
Programed Cell Death-1 (PD-1) .....................42, 73, 75,
76, 247–250, 252
Prostate cancer (PC) ............................11, 123, 149, 206,
238, 256–264
Pyrosequencing ................. 131, 132, 192, 193, 283–294
Regulation ............................................ 12, 26, 35–48, 62,
67, 75, 88–96, 105, 107, 112, 126–128, 132,
144–146, 158, 159, 163, 165–167, 177–179,
181, 184–188, 191, 194, 208–211, 223, 224,
234, 247–252, 256–259, 270
S
Screening .......................................... v, 5–7, 9–13, 21, 45,
58, 104, 235, 256, 264, 294
Social epigenomics ............................................... 233–241
Suppressors of cytokine signaling (SOCS) ...............5, 10,
106, 163, 205, 206
Survival ............9, 12, 13, 23–27, 29, 35, 43, 44, 46, 58,
60, 64, 67, 70, 71, 73, 87, 88, 90, 92, 94, 95, 106,
122, 126, 128, 161, 162, 167, 187, 208–210,
227, 239, 240, 256, 263, 264, 269, 271, 290
T
Tissue samples ................... 221, 222, 259, 263, 271, 273
Toll-like receptors (TLR) ........................... 151, 207, 208
Treatment ............... v, 4, 5, 8, 13, 14, 19, 20, 22–24, 43,
47, 48, 58, 60, 62–65, 69–71, 73, 76, 87, 90, 91,
94–96, 104, 105, 109, 110, 113, 129, 132, 133,
141, 145, 146, 151–153, 166, 167, 183, 209,
211, 212, 219, 237, 239, 248, 250, 256,
262–264, 269, 279, 288, 290, 291
V
Virus....................46, 142, 152, 161, 208, 249, 271, 279
W
Women’s cancers ........................................................... 4–7