Copyright Ó 2007 by the Genetics Society of America

DOI: 10.1534/genetics.107.072835

Efficient Tor Signaling Requires a Functional Class C Vps Protein Complex

in Saccharomyces cerevisiae

Sara A. Zurita-Martinez,*,1 Rekha Puria,*,1 Xuewen Pan,† Jef D. Boeke‡ and Maria E. Cardenas*,2
*Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710, †Department of
Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, Texas 77030 and ‡Department of Molecular Biology
and Genetics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205
Manuscript received March 2, 2007
Accepted for publication May 25, 2007

ABSTRACT
The Tor kinases regulate responses to nutrients and control cell growth. Unlike most organisms that only
contain one Tor protein, Saccharomyces cerevisiae expresses two, Tor1 and Tor2, which are thought to share all
of the rapamycin-sensitive functions attributable to Tor signaling. Here we conducted a genetic screen that
defined the global TOR1 synthetic fitness or lethal interaction gene network. This screen identified
mutations in distinctive functional categories that impaired vacuolar function, including components of the
EGO/Gse and PAS complexes that reduce fitness. In addition, tor1 is lethal in combination with mutations in
class C Vps complex components. We find that Tor1 does not regulate the known function of the class C Vps
complex in protein sorting. Instead class C vps mutants fail to recover from rapamycin-induced growth arrest
or to survive nitrogen starvation and have low levels of amino acids. Remarkably, addition of glutamate or
glutamine restores viability to a tor1 pep3 mutant strain. We conclude that Tor1 is more effective than Tor2 at
providing rapamycin-sensitive Tor signaling under conditions of amino acid limitation, and that an intact
class C Vps complex is required to mediate intracellular amino acid homeostasis for efficient Tor signaling.

T HE Tor kinases are key components of an evolu-

tionarily conserved nutrient-responsive pathway
that regulates cell growth and proliferation in eukaryotic
organisms. The Tor kinases were first identified in yeast
cells as the targets of the antiproliferative drug rapa-
mycin (Heitman et al. 1991). Thereafter, rapamycin has
been instrumental in elucidating biological events gov-
erned by Tor signaling, including complex transcrip-
tional and translational programs (reviewed in Rohde
et al. 2001; Crespo and Hall 2002).
When yeast cells are grown in ample nutrient condi-
tions, Tor activity promotes the expression of genes en-
coding tRNAs, ribosomal proteins, and rRNA, while
inactivating genes required for utilization of poor nitro-
gen and carbon sources, and stress responses (Zaragoza
et al. 1998; Beck and Hall 1999; Cardenas et al. 1999;
Hardwick et al. 1999; Powers and Walter 1999;
Komeili et al. 2000). Tor activity also supports trans-
lation, in large part by suppressing the general amino
acid control response regulated by the Gcn2 kinase, and
possibly by also affecting the stability of eIF4G (Berset
et al. 1998; Valenzuela et al. 2001; Cherkasova and
Hinnebusch 2003; Kubota et al. 2003; Rohde et al.
2004). Inhibition of Tor by rapamycin elicits many of the
1
These authors contributed equally to this work.
2
Corresponding author: Department of Molecular Genetics and Microbi-
ology, Duke University Medical Center, 322 CARL Bldg., Box 3546,
Research Dr., Durham, NC 27710. E-mail: carde004@mc.duke.edu
cellular responses that are triggered by starvation for
nutrients, such as inhibition of protein synthesis, down-
regulation of amino acid permeases, protein degrada-
tion, autophagy, and cell cycle arrest (reviewed by
Rohde et al. 2001; De Virgilio and Loewith 2006).
Unlike most organisms that express only one Tor
protein, Saccharomyces cerevisiae has two highly homolo-
gous Tor proteins, Tor1 and Tor2, which are thought to
share all of the rapamycin-sensitive functions attribut-
able to Tor signaling, while only Tor2 serves a unique
and essential rapamycin-insensitive role (reviewed in
Crespo and Hall 2002). A recent study has suggested
that Tor1 and Tor2 differ in providing a rapamycin-
sensitive function in certain class C vps mutants (Xie
et al. 2005); however, the exact nature of this function
remains to be determined. The Tor proteins form two
distinct multiprotein complexes: TORC1 and TORC2.
Tor1 (and to a lesser extent Tor2) is a component of
the TORC1 complex, which includes Lst8, Kog1, Tco89,
and Bit61. TORC2 consists of Tor2, Lst8, and the Avo1,
Avo2, and Avo3 proteins (Loewith et al. 2002; Wedaman
et al. 2003; Reinke et al. 2004). FKBP12-rapamycin phys-
ically associates with TORC1 but not with TORC2,
suggesting that this second complex mediates the rapa-
mycin-insensitive Tor2 role in controlling polarization of
the actin cytoskeleton (Loewith et al. 2002).
To understand why yeast cells express two functional
Tor proteins, we sought to define novel Tor1- or Tor2-
specific functions. Here we performed a genomewide

Genetics 176: 2139–2150 (August 2007)

2140 Zurita-Martinez et al.
screen searching for genes that when mutated in com-
bination with tor1 reduce fitness or render cells inviable.
These genes identified distinct functional networks in-
cluding those involved in protein sorting, vacuolar in-
heritance, and microautophagy. In particular, we find
that tor1 shows synthetic lethality or synthetic reduced
fitness with mutations in different components of the
class C Vps complex, which includes the Pep3, Pep5,
Vps16, Vps33, Vps39, and Vps41 proteins (Banta et al.
1988; Raymond et al. 1992; Rieder and Emr 1997;
Wurmser et al. 2000). The class C Vps complex plays a
central role in protein sorting by regulating vesicle dock-
ing and fusion at the endosome and between the endo-
some and the vacuole (Srivastava et al. 2000; Peterson
and Emr 2001). Viability of the tor1 pep3 double mutant
was restored by expression of Tor1 but not Tor2, in-
dicating that the function linking Tor1 and the class C
Vps complex is unique to the rapamycin-sensitive TORC1
complex. Mutants lacking components of the class C Vps
complex fail to recover from rapamycin-induced growth
arrest and to survive nitrogen starvation, have low levels
of amino acids, in particular glutamate, and show growth
defects at 37° (this study; Kitamoto et al. 1988; Robinson
et al. 1991). Remarkably, addition of glutamate or gluta-
mine rescues the growth defect of class C single vps
mutants and of a tor1 pep3ts conditional mutant at 37°.
Our studies suggest that, in contrast to Tor2, Tor1 is
specialized to support growth under conditions where
intracellular amino acid concentrations are drastically
reduced. We also conclude that an intact class C Vps
complex is required to provide intracellular amino acid
homeostasis for proper Tor1 signaling. These findings
provide a physiological foundation to understand the
duplication and divergence of Tor1 and Tor2 functions
in S. cerevisiae.
MATERIALS AND METHODS
Yeast strains and media: Strains used in this study are listed
in Table 1. All the strains are isogenic derivatives of BY4741 or
BY4742 and unless otherwise indicated were constructed by
the Saccharomyces Genome Deletion Project (distributed by
Invitrogen, Carlsbad, CA). Strains SZY25 and SZY21 were
obtained by deletion of TOR1 with URA3 in strains BY4741
and 13652, respectively. Strains SZY26, 27, 28, 29, 30, 31, 32,
and 33 as well as RPY50 and RPY51 were created by crossing
strain SZY25 to the pep3, pep5, vps15, vps16, vps34, vac7, vac8,
vac17, vps39, and vps41 MATa haploid strains, respectively.
Strain SZY36 was obtained from strain BY4742 by deletion of
the VPS33 gene with KanMX4. Strain SZY37 was constructed
by replacing the URA3 gene in strain SZY25 with LEU2.
Strain SZY40 was obtained by crossing strain SZY37 to the
pep3 haploid mutant strain #14105 and the resulting diploid
transformed with plasmid pBJ9113 expressing the pep3ts-108
(Srivastava et al. 2000) was sporulated and dissected to obtain
strain SZY40-4. SZY43 is a meiotic segregant of strain SZY32.
Strain SZY49 was constructed by crossing strains SZY25 and
SZY36.
Yeast synthetic medium (YNB) with ammonium was always
supplemented with 2% glucose (SG). SG medium was supple-
mented with amino acids to satisfy any auxotrophic require-
ments (SC) and for the experiment presented in Figure 6C
with 0.2% of the indicated amino acid. Sporulation medium
was 1.5% potassium acetate (KAc) (pH 7.5), supplemented
with any required amino acids. SLAD, YPD, and all other media
were prepared as described previously (Gimeno et al. 1992;
Sherman 2002). Rapamycin was added to the media from
concentrated stock solutions in 90% ethanol, 10% Tween-20.
Yeast transformations were performed by the lithium acetate
method (Schiestl and Gietz 1989). Unless noted otherwise,
mutant yeast strains were constructed by PCR-mediated gene
disruption, replacing the entire open reading frame of the
targeted gene with the indicated genes (Longtine et al. 1998;
Goldstein and McCusker 1999). All gene deletions were
confirmed by PCR.
Plasmids: Low-copy centromeric plasmids, pRS315-TOR1
expressing TOR1, and pML40-3 expressing TOR2, as well as
plasmids expressing Tor2-Tor1 hybrid proteins were described
previously (Lorenz and Heitman 1995; Alarcon et al. 1996).
Plasmid pSZ12 (Hybrid 4) was created by gap repair; briefly,
a 173-bp (from nucleotide 5316 to 5488 of TOR2) PCR product
was generated with primers SZ167 59–CATAATTGG GCCT
TAGCTAATTTTGAAGTAATATCCATGCTAACATCTGTCTC
TAAAAAGAAACAGGAAG–39 and SZ168 59–GAAAAAAGC
CCTTGATCGCTGGAACAACATGTCTTTGAATAAGATTAG
AAGAGTAATGAACTTC–39 and plasmid pML40-3 as tem-
plate. The PCR product was cotransformed with NcoI-digested
pRS315-TOR1 into strain 16864. All hybrids were confirmed
by sequencing. Plasmid pMEP2-GFP was kindly provided by
J. Rutherford and will be published elsewhere. Plasmids
pBJ9113 bearing the pep3ts-108 (Srivastava et al. 2000) and
p188 containing the GCN4-lacZ reporter gene were provided
by E. Jones and A. Hinnebusch, respectively.
Western blotting and a-factor processing: Cell extracts from
exponentially growing cultures in YEPD were prepared as
previously described except that the breakage buffer consisted
of 100 mm Tris-HCl, 50 mm KCl, 1 mm EDTA, 5% glycerol, and
the protease inhibitors leupeptin, aprotinin, and pepstatin
added at 1 mg/ml and 0.5 mm phenylmethyl sulfonyl fluoride
(Rohde et al. 2004). Western blot analysis with 40 mg of protein
for Ape1 and Alp1 and 10 mg for CpY was performed by
standard techniques with antibodies specific for Ape1 and
Alp1 (kindly provided by Y. Ohsumi) and CpY (Molecular
Probes, Eugene, OR). The antisera recognizing amino acids
1–100 and 1–147 of Tor1 and Tor2, respectively, were pre-
viously described (Cardenas and Heitman 1995; Alarcon
et al. 1996). For metabolic labeling cultures were grown to early
exponential phase in SC medium. Cells were washed and
resuspended in SC without methionine medium and treated
with drug vehicle alone or 100 nm rapamycin and incubated for
20 min. Metabolic labeling of yeast cells with Trans 35S-LABEL
(ICN), pulse chase, cell extract preparation, immunoprecip-
itation with specific antibodies for a-factor (a generous gift of
T. Graham), and CpY were performed at 30° according to
published protocols (Graham 1998).
Amino acid determination, Northern blot analysis, and
b-galactosidase assays: Amino acid extraction from exponen-
tially growing cells in YPD medium was performed as de-
scribed (Chen and Kaiser 2002). Amino acid analyses were
carried out in duplicate by anion exchange chromatography
employing a Beckman 6300 Li citrate-based analyzer followed
by post-column ninhydrin reaction detection system at the
Molecular Structure Facility, University of California at Davis.
Northern blot analysis as well as b-galactosidase assays to
determine GCN4-lacZ reporter gene activity were previously
described (Cardenas et al. 1999; Rohde et al. 2004).
Fluorescent microscopy: Cells were collected, spotted onto
microscope slides, and imaged in a Nikon Eclipse E400
 Tor and Class C Vps Protein Complex 2141

TABLE 1
Yeast strains used in this study

Strain Genotype Reference/source

BY4741 MATa his3D1 leu2D0 met15D0 ura3D0 Research Genetics
BY4742 MATahis3D1 leu2D0 lys2D0 ura3D0 Research Genetics
#13652 BY4742 ssd1TKanMX4 Research Genetics
#14105 BY4742 pep3TKanMX4 Research Genetics
#10817 BY4742 pep5TKanMX4 Research Genetics
#13236 BY4742 vps15TKanMX4 Research Genetics
#12783 BY4742 vps16TKanMX4 Research Genetics
#15149 BY4742 vps34TKanMX4 Research Genetics
#13774 BY4742 vps39TKanMX4 Research Genetics
#14015 BY4742 vps41TKanMX4 Research Genetics
#13021 BY4742 vac7TKanMX4 Research Genetics
#10253 BY4742 vac8TKanMX4 Research Genetics
#13470 BY4742 vac17TKanMX4 Research Genetics
#16864 BY4742 tor1TKanMX4 Research Genetics
#16522 BY4742 gtr1TKanMX4 Research Genetics
#13214 BY4742 ego3TKanMX4 Research Genetics
SZY21 MATahis3D1 leu2D0 lys2D0 ura3D0 ssd1TKanMX4 tor1TURA3 This study
SZY25 MATa his3D1 leu2D0 met15D0 ura3D0 tor1TURA3 This study
SZY26 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
pep3TKanMX4 tor1TURA3
SZY27 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
PEP5/pep5TKanMX4 tor1TURA3/TOR1
SZY28 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS15/vps15TKanMX4 tor1TURA3/TOR1
SZY29 MATa/ahis3D1/his3D1 leu2D/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS16/vps16TKanMX4 tor1TURA3/TOR1
SZY30 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS34/vps34TKanMX4 tor1TURA3/TOR1
SZY31 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VAC7/vac7TKanMX4 tor1TURA3/TOR1
SZY32 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VAC8/vac8TKanMX4 tor1TURA3/TOR1
SZY33 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VAC17/vac17TKanMX4 tor1TURA3/TOR1
SZY36 BY4742 vps33TKanMX4 This study
SZY37 MATa his3D1 leu2D0 met15D0 ura3D0 tor1TLEU2 This study
SZY40 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
ura3D0/ura3D0 PEP3/pep3TKanMX4 tor1TLEU2/TOR1
SZY40-4 MATa his3D1 leu2D0 ura3D0 met15D0 tor1TLEU2 pep3TKanMX4 [pep3ts-108] This study
SZY43 MATahis3D1 leu2D0 met15D0 ura3D0 tor1TURA3 vac8TKanMX4 This study
SZY49 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS33/vps33TKanMX4 tor1TURA3/TOR1
RPY48 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS39/vps39TKanMX4 tor1TURA3/TOR1
RPY49 MATa/ahis3D1/his3D1 leu2D0/leu2D0 LYS2/lys2D0 met15D0/MET15 This study
VPS41/vps41TKanMX4 tor1TURA3/TOR1
RPY50 MATahis3D1 leu2D0 met15D0 ura3D0 tor1TURA3 gtr1TKanMX4 This study
RPY51 MATahis3D1 leu2D0 met15D0 ura3D0 tor1TURA3 ego3TKanMX4 This study

microscope equipped for epifluorescence and with a Nikon
DXM1200F digital camera.
RESULTS
Mutation of TOR1 is synthetically lethal in combina-
tion with mutations in the class C VPS genes: To
understand the functional divergence between Tor1 and
Tor2, we performed a genomewide scale screen to iden-
tify genes that when mutated exhibit a reduced fitness
or synthetic lethal interaction with a tor1 mutation. This
screen, performed by diploid-based synthetic lethality
analysis on microarrays (dSLAM) (Pan et al. 2004), yielded
261 interactions that met the cut-off control/experi-
mental hybridization ratio (C/E ratio) of $2 (Table 2).
Remarkably, this set of genes comprises distinct clusters
that share common functions, including transcriptional
2142 Zurita-Martinez et al.

TABLE 2 TABLE 2
Synthetic lethal and reduced fitness interaction gene (Continued)
network of TOR1
ORF Gene Phenotype
ORF Gene Phenotype
Other functions
Vacuolar function/protein sorting YIL086W CST6 NC
YLR240W VPS34 SF YGL107C RMD9 NC
YLR396C VPS33 SL YHR067W RMD12 NC
YPL045W VPS16 SL YLR226W BUR2 NC
YCL063W VAC17 SF YPR101W SNT309 NC
YNL045W VAC7 SF YDL090C RAM1 NC
YBR097W VPS15 SF YMR125W CBC1 NC
YLR148W PEP3 SL YLR369W SSQ1 NC
YEL013W VAC8 SF YPL059W GRX5 NC
YMR231W PEP5 SL YPL178W CBC2 NC
YDL077C VPS39 SF
YDR080W VPS41 SF Genes are organized in functional categories according to
the published literature. Note that only the tor1 interactions
YBR077C EGO3 SF
with genes involved in vacuolar function and protein sorting
YGR163W GTR2 SF
(except for ego1) were confirmed by tetrad dissection and the
YML121W GTR1 SF observed phenotypes, synthetic lethal (SL) or synthetic fitness
YKR007W EGO1 NC defect (SF), are indicated. The rest of the interactions have
Ribosomal function not been confirmed (NC) and should be considered as can-
YBR191W RPL21A NC didate interactions.
YNL302C RPS19B NC
YBL027W RPL19B NC
YMR143W RPS16A NC regulation, mRNA processing, ribosomal and mitochon-
YDR025W RPS11A NC drial functions, vesicle docking and fusion, protein trans-
YGL135W RPl1B NC port, microautophagy, and vacuolar inheritance (Table 2,
YJR145C RPS4A NC Figure 1A, and data not shown).
YGL076C RPL7A NC In this study only the genetic interactions involved in
YBL087C RPL23A NC vacuolar functions and protein trafficking were vali-
YNL248C RPA49 NC
dated by classic tetrad analysis and the rest should be
Uncharacterized ORFs considered as potential synthetic interactions until sub-
YDR417C YDR417C NC ject to further analysis. Tetrad analysis was conducted in
YNL086W YNL086W NC
YAL011W SWC1 NC
mating crosses between the pep3, pep5, vps16, vps33, vps15,
YDR161W YDR161W NC vps34, vac7, vac8, vac17, gtr1, gtr2, and ego3 deletion
YJL022W YJL022W NC mutants and strain SZY25, in which the entire TOR1
Mitochondrial function open reading frame was replaced with the URA3 select-
YFL016C MDJ1 NC able marker. As shown in Figure 1B the haploid meiotic
YPL118W MRP51 NC progeny of the tor1 and pep3, pep5, vps16, and vps33
YMR193W MRPL24 NC crosses were wild type (WT), ura1, or G418 resistant but
YPL013C MRPS16 NC no meiotic segregants with the ability to grow on both
YJL063C MRPL8 NC SD-ura and G418 selective media were recovered, con-
YCR046C IMG1 NC
firming that these double mutants are synthetically
YLR426W YLR426W NC
YGR171C MSM1 NC lethal. In this analysis the rest of the genes examined
YPR100W MRPL51 NC exhibited a synthetic reduced fitness interaction when
YNL284C MRPL10 NC mutated in combination with tor1, as defined by the
YNL073W MSK1 NC smaller size of the double mutant colony and a slow
YMR158W MRPS8 NC growth phenotype (illustrated in Figure 1C for the tor1
YOR150W MRPl23 NC vps15, tor1 vps34, tor1 vac7, tor1 vac8, and tor1 vac17 and
YHR091C MSR1 NC
data not shown for tor1 gtr1, tor1 gtr2, and tor1 ego3
YKL170W MRPL38 NC
YBR146W MRPS9 NC double mutants). The class C VPS genes also include
YNR037C RSM19 NC VPS39 and VPS41; importantly, these genes were iden-
YIL093C RSM25 NC tified by the tor1 dSLAM screen but scored just below the
YBR268W MRPL37 NC C/E ratio of $2. On the basis of tetrad analysis,
YGR220C MRPL9 NC mutation of these vps genes in combination with tor1
YKL138C MRPL31 NC also resulted in a synthetic reduced fitness phenotype
YNL284C MRPL10 NC
(Figure 1C). These results validate the dSLAM screen
(continued ) and indicate that mutations in the class C VPS genes
 Tor and Class C Vps Protein Complex
show a synthetic lethal interaction with tor1. For the
remainder of this study, the focus is on understanding
the basis for the synthetic lethality and reduced fitness
defect exhibited by the tor1 class C vps double mutants.
Class C vps mutants fail to recover from rapamycin-
induced growth arrest: One hallmark of the genes
linked to Tor signaling is that their mutation alters
sensitivity to rapamycin. Mutation of 18 genes (includ-
ing 14 involved in vacuolar functions and protein
trafficking) out of the 62 shown in Table 2 resulted in
rapamycin hypersensitivity as compared with the WT
strain (Figure 2A) (Chan et al. 2000; Xie et al. 2005). In
particular, mutants lacking components of the protein-
sorting apparatus, including the class C Vps complex, the
pre-autophagosomal (PAS) complex, as well as the vac8
mutant, are all extremely sensitive to rapamycin as
compared to either the WT or the tor1 strains (Figure
2A). In addition, the class C vps mutants were tested for
their ability to resume growth after rapamycin exposure.
Actively growing cells were treated with rapamycin for
6 hr, washed, and spotted on YPD medium without drug.
In contrast to the WT or tor1 strains, which readily
recovered from rapamycin-induced growth arrest, mu-
tations in class C VPS genes abolished recovery (Figure
2143
Figure 1.—TOR1 exhibits synthetically lethal
and reduced fitness interactions with genes in-
volved in protein sorting and vacuolar functions.
(A) Schematic of the distinctive functional cate-
gories, according to the published literature,
identified by the tor1 dSLAM screen. (B) Hetero-
zygous diploid strains tor1 pep3 (SZY26), tor1 pep5
(SZY27), tor1 vps16 (SZY29), and tor1 vps33
(SZY49) (see Table 1 for complete genotypes)
were sporulated and dissected on YPD solid me-
dium. After 3 days of incubation at 30°, colonies
were replica plated onto YPD containing G418
(200 mg/ml) and SC-ura media. Plates were incu-
bated for 2 days and photographed. (C) Hetero-
zygous diploid strains tor1 vps15 (SZY28), tor1
vps34 (SZY30), tor1 vac7 (SZY31), tor1 vac17
(SZY33), tor1 vac8 (SZY32), tor1 vps39 (RPY50),
and tor1 vps41 (RPY51) were sporulated and dis-
sected as indicated above. Photographs show the
colony size on the YPD plate of representative
segregants from individual tetrads.
2B). Interestingly, a similar phenotype was observed with
strains harboring mutations in the EGO/Gse protein
complex (Figure 1A), which was shown recently to play a
role in combination with TORC1 in exit from rapamycin-
induced quiescence (Dubouloz et al. 2005).
Expression of TOR1 but not TOR2 restores growth of
a tor1 pep5 double mutant: The synthetic lethality of tor1
class C vps double mutants is surprising as it has been
proposed that either Tor1 or Tor2 can provide all of the
rapamycin-sensitive essential functions attributable to
the TORC1 signaling complex. The Tor proteins share a
high degree of amino acid sequence identity with a few
discrete stretches of dissimilarity, particularly at the ex-
treme N-terminus and, to a lesser extent, toward the
C-terminal region. To understand the structural basis
for the differential functions of the two TOR genes, we
created TOR2-TOR1 chimeric hybrid alleles cloned into
low-copy, centromeric plasmids and examined their
ability to provide TOR1 function and restore viability in
tor1 pep5 meiotic segregants. First the TOR2-TOR1 hy-
brids were verified to be efficiently expressed, based on
Western blot analysis with antibodies specific for Tor1 or
Tor2 (Figure 3A). Second, we made use of the fact that a
tor1 ssd1 strain is unable to grow at 39° (Alarcon et al.
2144 Zurita-Martinez et al.
Figure 2.—Class C vps mutants are hypersensitive to rapa-
mycin and fail to recover from rapamycin-induced growth ar-
rest. (A) The WT (BY4742), tor1 (#16864), and isogenic
strains bearing mutations in different components of the class
C Vps and PAS protein complexes as well as in genes involved
in vacuolar inheritance, were grown overnight in liquid YPD
medium. Equivalent numbers of cells were serially diluted
and aliquots were spotted onto YPD and YPD containing
20 nm rapamycin. Plates were photographed following 3 days
incubation at 30°. (B) Cultures of isogenic WT (BY4742), tor1
(#16864), pep5 (#10817), vps16 (#12783), and vps33 (SZY36)
were grown to exponential phase. Cultures were divided in
half and treated with drug vehicle alone or with 100 nm rapa-
mycin for 6 hr. Cells were pelleted by centrifugation, washed
twice, and equivalent numbers of cells were spotted on YPD
medium. After incubation photographs were taken at 48 hr
for both the untreated (YPD) and rapamycin-treated cells
and 72 hr for the rapamycin-treated cells.
1999), apparently due to inability of TOR2 to support
cell integrity in the absence of the TOR1 and SSD1 genes
(Reinke et al. 2004). Modest overexpression of TOR1 or
TOR2 as well as of the TOR2-TOR1 hybrids efficiently
rescued growth of the tor1 ssd1 mutant strain at 39°, in-
dicating that the TOR2-TOR1 hybrids function to re-
store plasma membrane integrity (Figure 3B).
While ectopic expression of plasmid-borne copies of
TOR1 effectively rescued the growth of tor1 pep5 segre-
gants, overexpression of TOR2 (also from a low-copy
centromeric plasmid) failed to do so (Figure 3C). This
result indicates that TOR1 has evolved to provide a func-
tion linked to the class C Vps complex which is not
shared by TOR2. TOR2-TOR1 hybrids 1, 2, and 3 were
Figure 3.—Expression of TOR1 but not TOR2 rescues via-
bility of tor1 pep5 segregants. (A) The tor1 ssd1 mutant strain
SZY21 was transformed with vector pRS315 and its derivatives
encoding TOR1, TOR2, and the following TOR2–TOR1 hy-
brids (depicted in C): hybrid 1, Tor2 amino acids 1–1688
fused to Tor1 amino acids 1682–2470; hybrid 2, Tor2 amino
acids 1–796 fused to Tor1 amino acids 788–2470; hybrid 3,
Tor2 amino acids 1–483 fused to Tor1 amino acids 475–
2470; hybrid 4, the Tor1 amino acid sequence from 1772–
1815 was replaced by the homologous amino acid sequence
of Tor2 from 1780–1818. Protein extracts of the different
transformants were analyzed by Western blot with antibodies
specific to an N-terminal region of Tor1 or Tor2. In these ex-
tracts, Cpr1 was also detected and serve as a loading control.
(B) Equivalent cell numbers of the SZY21 transformants as in-
dicated above were serially diluted and spotted in SD-leu me-
dium. Plates were photographed after incubation at 30° or 39°
and Tor1 function was scored by the ability to complement
the conditional synthetic lethal phenotype of the tor1 ssd1
strain at 39°. (C) The tor1 pep5 diploid strain SZY27 trans-
formed with the plasmids depicted at the left was sporulated
and dissected on YPD medium. Following incubation at 30°
for 3 days the plates were photographed and replica plated
to YPD containing 200 mg/ml G418, SC-ura, and SC-leu media
to score genotypes. The numbers on the right indicate the
percent of tetrads (from a total of 10 scored) with a 4:0,
3:1, and 2:2 viable:inviable ratio.
 Tor and Class C Vps Protein Complex 2145

able to suppress the synthetic lethality of tor1 pep5 seg-

regants, albeit with an apparent differential efficiency.
However, it should be noted that this assay examines
both the increase in 4:0 segregation events and the
relative growth of the rescued segregants. Based on an
increase in 4:0 segregation events, hybrids 1, 2, and 3 all
provide TOR1 function but it would be wrong to infer
that hybrid 2 affords the best rescue because more 4:0
events were observed. Given the known segregation
pattern of CEN-based plasmids (usually 2:2), the pro-
portion of 4:0 segregation events seen with hybrids 1, 2,
and 3 need not reflect a difference in rescue efficiency.
In fact, hybrids 1, 3, and 4 rescue better based on colony
growth. These results largely map this function to the
C-terminal 788 amino acids of Tor1 (Figure 3C). Closer
examination of this region in the Tor proteins revealed a
discrete domain, from amino acid 1772 to 1815, which
is highly dissimilar. However, replacement of this Tor1
region with the corresponding Tor2 sequence (hybrid
4) did not affect the ability to restore growth of tor1
pep5 segregants (Figure 3C). Thus, we conclude that the
functional-structural differences between Tor1 and Tor2
map elsewhere in the C-terminal domain.
Tor1 does not regulate the functions of the class C
Vps complex: To gain insight into the molecular mech-
anisms that underlie the synthetic lethal interaction
between TOR1 and class C VPS genes, we considered the
hypothesis that Tor1 regulates the functions of this
complex. This model is particularly attractive since Tor1
has been localized to internal membranes that resemble
Figure 4.—Tor1 signaling does not control class C Vps com-
those associated with the endocytic pathway (Wedaman plex functions. (A) Tor1 does not control the maturation of vac-
et al. 2003). To test this hypothesis, we examined if Tor1 uolar hydrolases. Exponentially growing cultures of the WT
mutation confers defects in class C Vps complex func- (BY4742), tor1 (#16864), and pep3 (#14105) strains in YPD
tions. The class C Vps protein complex is required for medium were treated with either drug vehicle ( ) or 100 nm
non-endosomal Golgi-to-vacuole transport, cytoplasm- rapamycin (1) for 1 hr. Protein extracts were prepared and an-
alyzed by Western blot with antibodies specific for CpY, Ape1,
to-vacuole targeting (Cvt), recycling from endosomes and Alp1. (B) Tor 1 does not regulate endocytosis of the
back to the late Golgi, endocytosis, and autophagy. The high-affinity ammonium permease Mep2. The WT, tor1, and
tor1 mutant did not show defects in the maturation of pep3 strains indicated in A were transformed with plasmid
the vacuolar hydrolases CpY, Ape1, or Alp1 as compared pMep2-GFP. Transformants were grown to early exponential
to the WT strain or the pep3 mutant, which is defective in phase in SC-ura, washed twice, and resuspended in SLAD me-
dium supplemented with the required amino acids to satisfy
the proteolytic processing of these proteins (Figure 4A). auxotrophic requirements. After 4 hr incubation in this me-
Furthermore, CpY, Ape1, and Alp1 maturation was not dium, 50 mm ammonium sulfate was added to the cultures
altered by rapamycin treatment (Figure 4A). Moreover, and incubation continued for 30 min. Cell samples were col-
mutation of TOR1 did not have any effect on endocytosis lected prior to and after addition of ammonium sulfate
of the ammonium permease Mep2 elicited by ammo- (NH1 4 ) and imaged for direct epifluorescence as indicated un-
der experimental procedures. (C) Effects of TOR1 mutation in
nium addition to cells growing in ammonium-limiting autophagy-mediated maturation of Ape1. The WT (BY4742),
medium (Figure 4B). These results indicate that the and the tor1 (#16864), pep3 (#14105), vac8 (#10253), and the
endosomal-to-vacuole, the Cvt, and the non-endosomal- tor1 vac8 (SZY43) mutant strains were grown and treated with
to-vacuole protein-sorting routes are not regulated by rapamycin as indicated in A. Protein extracts were prepared
Tor signaling and that Tor1 does not regulate endocy- and analyzed by Western blot with specific Ape1 antibodies.
tosis. This result is in accord with a previous study that
identified a rapamycin-insensitive role for Tor2, but not effect on autophagy, we made use of the fact that a vac8
for Tor1, in regulating endocytosis (deHart et al. 2003). mutant is defective in the Cvt pathway. Therefore, in a
Earlier studies have shown that treatment of yeast vac8 mutant, maturation of proApe1 in the vacuole is
cells with rapamycin results in autophagy, indicating a defective; however, this defect can be bypassed by in-
role for Tor signaling in regulating this process (Noda duction of autophagy (Abeliovich et al. 2000). Matu-
and Ohsumi 1998). To test if mutation of TOR1 had any ration of Ape1 is enhanced and induced by rapamycin
2146 Zurita-Martinez et al.

in the WT and vac8 strains, respectively (Figure 4C).

Interestingly, mutation of TOR1 restores Ape1 process-
ing in the vac8 cells, and rapamycin treatment of the tor1
vac8 double mutant dramatically enhances Ape1 pro-
cessing (Figure 4C). As expected, mutation of PEP3
efficiently blocked the rapamycin-induced maturation of
Ape1. These results show that mutation of TOR1 alone
results in a low level of autophagy, whereas mutation of
PEP3 blocks this process. We reasoned that if the basis
for the synthetic lethality of the tor1 class C vps double
mutants arose from a defect in effective execution of
autophagy, tor1 mutation should also exhibit synthetic
lethality in combination with mutations in other genes
required for autophagy. Although our screen detected a
synthetic reduced fitness interaction between tor1 and
vps15 or vps34, two genes required for autophagy
(Figure 1A) (Kihara et al. 2001), we found that a tor1
apg13 double-mutant strain that should be defective in
autophagy was fully viable (data not shown).
Synthetic lethal interaction can arise between two
genes whose products act in parallel or compensating
pathways. Accordingly, we considered the hypothesis
that TOR1 regulates a pathway that functions in parallel
with the class C complex for protein sorting. A pre-
diction of this model is that key genes working within
this pathway should be synthetically lethal in combina-
tion with a pep3 mutation. A dSLAM screen with pep3
revealed 38 genes that are known when mutated to alter
the sensitivity of cells to rapamycin (Figure 5A, data not
shown) (Chan et al. 2000; Xie et al. 2005). Within this
set, 13 genes share distinctive roles in protein traffick-
ing between the ER to Golgi complex and protein
cycling between the Golgi complex and endosomes Figure 5.—Tor1 does not regulate protein sorting from the
(Figure 5A). ER to Golgi complex or protein cycling between the Golgi
To test if Tor1 has a role in protein trafficking between complex and endosomes. (A) Schematic of a fraction of
these cell compartments, we tested the effects of TOR1 the genes (grouped in functional categories according to
mutation and rapamycin treatment on a-factor matura- the published literature) that when mutated alter rapamycin
sensitivity and showed reduced fitness and synthetically lethal
tion. The mating pheromone a factor is synthesized as a interactions in combination with mutation of PEP3. Interac-
precursor and subjected to extensive glycosylation as it tions of the genes indicated in bold were confirmed by tetrad
transverses the ER and Golgi complex, and then is analysis. Genes enclosed by a box were synthetically lethal in
cleaved at the late Golgi complex by the Kex2 protease combination with the pep3 mutation. (B) The WT (BY4742),
to produce mature pheromone. Importantly, Kex2 nor- tor1 (#16864), and pep3 (#14105) mutants were grown to early
exponential phase and treated with drug vehicle ( ) or 100 nm
mally cycles between the late Golgi complex and endo- rapamycin for 20 min (1). Cell were pulse labeled with Trans
somal compartments. Thus, a-factor maturation serves 35
S-LABEL for 8 min (min) and chased with unlabeled amino
as a reporter of protein trafficking between the ER to acids for 0, 5, 6, 14, 16, and 20 min as indicated in the figure
Golgi complex and protein cycling between the Golgi (for further detail, see materials and methods). The mature
complex and endosomes. In this experiment we also (m) and processed (p) forms of a-factor (top) and CpY (bot-
tom) were immunoprecipitated with a-factor and CpY-specific
monitored the processing of CpY in more detail. While antibodies, respectively. Immunoprecipitated proteins were
mutation of PEP3 resulted in accumulation of glycosy- separated by SDS-PAGE and visualized by autoradiography.
lated forms of a factor in the Golgi complex, and also The migration of precursor forms characteristic for the Golgi
blocked CpY processing, neither mutation of TOR1 complex and the ER compartment are indicated.
nor rapamycin treatment of the WT strain perturbed
a-factor or CpY processing to any significant extent
(Figure 5B). Furthermore, rapamycin treatment in the cin treatment had no effect on the normal cycling of the
pep3 strain did not alter the ratio of mature to immature SNARE protein Snc1 from early endosomes to the Golgi
a-factor forms observed in the pep3 untreated cells compartment and back to the plasma membrane (data
(Figure 5B). In addition, mutation of TOR1 or rapamy- not shown). Collectively, these results exclude models
 Tor and Class C Vps Protein Complex 2147

Figure 6.—Class C vps mutants

show severe defects in nitrogen
metabolism. (A) The class C Vps
complex is required for adapta-
tion to nitrogen limitation. Iso-
genic WT (BY4742), and pep5
(#10817), vps16 (#12783), vps33
(SZY36), and tor1 (#16864) mu-
tant strains were grown and spot-
ted on YPD medium as indicated
in the legend to Figure 2A. Fol-
lowing overnight incubation, the
plate was photographed (see over-
night image) and then starved
for nitrogen by replica-plating to
YNB without nitrogen medium.
After incubating for 10 days, cells
were replica plated back to YPD,
incubated for 24 hr, and photo-
graphed. (B) Class C Vps complex
mutations induce the general
amino acid control response. Ex-
ponentially growing cultures of
the WT (BY4742), and the pep5
(#10817), pep3 (#14105) mutant
strains harboring the GCN4-lacZ
reporter plasmid p180 were grown
to exponential phase in SC-ura
medium. Cultures were treated
with 100 nm rapamycin for 0, 1,
and 2 hr and analyzed for b-galac-
tosidase activity. (C) Growth of the
class C vps mutants at 37° is res-
cued by addition of glutamine,
glutamate, and to a lesser extent by arginine. Isogenic WT (BY4742), and tor1 (#16864), pep3 (#14105), tor1 pep3 (strain SZY40-4
transformed with plasmid pBJ9113 expressing the pep3-108ts allele), pep5 (#10817), vps16 (#12783), vps33 (SZY36), vps39
(#13774), and vps41 (#14015) mutant strains were grown and spotted on SC medium ( ) or SC medium supplemented with
the indicated amino acid. Plates were incubated at 37° for 2 days and photographed. (D) Supplementation with glutamine or glu-
tamate does not rescue the growth defect of the tor1 vac8, tor1 gtr1, and tor1 ego3 double mutants. Isogenic WT (BY4742), tor1 vac8
(SZY43), tor1 gtr1(RPY50), and tor1 ego3 (RPY51) double mutant strains were assayed as indicated in C except that plates were in-
cubated at 30°.

that evoke a role for Tor1 in regulating the class C Vps
complex, or acting in a parallel compensating pathway
to provide a known class C Vps complex function.
The synthetic lethality between TOR1 and PEP3 mu-
tations is suppressed by amino acids: Next, we enter-
tained a model in which the class C Vps complex promotes
Tor activity. Because Tor signaling is activated by nu-
trients, we tested the ability of the class C vps mutants to
respond to nitrogen starvation. In contrast to the WT
and tor1 strains, which effectively survived a 10-day pe-
riod of incubation on ammonium-starvation medium, the
class C vps mutants failed to resume growth (Figure 6A).
Previous reports have shown that class C vps mutants
contain severely fragmented vacuoles and are unable to
store normal levels of basic amino acids in the vacuole
(Kitamoto et al. 1988; Raymond et al. 1992). Low levels
of intracellular amino acids, or rapamycin exposure, are
known to trigger the general amino acid control re-
sponse by inactivation of eIF2a, which results in a block
to general protein synthesis and preferential translation
of Gcn4. We examined if the low amino acid levels in
class C vps mutants would suffice to activate Gcn4
translation. In accord with the above observation, pep3
or pep5 mutations resulted in robust Gcn4 translation,
comparable to that observed in the WT strain treated
with rapamycin (Figure 6B).
It has been proposed that glutamine and possibly
glutamate, which are amino acids central to nitrogen
metabolism, regulate nutrient signaling pathways, in-
cluding the Tor pathway (Crespo et al. 2002; reviewed by
Liu and Butow 2006). These observations prompted us
to examine in more detail the intracellular amino acid
content in the class C vps mutants. Under the growth
conditions analyzed (active growth in YPD medium) the
pep3, pep5, and vps33 mutants showed a lower level of the
basic amino acids lysine, histidine, and arginine than
that detected in the WT strain, in accord with an earlier
report (Table 3) (Kitamoto et al. 1988). Remarkably, in
contrast to the WTand tor1 strains, glutamate levels were
significantly reduced (1.5-fold) in the class C
vps mutants. The class C Vps complex is also required
to support growth at 37° (Figure 6C) (Robinson et al.
2148 Zurita-Martinez et al.

TABLE 3
The class C vps mutants show dramatically reduced levels of amino acids at 37°

Amino acid content (nmol/OD600)

Glutamate Glutamine Lysine Histidine Arginine
Strain 30° 37° 30° 37° 30° 37° 30° 37° 30° 37°
WT 108 6 10 100 6 6 17 6 2 8 6 0 18 6 1 8 6 0.7 8 6 1 4 6 0.1 14 6 0 6 6 2
tor1 143 6 5 96 6 5 24 6 1 14 6 0.1 23 6 1 9 6 0.3 7 6 0.4 4 6 0.3 16 6 1.4 7 6 0.3
pep3 81 6 2 29 6 0 19 6 1.5 6 6 0.5 5 6 2 4 6 1 2 6 1.2 160 5 6 1 5 6 0.4
pep5 79 6 3 6 6 2 15 6 0.3 7 6 1 6 6 0.4 5 6 0.3 2 6 0.5 ND 8 6 0.5 6 6 0.3
vps33 75 6 5 39 6 0.2 16 6 1 8 6 0 8 6 0.3 6 6 0.5 2 6 1.1 ND 8 6 1.2 7 6 0.1
ND, not detected.

1991, Koning et al. 2002). We sought to test if this growth
defect is linked to amino acid levels. Exponentially grow-
ing cultures of the different strains were shifted from
30° to 37° and the amino acid levels were determined.
Interestingly, shift to 37° for 3 hr caused a modest de-
cline in glutamate and a near twofold decrease in glu-
tamine in both the WT and the tor1 strains. In the pep3,
pep5, and vps33 mutants the concentration of these
amino acids declined more markedly, two- to threefold
depending on the strain, and glutamate reached a three-
fold lower level than the one observed in the WT strain
under similar conditions (Table 3). Moreover, supple-
mentation of the growth media with glutamate, or with
glutamine and to lesser extent with arginine, restored
growth of the pep3, pep5, vps33, vps39, and vps41 mutant
strains at 37°. This effect was specific and was not
observed when the individual basic amino acids lysine
or histidine were added as supplements (Figure 6C).
The vps16 strain has a more severe growth defect at 37°
than the rest of the class C vps mutants and this is only
marginally alleviated by glutamine supplementation (see
below for discussion). Strikingly, glutamate or glutamine
and less efficiently arginine also supported the growth
of a tor1 pep3 double-mutant strain carrying a partial loss
of function pep3ts allele on a plasmid (Figure 6C). In con-
trast, supplementation with glutamine or glutamate did
not rescue the growth defect of the tor1 vac8, tor1 gtr1, or
tor1 ego3 double mutants (Figure 6D). Finally, supple-
mentation with glutamine, glutamate, arginine, lysine,
and histidine partially rescued the viability of tor1 pep5
segregants; however, these segregants grew poorly and
rapidly accumulated suppressor mutations (data not
shown). These results argue that the synthetic lethality of
the tor1 pep3 double mutant derives from the metabolic
derangement that underlies the reduced amino acid con-
centrations observed in the class C vps mutants.
DISCUSSION
Our genomewide search to define synthetic fitness or
lethal interaction partners of TOR1 identified sets of
genes that provide distinct functions. Among the syn-
thetically lethal genes identified, four encode compo-
nents of the class C Vps complex that functions in the
recognition and fusion of vesicles with vacuolar and
secretory membranes. This screen also identified a syn-
thetic reduced fitness interaction between tor1 and mu-
tations in genes encoding the components of the EGO/
Gse complex, confirming and extending a previous
study (Dubouloz et al. 2005). The EGO/Gse complex
localizes to pre-vacuolar and vacuolar membranes and is
required for sorting of the Gap1 amino acid permease to
the plasma membrane in response to intracellular amino
acids (Gao and Kaiser 2006).
Rapamycin exposure results in autophagy and thereby
in a massive influx of membranes into the vacuolar
membrane (Noda and Ohsumi 1998). In combination
with TORC1, the EGO/Gse complex has been proposed
to play a role in recovery from rapamycin-induced cell
cycle arrest by enabling recycling of vacuolar mem-
branes via microautophagy (Dubouloz et al. 2005). We
have shown here that class C vps mutants are unable to
recover from prolonged exposure to rapamycin. Al-
though it is possible that the class C Vps complex is
required for microautophagy, we were unable to address
this question since class C vps mutants fail to complete
autophagy and contain severely fragmented vacuoles.
We find that the structural difference between Tor1
and Tor2 to support viability of tor1 pep5 segregants maps
to the C-terminal 788 amino acid region of Tor1. This
result is in contrast with a previous study which con-
cluded that the ability of a Tor1SR (rapamycin-resistant
mutant) to confer rapamycin resistance in a vps16
mutant lies in the N-terminal 120 amino acid region of
Tor1 (Xie et al. 2005). At present we do not have a good
explanation for this discrepancy other than the biolog-
ical assays to test for Tor1 function in the two studies were
different.
Our screen also identified the Vps34 phosphatidyli-
nositol 3-kinase and the Vps15 protein kinase, members
of the PAS protein complex which functions in autoph-
agy and protein sorting (Stack et al. 1995; Kihara et al.
2001), and genes involved in vacuolar inheritance (Fig-
ure 1A). Taken together these results reveal a prominent
link between Tor signaling and vacuolar function. This
 Tor and Class C Vps Protein Complex
view is further underscored by studies that have localized
different components of the Tor pathway to the vacuolar
membrane, including Tor2, Kog1, and Tco89 (Cardenas
and Heitman 1995; Reinke et al. 2004; Araki et al. 2005).
An important function of the vacuole is to preserve
amino acid homeostasis by sequestering basic amino
acids, which are toxic when present at high concen-
trations in the cytosol (reviewed by Klionsky et al. 1990).
Our results and those of others have shown that
mutants lacking components of the class C Vps complex
are unable to recover from ammonium starvation, they
have low concentrations of intracellular amino acids,
particularly glutamate and glutamine, and this concen-
tration is further reduced upon shift of these mutants
from 30° to 37°. Moreover, class C vps mutants have
growth defects at 37° (Figure 6C) (Robinson et al. 1991,
Koning et al. 2002). Remarkably, addition of glutamate
or glutamine and to lesser extent arginine restored the
growth at 37° of individual class C vps mutants and a tor1
pep3 mutant carrying a pep3ts allele, and partially rescued
the viability of tor1 pep5 segregants. The effect of
arginine could be explained by the ability of this amino
acid to be converted into glutamate by the concerted
actions of arginase and ornithine transaminase (re-
viewed by Davis 1986). We found that the vps16 strain
was only marginally rescued by glutamine supplementa-
tion, suggesting that Vps16 has an additional function(s)
different from that shared with the other members of
the class C Vps complex. In this regard a role for Vps16
in regulating mRNA decapping and stability has been
demonstrated (Zhang et al. 1999). Interestingly, genes
encoding two subunits of the cap-binding complex,
CBC1 and CBC2, were also identified by the tor1 syn-
thetic screen and a rapamycin-sensitive role for Tor in
controlling mRNA stability has been described (Albig
and Decker 2001). Thus, it is possible that Tor1 func-
tion becomes compromised in the vps16 mutant via
these activities independent of the class C Vps complex
function.
In summary, our results indicate that the class C Vps
complex is required to maintain amino acid homeosta-
sis for effective Tor activity and lend further support to
the proposal that glutamate/glutamine activates Tor
signaling (Crespo et al. 2002). These studies also dem-
onstrate that Tor1 is more efficient than Tor2 at provid-
ing rapamycin-sensitive Tor signaling under conditions
where intracellular amino acids are drastically reduced.
In support of this model, whereas Tor1 is a bona fide
member of the rapamycin-sensitive TORC1 complex,
Tor2 weakly interacts with this complex only in cells
lacking Tor1 and no stable association of Tor2 with
TORC1 has been detected in wild-type cells (Loewith
et al. 2002; Reinke et al. 2004).
Strikingly, although both humans and many fungi
express a single Tor kinase, the Tor genes have been
independently duplicated in both the budding yeast
S. cerevisiae and the fission yeast Schizosaccharomyces pombe
2149
(reviewed by Weisman 2004). Interestingly, in both cases
one of the two paralogs is essential (TOR2) and the other
is not under standard conditions (TOR1). Early studies
in S. pombe revealed a role for Tor1 in amino acid uptake
(Weisman et al. 2005). A more recent study has proposed
a shared function for Tor1 and Tor2 in enabling cell
proliferation and survival under both normal and adverse
conditions and a positive and negative role for Tor1 and
Tor2, respectively, in regulating G1 arrest and sexual
differentiation (Uritani et al. 2006). Taken together, our
findings provide a physiological basis for understanding
the functional differences that distinguish Tor1 and
Tor2 in S. cerevisiae and yield insight as to why the two
genes are among the few (2–8%) retained following the
genome duplication and massive gene loss event that
marked the evolution of hemiascomycetous yeasts.
We thank Todd Graham for advice and suggestions with the a factor
processing experiments. We thank Todd Graham, Elizabeth Jones,
Yoshinori Ohsumi, Alan Hinnebusch, and Julian Rutherford for gen-
erous gifts of plasmids and antisera and Joseph Heitman and John
McCusker for critical reading of the manuscript. This work was
supported by R01CA114107 from the National Cancer Institute (to
M.E.C); Xuewen Pan was supported by the Leukemia and Lymphoma
Society and by National Institute of Health grant HG-002432 (to J.D.B).
LITERATURE CITED
Abeliovich, H., W. A. Dunn, Jr., J. Kim and D. J. Klionsky,
2000 Dissection of autophagosome biogenesis into distinct nu-
cleation and expansion steps. J. Cell Biol. 151: 1025–1034.
Alarcon, C. M., M. E. Cardenas and J. Heitman, 1996 Mammalian
RAFT1 kinase domain provides rapamycin-sensitive TOR func-
tion in yeast. Genes Dev. 10: 279–288.
Alarcon, C. M., J. Heitman and M. E. Cardenas, 1999 Protein ki-
nase activity and identification of a toxic effector domain of the
target of rapamycin TOR proteins in yeast. Mol. Biol. Cell 10:
2531–2546.
Albig, A. R., and C. J. Decker, 2001 The target of rapamycin signal-
ing pathway regulates mRNA turnover in the yeast Saccharomyces
cerevisiae. Mol. Biol. Cell 12: 3428–3438.
Araki, T., Y. Uesono, T. Oguchi and E. A. Toh, 2005 LAS24/KOG1,
a component of the TOR complex 1 (TORC1), is needed for re-
sistance to local anesthetic tetracaine and normal distribution of
actin cytoskeleton in yeast. Genes Genet. Syst. 80: 325–343.
Banta, L. M., J. S. Robinson, D. J. Klionsky and S. D. Emr,
1988 Organelle assembly in yeast: characterization of yeast mu-
tants defective in vacuolar biogenesis and protein sorting. J. Cell
Biol. 107: 1369–1383.
Beck, T., and M. N. Hall, 1999 The TOR signalling pathway con-
trols nuclear localization of nutrient-regulated transcription fac-
tors. Nature 402: 689–692.
Berset, C., H. Trachsel and M. Altmann, 1998 The TOR (target
of rapamycin) signal transduction pathway regulates the stability
of translation initiation factor eIF4G in the yeast Saccharomyces cer-
evisiae. Proc. Natl. Acad. Sci. USA 95: 4264–4269.
Cardenas, M. E., and J. Heitman, 1995 FKBP12-rapamycin target
TOR2 is a vacuolar protein with an associated phosphatidylino-
sitol-4 kinase activity. EMBO J. 14: 5892–5907.
Cardenas, M. E., N. S. Cutler, M. C. Lorenz, C. J. Di Como and
J. Heitman, 1999 The TOR signaling cascade regulates gene
expression in response to nutrients. Genes Dev. 13: 3271–3279.
Chan, T. F., J. Carvalho, L. Riles and X. F. Zheng, 2000 A chem-
ical genomics approach toward understanding the global func-
tions of the target of rapamycin protein (TOR). Proc. Natl.
Acad. Sci. USA 97: 13227–13232.
Chen, E. J., and C. A. Kaiser, 2002 Amino acids regulate the intra-
cellular trafficking of the general amino acid permease of Saccha-
romyces cerevisiae. Proc. Natl. Acad. Sci. USA 99: 14837–14842.
2150 Zurita-Martinez et al.
Cherkasova, V. A., and A. G. Hinnebusch, 2003 Translational con-
trol by TOR and TAP42 through dephosphorylation of eIF2alpha
kinase GCN2. Genes Dev. 17: 859–872.
Crespo, J. L., and M. N. Hall, 2002 Elucidating TOR signaling and
rapamycin action: lessons from Saccharomyces cerevisiae. Microbiol.
Mol. Biol. Rev. 66: 579–591.
Crespo, J. L., T. Powers, B. Fowler and M. N. Hall, 2002 The
TOR-controlled transcription activators GLN3, RTG1, and
RTG3 are regulated in response to intracellular levels of gluta-
mine. Proc. Natl. Acad. Sci. USA 99: 6784–6789.
Davis, R. H., 1986 Compartmental and regulatory mechanisms in
the arginine pathways of Neurospora crassa and Saccharomyces cere-
visiae. Microbiol. Rev. 50: 280–313.
deHart, A. K., J. D. Schnell, D. A. Allen, J. Y. Tsai and L. Hicke,
2003 Receptor internalization in yeast requires the Tor2-Rho1
signaling pathway. Mol. Biol. Cell 14: 4676–4684.
De Virgilio, C., and R. Loewith, 2006 Cell growth control: little
eukaryotes make big contributions. Oncogene 25: 6392–6415.
Dubouloz, F., O. Deloche, V. Wanke, E. Cameroni and C. De
Virgilio, 2005 The TOR and EGO protein complexes orches-
trate microautophagy in yeast. Mol. Cell 19: 15–26.
Gao, M., and C. A. Kaiser, 2006 A conserved GTPase-containing
complex is required for intracellular sorting of the general
amino-acid permease in yeast. Nat. Cell Biol. 8: 657–667.
Gimeno, C. J., P. O. Ljungdahl, C. A. Styles and G. R. Fink,
1992 Unipolar cell divisions in the yeast S. cerevisiae lead to filamen-
tous growth: regulation by starvation and RAS. Cell 68: 1077–1090.
Goldstein, A. L., and J. H. McCusker, 1999 Three new dominant
drug resistance cassettes for gene disruption in Saccharomyces cer-
evisiae. Yeast 15: 1541–1553.
Graham, T. R., 1998 Metabolic labeling and immunoprecipitation
of yeast proteins. John Wiley & Sons, New York.
Hardwick, J. S., F. G. Kuruvilla, J. K. Tong, A. F. Shamji and S. L.
Schreiber, 1999 Rapamycin-modulated transcription defines the
subset of nutrient-sensitive signaling pathways directly controlled
by the Tor proteins. Proc. Natl. Acad. Sci. USA 96: 14866–14870.
Heitman, J., N. R. Movva and M. N. Hall, 1991 Targets for cell cy-
cle arrest by the immunosuppressant rapamycin in yeast. Science
253: 905–909.
Kihara, A., T. Noda, N. Ishihara and Y. Ohsumi, 2001 Two distinct
Vps34 phosphatidylinositol 3-kinase complexes function in au-
tophagy and carboxypeptidase Y sorting in Saccharomyces cerevi-
siae. J. Cell Biol. 152: 519–530.
Kitamoto, K., K. Yoshizawa, Y. Ohsumi and Y. Anraku, 1988 Mutants
of Saccharomyces cerevisiae with defective vacuolar function. J. Bacteriol.
170: 2687–2691.
Klionsky, D. J., P. K. Herman and S. D. Emr, 1990 The fungal vacuole:
composition, function, and biogenesis. Microbiol. Rev. 54: 266–292.
Komeili, A., K. P. Wedaman, E. K. O’Shea and T. Powers,
2000 Mechanism of metabolic control. Target of rapamycin sig-
naling links nitrogen quality to the activity of the Rtg1 and Rtg3
transcription factors. J. Cell Biol. 151: 863–878.
Koning, A. J., L. L. Larson, E. J. Cadera, M. L. Parrish and R. L.
Wright, 2002 Mutations that affect vacuole biogenesis inhibit
proliferation of the endoplasmic reticulum in Saccharomyces cere-
visiae. Genetics 160: 1335–1352.
Kubota, H., T. Obata, K. Ota, T. Sasaki and T. Ito,
2003 Rapamycin-induced translational derepression of GCN4
mRNA involves a novel mechanism for activation of the eIF2[a]
Kinase GCN2. J. Biol. Chem. 278: 20457–20460.
Liu, Z., and R. A. Butow, 2006 Mitochondrial retrograde signaling.
Annu. Rev. Genet. 40: 159–185.
Loewith, R., E. Jacinto, S. Wullschleger, A. Lorberg, J. L. Crespo
et al., 2002 Two TOR complexes, only one of which is rapamycin
sensitive, have distinct roles in cell growth control. Mol. Cell 10:
457–468.
Longtine, M. S., A. McKenzie, III, D. J. Demarini, N. G. Shah,
A. Wach et al., 1998 Additional modules for versatile and eco-
nomical PCR-based gene deletion and modification in Saccharo-
myces cerevisiae. Yeast 14: 953–961.
Lorenz, M. C., and J. Heitman, 1995 TOR mutations confer rapamy-
cin resistance by preventing interaction with FKBP12-rapamycin.
J. Biol. Chem. 270: 27531–27537.
Noda, T., and Y. Ohsumi, 1998 Tor, a phosphatidylinositol kinase ho-
mologue, controls autophagy in yeast. J. Biol. Chem. 273: 3963–3966.
Pan, X., D. S. Yuan, D. Xiang, X. Wang, S. Sookhai-Mahadeo et al.,
2004 A robust toolkit for functional profiling of the yeast ge-
nome. Mol. Cell 16: 487–496.
Peterson, M. R., and S. D. Emr, 2001 The class C Vps complex func-
tions at multiple stages of the vacuolar transport pathway. Traffic
2: 476–486.
Powers, T., and P. Walter, 1999 Regulation of ribosome biogenesis
by the rapamycin-sensitive TOR-signaling pathway in Saccharomy-
ces cerevisiae. Mol. Biol. Cell 10: 987–1000.
Raymond, C. K., I. Howald-Stevenson, C. A. Vater and T. H.
Stevens, 1992 Morphological classification of the yeast vacuo-
lar protein sorting mutants: evidence for a prevacuolar compart-
ment in class E vps mutants. Mol. Biol. Cell 3: 1389–1402.
Reinke, A., S. Anderson, J. M. McCaffery, J. Yates, III, S. Aronova
et al., 2004 TOR complex 1 includes a novel component, Tco89p
(YPL180w), and cooperates with Ssd1p to maintain cellular integ-
rity in Saccharomyces cerevisiae. J. Biol. Chem. 279: 14752–14762.
Rieder, S. E., and S. D. Emr, 1997 A novel RING finger protein com-
plex essential for a late step in protein transport to the yeast vac-
uole. Mol. Biol. Cell 8: 2307–2327.
Robinson, J. S., T. R. Graham and S. D. Emr, 1991 A putative zinc
finger protein, Saccharomyces cerevisiae Vps18p, affects late Golgi func-
tions required for vacuolar protein sorting and efficient alpha-factor
prohormone maturation. Mol. Cell. Biol. 11: 5813–5824.
Rohde, J., J. Heitman and M. E. Cardenas, 2001 The TOR kinases
link nutrient sensing to cell growth. J. Biol. Chem. 276: 9583–9586.
Rohde, J. R., S. Campbell, S. A. Zurita-Martinez, N. S. Cutler,
M. Ashe et al., 2004 TOR controls transcriptional and transla-
tional programs via Sap-Sit4 protein phosphatase signaling effec-
tors. Mol. Cell. Biol. 24: 8332–8341.
Schiestl, R. H., and R. D. Gietz, 1989 High efficiency transforma-
tion of intact yeast cells using single stranded nucleic acids as a
carrier. Curr. Genet. 16: 339–346.
Sherman, F., 2002 Getting started with yeast. Methods Enzymol.
350: 3–41.
Srivastava, A., C. A. Woolford and E. W. Jones, 2000 Pep3p/
Pep5p complex: a putative docking factor at multiple steps of ve-
sicular transport to the vacuole of Saccharomyces cerevisiae. Genet-
ics 156: 105–122.
Stack, J. H., B. Horazdovsky and S. D. Emr, 1995 Receptor-mediated
protein sorting to the vacuole in yeast: roles for a protein kinase, a
lipid kinase and GTP-binding proteins. Annu. Rev. Cell Dev. Biol 11:
1–33.
Uritani, M., H. Hidaka, Y. Hotta, M. Ueno, T. Ushimaru et al.,
2006 Fission yeast Tor2 links nitrogen signals to cell proliferation
and acts downstream of the Rheb GTPase. Genes Cells 11: 1367–1379.
Valenzuela, L., C. Aranda and A. Gonzalez, 2001 TOR modulates
GCN4-dependent expression of genes turned on by nitrogen lim-
itation. J. Bacteriol. 183: 2331–2334.
Wedaman, K. P., A. Reinke, S. Anderson, J. Yates, III, J. M. McCaffery
et al., 2003 Tor kinases are in distinct membrane-associated protein
complexes in Saccharomyces cerevisiae. Mol. Biol. Cell 14: 1204–1220.
Weisman, R., 2004 The fission yeast TOR proteins and the rapamycin
response: an unexpected tale. Curr. Top. Microbiol. Immunol.
279: 85–95.
Weisman, R., I. Roitburg, T. Nahari and M. Kupiec, 2005 Regu-
lation of leucine uptake by tor11 in Schizosaccharomyces pombe is sen-
sitive to rapamycin. Genetics 169: 539–550.
Wurmser, A. E., T. K. Sato and S. D. Emr, 2000 New component of
the vacuolar class C–Vps complex couples nucleotide exchange
on the Ypt7 GTPase to SNARE-dependent docking and fusion.
J. Cell Biol. 151: 551–562.
Xie, M. W., F. Jin, H. Hwang, S. Hwang, V. Anand et al., 2005 In-
sights into TOR function and rapamycin response: chemical geno-
mic profiling by using a high-density cell array method. Proc. Natl.
Acad. Sci. USA 102: 7215–7220.
Zaragoza, D., A. Ghavidel, J. Heitman and M. C. Schultz,
1998 Rapamycin induces the G0 program of transcriptional re-
pression in yeast by interfering with the TOR signaling pathway.
Mol. Cell. Biol. 18: 4463–4470.
Zhang, S., C. J. Williams, K. Hagan and S. W. Peltz, 1999 Mu-
tations in VPS16 and MRT1 stabilize mRNAs by activating an inhib-
itor of the decapping enzyme. Mol. Cell. Biol. 19: 7568–7576.
Communicating editor: A. P. Mitchell