Designation: E 2048 – 99

Standard Guide for

Detection of Nucleic Acids of the Mycobacterium
Tuberculosis Complex and Other Pathogenic Mycobacteria
by the Polymerase Chain Reaction Technique1
This standard is issued under the fixed designation E 2048; the number immediately following the designation indicates the year of
original adoption or, in the case of revision, the year of last revision. A number in parentheses indicates the year of last reapproval. A
superscript epsilon (e) indicates an editorial change since the last revision or reapproval.

INTRODUCTION

This guide covers detection of nucleic acids (deoxyribonucleic acid (DNA) or ribonucleic acid
(RNA)) of mycobacteria and specific identification of the Mycobacterium tuberculosis complex
(MTBC, which includes M. tuberculosis, M. bovis, M. microti and M. africunum), M. avium, M. leprae
and M. intracellulare nucleic acids by the polymerase chain reaction (PCR) technique.
PCR is a widely known molecular biology procedure that involves the amplification of a piece of
DNA by as much as a million-fold over the course of several hours. It is also possible to use PCR to
detect RNA by first copying RNA with the enzyme reverse transcriptase to produce a complementary
DNA molecule, which is then amplified by PCR; the combined process is known as RT-PCR. The
amplified DNA fragments can then be detected, identified and quantitated by classical procedures of
biochemistry/molecular biology. As few as only several molecules of DNA in a biological test
specimen can be rapidly and accurately identified. PCR is used as a tool in molecular biology
laboratories for basic and applied research, in clinical laboratories to aid in the diagnosis of genetic,
neoplastic and infectious diseases, and in biotechnology laboratories for the preparation of biotech-
nology products and to test for contaminants.
Mycobacterium tuberculosis (MTB) is the causative agent of tuberculosis (TB) in humans, and TB
is one of the leading causes of human death in the world (1, 2)2. About one third of the present world’s
population is infected with MTB (1). The definitive test for tuberculosis, isolation and specific
identification of MTB in culture, requires several weeks. Microscopic examination of acid-fast smears
is rapid, but non-specific and relatively insensitive. The value of using PCR or other DNA/RNA
amplification procedures for TB diagnosis is rapidity; clinical specimens can be evaluated within a
day. Thus, patient care and treatment can be initiated more rapidly when a specific diagnosis has been
determined.
This guide was developed by ASTM in collaboration with DIN (German Institute for Standardiza-
tion) Subcommittee E3/E9 on Molecular Biological Detection of Mycobacteria, Department for
Medical Standards (NAMed). It is recommended that this mycobacteria-specific PCR guide be used
in conjunction with ASTM’s general PCR Guide E 1873. The combination of the two guides provides
recommendations, basic considerations, criteria, and principles that should be employed when
developing, utilizing or assessing PCR-specific protocols for the detection of the DNA or RNA of
specific mycobacteria.
This guide assumes a basic knowledge of microbiology and molecular biology. It assumes the
availability of, and the ability to search the literature for, mycobacteria target-specific PCR protocols.

1. Scope developing, utilizing, or assessing PCR-specific protocols for

1.1 This guide covers basic considerations, criteria, prin- the amplification and detection or identification of mycobacte-
ciples and recommendations that should be helpful when rial nucleic acids. This guide is not a specific protocol for the
detection of specific mycobacteria. It is intended to provide
1 information that will assist the user in obtaining high quality
This guide is under the jurisdiction of ASTM Committee E-48 on Biotechnol-
ogy and is the direct responsibility of Subcommittee E48.02 on Characterization and and reliable data. The guide is closely related to and should be
Identification of Biological Systems. used concurrently with the general PCR Guide E 1873.
Current edition approved October 10, 1999. Published January 2000. 1.2 This guide has been developed for use in any molecular
2
The boldface numbers in parentheses refer to the list of references at the end of
this standard.
biology or biotechnology laboratory. It may be useful for the

Copyright © ASTM, 100 Barr Harbor Drive, West Conshohocken, PA 19428-2959, United States.

1
 E 2048
detection of mycobacteria in clinical, diagnostic laboratories.
1.3 This guide does not cover details of the various methods
such as gel electrophoresis that can be utilized to help identify
PCR-amplified mycobacterial nucleic acid sequences, and it
does not cover details of instrument calibration.
1.4 This guide does not cover specific variations of the basic
PCR or RT-PCR technology (for example, quantitative PCR,
multiplex PCR and in situ PCR), and it does not cover details
of instrument calibration.
1.5 Warning—Laboratory work involving certain clinical
specimens and microorganisms can be hazardous to personnel.
Precaution: Biosafety Level 2 facilities are recommended for
potentially hazardous work, and Biosafety Level 3 facilities are
required for propagating and manipulating Mycobacteria tu-
berculosis cultures (3). Safety guidelines should be adhered to
according to NCCLS M29-T2, I17-P and other recommenda-
tions (3).
2. Referenced Documents
2.1 ASTM Standards:
E 1873 Guide for Detection of Nucleic Acid Sequences by
the Polymerase Chain Reaction Technique3
2.2 NCCLS Standards:4
M29-T2 Protection of Laboratory Workers from Infectious
Disease Transmitted by Blood, Body Fluids, and Tissue-
Second Edition; Tentative Guideline
C24-A2 Statistical Quality Control for Quantitative Mea-
surements: Principles and Definitions; Approved
Guideline-Second Edition
MM3-A Molecular Diagnostic Methods for Infectious Dis-
eases; Approved Guideline
3. Terminology
3.1 Basic PCR definitions apply according to the general
PCR Guide E 1873 (Section 3).
3.2 Definitions of Terms Specific to This Standard:
3.2.1 internal control, n—in PCR, a control used to assess
the amplifiability of the reaction, that is, to determine whether
or not PCR inhibitors may be present in the reaction; for
example, an internal control can be a synthetic DNA segment
that can be added to the sample prior to amplification, that is of
similar length and base composition to the target gene se-
quence, and that contains primer binding regions identical to
those of the target sequence.
3.2.2 restriction enzymes, n—naturally occurring proteins
(also called restriction endonucleases) that are purified from
bacteria and that recognize specific nucleic acid sequence
patterns (sites) and cleave the nucleic acid at or near that
sequence (site).
4. Significance and Use
4.1 This guide is intended for use in any laboratory utilizing
PCR or RT-PCR to amplify and detect nucleic acid sequences
of mycobacteria from a biological preparation and to identify
the species of origin.
3
Annual Book of ASTM Standards, Vol 11.05.
4
Available from the National Committee for Clinical Laboratory Standards, 771
E. Lancaster Ave., Villanova, PA 19085.
2
4.2 The criteria used for the identification and evaluation of
the amplification reactions should be administered by an
individual trained in the use of molecular biological and
microbiological techniques associated with PCR and MTB.
5. Background Information about TB, MTB, Other
Mycobacteria, and Detection of Mycobacteria by PCR
5.1 The mycobacteria are acid-fast, non-motile, rod-shaped,
aerobic bacteria that do not form spores. They contain several
species pathogenic to humans. The primary human pathogens
are members of the Mycobacterium tuberculosis complex (M.
tuberculosis, M. bovis, M. africanum and M. microti) and M.
leprae. Other mycobacteria, such as the M. avium complex (M.
avium and M. intracellulare) and M. kansasii, cause disease in
immunocompromised individuals.
5.2 Tuberculosis has been a major public health problem in
the world for many centuries, particularly in overcrowded city
areas. In the 18th and 19th centuries, TB was responsible for a
quarter of all adult human deaths in European cities (4).
Several public health measures that finally led to a considerable
improvement include the pasteurization of milk, and the
antibiotics streptomycin (introduced in 1944) and
p-aminosalicylic acid (introduced in 1946) (4). However, the
emergence of drug-resistant MTB strains is becoming a serious
problem. For this and other reasons, TB is presently on the rise
again and is one of the leading infectious causes of death of
adult humans in the world.
5.2.1 The isolation of a species from the MTBC is required
for the definitive diagnosis of tuberculosis. Routine cultures are
time-consuming and can take up to eight weeks. Microscopic
examination of acid-fast smears is the most rapid method for
the detection of mycobacteria, but it is insensitive and non-
specific. Immunological and serological techniques are limited,
in general, due to poor sensitivity or specificity, or both (5, 6).
Species-specific nucleic acid probes have significantly im-
proved the opportunity for rapid confirmation of culture results
for several mycobacterial species (7).
5.3 The M. avium complex (MAC) consist of 28 serovars
(subspecies) of two distinct species, M. avium and M. intrac-
ellulare (8). The criteria used to distinguish M. avium from M.
intracellulare are now well established (9-11). MAC organisms
are ubiquitous in nature and have been isolated from water,
soil, plants, and other environmental sources (12). These
organisms are of low pathogenicity and frequently colonize
healthy individuals without causing disease. Person-to-person
transmission is thought to be unlikely, but many investigators
believe that pulmonary disease may result from inhalation of
infectious environmental aerosols. MAC infections have be-
come increasingly more common in the United States, and M.
avium is the most common non-tuberculous mycobacterial
species associated with human disease. The greatest increase in
MAC infections during the past decade has been in AIDS
patients for whom MAC has become the third most common
opportunistic disease (13). In one report, 98 % of MAC
infections in 45 AIDS patients were due to M. avium, whereas
40 % of MAC infections in patients without AIDS were due to
M. intracellulare (14).
5.3.1 The isolation of MAC by culture is required for
 E 2048
definitive diagnosis of MAC infection. However, routine cul-
tures are time consuming and can take up to eight weeks for
final diagnosis. Additionally, culture does not distinguish
between M. avium and M. intracellulare infection. Several of
the therapeutic agents used currently in the treatment of MAC
disease have different in vitro activity against M. avium and M.
intracellulare (15). As additional therapeutic agents become
available, the ability to distinguish between M. avium and M.
intracellulare may become more important.
5.4 Mycobacterium leprae, the causative agent of leprosy,
remains a serious health problem worldwide (16). Diagnosis of
M. leprae infections is a problem due to the fact that this
organism cannot be cultured by conventional methods. Classi-
cal methods of diagnosis, such as microscopic examination of
skin biopsies and antibody testing lack sensitivity and speci-
ficity (17). However, PCR can be used for rapid and sensitive
diagnosis of M. leprae infections.
5.5 PCR has proven to be a useful procedure for the
detection of mycobacteria and the specific identification of the
species present. Mycobacterial DNA in a clinical sample is
typically extracted and amplified, and the PCR product is then
identified. Depending on the PCR amplification target em-
ployed, the analytic sensitivity of amplification assays ranges
from about 1 to 100 mycobacteria (17). Primers used in the
PCR amplification from mycobacterial genomes can be either
species-specific or genus-specific. PCR-based tests specific for
mycobacteria have been shown to improve the rapid diagnosis
of tuberculosis and other mycobacteria-caused diseases by
allowing the direct detection of mycobacteria in clinical
specimens.
5.5.1 Clinical studies have demonstrated that PCR-based
assays accurately detect MTB in respiratory specimens (18-
22). The specificity of these tests ranges from 95 to 100 %.
Furthermore, these MTB-specific tests do not cross-react with
other mycobacteria. Clinical specimens that yielded non-
tuberculosis mycobacteria when cultured gave negative results
when tested by MTB-specific PCR assays. The MTB PCR
assays generally exhibit greater than 90 % sensitivity for the
subset of clinical specimens that are positive for acid-fast
bacilli (AFB) positive by microscopy. These assays exhibit
lower sensitivity, ranging from 50 to 75 %, for the subset of
clinical specimens that are AFB-negative. The limited sensi-
tivity is attributed to the low organism load in AFB-negative
specimens. Because the volume of specimen used to inoculate
cultures is usually much greater than the volume tested by
PCR, mycobacteria may be delivered to the culture, but not to
the PCR reaction.
5.5.2 Clinical studies have shown that PCR assays can
detect MAC directly in respiratory specimens and in blood
(23-27). Many of these assays can distinguish which of the two
MAC species, M. avium or M. intracellulare, is present in the
specimen. The specificity of these tests ranges from 97 to
100 %. Furthermore, these MAC-specific tests do not cross-
react with other mycobacteria. Clinical specimens that yielded
M. tuberculosis, or other non-MAC mycobacteria, when cul-
tured gave negative results when tested by MAC-specific PCR
assays. Sensitivity for MAC is generally greater than 90 %.
3
6. Principle of the PCR Method
6.1 See Guide E 1873 (Section 5) for a description of the
PCR method.
6.2 In addition to 6.1, the amplification of target sequences
takes place in vitro. Procedures for detection of specific
amplified products that allow a differentiation to be made
between species of the MTBC and ubiquitous mycobacterial
species should be used preferentially.
7. Target Material
7.1 For general information see Guide E 1873 (Sections 6
and 9).
7.2 In addition to 7.1, for the detection of nucleic acid
sequences of the MTBC, immediate transport of the test
material to the laboratory is recommended. It is possible that
transport periods of >48 h can interfere with the nucleic acid
detection.
7.3 Typical biological specimens for the detection of myco-
bacteria or their nucleic acid sequences include:
7.3.1 Specimens Used in Biotechnology or Basic Molecular
Biology Research Laboratories—Cultures of mycobacteria,
purified preparations of mycobacteria or mycobacterial nucleic
acid.
7.3.2 Specimens Used in Clinical, Diagnostic Laboratories
in the Case of Suspected MTB Infection—Respiratory sample
material (for example, sputum, bronchoalveolar lavages), gas-
tric juice, stomach aspirate, urine, sperm and prostatic secre-
tion, puncture exudate, cerebrospinal fluid, bone marrow and
biopsy material (tissues).
7.4 Methods currently used for extraction of the target
sequence from mycobacteria are:
7.4.1 Alkaline Lysis—In the presence of sodium hydroxide
and detergent with increased temperature and subsequent
neutralization of the reaction mixture.
7.4.2 Guanidium Isothiocyanate—Extraction.
7.4.3 Enzymatic Extraction—Of nucleic acid using protein-
ase K plus lysozyme or detergent treatment, or both.
7.4.4 Mechanical-Physical Pretreatment—For disruption of
the bacterial cells, for example, ultrasound, repeated shock
freezing/boiling.
7.4.5 A combination of the procedures described in 7.4.1 to
7.4.4 is possible. Methods used should be tested in the
laboratory with respect to their efficiency and reproducibility
through the introduction of appropriate control bacteria.
7.5 Substances that inhibit PCR such as heparin, hemoglo-
bin, etc., should be considerably reduced in amount through the
extraction procedures used. When extraction procedures do not
reduce inhibitors sufficiently, typical methods for reducing the
amount of inhibitors, such as solid phase adsorption of the
nucleic acids or inhibitors, phenol-chloroform extraction, etc.,
may be used to remove inhibitors. Purification of the extracted
nucleic acids by solid phase adsorption, for example, to
silicates or resins, can lead to increased purity, but may also
result in considerable losses of nucleic acids. This guide
recommends that an internal control nucleic acid sequence be
added to each sample to monitor amplification and detect
samples that inhibit PCR (28).
 E 2048
8. PCR Laboratory Design
8.1 Follow instructions for PCR laboratory design accord-
ing to Guide E 1873 (Section 7) and NCCLS MM3-A (Section
12).
9. Special Equipment/Supplies
9.1 General—See the recommendations of Guide E 1873
(Section 8) and NCCLS MM3-A (Section 12).
9.2 In addition to 9.1, equipment that ensures safe disrup-
tion of mycobacteria, such as programmed incubators, en-
closed sonicators, or the equivalent is needed.
9.3 Nucleic acids from mycobacteria of the MTBC and
from clinical specimens containing M. tuberculosis, M. avium
or M. intracellulare should be isolated in Biosafety Level 2
(BSL2) or BSL3 laboratories.
10. Chemicals and Reagents
10.1 General—See the recommendations of Guide E 1873
(Section 9).
10.2 Mycobacteria PCR Primers—The selected target DNA
sequence should be bounded by nucleic acid sequences specific
to mycobacterial DNA; these sequences will serve as primer
binding sites. The primer binding sequences shall be unique to
mycobacteria to ensure that DNA of other organisms is not
amplified along with the mycobacterial DNA. The primer
binding sequences also shall be highly conserved among all
mycobacterial species that need to be detected. If the primer
binding sequences are not well-conserved, certain mycobacte-
rial species with substantially divergent sequences might not
get amplified.
10.2.1 Several primer pairs may be used to enhance speci-
ficity. Each primer pair can simultaneously amplify a different
target sequence within the mycobacterial genome. Alterna-
tively, one target sequence can be amplified using a single
primer set to generate an initial amplification product. Then, a
second set of nested primers, which recognize sequences
within the initial amplification product, can be used to generate
the shorter, final amplification product (see 10.2.1.2).
10.2.1.1 Multiple Targets—The likelihood of false-positive
results is reduced by defining a positive result as the presence
of multiple, specific amplification products. Reactions inad-
vertently contaminated with a single DNA target sequence will
contain only a single amplified target and not be classified as
positive. Reactions containing non-specifically amplified DNA
that mimics one of the target sequences will lack the other
specific targets and not be classified as positive.
10.2.1.2 Nested Amplification—The primary target is am-
plified using an outer set of primers to generate an intermediate
that serves as the target for the second set of internal primers.
This two-stage amplification process can generate more final
product, thereby increasing analytical sensitivity. Specificity
will be enhanced, because the final amplification product will
be formed only if the correct intermediate is formed. Products
formed by non-specific interactions between the first set of
primers and extraneous DNA will not contain binding sites for
the second set of primers and, thus, will not generate the
characteristic final product. Caution should be taken when
using nested PCR, according to the general PCR Guide E 1873.
10.2.2 The target sequence recognized by the primers may
4
be present in a single copy in the mycobacterial genome or may
be present in multiple copies. Because they are present in
multiple copies in each organism, repetitive target sequences
provide a natural amplification that may enhance the analytical
sensitivity of the assay.
10.2.3 The primer binding sequences may be specific to one
species of mycobacteria or may be conserved among several
species of mycobacteria. Species-specific primers should be
used when the assay is required to detect only one species of
mycobacteria. Primers that are conserved among several spe-
cies should be used for applications where it is desirable to
detect any, or all, of the different species of mycobacteria that
may be present in a sample. An example of the latter applica-
tion is clinical diagnosis. Specimens from patients suspected of
having mycobacteria infection may contain any one of several
pathogenic species. A diagnostic test shall be able to detect all
of the species and identify which of them is actually present.
10.2.3.1 Species-Specific Primers—The sequences recog-
nized by these primers shall be unique to the species of interest
and shall not be found in other mycobacterial species. Table 1
lists several species-specific primers for the amplification of
the MTBC.
10.2.3.2 Multiple Species Primers—These primers should
contain sequences that are conserved in all of the mycobacte-
rial species of interest. If it will be necessary to identify the
particular species present in a sample, the primers should be
positioned so that a portion of the sequence between them
differs among the target species. A set of species-specific
probes that are homologous to this unique region can be
hybridized to the amplified DNA for species identification.
Table 1 lists several primer pairs that amplify DNA from
multiple mycobacterial species and yield products that can
contain unique sequences for species identification.
10.3 Detection of Amplification Products—The method
used to visualize reaction products shall distinguish amplified
target DNA from DNA generated from non-specific interac-
tions between primers or between primers and non-target
DNA.
10.3.1 For amplification products generated by species-
specific primers, gel electrophoresis can be used to demon-
strate that the product matches the expected size of the
amplified target DNA. Alternatively, more specific detection
techniques, such as restriction enzyme digestion or hybridiza-
tion to a DNA probe, can be used to show that the products
contain sequences characteristic of amplified target DNA and
should be used in clinical laboratory practice.
10.3.2 Amplification products generated by primers that
interact with multiple species may be detected using generic
techniques that do not identify the individual species present,
or they may be visualized using species-specific detection
methods. Generic detection techniques can be used to screen
for specimens that contain mycobacteria. This can be accom-
plished by gel electrophoresis or by using probes or restriction
enzymes that recognize sequences conserved among all the
target species. Species-specific detection techniques can then
be used to identify the target organism(s) present in each of the
 E 2048
specimens identified as positive by a generic detection method.
DNA probes for variable sequences that differ among the target
species are required for this purpose.

TABLE 1 Primers and Probes for PCR Amplification of Mycobacterial DNA

Target Gene Function Specificity Name Sequence Reference

65 kD protein upstream primer genus TB-1 58GAGATCGAGCTGGAGGATCC38 (29)
downstream primer genus TB-2 58AGCTGCAGCCCAAAGGTGTT38 (30)
upstream primer M. tuberculosis TB-28 58CCATCGATCCGAGACCCTGCTCAAGGGC38
downstream primer M. tuberculosis TB-29 58TGCTCTAGACTCCTCGACGGTGATGACG38
probe M. tuberculosis TB-3 58GCGGCATCGAAAAGGCCGTG38
probe M. tuberculosis TB-4 58CGAAATCGCTGCGGTGGCCG38
probe M. avium TB-5 58CTGCCACCGCGGCCATCTCC38
probe M. fortuitum TB-6 58CTGCCACCGCCGGTATCTCC38

16S rRNA upstream primer genus KY18 58CACATGCAAGTCGAACGGAAAGG38 (31)

downstream primer genus KY75 58GCCCGTATCGCCCGCACGCTCACA38
probe M. tuberculosis KY172T3 58GGTGGAAAGCGCTTTAGCGGT38
probe M. avium proprietaryA
probe M. intracellulare proprietaryA

16S rRNA upstream primer slow growing MYCOB 58ATGCAAGTCGAACGGAAAGG38 (32)

mycobacteria
downstream primer slow growing 58TGCACACAGGCCACAAGGGA38
mycobacteria
upstream primer M. avium MAV 58CCTCAAGACGCATGTCTTCT38
downstream primer M. avium 58ACAGCTCCCTCCCAAAAGGG38
upstream primer M. intracellulare MIN 58CCTTTAGGCGCATGTCTTTA38
downstream primer M. intracellulare 58GCACAGCTCCCTCCCAAGGG38
probe none used

16S rRNA upstream primer genus 246 58AGAGTTTGATCCTGGCTCAG38 (33)

downstream primer genus 264 58TGCACACAGGCCACAAGGGA38
downstream primer genus 260 58GTCCTGTGCATGTCAAACCC38
downstream primer genus 267 58CACGCCCACAGTTAAGCTGT38
probe genus 247 58TTTCACGAACAACGCGACAA38
probe M. tuberculosis 58ACCACAAGACATGCATCCCG38
probe M. avium/paratb 58ACCAGAAGACATGCGTCTTG38
probe M. intracellulare 58ACCTAAAGACATGCGCCTAA38

Superoxide dismutase upstream primer universal (all Z205 58AGCTTCACCACAGCAAGCACCA38 (34)

organisms)
downstream primer universal Z212 58TCG(G,T)CCCAGTTCACGAC(G,A)TTCCA38B
upstream primer genus Z261 58CCAA(A,G)CTCGAAGAGGCGCG(C,G)GCCAA38B
probes: cocktail for M. tuberculosis Z310 58GACAAGCCCACCGGCGAACTCGCCGCAGCCATCGCCG38
genus detection M. xenopi and M. Z311 58GACAAGCCGACCGGCGAATTGGCCGCCGC(G,C)ATCGACG38B
intracellulare
M. avium Z312 58GACAAGCCCACCGGTGAGCTGGCCGCCGCGATCGACG38
M. gordonae Z313 58GACAAGCCGACCGGTGACCTGGCCGCCGCGATCGACG38
M. fortuitum Z314 58GACAAGCCGACGGGCGATCTGGCCGCGGCGATCGAC38
M. scrofulaceum Z315 58GACAAGCCGACCGGAGAACTGGCCGCCGCGATCGATG38
M. simiae Z316 58GACAAGCCGACCGGAGATCTCGCCGCCGCCATCGACG38
M. kansasii Z317 58GACAAGCCGACCGGCGAACTCGCCGCGGCCATCGACG38
probes for species M. tuberculosis Z302 58ACGAACTTCCCGCTAGGCATTGTTCCGCTGCTGCTGC38
detection M. tuberculosis Z337 58AGTCGACTTTGCCAAGGCGTTT38
M. avium Z301 58GTCCTTCGACAAGTTCCGAGCGCAATTCAGCGCCGCC38
M. intracellulare Z303 58CCTTCGGATCCTTCGACCGGTTCCGCGCGCAGTTCAG38

Superoxide dismutase probes for species M. scrofulaceum Z306 58TGACACACTCGGCAGCAGGCTGCTCACCTTCCAGCTT38

detection M. kansasii Z340 58CCAGACGAACTTTCCACTCGGA38
M. fortuitum Z369 58ACGACAGCCTGGGCGATCGGCT38
M. simiae Z304 58GTCCCCGAACGGCGGAGACAAGCCGACCGGAGATCTC38
M. gordonae Z366 58TCTGGGCGGCCGGTTGCTCACCTTT38
M. xenopi Z309 58TCCGCGATCGTCGGGCATGAGAAGGCCCTCGCGTTCA38

Repetitive element upstream primer genus MtbA 58GGGTCGGTGACTCCGGGGGCT38 (35)

downstream primer genus MtbB 58CGGTGGGAACGGGGGCGCT38
upstream primer genus MtbC 58TACGGATTCCGTCCACCGTCAT38
downstream primer genus MtbD 58CACCGGCGGAACACT38
probe M. tuberculosis none PCR products derived from amplification of M. tuberculosis DNA

IS6110 upstream primer M. tuberculosis IS41 58CCTGCGAGCGTAGGCGTCGG38 (36)

complex

5
 E 2048

TABLE 1 Continued
Target Gene Function Specificity Name Sequence Reference
downstream primer M. tuberculosis IS43 58TCAGCCGCGTCCACGCCGCCA38 (37)
complex
downstream primer M. tuberculosis 58CTCGTCCAGCGCCGCTTCGG38
complex
probe none PCR products derived from amplification of M. tuberculosis DNA

MPB64 protein upstream primer M. tuberculosis 1 58TCCGCTGCCAGTCGTCTTCC38 (38)

complex
downstream primer M. tuberculosis 2 58GTCCTCGCGAGTCTAGGCCA38
complex
probe M. tuberculosis 58CTTCAACCCGGGGGAGT38
complex

Clone pPH7301 upstream primer M. tuberculosis A 58GGTCCTGACGGTAATGGGGT38 (6)

complex
downstream primer M. tuberculosis D 58CGCCCATCCACATCCCGCCC38
complex
probe M. tuberculosis E 58GGACATCTCTGTTCCATCCA38
complex

38kD protein upstream primer M. tuberculosis MT1 58ACCACCGAGCGGTTCGCCTGA38 (39)

complex
downstream primer M. tuberculosis MT2 58GATCTGCGGGTCGTCCCAGGT38
complex
probe M. tuberculosis MT3 58CGCTGTTCAACCTGTGGGGTCCGGCCTTTC38
complex

Repetitive element upstream primer M. tuberculosis 58GCGGCTCGGGCGGCGTCGGTGGCTT38 (40)

complex
downstream primer M. tuberculosis 58GCCAGAACCGACCAACCCGCCGATA38
complex
probe M. tuberculosis cloned DNA
complex

MBP70 antigen upstream primer M. tuberculosis TB1A 58GAACAATCCGGAGTTGACAA38 (20)

complex
downstream primer M. tuberculosis TB1B 58AGCACGCTGTCAATCATGTA38
complex
probe none

18kD protein upstream primer M. leprae 58ATTCGTCGTCGAGTTCGACCTTCCT38 (16)

downstream primer M. leprae 58TGACAACAAACGCGTTGTTCGATTC38
probe cloned DNA
A
Probes are available commercially in the COBAS AMPLICOR and AMPLICOR Mycobacterium avium and Mycobacterium intracellulare detection kits.
B
Primer or probe is a mixture of multiple sequences. Parentheses indicate positions of sequence heterogeneity. Each oligonucleotide in the mixture contains one of the
two nucleotides shown in each set of parentheses (for example, if there are two sets of parenthesis, mixture is composed of four distinct sequences).

11. Conditions Preliminary to the Performance of PCR
11.1 General—See recommendations of Guide E 1873
(Section 10).
12. Performance of PCR
12.1 General—See recommendations of Guide E 1873
(Section 11). Additional details on the design and utilization of
internal controls can be found in Ref. (28).
12.2 The positive control(s) used should be added suffi-
ciently early in order to control the course of the entire process
from extraction of nucleic acids to detection of the amplified
products.
13. Evaluation and Interpretation of Results
13.1 General—See Guide E 1873 (Section 12).
13.2 In addition to the above, for clinical, in vitro diagnostic
PCR testing, the nucleic acid detection of the MTBC is to be
evaluated as:
13.2.1 Positive—A signal obtained by hybridization was
above the cut-off value taken as baseline for the procedure in
comparison with the accompanying controls, or a specific
amplified product obtained and characterized by means of its
sequence or its restriction fragment pattern or its molecular
weight, or a combination thereof.
13.2.2 Negative—In the case of hybridization, signal did not
exceed a cut-off value taken as baseline for the procedure, or a
specific amplified product was not obtained when consider-
ation was given to the result of the accompanying controls.
13.2.3 Indeterminate—The positive or negative control re-
actions did not work correctly, or the internal control indicated
an amplification failure due to either inhibition by the sample
or technical error. Under these conditions the test is to be
repeated with consideration given to the problem that occurred.
13.2.4 Inconclusive—In the case of hybridization, a test
result was obtained that lies in a narrow region close to the
threshold value, or a specific amplified product could not be
generated in sufficient amount. Inconclusive results are to be
repeated in the same laboratory and an attempt made to obtain
an interpretable result.
13.3 Evaluation and documentation of the amplified product

6
 E 2048
should be carried out.
13.4 Interpretation of results of the PCR reaction depends
on: 1) what results were obtained with the controls, 2) which
primers were used for the amplification, 3) which target
sequences were used, 4) which test procedure was used for
obtaining the amplified product, 5) whether DNA or RNA was
used as starting material, and 6) from which test specimens the
mycobacteria were obtained and concentrated.
14. Report
14.1 General requirements for the report are given in Guide
E 1873 (Section 13).
14.2 For a report of in vitro diagnostic PCR test results, in
order to assure a correct diagnosis:
14.2.1 A report of positive findings may include a recom-
mendation that a repeat of the test may be made using fresh test
material when a patient has a positive nucleic acid detection for
the first time. The recommendation should take into consider-
ation the results of other test procedures such as microscopy
and culture.
14.2.2 A report of negative findings is generated in the case
of a validated, negative test result. A negative nucleic acid
detection report should always contain an addendum that states
even in the case of a negative result, an infection with
mycobacteria is not completely excluded. When tuberculosis
continues to be suspected, a recommendation is to be included
in the report concerning a suitable time for a test repeat and the
type of test specimens.
14.2.3 A report of questionable findings should be made
only in the case that after repeated, unclear results have been
REFERENCES
(1) Crofton, J., Chaulet, P., and Maher, D., “Guidelines for the Manage-
ment of Drug-Resistant Tuberculosis,” World Health Organization,
Geneva, 1997.
(2) Rattan, A., Kalia, A., and Ahmad, N., “Multidrug-Resistant Mycobac-
terium tuberculosis: Molecular Perspectives,” Emerging Infectious
Diseases, Vol 4, 1998, pp. 195-209.
(3) Richmond, J.Y., and McKinney, R.W., Biosafety in Microbiological
and Biomedical Laboratories, 3rd ed., U.S. Department of Health and
Human Services, Publication No. (CDC) 93-8395, U.S. Government
Printing Office, Washington DC, 1993.
(4) Sepkowitz, K.A., Raffalli, J., Riley, L., Kiehn, T.E., and Armstrong, D.,
“Tuberculosis in the AIDS Era,” Clinical Microbiology Reviews, Vol 8,
1995, pp. 180-199.
(5) Daniel, T. M., “The Rapid Diagnosis of Tuberculosis: A Selective
Review,” Journal of Laboratory Clinical Medicine, Vol 116, 1990, pp.
277-282.
(6) Hermans, P.W.M., Schuitema, A.R.J., and Soolingen, D.V., “Specific
Detection of Mycobacterium tuberculosis Complex Strains by Poly-
merase Chain Reaction,” Journal of Clinical Microbiology, Vol 28,
1990, pp. 1204-1213.
(7) Huang, C.H. and Jungkind, D.L., “Non-Radioactive Probe for the
Rapid Identification of Mycobacterium avium Complex from Clinical
Specimens,” Molecular and Cellular Probes, Vol 5, 1991, pp. 277-
280.
(8) Nolte, F.S. and Metchock, B., “Mycobacterium,” Manual of Clinical
Microbiology, 6th ed., American Society for Microbiology Press,
Washington, DC, 1995, pp. 400-437.
7
obtained, the existence or absence of the suspected mycobac-
teria cannot be eliminated or verified. The performance of
further tests with newly obtained test specimens should be
recommended.
14.2.4 In all cases described in 14.2.1-14.2.3, the report
should comment upon the validity of all associated diagnostic
methods utilized. The report should also take into consider-
ation any other test procedures used such as microscopy and
culture available at that time.
15. Quality Assurance
15.1 Basic concepts for quality assurance in the laboratory
should be followed, according to NCCLS C24-A and NCCLS
MM3-A.
15.2 See the general requirements given in Guide E 1873
(Section 14).
15.3 In addition to 15.2, the user should keep in mind that
the detection of mycobacterial nucleic acids by PCR is a
rapidly developing area, and the user needs to consider current
innovations in the field and to integrate them into the test
methodology and report interpretation.
16. Troubleshooting
16.1 See Guide E 1873 (Section 15).
17. Keywords
17.1 amplification; DNA primer; DNA probe; M. avium; M.
intercellulare; MTB; MTB complex; Mycobacterium tubercu-
losis; PCR; polymerase chain reaction; TB; tuberculosis
(9) Frothingham, R. and Wilson, K.H., “Molecular Phylogeny of the
Mycobacterium avium Complex Demonstrates Clinically Meaningful
Divisions,” Journal of Infectious Diseases, Vol 169, 1994, pp. 305-
312.
(10) Thorel, M.F., Krichevsky, M., and Levy-Frebault, V., “Numerical
Taxonomy of Mycobactin-Dependent Mycobacteria, Emended De-
scription of Mycobacterium avium, and Description of Mycobacte-
rium avium Subsp. avium subsp. Nov., Mycobacterium avium Subsp.
Paratuberculosis Subsp. Nov., and Mycobacterium avium Subsp.
Silvaticum Subsp. Nov.,” International Journal of Systematic Bacte-
riology, Vol 40, 1990, pp. 254-260.
(11) Wayne, L., and Sramek, H., “Agents of Newly Recognized or
Infrequently Encountered Mycobacterial Diseases,” Clinical Micro-
biology Reviews, Vol 5, 1992, pp. 1-25.
(12) Von Reyn, C.F., Waddell, R.D., Eaton, T., Arbeit, R. D., Maslow, J.
N., Barber, T. W., Brindle, R. J., Gilks, C. F., Lumio, J., Lahdevirta,
J., Ranki, A., Dawson, D., and Falkinham III, J. O., “Isolation of
Mycobacterium avium complex from Water in the United States,
Finland, Zaire, and Kenya,” Journal of Clinical Microbiology, Vol
31, 1993, pp. 3227-3230.
(13) Horsburgh, C.R.,“ Advances in the Prevention and Treatment of
Mycobacterium avium Disease,” New England Journal of Medicine,
Vol 335, 1996, p. 428.
(14) Guthertz, L.S., Damsker, B., Bottone, E.J., Ford, E.G., Midura, T.D.,
and Janda, J.M., “Mycobacterium avium and Mycobacterium intrac-
ellulare Infections in Patients With and Without AIDS,” Journal of
Infectious Diseases, Vol 160, 1989, pp. 1037-1041.
 E 2048
(15) Inderlied, C.B., Kemper, C.A., and Bermudez, L.E.M., “The Myco-
bacterium avium Complex,” Clinical Microbiology Reviews, Vol 6,
1993, pp. 266-310.
(16) Williams, D. L., Gillis, T.P., Booth, R.J., Looker, D., Watson, J.D.,
“The Use of a Specific DNA Probe and Polymerase Chain Reaction
for the Detection of Mycobacterium leprae,” Journal of Infectious
Diseases, Vol 162, 1990, pp. 193-200.
(17) Young, K.K.Y., “The Detection of Mycobacterial DNA Using PCR,”
PCR-Based Diagnostics in Infectious Disease, Blackwell Scientific
Publications, Inc., Boston, MA, 1994, pp. 537-558.
(18) Beavis, K., Lichty, M.B., and Jungkind, D.L.,“ Evaluation of Ampli-
cor PCR for Direct Detection of Mycobacterium tuberculosis from
Sputum Specimens,” Journal of Clinical Microbiology, Vol 33, 1995,
pp. 2582-2586.
(19) Bodmer, T., Gurtner, A., Scholkmann, M., and Matter, L., “Evalua-
tion of the COBAS AMPLICOR MTB System,” Journal of Clinical
Microbiology, Vol 35, 1997, pp. 1604-1605.
(20) Cousins, D.V., Wilton, S.D., and Francis, B.R., “Use of Polymerase
Chain Reaction for Rapid Diagnosis of Tuberculosis,” Journal of
Clinical Microbiology, Vol 30, 1992, pp. 255-258.
(21) Piersimoni, C., Callegaro, A., Nista, D., Bornigia, S., DeConti, F.,
Santini, G., and De Sio, G., “Comparative Evaluation of Two
Commercial Amplification Assays for the Direct Detection of Myco-
bacterium tuberculosis Complex in Respiratory Samples,” Journal of
Clinical Microbiology, Vol 35, 1997, pp. 193-196.
(22) Yuen, K-Y., Yam, W-C., Wong, L-P., and Seto, W-H., “Comparison of
Two Automated DNA Amplification Systems with a Manual One-
Tube Nested PCR Assay for Diagnosis of Pulmonary Tuberculosis,”
Journal of Clinical Microbiology, Vol 35, 1997, pp. 1385-1389.
(23) Gamboa, F., Manterola, J. M., Lonca, J., Matas, L., Viñado, B.,
Giménez, M., Cardona, P. J., Padilla, E., and Ausina, V., “Detection
and Identification of Mycobacteria by Amplification of RNA and
DNA in Pretreated Blood and Bone Marrow Aspirates by a Simple
Lysis Method,” Journal of Clinical Microbiology, Vol 35, 1997, pp.
2124-2128.
(24) Ichiyama, S., Iinuma, Y., Tawada, Y., Yamori, S., Hasegawa, Y.,
Shimokata, K., and Nakashima, N., “Evaluation of Gen-Probe
Amplified Mycobacterium tuberculosis Direct Test and Roche PCR-
Microwell Plate Hybridization Method (AMPLICOR Mycobacte-
rium) for Direct Detection of Mycobacteria,” Journal of Clinical
Microbiology, Vol 34, 1996, pp. 130-133.
(25) Kox, L.F., van Leeuwen, J., Knijper, S., Jansen, H.M., and Kolk,
A.H., “PCR Assay Based on DNA Coding for 16S rRNA for
Detection and Identification of Mycobacteria in Clinical Samples,”
Journal of Clinical Microbioogy, Vol 33, 1995, pp. 3225-3233.
(26) Oggioni, M.R., Fattorini, L., Li, B., De Milito, A., Zazzi, M., Pozzi,
G., Orefici, G., and Valensin, P.E., “Identification of Mycobacterium
tuberculosis Complex, Mycobacterium avium and Mycobacterium
intracellulare by Selective Nested Polymerase Chain Reaction,”
Molecular and Cellular Probes, Vol 9, 1995, pp. 321-326.
(27) Yanazaki, T. and Nakamura, R.M., “Identification of Mycobacterium
intracellulare by a Polymerase Chain Reaction Using Species-
Specific Primers,” Tuberculosis Lung Disease, Vol 76, 1995, pp.
330-335.
(28) Rosenstraus, M., Wang, Z., Chang, S.-Y., DeBonville, D., and
Spadoro, J.P., “An Internal Control for Routine Diagnostic PCR:
Design, Properties, and Effect on Clinical Performance,” Journal of
Clinical Microbiology, Vol 36, 1998, pp. 191-197.
(29) Hance, A.J., Grandchamp, B., Lévy-Frébault, V., Lecossier, D.,
Rauzier, J., Bocart, D., and Gicquel, B., “Detection and Identification
of Mycobacteria by Amplification of Mycobacterial DNA,” Molecu-
lar Microbiology, Vol 3, 1989, pp. 843-849.
(30) Pierre, C., Lecossier, D., Boussougant, Y., Bocart, D., Joly, V., Yeni,
P., and Hance, A.J., “Use of a Reamplification Protocol Improves
Sensitivity of Detection of Mycobacterium tuberculosis in Clinical
Samples by Amplification of DNA,” Journal of Clinical Microbiol-
ogy, Vol 29, 1991, pp. 712-717.
(31) Tevere, V. J., Hewitt, P. L., Dare, A., Hocknell, P., Keen, A., Spadoro,
J. P., and Young, K. K. Y., “Detection of Mycobacterium tuberculosis
by PCR Amplification with Pan-Mycobacterium Primers and Hybrid-
ization to an M. tuberculosis-Specific Probe,” Journal of Clinical
Microbiology, Vol 34, 1996, pp. 918-923.
(32) Chen, Z.H., Butler, W.R., Baumstark, B.R., and Ahearn, D.G.,
“Identification and Differentiation of Mycobacterium avium and M.
intracellulare by PCR,” Journal of Clinical Microbiology, Vol 34,
1996, pp. 1267-1269.
(33) Boddinghaus, B., Rogall, T., Flohr, T., Blocker, H., and Bottger, E.C.,
“Detection and Identification of Mycobacteria by Amplification of
rRNA,” Journal of Clinical Microbiology, Vol 28, 1990, pp. 1751-
1759.
(34) Zolg, J. W., and Philippi-Schulz, S., “The Superoxide Dismutase
Gene, a Target for Detection and Identification of Mycobacteria by
PCR,” Journal of Clinical Microbiology, Vol 32, 1994, pp. 2801-
2812.
(35) Patel, R. J., Fries, J. W., Piessens, W. F., and Wirth, D. F., “Sequence
Analysis and Amplification by Polymerase Chain Reaction of a
Cloned DNA Fragment for Identification of Mycobacterium tubercu-
losis,” Journal of Clinical Microbiology, Vol 28, 1990, pp. 513-518.
(36) Eisenach, K. D., Cave, M. D., Bates, J. H., and Crawford, J. T.,
“Polymerase Chain Reaction Amplification of a Repetitive DNA
Sequence Specific for Mycobacterium tuberculosis,” Journal of
Infectious Diseases, Vol 161, 1990, pp. 977-981.
(37) Plikaytis, B.B., Eisenach, K.D., Crawford, J.T., and Shinnick, T.M.,
“Differentiation of Mycobacterium tuberculosis and Mycobacterium
bovis BCG by a Polymerase Chain Reaction Assay,” Molecular and
Cellular Probes, Vol 5, 1991, pp. 215-219.
(38) Shankar, P., Manjunath, N., Lakshmi, R., Aditi, B., Seth, P., and
Shriniwas, M.D., “Identification of Mycobacterium tuberculosis by
Polymerase Chain Reaction,” Lancet, Vol 335, 1990, p. 423.
(39) Sjobring, U., Mecklenburg, M., Andersen, A.B., and Miorner, H.,
“Polymerase Chain Reaction for Detection of Mycobacterium tuber-
culosis,” Journal of Clinical Microbiology, Vol 28, 1990, pp. 2200-
2204.
(40) De Wit, D., Steyn, L., Shoemaker, S., and Sogin, M.,“ Direct
Detection of Mycobacterium tuberculosis in Clinical Specimens by
DNA Amplification,” Journal of Clinical Microbiology, Vol 28, 1990,
pp. 2437-2441.

The American Society for Testing and Materials takes no position respecting the validity of any patent rights asserted in connection
with any item mentioned in this standard. Users of this standard are expressly advised that determination of the validity of any such
patent rights, and the risk of infringement of such rights, are entirely their own responsibility.

This standard is subject to revision at any time by the responsible technical committee and must be reviewed every five years and
if not revised, either reapproved or withdrawn. Your comments are invited either for revision of this standard or for additional standards
and should be addressed to ASTM Headquarters. Your comments will receive careful consideration at a meeting of the responsible
technical committee, which you may attend. If you feel that your comments have not received a fair hearing you should make your
views known to the ASTM Committee on Standards, at the address shown below.

This standard is copyrighted by ASTM, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959, United States.
Individual reprints (single or multiple copies) of this standard may be obtained by contacting ASTM at the above address or at
610-832-9585 (phone), 610-832-9555 (fax), or service@astm.org (e-mail); or through the ASTM website (www.astm.org).