Parasitology International 55 (2006) S87 – S90

www.elsevier.com/locate/parint

Copro-DNA tests for diagnosis of animal taeniid cestodes

Alexander Mathis *, Peter Deplazes
Institute of Parasitology, Vetsuisse-Faculty, University of Zurich, Winterthurerstr. 266a, 8057 Zurich, Switzerland
Available online 1 December 2005

Abstract

PCR has proven its value for the diagnosis of taeniid cestodes in animal definitive hosts, although only few specific tests are available at the
moment (Echinococcus multilocularis, Echinococcus granulosus Fsheep strain_). Additional tests with specificities for further taeniids are urgently
needed and new tests are currently being developed, e.g. a multiplex PCR for simultaneous detection of E. multilocularis, E. granulosus (all
strains) and Taenia spp. (all species). PCR is a technically demanding and expensive technique: DNA isolation from faecal specimens remains a
laborious task because of the presence of PCR-inhibitory substances, and special precautions need to be taken to avoid false-positive results due to
cross-contamination of amplification reactions. PCR, therefore, is mainly used for confirmative purposes of coproantigen-positive samples or for
identification of taeniid eggs recovered from faecal specimens or from environmental samples.
D 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: PCR; Multiplex PCR; Diagnosis; Echinococcus; Taenia; DNA isolation; Faecal specimen

1. Introduction of coproantigen-positive samples or, as the method of choice,

In contrast to many other helminth infections, intra vitam
diagnosis of taeniid tapeworm infections cannot reliably be
achieved by microscopical detection of worm eggs in faecal
samples by routine coprological methods (flotation technique)
because eggs of all species of the family Taeniidae (genera
Echinococcus and Taenia) are morphologically indistinguish-
able from one another. Two alternative approaches, the
detection of specific coproantigens by ELISA [1,2] and
copro-DNA, have been successfully developed and evaluated.
Parasite DNA excreted with eggs, proglottids or parasite
cells (virtually no cell-free DNA is present in faecal material
due to the activity of the intestinal microflora) can be detected
from faeces after amplification by PCR. However, no
commercially available kits exist for copro-DNA detection.
DNA isolation from faecal specimens remains a cumbersome
task and PCR is a demanding technology which has to be
performed in specialized laboratories. Therefore, PCR cannot
be considered suitable for routine diagnostic or large-scale
purposes. PCR-based diagnosis of intestinal infections has to
be implemented within a diagnostic strategy. Many diagnostic
laboratories mainly use copro-PCR for confirmatory purposes
* Corresponding author. Tel.: +41 44 635 85 36; fax: +41 44 635 89 07.
E-mail address: alexander.mathis@access.unizh.ch (A. Mathis).
1383-5769/$ - see front matter D 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.parint.2005.11.012
for identification of taeniid eggs recovered from faecal speci-
mens or from environmental samples [1,3,4]. Specific PCR
assays are available for only a limited number of species or
genotypes, and the broadening of the diagnostic repertoire is
urgently needed.
2. DNA isolation from faecal material
The pioneering work of Bretagne and colleagues [5]
described a DNA isolation protocol from 4 g of faeces. After
an alkaline lysis step and an organosolvent extraction, DNA
was purified with a commercial DNA purification kit. The
procedure requires the use of highly toxic chemicals (phenol,
chloroform) and needs large, organosolvent-resistant vessels
with suitable centrifuges. Sensitivity of downstream PCR was
reported to be 1 Echinococcus multilocularis egg in 1500 Al of
diluted fox faeces [6]. However, several groups have reported
that despite these high purification efforts some samples still
exhibited very strong inhibitory effects on DNA amplification.
For example, an increase in sensitivity from 24% to 82% was
achieved [7] after introduction of an additional DNA purifica-
tion step to this already laborious protocol. Meanwhile,
commercial kits tailored for DNA isolation from specimens
rich in PCR inhibitory substances (faeces, soil) are available. A
precedent alkaline lysis step (or alternatively boiling the
S88 A. Mathis, P. Deplazes / Parasitology International 55 (2006) S87 – S90
samples in 0.5% SDS [8]), however, is still required as lysis of
taeniid eggs is not effectual by the standard procedure
(proteinase K digestion in detergent-containing buffer) provid-
ed by such commercial DNA isolation kits [6]. By default, only
approximately 200 mg of faeces can be processed with such
kits. In order to enhance the chances to detect organisms that
are unevenly distributed in the faeces (which might hold true
for taeniid eggs), larger amount of faeces can initially be
processed but DNA yield and concentration is not higher as
compared to the standard protocol due to the limited capacity
of the DNA-binding columns of the kits. Whereas the standard
protocol has been used for copro-diagnosis of taeniids [9,10],
no reports on the suitability of the up-scaled protocol for
detection of taeniids are available, but we are currently
investigating this topic with faeces from carnivores experi-
mentally infected with E. multilocularis.
One approach to overcome the limitations of restricted
specimen volume and PCR inhibition is to first concentrate
helminth eggs by a combination of sequential sieving and an in-
between step of flotation in zinc chloride solution [11]. Hence,
helminth eggs, which are highly resistant in the environment,
can be concentrated from large sample volumes (up to 20 g were
investigated) in a few microliters of fluid and detected by means
of an inverted microscope in a closed tube. DNA isolation from
these eggs can be achieved using a simplified protocol of the
alkaline lysis method combined with a commercial kit with no
need for organosolvent extractions and with usual 1.5 ml tubes
in combination with table centrifuges. Whereas PCR inhibition
with DNA obtained with this method was of little concern with
faeces from red foxes, dog faeces required an additional
incubation step with Chelex beads and extra washing steps of
the DNA-adsorbing matrices [12].
As microscopic egg detection using this approach was
shown to be very sensitive, only samples containing taeniid
eggs need to be further investigated by the costly PCR [13].
This might be particularly advantageous in areas or animal
populations with low prevalences of taeniid infections.
Obviously, this approach is suitable for the diagnosis of gravid
infections only, whereas approaches using DNA isolated
directly from faeces principally hold the potential to also
detect prepatent infections. Indeed, PCR was positive with such
material from cats experimentally infected with E. multi-
locularis in the first days of infection (probably detecting
protoscolices which did not establish and were excreted) and
towards the end of the prepatent period (indicating the
excretion of worms or single proglottids) [1]. In a single,
laborious field study [6], PCR with DNA isolated from faecal
samples (rectal contents) according to the method of Bretagne
and colleagues [5] detected 49 of 63 wild red foxes harbouring
immature worms as determined at necropsy with a parasito-
logical test (intestinal scraping technique) which suffers from a
low sensitivity. The sensitivity of PCR-detection was depen-
dent on the worm burden. All 5 foxes harbouring more than
1000 immature worms were detected and 70% of the animals
with less than 10 parasites.
An important limitation of DNA-based diagnosis is the fact
that formalin-fixed faecal material is not suitable (due to DNA
degradation). However, faecal material stored in 70% ethanol
or at 20 -C or 80 -C (which kills the eggs) can be used
[5,6,11,13]; in case that one aims at identifying taeniid eggs,
prolonged storage at ambient temperature might be feasible
thanks to the robustness of the eggs.
3. PCR
Although the methods for isolating DNA from faecal
specimens have very much improved regarding the separation
of PCR-inhibitory substances, a co-purification of such
substances cannot absolutely be excluded. Therefore, control
PCRs need to be performed with all samples by spiking parallel
reactions either with target DNA, which bears a considerable
risk for building up a cross-contamination problem, or with a
size-modified target [11]. Furthermore, it is highly recom-
mended to include PCR facilitators, such as bovine serum
albumin (BSA), in the reaction buffers. Great attention should
be paid to prevent carryover of amplicons. This can be
achieved by using the dUTP/UNG system and aerosol-guarded
tips as well as by strictly separating the areas of DNA isolation,
PCR and amplicon analysis.
Copro-DNA diagnosis requires highly specific primers as
DNA from a plethora of organisms might be present in faecal
specimens. The complexity of DNA is lower in samples with
the above described precedent isolation of taeniid eggs, and
less stringent primers might be employed, particularly with an
additional analysis of the amplicon by RFLP, SSCP or
sequencing (although such approaches have not been evaluat-
ed). For identification or genotyping of taeniids with Fpure_
parasite DNA (obtained post mortem from isolated worms or
from metacestode material from intermediate hosts), primers
whose specificity with diagnostic specimens is not known can
be employed. Hence, primers targeting nuclear or mitochon-
drial genes combined with further analysis of the amplicons (as
above) have been used to identify Echinococcus granulosus
strains or Taenia spp. [14 –18]. Random amplification of
polymorphic DNA (RAPD) has also proven its value for this
purpose [19]. Whether these approaches have the potential to
differentiate taeniid eggs isolated from faeces remains to be
determined.
PCR not only allows to distinguish the morphologically
identical eggs of all the taeniids, but it also offers the possibility
to determine egg numbers. However, due to the irregular
shedding of eggs, such quantitative PCRs, which to our
knowledge have yet to be established, are of limited use for
investigating single faecal samples from few animals. Howev-
er, such an approach might contribute to transmission/
epidemiological studies when employed on a larger scale in
populations of definitive hosts over a prolonged period of time.
3.1. E. multilocularis
Two different genes have so far been targeted in diagnostic
PCR for the detection of intestinal E. multilocularis infection in
faecal samples of foxes, the U1 snRNA gene [5] and the mt
12S rRNA gene [6,13] (Table 1). However, the primers that are
 A. Mathis, P. Deplazes / Parasitology International 55 (2006) S87 – S90 S89

Table 1 with E. granulosus (3 isolates, without strain identification),

PCR primers evaluated for identifying taeniids from faecal specimensa Taenia crassiceps (1), Taenia hydatigena (3), Taenia martis
(Primer designation) Primer sequence (5VY3V) Ref. Target; comments (2), Taenia mustela (1), Taenia ovis (1), Taenia pisiformis (1),
E. multilocularis Taenia polyacantha (2), Taenia serialis (1), Taenia taeniafor-
GTGAGGCGATGTGTGGTGATGGAGA [5] U1 sRNA gene: may mis (2), Mesocestoides leptothylacus (1), and several isolates
GAAGGCAAGTGGTCAGGGGCAGTAG yield non-specific
of nematodes of fox origin (Toxocara sp., Uncinaria sp.). This
products when used
with metacestode test was furthermore extensively evaluated with total DNA
material containing extracted from rectal samples of 250 wild foxes revealing a
host DNA specificity of 100% as assessed with the results obtained with
(unpublished the intestinal scraping technique (ICS) after necropsy.
observation)
Outer primers: [6] Mitochondrial 12S
(P60.for) RNA gene; used in 3.2. E. granulosus
TTAAGATATATGTGGTACAGGATTAGATACCC two-tube nested PCR
(P375.rev) PCR primers that have been evaluated for diagnosis of E.
AACCGAGGGTGACGGGCGGTGTGTACC granulosus from faecal samples have been reported from two
Inner primers:
groups [9,12] (Table 1). Both systems provide the possibility to
(Pnest.for)
ACAATACCATATTACAACAATATTCCTATC identify E. granulosus Fsheep strain_. Stefanic et al. [12]
(Pnest.rev) derived genotype-specific primers from in silico analysis of
ATATTTTGTAAGGTTGTTCTA mitochondrial 12S RNA genes yielding a single band of 255 bp
Outer primers: [8] Mitochondrial 12S upon analysis of amplicons on agarose gels in positive cases.
(Em-1) RNA gene; modified
Specificity for E. granulosus Fsheep strain_ was ascertained by
TAAGATATATGTGGTACAGGATTAGATACCC from [6] for use in
(Em-2) one-tube nested PCR testing DNA from other E. granulosus strains (Fhorse strain_,
GGTGACGGGCGGTGTTGTA Fcattle strain_, Fcamel strain_, Fpig strain_ [15]) and from a large
Inner primers: number of cestode species. Abbasi and colleagues [9] used the
(Em-3) information on a newly identified repeated sequence from E.
ATATTACAACAATATTCCTATC
granulosus Fsheep strain_ to design PCR primers which yield a
(Em-4)
ATATTTTGTAAGGTTGTTCTA banding pattern upon gel electrophoresis. Specificity was tested
(EM-H15) [13] Mitochondrial 12S with DNA from 9 other cestode species. Different banding
CCATATTACAACAATATTCCTATC RNA gene; modified patterns were obtained with E. granulosus DNA from
(EM-H17) from [6] for use in metacestodes from a horse and from a camel, but the
GTGAGTGATTCTTGTTAGGGGAAG single PCR
significance of these observations are not clear yet.
E. granulosus In addition, Cabrera and colleagues [20] derived degenerate
(Eg1121a) [9] Repeated sequence primers from aligned mitochondrial sequences yielding a
GAATGCAAGCAGCAGATG from E. granulosus theoretical specificity for the six strains of E. granulosus
(Eg1122a) Fsheep strain_; yields considered in primer design and for Echinococcus oligarthrus
GAGATGAGTGAGAAGGAGTG banding pattern upon
and Echinococcus vogeli. Upon evaluation with eggs obtained
electrophoresis
(Eg1f) [12] Mitochondrial 12S directly from gravid proglottids of a few helminths, amplifica-
CATTAATGTATTTTGTAAAGTTG RNA gene; specific tions products were obtained with one isolate of E. granulosus,
(Eg1r) for E. granulosus but not with single isolates of other helminths. The test has not
CACATCATCTTACAATAACACC Fsheep strain_; been further validated for diagnostic use on faecal or
modified from [21]
environmental material. Dinkel and colleagues [21] designed
a
No corresponding PCR primers for diagnosis of intestinal Taenia spp. of E. granulosus strain-specific primer pairs (for strains G1
animals are reported as yet; for primers with specificity for human-intestinal
Fsheep strain_, G5 Fcattle strain_, and combined G6/7 Fcamel
Taenia spp., see Ref. [10].
and pig strains_) and used them for genotyping of metacestode
material. The suitability of these primers for copro-DNA
complementary to U1 snRNA sequences were shown not to be remains to be demonstrated.
strictly species-specific for E. multilocularis as a product of the No copro-PCR is available for identifying all strains of E.
expected size was also obtained with a horse strain of E. granulosus. In an ongoing work, we are evaluating E.
granulosus [8]. The original PCR protocol [5] was modified granulosus pan-specific primers (to be used singly or in a
[7] by introducing a second round of amplification with nested multiplex PCR with primers specific for E. multilocularis and
PCR using DNA isolated directly from faeces. Hence, Taenia spp.) yielding an amplicon which, upon sequencing,
application of this method resulted in an increase of sensitivity allows to identify all strains.
from 62% of the single primer pair PCR to 82% as determined
with 17 proven positive samples but the specificity of this 3.3. Taenia spp.
nested PCR was not further evaluated.
The specificity for E. multilocularis of the nested PCR Contrary to the situation with the human intestinal Taenia
amplifying part of the mt12S rRNA gene [6] was confirmed species (Taenia saginata, Taenia solium) for which specific
S90 A. Mathis, P. Deplazes / Parasitology International 55 (2006) S87 – S90
primers have been described for copro-PCR (e.g. [10]), no PCR
protocols are available for specific identification of other
Taenia spp. Analogous to our effort to establish E. granulosus-
specific primers, we are evaluating primers which allow to
detect and to identify (upon sequencing of the amplicon) all
Taenia species from carnivores and which can be employed in
multiplex PCR. Such a test for identification of Taenia spp.
from faecal and environmental samples is urgently needed as it
allows to draw conclusions on the sources of Taenia infections
(Taenia spp. with wild rodents/lagomorphs as intermediate host
vs. Taenia spp. with farm animals as intermediate hosts
indicating that the final host had access to offal). Such
information is crucial for assessing the efficiency of taeniid
control programmes.
References
[1] Deplazes P, Dinkel A, Mathis A. Molecular tools for studies on the
transmission biology of Echinococcus multilocularis. Parasitology 2003;
127:S53 – 61.
[2] Craig PS, Rogan MT, Campos-Ponce M. Echinococcosis: disease,
detection and transmission. Parasitology 2003;127:S5 – 20.
[3] Reiterova K, Miterpakova M, Turcekova L, Antolova D, Dubinsky P.
Field evaluation of an intravital diagnostic test of Echinococcus multi-
locularis infection in red foxes. Vet Parasitol 2005;128:65 – 71.
[4] Smith GC, Gangadharan B, Taylor Z, Laurenson MK, Bradshaw H, Hide
G, et al. Prevalence of zoonotic important parasites in the red fox (Vulpes
vulpes) in Great Britain. Vet Parasitol 2003;118:133 – 42.
[5] Bretagne S, Guillou JP, Morand M, Houin R. Detection of Echinococcus
multilocularis DNA in fox faeces using DNA amplification. Parasitology
1993;106:193 – 9.
[6] Dinkel A, von Nickisch-Rosenegk M, Bilger B, Merli M, Lucius R,
Romig T. Detection of Echinococcus multilocularis in the definitive host:
coprodiagnosis by PCR as an alternative to necropsy. J Clin Microbiol
1998;36:1871 – 6.
[7] Monnier P, Cliquet F, Aubert MF, Bretagne S. Improvement of a
polymerase chain reaction assay for the detection of Echinococcus
multilocularis DNA in faecal samples of foxes. Vet Parasitol 1996;67:
185 – 95.
[8] van der Giessen JW, Rombout YB, Franchimont JH, Limper LP, Homan
WL. Detection of Echinococcus multilocularis in foxes in The Nether-
lands. Vet Parasitol 1999;82:49 – 57.
[9] Abbasi I, Branzburg A, Campos-Ponce M, Abdel Hafez SK, Raoul F,
Craig PS, et al. Copro-diagnosis of Echinococcus granulosus infection in
dogs by amplification of a newly identified repeated DNA sequence. Am J
Trop Med Hyg 2003;69:324 – 30.
[10] Yamasaki H, Allan JC, Sato MO, Nakao M, Sako Y, Nakaya K, et al.
DNA differential diagnosis of taeniasis and cysticercosis by multiplex
PCR. J Clin Microbiol 2004;42:548 – 53.
[11] Mathis A, Deplazes P, Eckert J. An improved test system for PCR-based
specific detection of Echinococcus multilocularis eggs. J Helminthol
1996;70:219 – 22.
[12] Stefanic S, Shaikenov BS, Deplazes P, Dinkel A, Torgerson PR, Mathis A.
Polymerase chain reaction for detection of patent infections of Echino-
coccus granulosus (‘‘sheep strain’’) in naturally infected dogs. Parasitol
Res 2004;92:347 – 51.
[13] Stieger C, Hegglin D, Schwarzenbach G, Mathis A, Deplazes P. Spatial
and temporal aspects of urban transmission of Echinococcus multi-
locularis. Parasitology 2002;124:631 – 40.
[14] Haag KL, Araujo AM, Gottstein B, Siles-Lucas M, Thompson RC, Zaha
A. Breeding systems in Echinococcus granulosus (Cestoda; Taeniidae):
selfing or outcrossing? Parasitology 1999;118:63 – 71.
[15] McManus DP, Bowles J. Molecular genetic approaches to parasite
identification: their value in diagnostic parasitology and systematics. Int
J Parasitol 1996;26:687 – 704.
[16] Gasser RB, Chilton NB. Characterisation of taeniid cestode species by
PCR-RFLP of ITS2 ribosomal DNA. Acta Trop 1995;59:31 – 40.
[17] von Nickisch-Rosenegk M, Silva-Gonzalez R, Lucius R. Modification of
universal 12S rDNA primers for specific amplification of contaminated
Taenia spp. (Cestoda) gDNA enabling phylogenetic studies. Parasitol Res
1999;85:819 – 25.
[18] Gasser RB, Zhu X, Woods W. Genotyping Taenia tapeworms by single-
strand conformation polymorphism of mitochondrial DNA. Electrophore-
sis 1999;20:2834 – 7.
[19] Scott JC, McManus DP. The random amplification of polymorphic DNA
can discriminate species and strains of Echinococcus. Trop Med Parasitol
1994;45:1 – 4.
[20] Cabrera M, Canova S, Rosenzvit M, Guarnera E. Identification of Echino-
coccus granulosus eggs. Diagn Microbiol Infect Dis 2002;44:29 – 34.
[21] Dinkel A, Njoroge EM, Zimmermann A, Walz M, Zeyhle E, Elmahdi IE,
et al. A PCR system for detection of species and genotypes of the
Echinococcus granulosus-complex, with reference to the epidemiological
situation in eastern Africa. Int J Parasitol 2004;34:645 – 53.