Professional Documents
Culture Documents
Snduein 4 Zzed
Snduein 4 Zzed
CONTENTS
4 JA N UA RY 2 0 1 9 • V O LU M E 3 6 3 • I S S U E 6 4 2 2
Internalizing
receptors to forget
18
LETTERS 78 PALEONTOLOGY
24 NEXTGEN VOICES:
CHALLENGING TRANSITIONS 27 & 46 An elephant-sized Late Triassic
synapsid with erect limbs
T. Sulej and G. Niedźwiedzki
RESEARCH 81 EVOLUTION
DNA fragility in the parallel evolution
of pelvic reduction in stickleback fish
K. T. Xie et al.
IN BRIEF
84 PROTEIN TRANSLOCATION
39 From Science and other journals Structure of the posttranslational
Sec protein-translocation channel
REVIEW
RESEARCH ARTICLES
43 IMMUNOLOGY DEPARTMENTS
Commensal-specific T cell plasticity
54 MESOSCOPIC PHYSICS 7 EDITORIAL
promotes rapid tissue adaptation to
Counter-propagating charge transport Examining author gender data
injury O. J. Harrison et al.
in the quantum Hall effect regime By Jeremy Berg
RESEARCH ARTICLE SUMMARY; FOR FULL TEXT:
dx.doi.org/10.1126/science.aat6280 F. Lafont et al.
98 WORKING LIFE
44 NEUROSCIENCE 57 NANOMATERIALS Lessons from the ‘real world’
Synaptotagmin-3 drives AMPA receptor Fluorine-programmed nanozipping to By Barbara A. Wanchisen
endocytosis, depression of synapse tailored nanographenes on rutile TiO2
strength, and forgetting A. Awasthi et al. surfaces M. Kolmer et al.
RESEARCH ARTICLE SUMMARY; FOR FULL TEXT: ON THE COVER
dx.doi.org/10.1126/science.aav1483
61 ATOMIC PHYSICS Artist’s rendering of an
▶ PERSPECTIVE P. 31
Laser cooling of ions in a neutral early morning in Silesia,
plasma T. K. Langin et al. Poland, during the Late
45 PLANT SCIENCE ▶ PERSPECTIVE P. 33
Synthetic glycolate metabolism Triassic. The elephant-
pathways stimulate crop growth and sized dicynodont
64 NEUROSCIENCE Lisowicia bojani,
productivity in the field P. F. South et al.
CREDITS: (PHOTO) MARCO MEGA/ALAMY STOCK PHOTO; (GRAPHIC) C. BICKEL/SCIENCE
SCIENCE (ISSN 0036-8075) is published weekly on Friday, except last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Periodicals mail
postage (publication No. 484460) paid at Washington, DC, and additional mailing offices. Copyright © 2019 by the American Association for the Advancement of Science. The title SCIENCE is a registered trademark of the AAAS. Domestic
individual membership, including subscription (12 months): $165 ($74 allocated to subscription). Domestic institutional subscription (51 issues): $1971; Foreign postage extra: Mexico, Caribbean (surface mail) $55; other countries (air
assist delivery): $98. First class, airmail, student, and emeritus rates on request. Canadian rates with GST available upon request, GST #125488122. Publications Mail Agreement Number 1069624. Printed in the U.S.A.
Change of address: Allow 4 weeks, giving old and new addresses and 8-digit account number. Postmaster: Send change of address to AAAS, P.O. Box 96178, Washington, DC 20090–6178. Single-copy sales: $15 each plus shipping
and handling; bulk rate on request. Authorization to reproduce material for internal or personal use under circumstances not falling within the fair use provisions of the Copyright Act is granted by AAAS to libraries and others who use
Copyright Clearance Center (CCC), www.copyright.com. The identification code for Science is 0036-8075. Science is indexed in the Reader’s Guide to Periodical Literature and in several specialized indexes.
Published by AAAS
Corrected 4 January 2019. See full text.
ED ITORIAL
I
previously reported results of a study on au- compared with 16% in the physical sciences and 22% in
thor gender in Science (science.sciencemag.org/ other fields. The values for corresponding authors are
content/355/6323/329) that was based on the ex- 19, 12, and 20%, respectively.
amination of a random sample of approximately The gender distributions for papers that were pub-
2600 authors for which gender was inferred by lished can be compared with those for the overall sub-
painstaking analysis of websites and similar sourc- missions pool. The acceptance rates for Reports were
es. Unfortunately, this approach does not scale not significantly different for female as compared to
well to large samples necessary for many analyses. male first authors for papers submitted in 2016 and Editor-in-Chief,
We have since initiated systematic efforts to examine 2017, although significant differences were observed Science Journals.
gender distributions of key populations of authors and favoring male authors from 2011 to 2015. Further work jberg@aaas.org
reviewers for the Science family of journals using addi- is in progress to determine if these disparities are
8-year period examined. Twenty-five ± 1% of the first Nonetheless, ensuring that gender distributions for re-
authors are female, while 18 ± 1% of the correspond- viewers approximate those for authors is good practice,
ing authors are female, consistent with the results from and peer reviewers do get access to exciting scientific
our earlier analysis. These figures reflect the weighted results and are often invited to write Perspectives. We
averages across the different fields covered by Science. plan to share these and other analyses and encourage
Separating submissions by field reveals that 30% of first others to perform and share similar examinations.
authors of submissions in the life sciences are female, –Jeremy Berg
10.1126/science.aaw4633
AREAS TO WATCH the ice’s structure and the water and land
beneath it, using everything from seismo-
meters to instrument-carrying seals. Both
What’s coming up in 2019 missions will benefit from revitalized satel-
lite coverage, as two satellites launched last
S
cientists in Europe and the United States face an uncertain year, the Ice, Cloud, and Land Elevation
political landscape in the new year, which could affect fund- Satellite-2 and the Gravity Recovery and
ing and collaborations. The threat is most acute in the United Climate Experiment Follow-on, which
measure ice height and mass, respectively,
Kingdom, which plans to exit the European Union in March begin to beam science data back home.
but has not settled on the terms of its departure. Some big re-
search findings could share the headlines, however, including
A science whisperer for Trump
the first clear images of the supermassive black hole at the heart of
SCIENCE POLICY | For 2 years, President
our galaxy, from astronomers in an international collaboration called Donald Trump has been making decisions
the Event Horizon Telescope. Science’s news staff forecasts other involving science and innovation without
areas of research and policy likely to make news this year. input from a White House science adviser.
Meteorologist Kelvin Droegemeier, whom
PHOTO: ALFRED WEGENER INSTITUTE/STEFAN HENDRICKS
Published by AAAS
The RV Polarstern, shown the team will loft a balloon into the strato-
here on a 2013
Seeking new physics in the muon sphere, where it will release 100 grams
polar research cruise, | By studying the
PA R T I C L E P H YS I C S of reflective particles—probably calcium
will spend a winter magnetism of a particle called the muon, carbonate, the chalky ingredient in antacid
frozen in Arctic sea ice. physicists hope to find results this year tablets. Flying back through the plume,
that could point to new particles or forces, the balloon will observe its cooling effect.
something they have craved for decades. Solar-radiation management, as it’s known,
Scientists at Fermi National Accelerator is controversial. It does not reduce the
Laboratory (Fermilab) in Batavia, Illinois, built-up carbon dioxide that drives climate
are examining whether the muon—a change and ocean acidification, and there’s
heavier and shorter-lived cousin of the no accepted international governance.
electron—is more magnetic than theory
predicts. The Muon g-2 experiment found
a hint of such an excess when it ran at Divided we stand?
Brookhaven National Laboratory in Upton, SCIENCE POLICY | You’ll need a Ouija
New York, from 1997 to 2001. Physicists board to predict how U.S. science will fare
moved the experiment’s 15-meter-wide this year under a divided government, with
electromagnet to Fermilab in 2013, Democrats now in control of the House of
upgraded the apparatus, and started to Representatives while Republicans retain
record data in January 2018. A first result
sexual harassment would be narrowed get its first, modest field experiment this genetically modified (GM) mosquitoes in
from “unwelcome conduct of a sexual year. In solar geoengineering, vast amounts Africa is set to happen in Burkina Faso
nature” to “unwelcome conduct on the of reflective aerosol particles would this year, an initial step in a planned “gene
basis of sex that is so severe, pervasive, be sprayed into the high atmosphere, drive” strategy against malaria. It will be
and objectively offensive that it effec- mimicking the cooling effects of volcanic the first release of GM mosquitoes of the
tively denies a person equal access” to eruptions. The Stratospheric Controlled genus Anopheles, which transmits the
education. And defendants’ lawyers will Perturbation Experiment, led by climate parasite responsible for the disease. The
be able to cross-examine accusers. The scientists at Harvard University, will test gene drive approach, under development at
department is accepting comments on the the idea in a small, controlled way. If its the nonprofit consortium Target Malaria,
proposals until 28 January. plans are approved by an advisory board, would spread mutations through the wild
population that knock out key fertility to living descendants. Some warn, however,
genes or reduce the proportion of female The next planetary mission that widespread adoption of similar methods
insects, which transmit disease. But the | In July, NASA will chart
S PAC E S C I E N C E could be used to coerce communities into
first GM Anopheles mosquitoes released its next major step in planetary science genetic testing. In France, a government-
won’t bear such mutations and aren’t when it selects the next billion-dollar mis- commissioned report recommended in
intended to cut down the population. sion under its New Frontiers program. The November 2018 that over the next 5 years,
Researchers will let out fewer than agency will choose between two finalists. French museums work with colleagues in
10,000 genetically sterilized males to Dragonfly would send a semiautonomous Africa to repatriate tens of thousands of
observe how they survive and disperse quad-copter to fly across the surface of cultural artifacts looted during colonial rule
in the wild and to help introduce the Titan, the saturnian moon sculpted by if their countries of origin ask for them.
concept of GM mosquitoes to regulators rivers of liquid methane. The copter would
and community members. search for clues of chemical reactions that
could lead to life. The Comet Astrobiology Disease crisis looms for swine
Exploration Sample Return mission would | Pig farmers—
L I V E S T O C K AG R I C U LT U R E
Nations size up biodiversity return gases and ice from the nucleus of and perhaps some bacon lovers—will anx-
| Three years in the mak-
C O N S E R VAT I O N the comet 67P/Churyumov-Gerasimenko. iously scan the headlines this year for news
ing, a $2.4 million assessment of Earth’s Such samples, likely unaltered for billions of African swine fever (ASF). Harmless to
biodiversity and ecosystems will be pub- of years, could provide a window into the humans, the viral disease is highly infec-
lished in May. By evaluating trends over role comets played in delivering water and tious and lethal among pigs, causing serious
50 years in indicators such as species organic compounds to Earth in its economic damage through culls and trade
Published by AAAS
IN DEP TH
By Tania Rabesandratana ary 2020, has drawn support from many to OA, says librarian Jeffrey MacKie-Mason,
scientists, who welcome a shake-up of a pub- the chief digital scholarship officer at the
H
ow far will Plan S spread? lishing system that can generate large prof- University of California, Berkeley.
Since the September 2018 launch its while keeping taxpayer-funded research Robert-Jan Smits, the European Com-
of the Europe-backed program to results behind paywalls. But publishers (in- mission’s OA envoy in Brussels, who is one
mandate immediate open access (OA) cluding AAAS, which publishes Science) are of the architects of Plan S, says publishers
to scientific literature, 16 funders in concerned, and some scientists worry that have stalled by emphasizing the need for
13 countries have signed on. That’s Plan S could restrict their choices. broad participation. “The big publishers
still far shy of Plan S’s ambition: to con- If Plan S fails to grow, it could remain told me: ‘Listen, we can only flip our jour-
vince the world’s major research funders a divisive mandate that applies to only a nals [to OA] if this is signed by everyone. So
to require immediate OA to all first go on a trip around the world
published papers stemming from “[Plan S] is perhaps our best chance to and come back in 20 years. Then
their grants. Whether it will we can talk again,’” Smits recalls.
reach that goal depends in part transform the publishing industry soon.” “Some people try to do anything to
on details that remain to be set- Jeffrey MacKie-Mason, University of California, Berkeley keep the status quo.”
tled, including a cap on the au- OA mandates are nothing new:
thor charges that funders will pay for OA small percentage of the world’s scientific In Europe, 74 research funders require that
ILLUSTRATION: DAVIDE BONAZZI/SALZMAN ART
publication (Science, 30 November 2018, papers. (Delta Think, a consulting company papers be made free at some point, up from
p. 983). But the plan has gained momen- in Philadelphia, Pennsylvania, estimates 12 in 2005, according to the Registry of
tum: In December 2018, China stunned that the first 15 funders to back Plan S ac- Open Access Repository Mandates and Poli-
many by expressing strong support for counted for 3.5% of the global research ar- cies. But existing policies typically allow a
Plan S (Science, 14 December 2018, p. 1218). ticles in 2017.) To transform publishing, the delay of 6 or 12 months after initial publica-
This month, a national funding agency in plan needs global buy-in. The more funders tion, during which papers can remain be-
Africa is expected to join, possibly followed join, the more articles will be published in hind a publisher paywall.
by a second U.S. funder. Others around the OA journals that comply with its require- Plan S requires immediate OA; it also in-
world are considering whether to sign on. ments, pushing publishers to flip their jour- sists that authors retain copyright and that
Plan S, scheduled to take effect on 1 Janu- nals from paywall-protected subscriptions hybrid journals, which charge subscrip-
tions but also offer a paid OA option, sign government research funder and two na- National Institute of Informatics in Tokyo,
“transformative agreements” to switch to tional science libraries issued strong state- an adviser to the Japan Alliance of Univer-
fully OA. ments backing Plan S’s goals. “China needs sity Library Consortia for E-Resources, says
Some European funders think Plan S to contribute to international open access that despite interest from funders and li-
goes too far. “We and many German [or- [and] open its research results to its own braries, OA has yet to gain much traction
ganizations] think that we should not be people,” says Zhang Xiaolin of Shanghai- in his country.
as prescriptive as Plan S is,” says Wilhelm Tech University in China, who chairs the South America has a strong tradition
Krull, secretary general of the Volkswagen Strategic Planning Committee of the Chi- of OA repositories and fee-free publish-
Foundation, a private research funder in nese National Science and Technology Li- ing, often with government subsidies.
Hannover, Germany. The country is Eu- brary. Even if Chinese organizations do not Bianca Amaro, president of LA Referencia,
rope’s top producer of scientific papers, join Plan S formally, similar OA policies in a Santiago-based Latin American network
ahead of the United Kingdom and France, China would have a “huge, perhaps deci- of repositories, says Plan S takes a more
whose main funding agencies have signed sive impact on the publishing industry,” “systemic view” than previous policies, and
on to Plan S. Germany’s biggest MacKie-Mason says. she values its pledge to monitor APCs and
federal funding agency, DFG, For now, North America is their impact—a worry for lower-income
said it supports Plan S’s goals Paper players not following suit. The Bill & countries. “We’ll see how Europe handles
but prefers to let research- Melinda Gates Foundation was this,” she says.
Percentages of the
ers drive the change. Other world’s 2016 science
the first Plan S participant out- Of course, MacKie-Mason says, not every
funders, including the Esto- articles by country side Europe, and another pri- funding agency will agree that Plan S is the
nian Research Council, say the vate funder may follow. But U.S. best way to universal OA. “But some will
CREDITS: (GRAPHIC) N. DESAI/SCIENCE; (DATA) NATIONAL SCIENCE BOARD, SCIENCE & ENGINEERING INDICATORS 2018
4.5 Germany
Véronique Halloin, secretary- we’ve done our homework to The Plan S team predicts steady growth
general of FNRS, whose exist- 4.3
United ensure it would have the best ef- in the coming months. Funders will dis-
ing OA mandate caps APC re- Kingdom fect on Canadian science,” says cuss Plan S in São Paulo, Brazil, at the May
imbursement at €500—which 4.2 Japan Kevin Fitzgibbons, executive meeting of the Global Research Council,
Halloin admits is on the low side. director of corporate planning an informal group of funding agencies. Al-
Many await the European 3 France and policy at Canada’s Natural though Smits will leave the European Com-
Commission’s policy: Although 3 Italy Sciences and Engineering Re- mission in March, the Plan S coalition is
its grants represent a small 2.8 South Korea
search Council in Ottawa. seeking a replacement who can keep the
percentage of research funding Outside Europe and North momentum going.
2.6 Russia
in Europe, its OA rules can in- America, funders gave Science “The combined weight of Europe and
fluence national mandates. The 2.5 Canada mixed responses about Plan S. China is probably enough to move the sys-
commission’s research chief, 2.3 Brazil India, the third biggest pro- tem,” says astrophysicist Luke Drury, of the
Carlos Moedas, supports Plan 2.3 Spain ducer of scientific papers in Dublin Institute for Advanced Studies and
S, and its 7-year funding pro- 2.2 Australia the world, will “very likely” the lead author of a cautiously supportive
gram Horizon Europe, which join Plan S, says Krishnaswamy response to Plan S by All European Acad-
will begin in 2021, contains VijayRaghavan in New Delhi, emies, a federation of European academies
general statements of support principal scientific adviser to of sciences and humanities.
for OA. Plan S’s rules will go India’s government. But the If Plan S does succeed in bringing about a
into the program’s model con- Other
Russian Science Foundation fairer publishing system, he says, a transition
tract for grants, Smits says. 25.1 is not planning to join. South to worldwide OA is sure to follow. “Some-
countries
Smits has found unexpected Africa’s National Research body has to take the lead, and I’m pleased
support from China, which Foundation says it “supports that it looks like it’s coming from Europe.” j
now produces more scientific Plan S in principle,” but wants
papers than any other coun- to consult stakeholders before With reporting by Jefrey Brainard, Sanjay
try. Last month, China’s largest signing on. Jun Adachi of the Kumar, Dennis Normile, and Brian Owens.
Published by AAAS
In some wet tropical mountains, carbon dioxide is
captured and flushed out of the atmosphere.
H
ate the cold? Blame Indonesia. It may ics somehow drives those shifts as it remakes to see which formed in the topics, and when.
sound odd, given the contributions the planet’s surface. But for several decades, “We were surprised that this is not as compli-
to global warming from the country’s researchers have debated exactly what turns cated as we thought,” Macdonald said.
270 million people, rampant defores- the CO2 knob. Many have focused on the vol- The team compared the results to records
tation, and frequent carbon dioxide canoes that rise where plates dive beneath of past glaciations and found a strong cor-
(CO2)-belching volcanic eruptions. But one another. By spewing carbon from Earth’s relation. They also looked for declines in
over much longer times, Indonesia is sucking interior, they could turn up the thermostat. volcanism, which might have cooled the cli-
CO2 out of the atmosphere. Others have emphasized rock weathering, mate. But their influence was much weaker,
Many mountains in Indonesia and neigh- which depends on mountain building driven Macdonald said.
boring Papua New Guinea consist of ancient by plate tectonics. When the mountains Kimberly Lau, a geochemist at the Univer-
volcanic rocks from the ocean floor that contain seafloor rocks rich in calcium and sity of Wyoming in Laramie, calls the work
were caught in a colossal tectonic collision magnesium, they react with CO2 dissolved “exciting in idea and novel in execution.” Lee,
between a chain of island volcanoes and a in rainwater to form limestone, which is however, would like to see direct evidence
continent, and thrust high. Lashed by tropi- eventually buried on the ocean floor. Both from ancient sediments that the collisions
cal rains, these rocks hungrily react with CO2 processes matter; “the issue is which one is drove up rock weathering. “They have to go
and sequester it in minerals. That is why, changing the most,” says Cin-Ty Lee, a volca- to the sink and study those,” he says. And a
with only 2% of the world’s land area, Indo- nologist at Rice University in Houston, Texas. recent study challenges the mountain ther-
nesia accounts for 10% of its long-term CO2 Having the right rocks to drive the CO2- mostat idea with evidence for the importance
absorption. Its mountains could explain why chewing reaction is not sufficient. Climate of volcanoes. The study used ages from thou-
ice sheets have persisted, waxing and wan- matters, too. For example, the Siberian Traps, sands of zircons, durable crystals that can in-
ing, for several million years (although they a region that saw devastating volcanic erup- dicate volcanic activity, to show that upticks
are now threatened by global warming). tions 252 million years ago, are rich in such in volcanic emissions were the dominant
Now, researchers have extended that rocks but absorb little, says Dennis Kent, a force driving the planet’s warm periods. It’s
theory, finding that such tropical mountain- geologist at Rutgers University in New Bruns- likely both teams have at least one hand on
building collisions coincide with nearly all of wick, New Jersey. “It’s too damn cold,” he the truth, adds Lee, who contributed to the
the half-dozen or so significant glacial periods says. Saudi Arabia has the heat and the rocks zircon paper.
PHOTO: ROBERT HARDING/ALAMY STOCK PHOTO
in the past 500 million years. “These types of but lacks another ingredient. “It’s hotter than The beauty of his team’s model, Macdonald
environments, through time, are what sets Hades but it doesn’t rain.” Indonesia’s loca- said at the end of his talk, is that it explains
the global climate,” said Francis Macdonald, tion in the rainy tropics is just right. “That is not just why glacial times start, but also why
a geologist at the University of California, probably what’s keeping us centered in an ice they stop. A hothouse Earth appears to be
Santa Barbara, when he presented the work age,” Kent adds. the planet’s default state, prevailing for three-
last month at a meeting of the American Geo- Over the past few years, Macdonald and fourths of the past 500 million years. An
physical Union in Washington, D.C. If Earth’s his collaborators have searched for other Indonesia-style collision may push the global
climate has a master switch, he suggests, the times when tectonics and climate could have climate into a glacial period, but only for a
rise of mountains like Indonesia’s could be it. conspired to open an Indonesia-size CO2 while. Mountains erode and continents drift.
Most geologists agree that long-term drain. They found that glacial conditions And the planet warms again. j
NEUROSCIENCE
By Kelly Servick removal of a brain tumor, when electrical words aloud. Meanwhile, electrodes re-
readouts from the exposed brain help sur- corded from the brain’s speech planning ar-
F
or many people who are paralyzed and geons locate and avoid key speech and motor eas and motor areas, which send commands
unable to speak, signals of what they’d areas. Another is when a person with epi- to the vocal tract to articulate words. The
like to say hide in their brains. No one lepsy is implanted with electrodes for several network mapped electrode readouts to the
has been able to decipher those sig- days to pinpoint the origin of seizures before audio recordings, and then reconstructed
nals directly. But three research teams surgical treatment. “We have, at maximum, words from previously unseen brain data.
recently made progress in turning 20 minutes, maybe 30,” for data collection, According to a computerized scoring sys-
data from electrodes surgically placed on Martin says. “We’re really, really limited.” tem, about 40% of the computer-generated
the brain into computer-generated speech. The groups behind the new papers made words were understandable.
Using computational models known as neu- the most of precious data by feeding the Finally, neurosurgeon Edward Chang and
ral networks, they reconstructed words and information into neural networks, which his team at the University of California,
son to person, so computer models must Miguel Angrick of the University of Bremen interface: If they can hear the computer’s
be “trained” on each individual. And the in Germany and Christian Herff at Maas- speech interpretation in real time, they may
models do best with extremely precise data, tricht University in the Netherlands, relied be able to adjust their thoughts to get the
which requires opening the skull. on data from six people undergoing brain result they want. With enough training of
Researchers can do such invasive record- tumor surgery. A microphone captured both users and neural networks, brain and
ing only in rare cases. One is during the their voices as they read single-syllable computer might meet in the middle. j
Published by AAAS
ECOLOGY
F
or people, and many other animals, seems anytime anyone looks for it, they find sity in Madrid, calls the kin effects “altruis-
family matters. Consider how many a kin effect,” says André Kessler, a chemical tic” because each individual plant gives up
jobs go to relatives. Or how an ant will ecologist at Cornell University. some of its ultimate seedmaking potential
ruthlessly attack intruder ants but res- From termites to people, kin-specific be- to expend more energy making flowers. In
cue injured, closely related nestmates. haviors have evolved over and over in ani- the end, he suspects, more seeds are fertil-
There are good evolutionary reasons mals, showing there is a strong advantage ized overall in the closely related pots.
to aid relatives, after all. Now, it seems, fam- to helping relatives pass on shared genes. Doubts linger. Is a plant identifying genetic
ily feelings may stir in plants as well. Dudley reasoned that the same evolutionary kin, or simply recognizing that its neighbor is
A Canadian biologist planted the seed of forces should apply to plants. Not long after more or less similar to itself? “I do not think
the idea more than a decade ago, but many researchers proved that plants can distin- that there has been convincing evidence for
plant biologists regarded it as heretical— guish “self” from “nonself” roots, she tested kin recognition in plants yet,” says Hélène
plants lack the nervous systems that enable whether they could also pick out and favor Fréville, a population biologist studying crops
animals to recognize kin, so how can they kin. She grew American searocket (Cakile at the Montepellier outpost of the French Na-
know their relatives? But with a series of edentula), a succulent found on North tional Institute for Agricultural Research.
recent findings, the notion that plants re- American beaches, in pots with relatives or Sagebrush bushes (Artemisia tridentata)
ally do care for their most genetically close with unrelated plants from the same popu- have provided some strong clues, however.
peers—in a quiet, plant-y way—is taking lation. With strangers, the searocket greatly When injured by herbivores, these plants
root. Some species constrain how far their expanded its underground root system, but release volatile chemicals that stimulate
roots spread, others change how many flow- with relatives, it held these competitive urges neighboring sagebrush to make chemicals
ers they produce, and a few tilt or shift their in check, presumably leaving more room for toxic to their shared enemies. Ecologist
leaves to minimize shading of neighboring kin roots get nutrients and water. The claim, Richard Karban at the University of Califor-
plants, favoring related individuals. published in 2007, shocked colleagues. A few nia, Davis, wondered whether kin were pref-
“We need to recognize that plants not sharply criticized the work, citing flawed sta- erentially warned. His group had already
only sense whether it’s light or dark or if tistics and bad study design. found that sagebrush plants roughly fall into
they’ve been touched, but also whom they Since then, however, other research- two “chemotypes,” which mainly emit ei-
PHOTO: RON STEINER/ALAMY STOCK PHOTO
are interacting with,” says Susan Dudley, a ers have confirmed her findings. Recently, ther camphor or another organic compound
plant evolutionary ecologist at McMaster working with Moricandia moricandioides, called thujone when their leaves are dam-
University in Hamilton, Canada, whose a Spanish herb, Rubén Torices and his col- aged. The team showed that the chemotypes
early plant kin recognition studies sparked leagues at the University of Lausanne in are heritable, making them a potential kin
the interest of many scientists. Switzerland and the Spanish National Re- recognition signal. In 2014, the researchers
Beyond broadening views of plant be- search Council demonstrated cooperation reported that when volatiles from a plant
havior, the new work may have a practical in flowering. After growing 770 seedlings in of one chemotype were applied to the same
side. In September 2018, a team in China pots either alone or with three or six neigh- type of plant, those plants mounted stronger
reported that rice planted with kin grows bors of varying relatedness, the team found antiherbivore defenses and had much less
insect damage than when the volatiles were yields. His lab studies rice varieties that give PLANETARY SCIENCE
applied to a plant of the other chemotype—a off weed-killing chemicals in their roots.
hint of a kin effect.
The mustard Arabidopsis thaliana has
provided another clue. About 8 years ago,
Right now, they don’t have high enough
yields to replace commonly grown variet-
ies that require herbicides. But in 3-year-
Asteroid
Jorge Casal, a plant biologist at the Univer-
sity of Buenos Aires, noticed that Arabidopsis
long field tests, kin-recognizing versions of
these self-protective rice varieties produced mission faces
‘breathtaking’
plants growing next to relatives shift the ar- a 5% increase in yield when grown with kin,
rangement of their leaves to reduce shading rather than unrelated plants, Kong and col-
of their neighbors, but don’t do that when the leagues reported in late September 2018 in
neighbors are unrelated. How they sense the
presence of relatives was a mystery, however.
The plants do have light sensors, and
New Phytologist. To test the approach on a
larger scale, he and his colleagues are plant-
ing “kin” seedlings of the weed-killing strain
touchdown
in 2015, Casal’s team discovered that the together in paddy fields in South China. As first data roll in from
strength of reflected light striking nearby Brian Pickles, an ecologist at the Uni-
leaves signaled relatedness and triggered versity of Reading in the United Kingdom, Hayabusa2, engineers plan
the rearrangements. Relatives tend to proposes that kin recognition could even descent to rocky surface
sprout leaves at the same height, bouncing help forests regenerate. By tracing flows
more light onto each other’s leaves. By shift- of nutrients and chemical signals between
ing leaves to reduce how much they shade trees connected by underground fungi, he By Dennis Normile, in Yonago, Japan
than plants forced to grow straight up. convinced. “We are learning that plants are ing to plan since Hayabusa2 was launched
Chui-Hua Kong, a chemical ecologist at capable of so much more sophisticated be- in December 2014. Its cameras and detec-
the China Agricultural University in Beijing, havior than we had thought,” he says. “It’s tors have already provided clues to the
is exploiting a similar effect to boost rice really cool stuff.” j asteroid’s mass, density, and mineral and
Published by AAAS
elemental composition, and three rovers to conduct comparative studies of these two studies that can reveal much more about
dropped on the asteroid have examined asteroid brothers,” Watanabe says. the asteroid’s age and content. ISAS engi-
the surface. At the symposium, ISAS re- Geologist Stephen Mojzsis of the Univer- neers programmed the craft to perform
searchers presented early results, including sity of Colorado in Boulder is not convinced autonomous landings, anticipating safe
evidence of an abundance of organic ma- such asteroids will prove to be the source of touchdown zones at least 100 meters in di-
terial and hints that the asteroid’s parent Earth’s water; there are other theories, he ameter. Instead, the biggest safe area within
body once held water. Those findings “add says, including the possibility that a giant the first landing zone turned out to be just
to the evidence that asteroids rather than Jupiter-like gaseous planet migrated from 12 meters wide.
comets brought water and organic materi- the outer to the inner solar system, bringing That will complicate what was already a
als to Earth,” says project scientist Seiichiro water and other molecules with it around nail-biting operation. Prior to each landing,
Watanabe of Nagoya University in Japan. the time Earth was formed. Still, findings Hayabusa2 planned to drop a small sphere
Ryugu is 1 kilometer across and 900 me- on Ryugu’s shape and composition “scien- sheathed in a highly reflective material to be
ters top to bottom, with a notable bulge tifically, could be very important,” he says. used as a target, to ensure the craft is mov-
around the equator, like a diamond. ing in sync with the asteroid’s rotation.
Visible light observations and com- Gravity then pulls the craft down gen-
puter modeling suggest it’s a porous tly until a collection horn extending
pile of rubble that likely agglomerated from its underside makes contact with
dust, rocks, and boulders after another the asteroid; after a bulletlike projec-
asteroid or planetesimal slammed tile is fired into the surface, soil and
into its parent body during the early rock fragments hopefully ricochet into
on the parent body or on the asteroid, says Fuyuto Terui, who is in charge
says Mutsumi Komatsu, a planetary ma- of mission guidance, navigation, and
1m
terials scientist at the Graduate Univer- control. Aiming at the smaller zone
sity for Advanced Studies in Hayama, means Hayabusa2 can keep the target
Japan. The asteroid’s high porosity also Hayabusa2 imaged its shadow during a rehearsal descent (top). A marker in sight until the craft is close
suggests it once harbored significant close-up shows a surface strewn with boulders (bottom). to the surface; the bigger zone gives
amounts of water or ice and other vola- more leeway for error, but the craft
tile compounds that later escaped, Watanabe Some new details come from up-close will lose its view of the marker earlier in
says. Asteroids such as Ryugu are rich in car- looks at the asteroid’s surface. On 21 Sep- the descent.
bon as well, and they may have been respon- tember, Hayabusa2 dropped a pair of rovers Assuming the craft survives the first
sible for bringing both water and carbon, the size of a birthday cake, named Minerva- landing, plans call for Hayabusa2 to blast a
life’s key building block, to a rocky Earth II1A and -II1B, on Ryugu’s northern hemi- 2-meter-deep crater into Ryugu’s surface at
early in its history. (Comets, by contrast, are sphere. Taking advantage of its low gravity another site a few months later, by hitting it
just 3% to 5% carbon.) to hop autonomously, they take pictures with a 2-kilogram, copper projectile. This is
Support for that theory, known as the late that have revealed “microscopic features of expected to expose subsurface material for
heavy bombardment, comes from another the surface,” Tsuda says. And on 5 October, observations by the craft’s cameras and sen-
asteroid sample return mission now in Hayabusa2 released a rover developed by sors; the spacecraft may collect some mate-
progress. Early last month, NASA’s OSIRIS- the German and French space agencies that rial from the crater as well, using the same
REx reached asteroid Bennu, which is analyzed soil samples in situ and returned horn device. There could be a third touch-
shaped like a spinning top as well and, the additional pictures. down, elsewhere on the asteroid. If all goes
U.S. space agency has reported, has water The ultimate objective, to bring aster- well, Hayabusa2 will make it back to Earth
trapped in the soil. “We’re lucky to be able oid samples back to Earth, will allow lab with its treasures in 2020. j
BIOLOGY
IN THE BANK
How an open-access trove of
data on Britons is unlocking
I
n early 2017, epidemiologist Rory the encrypted files. Then, on 19 July 2017, long-running controversies about the ap-
Collins at the University of Oxford in they released a final encryption key, firing plication of genetics to behavior in people.
the United Kingdom and his team the starting gun for a scientific race. When the Manchester-based UKB en-
faced a test of their principles. They Within a couple of days, one U.S. group rolled its first volunteer 13 years ago, some
run the UK Biobank (UKB), a huge had done quick analyses linking more than critics wondered whether it would be a
research project probing the health 120,000 genetic markers to more than waste of time and money. But by now, any
and genetics of 500,000 British peo- 2000 diseases and traits, data it eventu- skepticism is long gone. “It’s now clear
ple. They were planning their most ally put up on a blog. Only 60,000 markers that it has been a massive success—largely
sought-after data release yet: genetic had previously been tied to disease, says because the big data they have are being
profiles for all half-million participants. human geneticist Eric Lander, president made widely available,” says Oxford de-
Three hundred research groups had signed and director of the Broad Institute in Cam- velopmental neuropsychologist Dorothy
up to download 8 terabytes of data—the bridge, Massachusetts. “[They] doubled Bishop, a participant. Other biobanks are
equivalent of more than 5000 streamed that in a week.” bigger or collect equally detailed health
movies. That’s enough to tie up a home Within 2 weeks, others had begun to data. But the UKB has both large numbers
computer for weeks, threatening a key goal post draft manuscripts on the bioRxiv pre- of participants and high-quality clinical
of the UKB: to give equal access to any print site. By now, those data have spawned information. It “allows us to do research
qualified researcher in the world. dozens of papers in journals or on bioRxiv, on a scale that we’ve never been able to do
“We wanted to create a level playing firming up how particular genes contrib- before,” says Peter Visscher, a quantitative
field” so that someone at a big center with ute to heart disease, diabetes, Alzheimer’s, geneticist at the University of Queensland
a supercomputer was at no more of an ad- and other conditions, as well as genes’ role in Brisbane, Australia.
vantage than a postdoc in Scotland with a in shaping personality, depression, birth The crucial ingredient, however, may be
PHOTO: NIGEL HILIER
smaller computer and slower internet link, weight, insomnia, and other traits. More open access. Researchers around the world
says Oxford’s Naomi Allen, the project’s chief controversially, data from the trove also can freely delve into the UKB data and rap-
epidemiologist. They came up with a plan: pointed to DNA markers linked to educa- idly build on one another’s work, resulting
They gave researchers 3 weeks to download tion level and sexual orientation, stoking in unexpected dividends in diverse fields,
Published by AAAS
NEWS
diet and smoking with the development of In 2015, his team released the first batch
disease over time. The model was the famous of genetic data on a subset of 150,000 par-
Framingham Heart Study, a long-term study ticipants. Then came the July 2017 release
that initially analyzed 5200 residents of of full genotyping data for all 500,000. Two
Framingham, Massachusetts, seeking factors months later, Benjamin Neale’s group at the
that influence heart disease. The UKB proj- Broad Institute put up its blog doubling the
ect, which has received $308 million in fund- number of markers linked to traits and dis-
ing so far from the Wellcome Trust medical orders, as well as a web browser for looking
charity, the U.K. government, and disease up specific markers. “We viewed it as a ser-
foundations, “was going to be like Framing- vice to the community,” Neale says.
ham, only 100 times bigger,” says principal
investigator Collins. TODAY, about 7000 researchers have reg-
From 2006 to 2010, the UKB enrolled istered to use UKB data on 1400 projects,
500,000 people aged 40 to 69 through the and nearly 600 papers have been published.
United Kingdom’s National Health Service. Some studies simply link behaviors and dis-
Mailed invitations were sent widely, includ- ease, for example reporting that drinking
ing to people in poor and ethnically diverse more coffee can reduce mortality but that
areas of cities such as Birmingham. But in
the end, participants were “anybody you
could persuade,” Collins says. Investigators Engine of productivity
ect’s chief downside, as it explores just one ing. They also sign a legal agreement not to collect their own data,” says statistical genet-
slice of humanity: northern Europeans. It try to reidentify any participant.) icist Danielle Posthuma of Vrije University in
holds data for only about 20,000 people “It was a novel concept,” says Collins, who Amsterdam, who studies brain diseases. By
of African or Asian descent, for example. says he’s lost track of the times someone has combining data from the UKB and other col-
Yet as new papers appear every few days, asked him after a talk whether he’s inter- lections, investigators can amass samples of
researchers say the UKB remains a shin- ested in collaborating. “I have to say, ‘You a million people or more, amplifying the sig-
ing example of the power of curiosity un- just request the data.’ To some extent people nal of gene variants with subtle effects. For
leashed. “It’s the thing we always dreamed don’t believe it.” some diseases, dozens or hundreds of genes
of,” Lander says. The aim is to maximize the scientific pay- appear to play a role. The genetic links are
off: “By making data available to 100 people suggestive correlations; establishing cause
THE UKB WAS ANNOUNCED in the early 2000s around the world, we can get a lot more re- and effect will take more genetics work and
as a classical epidemiological study—the search done than if I sit here and do one lab studies, which could reveal new disease
kind used to associate risk factors such as study a year with the data,” he says. pathways that might be drug targets.
In the near term, the large sample sizes THE UKB’S UNUSUAL DESIGN does have some enrolled 33,000 Britons of Bangladeshi
are boosting the power of “polygenic” risk limitations. The big one: Ninety-four per- and Pakistani ancestry. In his experience,
scores, which calculate a person’s disease risk cent of participants are white. “It’s really South Asians in the United Kingdom are
by combining many genetic markers. For ex- good if you’re British or European,” Lander less likely to respond to mailed invitations.
ample, one study published in August 2018 says. But, “If you’re an American without His project achieved success by approach-
in Nature Genetics drew on the July 2017 European ancestry or an African or Asian, ing potential participants in person—
data to devise risk scores for five diseases, in- you’re going to be poorly serviced by the sometimes in their native language—in
cluding breast cancer and heart disease. The new polygenic risk scores.” Nor will scores “trusted” settings such as health clinics
authors, at Massachusetts General Hospital for traits such as educational attain- and community centers.
in Boston and the Broad Institute, found that ment be meaningful in people with non- Collins and other geneticists hope other
a surprisingly high 8% of people of European European ancestry. biobanks can help fill the gap. For exam-
descent have at least a threefold elevated risk The mailed invitation recruitment strat- ple, the Wellcome Trust is now the main
for heart disease. And up to 6% have a three- egy didn’t work as well as hoped, says funder of the China Kadoorie Biobank,
fold increase in risk for one of the four other Collins, who notes that young, low-income, with data on 515,000 people from main-
diseases, suggesting they should be screened white men are also scarce in the database. land China, belonging to 10 ethnic groups.
early and consider lifestyle changes or other “We were aiming to get heterogeneity, but In the United States, the All of Us biobank
measures that could improve their odds. it’s difficult.” funded by the National Institutes of Health
The most provocative studies have probed Bishop blames the project’s slant toward (NIH) aims to use community outreach to
for genetic influences on human behavior. higher income, healthy, white people on help enroll at least half of its 1 million par-
ticipants from minority groups, and like
bryos for desired traits or discriminate or concern that genetic findings could be the world, are already gearing up for the
against individuals with certain genetic used to discriminate. wide release of the first batch of exome
profiles. That would be a misuse of the Engaging such groups is possible, says data on 50,000 participants. Again, they’ll
findings, say the researchers who identi- geneticist David Van Heel of Queen Mary allow time for the download, then release a
fied these links. They stress that the prob- University of London, who heads the code. The starting gun in the next scientific
abilities mean little on the individual level. Genes & Health study, which so far has race is set for March. j
Published by AAAS
SPOTTING EVOLUTION
AMONG US
The half-million people in the UK Biobank hold the genetic legacy
of Neanderthals—and clues to how we are still evolving
By Ann Gibbons
N
eanderthals are still among us, get their rubber-gloved hands on enough Among participants in the UK Biobank are people
Janet Kelso realized 8 years ago. people’s genomes to detect the relatively whose Neanderthal DNA predisposes them to traits
She had helped make the momen- rare bits of Neanderthal DNA, much less such as propensity to sunburn, staying up late,
tous discovery that Neanderthals to see whether or how our extinct cousins’ depression, smoking, and feeling lonely.
repeatedly mated with the ances- genetic legacy might influence disease or
tors of modern humans—a find- physical traits. could actually look and say: ‘We see a Ne-
ing that implies people outside of But a few years ago, Kelso and her col- anderthal version of the gene and we can
Africa still carry Neanderthal DNA leagues at the Max Planck Institute for measure its effect on phenotype in many
today. Ever since then, Kelso has Evolutionary Anthropology in Leipzig, people—how often they get sunburned,
ILLUSTRATION: PETER ARKLE
wondered exactly what modern humans Germany, turned to a new tool—the UK what color their hair is, and what color
got from those prehistoric liaisons—beyond Biobank (UKB), a large database that their eyes are,’” Kelso says. They found
babies. How do traces of the Neanderthal holds genetic and health records for half Neanderthal variants that boost the odds
within shape the appearance, health, or per- a million British volunteers (see story, that a person smokes, is an evening person
sonalities of living people? p. 18). The researchers analyzed data from rather than a morning person, and is prone
For years, evolutionary biologists couldn’t 112,338 of those Britons—enough that “we to sunburn and depression.
Kelso is one of many researchers who are used proprietary electronic records of 28,000 psychiatric and lifestyle traits.” Those rich
turning troves of genetic and medical data on Americans. His team was the first to publish, data have also made the UKB a hunting
living people into windows on human evolu- reporting Neanderthal DNA variants that ground for clues to evolutionary changes
tion. In addition to unearthing archaic DNA, raise the risk of depression, skin lesions, that have shaped people’s genomes in the
the studies are pinpointing genes that natu- blood clots, and other disorders in people past few generations—and may even be do-
ral selection may now be winnowing out of today (Science, 12 February 2016, p. 648). In- ing so today.
the gene pool and other genes—for example spired by Capra’s study, Kelso jumped in, be-
those linked to fertility—that it may be fa- coming the first to use UKB data to publish A FEW YEARS AGO, Molly Przeworski of Co-
voring. Among the most fruitful of the data Neanderthal gene variants in living people. lumbia University and Joe Pickrell of the
sources is the UKB, which makes its data ac- Her results suggest that although some Ne- New York Genome Center in New York City
cessible to researchers, no matter where they anderthal gene variants may have been op- met for lunch near Columbia’s campus. Talk
are and what their field. Its giant database timal for active lives outdoors in prehistoric turned to aging and Alzheimer’s disease.
is “a magical new resource that [will] help Europe, they may be problematic for people Pickrell had been writing a blog, where he
us answer a whole bunch of hard questions now, who live mostly indoors in artificial had discussed studies showing that between
we’re struggling with now because all of the light and get less exercise. the ages of 70 and 85, carriers of the ApoE4
data has been under lock and key,” says allele, which boosts the risk of Al-
population geneticist Jeremy Berg, a zheimer’s and cardiovascular disease,
postdoc at Columbia University. “It is a died at about twice the rate of non-
step beyond other databases.” carriers. The pair wondered whether
For the UKB architects, who designed other gene variants affect survival so
Published by AAAS
perhaps, Przeworski speculates, because traits in women and men that might have in- Using other databases, researchers had
the variants curb older men’s fecundity. fluenced fertility, such as age of first birth, found that the number of genes that con-
Or perhaps the hypothesized benefit that age of menopause, height, weight, body tribute to tallness in Europeans increased
healthy grandmothers confer on grandchil- mass, blood pressure, and education. They on a cline from south to north. Many re-
dren was at work. found 23 traits in women and 21 in men searchers, including Berg, had concluded
The researchers did find two genes that linked to having more children. Not surpris- that northern Europeans had inherited
suddenly became rare at older ages, suggest- ingly, mothers who gave birth early and had those genes from an ancient migration—
ing they were harmful. One was ApoE4: As late menopause—and therefore had a longer that of the Yamnaya herders who migrated
expected, fewer carriers—especially women— reproductive span—were more fertile. So from the Eurasian steppe to central Europe
lived past age 80. Also, fewer men with a vari- were women who were heavier and shorter, about 4000 years ago. Berg and others sug-
ant of the CHRN3 gene that makes it harder perhaps because shorter bodies are more gested natural selection had favored tall-
to quit smoking survived past the age of 75 energy efficient, leaving a bigger reserve for ness in the Yamnaya or their ancestors,
than did men without the variant. pregnancy and nursing. and ancient DNA reveals that the Yamnaya
The researchers concluded that natural Visscher and his colleagues then set out were tall.
selection has not yet had time to eliminate to identify the genetic basis of these fertility- But now, with UKB data, population ge-
these two alleles, perhaps because changes linked traits. They analyzed data from neticist Graham Coop of UC Davis and his
in the environment and human behavior 157,807 of the women and 115,902 of the colleagues, including Berg, are challenging
only recently made them deadly (Science, men. As predicted, they found that the most that finding. In a bioRxiv preprint posted in
20 May 2016, p. 876). For example, the fertile women had higher frequencies of al- June 2018, they analyzed genetic and height
CHRN3 allele wouldn’t have affected sur- leles that tend to make them shorter and data on 500,000 people from the 2017 UKB
Challenging transitions
nel management, and ordering experience
as possible.
Elena Mahrt
Center for the Genetics of Host Defense,
We asked young scientists these questions: Have you ever encountered University of Texas Southwestern Medical Center,
Dallas, TX 75390, USA.
a particularly stark diference between an old and new position Email: elena.mahrt@utsouthwestern.edu
in your education or career? What was the diference between the
ILLUSTRATION: ROBERT NEUBECKER
positions, and what advice would you give to someone making As a scientist, I could focus on research,
but my transition to a professor role
a similar transition? Here, respondents share the challenges they faced came with new responsibilities. Instead
when they took on new responsibilities and roles, changed fields, of simply reading a publication to plan
or moved to new places. To others in similar situations, they advise: new experiments, I now read with an eye
toward how to explain the concepts to a
Be confident, prepared, and patient; communicate; and always ask student. A scientist might manage a group
for help when needed. —Jennifer Sills of 5 to 10 researchers, whereas a teacher
Published by AAAS
manages students ranging from under- and maintaining connections to your Transitioning from a dental school in India
graduates to postdoctoral fellows. As a original field. to a business school in the United States was
scientist, I could remain silent and work Fengbo Li tough. Looking back, I was not adequately
out problems internally. As a teacher, I Zhejiang Academy of Agricultural Sciences, prepared to appreciate the teaching peda-
have to talk constantly, yet remain calm. Hangzhou, Zhejiang 310021, China. gogy in a business school, which was in
Email: fengboli@gmail.com
Sudhakar Srivastava stark contrast to what I had been exposed to
Institute of Environment and Sustainable in dental school. Difficulties adapting to the
Development, Banaras Hindu University, Varanasi, When I transitioned from a master’s degree
Uttar Pradesh 221005, India. surroundings, environment, and culture of
program in Colombia to a Ph.D. program in
Email: sudhakar.srivastava@gmail.com a different country further compounded my
the United Kingdom, I encountered cultural
problems during my first year of graduate
shock and language barriers. To address
The training of a physician focuses on the studies. To those in a similar predicament,
these challenges, I acknowledged the differ-
familiarity with medical knowledge and I would recommend being a good listener,
ences, maintained an open dialogue with
clinical guidelines, whereas solid statis- setting achievable goals for each day, focus-
peers and supervisors to ensure accurate
tics and a programming background are ing on seemingly small activities, being
communication, and tried to view setbacks
required to become a data scientist. To detail oriented, and asking for help if you
with perspective. I also surrounded myself
make the transition, I joined a Ph.D. pro- need any. You will be surprised at how much
with other multilingual people who could
gram after medical school; spent 3 years people are willing to help those coming from
relate to the process of learning another
taking classes on statistical inference, a different country.
language and its frustrations, and I looked
machine learning, and computational for academic role models who weren’t native Veerasathpurush Allareddy
biology; and participated in programming College of Dentistry, University of Illinois at Chicago,
English speakers. Rather than compare
When our institute decided to launch clinical practice was daunting. I believe Email: signe.mosegaard@clin.au.dk
a new aquaculture research program, I it is important for students making this
returned to the aquaculture field without transition to prepare themselves not just I left a research assistant position in a
hesitation and reconnected and collabo- for the sprint to the next exam but for the 20-member lab to do my Ph.D. as the sole
rated with colleagues and old friends in “marathon” that is medical training. member of a new lab. Our productivity
the aquaculture community. To those Cody Lo depended on my effort, and I understood
transitioning from one field to another, I University of British Columbia, Vancouver, BC V6T both the responsibility and the opportunity
recommend being prepared for setbacks 1Z3, Canada. Email: codylo@alumni.ubc.ca the position entailed. I advise others to start
a Ph.D. with a secure and honest vision more we serve as role models, push societal stakeholders with substantially differ-
of what they want to achieve. Otherwise, acceptance of equality, and improve condi- ent levels of expertise, expectations, and
all the distractions in the world will not tions for future academic mothers. backgrounds on a daily basis. Excellent
be comfort enough during the difficult or Christine D. Bacon oral and written communication skills
unexpected moments. Department of Biological and Environmental are essential to ensure that messages are
Sciences, University of Gothenburg, Gothenburg, delivered clearly, precisely, and effi-
Steven M. Heaton Sweden. Email: christinedbacon@gmail.com
Department of Biochemistry and Molecular ciently. Understanding the organizational
Biology, Biomedicine Discovery Institute, landscape also plays a crucial role in effec-
Monash University, Clayton, VIC 3800, Australia. When I started my Ph.D. project, I depended tive communication, and the academic
Email: steven.heaton@monash.edu on guidance from my supervisor. When I platform does not provide that type of
transitioned to postdoctoral work, I had complex environment. Thus, I believe
Medical school was like drinking from a fire to independently navigate my research
hose. There was so much to learn; the more internships and industrial co-op positions
schedule, including both long-term and are the best opportunities for postgradu-
efficient I was, the better. When I transi- short-term goals. It was up to me to stay
tioned to graduate school during my M.D./ ate students who would like to get true
engaged, focus on my goals, and change exposure to the industrial atmosphere and
Ph.D. training, the rules for success were direction when appropriate. Self-navigation
less clear. My research mentor often tells me to improve their soft skills.
driven by intrinsic motivation helped me
to be creative, but there is no textbook for Dhanuka Wasalathanthri
find success as a postdoctoral researcher. Sanofi US, Fiskdale, MA 01518, USA.
creativity. Testing the boundaries of science Email: dhanuka02@gmail.com
Sha Yu
requires experiments or techniques that you School of Biological Sciences, Seoul
have never done before, and when you try National University, Seoul 8826, South Korea.
Published by AAAS
Downloaded from http://science.sciencemag.org/ on January 3, 2019
PERSPECTIVES
C
ollective behavior of social animals, observational data collected from marathon interaction rules from observations of group
particularly coordinated group move- runners. This approach circumvents many behavior is a complex, nonlinear inverse
ments, is one of the most striking of the sometimes-questionable assumptions problem, so drawing reliable conclusions in a
phenomena in the natural world, as that have previously been made and provides model-free way is often impossible.
anyone who has been enthralled by a roadmap for constructing an empirically Rather than thinking about a group as a
flocks of starlings or schools of sar- grounded theory of collective behavior. composite of individual agents with their
dines can attest. Research in this broad, in- The dominant paradigm for describing own rules, a group can instead be considered
terdisciplinary field has recently exploded, collective behavior is agent-based model- as an entity itself. The properties of the group
with motivations ranging from understand- ing. Each individual in a group is treated as certainly emerge from interactions between
ing the biological basis of social behavior an “agent” that follows a set of rules to de- the individuals, but to model these properties,
(1) to developing algorithms for designing termine its behavior. Most commonly, these it is not necessary to know where they come
and controlling swarms of robots (2). There rules include instructions to not stray too from. In this sense, collective behavior can
is good reason to think that the behavior far from the group, to avoid collisions, and, be treated analogously to how the mechan-
of human crowds is quite similar to these for directed motion, to move in the same ics of materials are modeled. To describe how
animal groups and that studying humans direction as nearby agents (5). Agent-based water flows, one does not need to consider
might help elucidate the origins of crowd models have succeeded in qualitatively re- molecular interactions; rather, one can apply
panic and other dangerous instabilities that producing patterns observed in real animal conservation laws for a macroscopic amount
can lead to injury or loss of life (3). All these groups (1), providing strong evidence that lo- of water and constrain them with empirical
PHOTO: MARCO MEGA/ALAMY STOCK PHOTO
goals require modeling, both as a check on cal interaction alone is sufficient to drive the observations (in the case of hydrodynamics, a
our understanding and as a predictive tool formation of group-level coherent behavior. linear constitutive law that relates stress and
for analyzing new situations. On p. 46 of this However, pattern isn’t everything, and just strain rate). Such an approach cannot cap-
issue, Bain and Bartolo (4) describe a pow- because a model’s output qualitatively looks ture the behavior of water molecules, but if
erful new way to model human crowds. In- acceptable does not mean that the model is the goal is to formulate a predictive theory of
stead of focusing on individuals, they build right. There is also reason to be skeptical of hydrodynamics, they are not necessary.
this approach because it requires a priori as- Bain and Bartolo have essentially followed
Department of Civil and Environmental Engineering, Stanford sumptions about animal behavior that are at this approach for human crowds. They be-
University, Stanford, CA 94305, USA. Email: nto@stanford.edu least oversimplified if not incorrect. In recent gin with generic equations of motion for the
C
dangerous situations such as crowd panic. onservation areas around the world finer levels of forest change, but they still re-
The approach of Bain and Bartolo opens aim to help conserve animal biodiver- main a proxy for animal biodiversity rather
many avenues for future work for collective sity, but it is often difficult to measure than a direct measure of it (4).
behavior researchers more generally. For ex- conservation success without detailed Repeated on-the-ground surveys can
ample, it should inspire studies that pinpoint on-the-ground surveys. High-resolu- provide the required information to assess
a group response to perturbations—such as tion satellite imagery can be used to animal biodiversity. However, such sur-
the traveling waves launched by the start- verify whether or not deforestation has oc- veys are expensive, cover limited ground,
ing events of a marathon race—to constrain curred in areas dedicated for conservation and may be affected by the biases of indi-
continuum models. Some studies along these (1). Such remote sensing analyses can reveal vidual experts. One possible alternative is
lines have already been done, such as char- forest loss and, in some cases, severe forest the use of bioacoustics, which can detect
acterizing the response of starling flocks to degradation, such as through fragmenta- animals by their vocalizations. Depending
predators (10), of ants to mechanical stresses tion and intensive selective logging, espe- on vegetation structure and the vocaliz-
(11), and of midge swarms to sensory cues (12). cially if it includes the construction of roads ing species, acoustic recorders can detect
More work is necessary to incorporate these or camps. However, conservation benefit is animal calls and song from several hun-
findings into dynamical continuum models determined not only by forest loss but also dred meters away (5). Autonomous sound-
that avoid the need for a priori assumptions by the level of degradation in those forests recording devices are now available from
about animal behavior. Ultimately, such mod- left standing. Bioacoustics—specifically the several companies as small units that are
els may even be an effective way to determine recording and analysis of entire sound- inconspicuous to humans. They can be
the local interactions themselves because any scapes—is an emerging tool with great programmed to record either continuously,
agent-based model must approach the con- promise for effectively monitoring animal if there is sufficient solar power or cellular
tinuum model as a limiting case. j biodiversity in tropical forests under vari- network signal for direct transmission of
ous conservation schemes (2, 3). data to cloud storage, or at given intervals,
REFERENCES
Even forests that appear intact in satellite if battery power and data storage are lim-
1. J. K. Parrish, L. Edelstein-Keshet, Science 284, 99 (1999).
2. M. Rubenstein, A. Cornejo, R. Nagpal, Science 345, 795 imagery can have low biodiversity conserva- iting factors (6). Several multiyear record-
(2014). tion value because of effects such as canopy ings have now been completed (7).
3. D. Helbing, I. Farkas, T. Vicsek, Nature 407, 487 (2000).
4. N. Bain, D. Bartolo, Science 363, 46 (2019). simplification, understory fires, invasion by Selected times of the day can convey a
5. C. W. Reynolds, Comput. Graph. 21, 25 (1987). exotic species, or overhunting. These forms disproportionately large amount of infor-
6. Y. Katz, K. Tunstrøm, C. C. Ioannou, C. Huepe, I. D. Couzin, of degradation are difficult to monitor re- mation about the resident biodiversity; for
PHOTO: RHETT A. BUTLER/MONGABAY.COM
Published by AAAS
Hornbills, such as this rhinoceros hornbill in protected forests should be determined scape composition due to climate change
Bukit Tigapuluh National Park, Sumatra, not just by how much forest loss has been might be beyond the direct control of the
Indonesia, have prominent vocalizations that avoided, but also by the level of biological companies, but abrupt and quick change in
can be identified in soundscapes. integrity of those forests left standing. Bio- soundscapes is more likely to be attributable
acoustics has the potential to provide this to management. In these cases, other mea-
feasible to repeat measurements over time. information (see the figure). sures (such as prevention of hunting, refor-
Also, the results are not influenced by in- Advances in bioacoustics, as well as the esting edges or the degraded areas of the
dividual researchers’ biases or simply by robustness and affordability of sound- conserved zone with native species, or curb-
the presence of observers in the field. The recording devices, make it possible for ing fires) would be called for by auditors,
method offers the possibility to monitor companies or independent consultants to who are typically involved in independent
multiple taxonomic groups at the same time deploy sound recorders in areas of forest verification of a company’s commitments.
(all vocalizing birds, mammals, insects, and maintained by a company under legal re- Because of the enormous size of the
amphibians), as opposed to, for example, quirements, certification, or a zero-defores- acoustic datasets and the computational
camera traps. Finally, the data can be reana- tation commitment. If the soundscape of a power required to analyze them, there is
lyzed in the future with improved algorithms forest spared from conversion were becom- a need for a global organization to host a
or to search for specific acoustic features. ing more impoverished and altered beyond global acoustic platform, which would al-
Analysis of human-made sounds can help to the natural variation of the soundscape low direct, on-the-fly analysis. The develop-
clarify how sounds from machinery (such as baseline, on-the-ground survey would be ment of such a data hosting and analysis
tractors, bulldozers, and chainsaws) affect warranted. Slow, gradual changes in sound- platform should be a priority, together with
habitat quality and to track illegal human the collection of regional soundscape base-
studies linking on-the-ground biodiversity ing from brands that can show the results
surveys to soundscape indices are needed of their conservation efforts, on top of their
from a wide variety of forest types and hu- certification logo or zero-deforestation
man disturbances to determine whether commitment. The scientific community
such indices can be generalized. In areas will benefit from a huge tranche of data on
Soundscape of a forest that
where hunting is important, the recordings ecological communities across the tropics.
belongs to a nearby plantation
could also be used to determine the presence committed to zero deforestation It is therefore in the interest of certification
or absence of the hunted species (typically bodies to harness the developments in bio-
large mammals and birds) using individual acoustics for better enforcement and effec-
species recognition algorithms. tiveness measurements of their schemes. j
Bioacoustics has particular potential in
REFERENCES
the context of industry sustainability cer-
1. H. K. Gibbs et al., Conserv. Lett. 9, 32 (2016).
tification and zero-deforestation commit- 2. J. Sueur, A. Farina, Biosemiotics 8, 493 (2015).
ments, both of which have become popular, 1 Comparison 3. B. Krause, A. Farina, Biol. Conserv. 195, 245 (2016).
widely publicized conservation strategies (1, over time 4. M. M. C. Bustamante et al., Glob. Change Biol. 22, 92
(2016).
15). Companies involved in such industries 5. K. Darras, P. Pütz, Fahrurrozi, K. Rembold, T. Tscharntke,
as palm oil, beef, soy, and pulp and paper Biol. Conserv. 201, 29 (2016).
production commit to not cause any defor- 6. A. Rodriguez et al., Ecol. Inform. 21, 133 (2014).
7. S. H. Gage, A. C. Axel, Ecol. Inform. 21, 100 (2014).
estation through their industrial develop- 8. Z. Burivalova et al., Conserv. Biol. 32, 205 (2018).
ment. Typically, this means that any new 2 Comparison 9. C. Astaras, J. M. Linder, P. Wrege, R. D. Orume, D. W.
plantation, ranch, or farm can only be devel- Macdonald, Front. Ecol. Environ. 15, 233 (2017).
to a regional
10. J. L. Deichmann et al., Biotropica 50, 713 (2018).
oped in an area that is already deforested or baseline 11. R. T. Buxton et al., Conserv. Biol. 32, 1174 (2018).
heavily degraded. In some countries, such 12. L. M. Ferreira et al., J. Ecoacoust. 2, PVH6YZ (2018).
as Brazil, companies are legally obliged to 13. A. P. Hill et al., Methods Ecol. Evol. 9, 1199 (2018).
14. D. Stowell, Y. Stylianou, M. Wood, H. Pamuła, H. Glotin,
protect parts of their concessions from de-
Methods Ecol. Evol. 10.1111/2041-210X.13103 (2018).
forestation. However, precise definitions of 15. S. Brown, D. Zarin, Science 342, 805 (2013).
zero deforestation are often missing (15).
The conservation benefit of such industry- 10.1126/science.aav1902
L
assa fever is a viral hemorrhagic fever also provide invaluable information about tomatic cases and the nonspecific symptoms
prevalent in West Africa that has been structural variations and epigenetic modifi- mimicking myriads of infectious diseases in
gaining international attention as an cations between individual organisms. How- the region in patients who actually become
emerging infectious disease with the ever, with longer reads comes greater error sick, establishing the true burden of Lassa
potential to cause epidemics (1). Con- rates, which appear to improve with repeated fever in Nigeria and other West African coun-
firmed and suspected cases of Lassa reads of the same genetic material, as long as tries has been near impossible (8). The dis-
fever have been steadily rising in Nigeria it is of high-enough quality and quantity (5). ease is mainly spread through contact with
over the past 3 years. Laboratory-confirmed With its compact size, portability, and quick the urine and feces of multimammate rats in
cases have increased from 106 in 2016 to 143 turnaround time, the device can be rapidly the household setting, a human-vector inter-
in 2017 and had already reached 562 by No- deployed in outbreak areas where laboratory face that happens mostly in poor communi-
Published by AAAS
NEUROSCIENCE
By Nataniel J. Mandelberg and tioning in mice can be deactivated through dant at postsynaptic regions, is endocytosed
Richard Tsien optogenetically induced LTD and reactivated when neurons are stimulated, binds directly
with LTP (6). LTP occurs when the activity of to GluA2 receptors, and controls their inter-
F
rom correct answers on a school exam the presynaptic neuron causes a large influx nalization. Awasthi et al. show that SYT3 has
to a loved one’s birthday, we have all of Ca2+ into the postsynaptic neuron. It mani- a functional impact on synaptic plasticity. In-
forgotten things we wish we had not. fests as an increased number of a-amino- duction of LTP was unaffected by Syt3 gene
The ability to forget, however, is a 3-hydroxy-5-methyl-4-isoxazolepropionic deletion in mice, whereas the decay of LTP
feature rather than a flaw of how our acid (AMPA) type 2 subunit–containing glu- and the induction of LTD, both reliant on
brains work. As the celebrated author tamate (GluA2) receptors at the spine, mak- GluA2 receptor endocytosis, were abolished.
Jorge Luis Borges wrote about a man inca- ing the postsynaptic neuron more responsive Notably, SYT3 binds Ca2+ at 5- to 20-fold
pable of forgetting, Funes the Memorious (1), to input from the presynaptic cell. By con- lower concentrations (8) than does SYT1,
“I suspect, however, that he was not very ca- trast, LTD is driven by smaller Ca2+ events which participates in postsynaptic recruit-
depression (LTD). Controlling LTP and LTD trol the exocytosis of presynaptic vesicles (full hidden platform in a pool of water, but the
in rodents drastically affects memories they of neurotransmitters) from the bouton, and location of the platform was changed every
have formed: Previously learned fear condi- postsynaptic SYT1 and SYT7 are required for day. Mice in which Syt3 was deleted persisted
glutamate receptor exocytosis in LTP (7). Aw- with former platform locations rather than
asthi et al. show that SYT3 has key qualifi- seeking new ones, as if unable to distinguish
Langone Medical Center, New York University,
New York, NY, USA. Email: richard.tsien@nyumc.org; cations to be the arbiter of LTD through its between a past memory and a new, immedi-
nataniel.mandelberg@nyumc.org regulation of GluA2 receptors: SYT3 is abun- ately relevant experience.
T
as vesicles of neurotransmitters can be real- he enzyme ribulose 1,5-bisphosphate Photorespiration is an essential metabolic
located among presynaptic boutons along an carboxylase-oxygenase (RuBisCO) is repair pathway in all organisms that perform
axon (12). This study begins to show how neu- one of the most abundant proteins oxygenic photosynthesis, from cyanobacte-
rons might use similar tools pre- and post- on Earth. During photosynthesis, it ria, through algae, to land plants (2, 4). Core
synaptically to channel resources to the most assimilates atmospheric CO2 into bio- photorespiratory metabolism comprises nine
important synapses while culling synapses mass and hence is a major driver of the enzymatic steps that are distributed over
that no longer encode relevant information. global carbon cycle. However, the enzyme is chloroplast, peroxisome, and mitochondrion
The work of Awasthi et al. has a close yet catalytically imperfect. It accepts not only CO2 within a plant cell. It converts detrimental
unexplored relationship to pathological pro- as a substrate, but also O2, which leads to the 2-PGlycolate into the Calvin-Benson cycle
Published by AAAS
South et al. revisited two previously estab- were introduced into the model crop tobacco, ATOMIC PHYSICS
lished synthetic bypasses of photorespiration which was investigated not only in growth
(6, 7) and tested a newly designed pathway
in genetically modified tobacco plants. These
pathways aim to completely metabolize the
chambers and greenhouses, but also in field
trials. Thus, the yield gains manifested in an
agriculturally relevant scenario and not only
Really cool
photorespiratory metabolite glycolate, which
is generated from 2-PGlycolate by phospho-
in controlled environments.
Importantly, the synthetic pathways open neutral
glycolate phosphatase within the chloroplast.
They release CO2 close to RuBisCO (not in mi-
tochondria, as in natural photorespiration)
new avenues for reevaluating long-standing
hypotheses regarding the importance of
photorespiration beyond detoxification of
plasmas
to increase the ratio of CO2 to O2 fixation.
Alternative pathway (AP) 1 originates from
2-PGlycolate. Photorespiration is considered
indispensable for photosynthesis in an O2-
Properties of laser-cooled
the bacterium Escherichia coli and uses five containing atmosphere, and mutants defec- neutral plasmas can be
enzymes that oxidize glycolate via glyoxylate
and tartronic semialdehyde to glycerate (6).
tive in photorespiration can only survive in a
high-CO2 atmosphere (10). Genetic suppres-
used to model high–energy-
The second bypass, AP2, uses three enzymes sor screens on such mutants have been un- density plasmas
that convert glycolate via glyoxylate and ma- successful to date. The study of South et al.
late to acetyl–coenzyme A (CoA). AP2 also demonstrates that a photorespiratory pheno-
requires the expression of catalase for de- type (repression of PLGG1) can be suppressed By Scott Bergeson
toxification of hydrogen peroxide that results by metabolic engineering. The true reason or
The foundation of this treatment rests (5). In fusion-class plasmas, for example, shown how to laser-cool ions in a neu-
on a hierarchy of length scales. The Debye the non-ideal limit is approached in the tral plasma, which overcomes a critical
length lD is the distance over which elec- early stages of the plasma evolution dur- roadblock in the field of strongly coupled
trons rearrange their positions so that there ing compression and early heating of the plasma physics. Although photoionized
is zero electric field inside the plasma. This system, and G ~ 1. The traditional concept laser-cooled gases are initiated with essen-
length must be shorter than the extent of the of a collision becomes problematic because tially zero kinetic energy, the ions instantly
plasma but longer than the average distance lD ≈ aWS ≈ r0. experience strong accelerating forces
between ions in the plasma, the so-called The plasmas created by Langin et al. are from neighboring ions and heat up. This
Wigner-Seitz radius aWS. These constraints similar to high–energy-density plasmas be- “disorder-induced heating” limits G to val-
ensure that there are many particles in a lD- cause they have comparable values of G (6). ues near 2 (11), but laser-cooling the plasma
sized sphere so that Boltzmann’s statistical Thermodynamic properties of plasmas can ions makes it possible to manipulate the
assumptions about collisions will hold. The be expressed in terms of G, so all plasmas value of G. Thus, collision physics in this
Debye length must also be orders of magni- with a given value of G are thermodynami- system can serve as a check on benchmark
tude longer than the classic distance of clos- cally similar. Thus, these ultracold neutral calculations. It also means these low-
est approach r0, which can be thought of as plasmas can help probe the frontier of fu- temperature plasmas can be used as simu-
the minimum distance between two ions in sion science (see the figure). Measurements lators for high–energy-density plasmas.
a head-on collision. of collision properties (momentum trans- In what seems like a paradox, the ultra-
Treatments like the Boltzmann equa- fer, thermal relaxation, diffusion, collision cold neutral plasmas of Langin et al. can
tion are valid when lD >> aWS >> r0. This cross sections, Coulomb logarithms, and help us understand collision parameters in
high–energy-density plasma science. Un-
tion of kinetic plasma theories is that G << strong laboratory fields associated with ion 10. T. C. Killian et al., Phys. Rev. Lett. 83, 4776 (1999).
11. Y. C. Chen et al., Phys. Rev. Lett. 93, 265003 (2004).
1, that is, conditions of low density and high trapping are absent.
12. P. W. Terry, Rev. Mod. Phys. 72, 109 (2000).
temperature. The presence of those fields typically 13. D. V. Dylov, J. W. Fleischer, Phys. Rev. Lett. 100, 103903
When the foregoing hierarchy of length dominates the ion motion for trapped (2008).
or energy scales is not met, the plasma is ions and obscures the underlying inter- 14. D. Murphy et al., Nat. Commun. 5, 4489 (2014).
said to be “non-ideal” or “strongly coupled” esting plasma physics. Langin et al. have 10.1126/science.aau7988
Published by AAAS
Commitments have been made to improve
tracking of products from tuna (such as
Atlantic bluefin tuna) from vessel to final buyer.
V
oluntary commitments by states, gov- state and nonstate actors to submit com- smaller in the number of commitments than
ernmental or nongovernmental orga- mitments to advance implementation of the UN process, the Our Ocean conferences
nizations, and other actors, aiming to Sustainable Development Goal (SDG) 14 succeed particularly in mobilizing financial
deliver outcome-oriented activities, and associated targets (4). Part of a compre- resources or pledges for creation of new ma-
have become a well-recognized mech- hensive framework of 17 interlinked goals rine protected areas.
anism in international sustainability under the UN’s 2030 Agenda for Sustain-
policy (1–3). For ocean governance, the call- able Development (5), SDG 14 calls on states A TRANSFORMATIVE TOOL?
ing for and pledging of voluntary commit- and the global community to “conserve and Though not replacing state measures to im-
ments could become a game changer, with sustainably use the oceans, seas and marine plement legally binding agreements, we be-
two major international processes harness- resources for sustainable development.” It is lieve that voluntary commitments hold great
ing such voluntary contributions in recent underpinned by 10 specific targets address- additional potential for driving transforma-
years: the Our Ocean conferences, an annual ing marine pollution, conservation, ocean tive change for the ocean. They mobilize ac-
high-level series initiated by U.S. Secretary acidification, fisheries, benefits for Small Is- tions and means for improving ocean health,
of State John Kerry in 2014, and the United land Developing States, small-scale fisheries, support the creation of new partnerships
Nations (UN) Ocean Conference, which took scientific knowledge and marine research, across different sectors and actor groups, and
place for the first time in June 2017. Such and international law. facilitate learning processes and exchange
calls and commitments provide opportuni- More than 1300 voluntary commitments of innovative practice. By lowering barriers
ties to raise awareness, promote engage- for ocean action, such as measures for com- to address complex cross-cutting problems,
ment, and catalyze political will for action bating marine pollution or strengthening the nonbinding nature of voluntary commit-
on the part of states as well as public and capacity for marine research, were made at ments also helps to overcome established but
private sectors. However, without effective the UN Ocean Conference by governments, problematic sectorial approaches in ocean
and transparent review systems, it is diffi- the UN system, civil society organizations, governance. Voluntary commitments also
PHOTO: RICHARD HERRMANN/MINDEN PICTURES
cult to link pledged commitments to actual academia, the scientific community, and the create normative pressure (1, 12) and increase
implementation. Quality control and ensur- private sector (6). Despite the open call for expectations to play an active role in improv-
ing that commitments are effective and im- contributions, the majority of commitments ing ocean health.
pactful will be difficult to achieve. A uniform registered were still made by governmental However, central oversight is needed to
global process is required to register and as- actors and civil-society organizations (7). ensure that promises are kept. Without a
sess commitments, including consistent re- But they also include innovative initiatives transparent and rigorous pledge and review
porting and monitoring systems with clear from the private sector and philanthropic system for all ocean-related commitments,
targets, baselines, and review systems. organizations such as the Tuna 2020 Trace- there is a risk of double-announcing in vari-
ability Declaration or the Seafood Business ous forums or creating a flurry of low-impact
Institute for Advanced Sustainability Studies (IASS), 14467 for Ocean Stewardship (SeaBOS) platform, or short-term activities that do not deliver
Potsdam, Germany. Email: sebastian.unger@iass-potsdam.de which seek change both through collective progress on targets. Other critical challenges
associated with voluntary commitment pro- other ocean-related SDGs and targets. ments should be reported to and assessed
cesses are accountability, enforcement, effec- To identify trends and to measure distance by the UN’s High-level Political Forum on
tiveness, and progress accounting (2, 13). and progress to targets, this global registry Sustainable Development and reflected in
The pledging processes under the UN should be linked to baseline data in exist- the Global Sustainable Development Report.
Ocean Conference and the Our Ocean series ing databases and assessment processes on The registry should also seek synergies with
seek to address these challenges to a certain the state of the marine environment. For reporting systems for other goal-based policy
extent through their individual registrations example, the World Database on Protected frameworks such as the UN Paris Agreement
procedures that request the formulation of Areas, which is run by the UN Environment on climate change.
commitments along defined criteria. Our World Conservation Monitoring Centre Both the UN Ocean Conference process
Ocean 2018, for the first time, published a (UNEP-WCMC) and the International Union and the Our Ocean series will continue to col-
report seeking to describe progress on com- for Conservation of Nature (IUCN), the UN’s lect voluntary commitments toward the next
mitments made under previous Our Ocean World Ocean Assessment, or the UN Food UN Ocean Conference planned for 2020 and
conferences (14), and the UN’s registry of and Agriculture Organization’s world fishery the upcoming Our Ocean conferences in Nor-
voluntary commitments invites pledging en- and aquaculture statistics could provide the way (2019) and Palau (2020). And there have
tities to provide updates on progress through necessary information. been first discussions of possible coordina-
their website (8). But the two registry systems In addition, independent scientific data tion of the two commitment systems, a prom-
are neither harmonized in terms of the data and assessments such as the Ocean Health ising prospect for developing an orchestrated
gathered nor in the standards for acceptance Index (15) or the MPAtlas of the Marine Con- post-2020 strategy for ocean sustainability
and registration of commitments. This lack servation Institute could be taken into ac- with a uniform global pledge and review sys-
of robust and consistent tracking and report- count. The UN Decade of Ocean Science for tem for voluntary ocean commitments. j
Published by AAAS
NATO’s efforts stopped short of confronting the
environmental degradation caused by warfare.
A military alliance goes green Skeptics will note, however, that American
officials repeatedly determined when, and
how, NATO would pursue environmental re-
Seeking solutions to Cold War divisions, in the mid-20th search and policy.
The protagonists of Greening the Alliance
century NATO embraced environmentalism are scientists in the upper echelons of Cold
War military and diplomatic institutions.
By Dagomar Degroot search with obvious strategic applications, This focus makes for a richly detailed story of
it actually exacerbated divisions among political maneuvering and high-minded ide-
W
ar and preparation for war have the allies. als, yet it also deprives Turchetti’s narrative
long led militaries to exploit, In 1966, Turchetti argues, growing dissat- of context that might have given it greater
transform, and degrade environ- isfaction with NATO’s science program came significance. Politicians and military officers
ments. How ironic, then, that at to a head. The rise of environmentalism, the are rarely mentioned by name, and ordinary
the height of the Cold War, the sinking of the tanker SS Torrey Canyon, and people who may have shaped the course of
North Atlantic Treaty Organiza- the political opportunism of Richard Nixon scientific research, such as North Sea fisher-
tion (NATO)—the most powerful military all led to an American push for a new kind of men resistant to early oceanographic surveys,
alliance ever assembled—emerged as a lead- environmental research at NATO. Enter the rarely receive much attention.
ing proponent of environmental- “Committee on the Challenges of Key scientific controversies discussed in
ism. Simone Turchetti’s Greening Modern Society” (CCMS), estab- Greening the Alliance—the possibility of nu-
the Alliance is the first book to lished in 1969 to fund research clear winter, for example—frequently appear
explain the surprising rise, re- into toxicology, devastated ecosys- with little explanation, and Turchetti opts not
peated revision, and possible tems, and environmental moni- to compare NATO’s environmental programs
decline of NATO’s environmental toring. Research pioneered by with similar and simultaneous efforts in
research program. the committee steadily advanced other western institutions. (Neil Maher has
Turchetti organizes his book a brand of environmentalism recently revealed that NASA similarly strug-
chronologically. After insightful that prized scientific rationalism gled to implement an “environmental turn”
passages on sources and meth- Greening the Alliance rather than the radical counter- in the 1970s, for example.) Moreover, because
Simone Turchetti
ods, he traces the diplomatic University of Chicago culture of the grassroots environ- Turchetti rarely explains the scope and sig-
tensions and maneuverings that, Press, 2018. 263 pp. mentalist movement. nificance of NATO’s environmental science
in 1958, led representatives of Yet, Turchetti explains that Eu- program within the broader development
the United States and Britain to cooperate ropean allies repeatedly stalled CCMS initia- of 20th-century science, it is difficult for the
in securing support for a new NATO Sci- tives, which in any case never confronted reader to know just how important the activi-
ence Committee. Supporting environmen- the environmental impact of military activi- ties of the CCMS really were.
tal research, they hoped, would promote ties. When the CCMS exposed new divisions Written in workmanlike prose, Green-
parallel diplomacy to repair deepening di- within NATO, American support withered, ing the Alliance is therefore a book that will
PHOTO: WIKIMEDIA COMMONS
visions among the alliance’s 12 signatories. and the alliance’s commitment to environ- primarily appeal to a relatively small group
Yet because the committee sponsored re- mentalism seemed to fade. By that time, of historians and political scientists. Yet for
however, emerging weapons systems in the those specialists, it succeeds in telling a new
United States and the Soviet Union increas- and critically important story. j
The reviewer is at the Department of History,
Georgetown University, Washington, DC 20057, USA. ingly demanded constant environmental
Email: dd865@georgetown.edu surveillance. This new reality encouraged 10.1126/science.aav1863
ECONOMICS
By Jon Peha will now have to compete with accountants The Globotics Upheaval
around the world. An accountant whose Globalization, Robotics,
and the Future of Work
I
n the conference room of a popular San primary advantage is the ability to detect
Francisco–based magazine, journal- complex patterns in financial data will have Richard Baldwin
Oxford University Press,
ists and editors walk through the door, to compete with machine-learning software 2019. 300 pp.
gathering for a staff meeting. One col- that never sleeps or asks for a raise.
league, however, rolls in on two large For people hoping to choose a profession
motorized wheels. that won’t soon be replaced, Baldwin recom-
“EmBot” is a human-sized robot that mends those that require physical proximity fast for society to absorb. Baldwin portrays
shows live video of Emily Dreyfus, a staff and that take advantage of distinctly human the progress of telepresence and AI as sud-
writer who lives 3000 miles away. But qualities, such as creativity, social awareness, denly becoming rapid, but these technolo-
EmBot is more than a face on a screen. It ethics, and empathy. AI robots cannot (yet) gies have been progressing for decades.
than half of current jobs in a developed econ- this was not a period of high unemploy- jobs as they become outdated, and that we
omy. The effects will be uneven. ment—Trump was elected after 7 years of must do more to help those who’ve been
Some skilled workers will prosper as they solid economic growth that drove the U.S. displaced by technology reenter the work-
gain the ability to compete for jobs across unemployment rate from 10 to 4.6%—it is force and offer such individuals a strong
the globe; others will become obsolete. An possible that globotics could have contrib- safety net along the way.
accountant whose primary competitive ad- uted to low growth in wages. I would add education reform to the
vantage is that she lives within easy driving Although the book offers valuable in- prescription: Moving forward, schools and
distance of a commercial hub, for example, sights into the long-term impact that glo- universities should teach students to work
balization and AI will have on workers, with emerging technology rather than
The reviewer is at the Department of Engineering and Public the case that globotics will bring upheaval compete against it. j
Policy and the Department of Electrical and Computer
Engineering, Carnegie Mellon University, Pittsburgh, PA 15213, is less convincing. Upheaval occurs when
USA. Email: peha@cmu.edu technology advances at a pace that is too 10.1126/science.aav6273
Published by AAAS
RESEARCH
Fluorinated aryl groups couple
to form nanographenes
Kolmer et al., p. 57
ATOMIC PHYSICS
PROTEIN TRANSLOCATION
Making a strongly
Posttranslational
CREDITS: (TOP TO BOTTOM) KOLMER ET AL.; DYLAN BUELL /STRINGER/GETTY IMAGES
Runners moving down Columbus Drive at the Chicago Marathon, October 2017 coupled plasma
translocon architecture Plasmas—gases of ionized
About a third of proteins are atoms and electrons—are
CROWD DYNAMICS
transported into endoplasmic naturally formed at high temper-
A crowd that flows like water reticulum by the universally
conserved Sec61 protein-
atures, such as those reached in
the interiors of stars. Describing
T
he behavior of large numbers of insects, animals, and
conducting channel. Itskanov plasmas theoretically is tricky
other flocks is often based on rules about individual inter-
and Park determined a cryo– when they are in the strongly
actions. Bain and Bartolo applied a fluid-like model to the
electron microscopy structure coupled regime; reaching that
behavior of marathon runners as they walked up to the
of the Sec complex from yeast, regime in the laboratory would
start line of the Chicago Marathon (see the Perspective by
which mediates posttranslational provide a valuable benchmark
Ouellette). They observed nondamping linear waves with the
translocation of many secretory for theory. To that end, Langin
same speed for different starting corrals of runners and at dif-
proteins across the endoplasmic et al. worked with a cold plasma
ferent races around the world. Their model should apply both
reticulum membrane. The study created out of atoms of stron-
to this type of polarized crowd as well as to other groups, which
reveals how Sec63 activates tium that were ionized by laser
may help guide crowd management. —BG
the Sec61 channel for substrate light (see the Perspective by
Science, this issue p. 46; see also p. 27 polypeptide insertion. The Bergeson). They used lasers to
structure also explains the cool the ions down to about 50
PHOTOS: (LEFT TO RIGHT) SHAWSHOTS/ALAMY STOCK PHOTO; NATIONAL GEOGRAPHIC IMAGE COLLECTION/ALAMY STOCK PHOTO
More than 25% of the approxi- late-onset genetic disorders, signaled to roots to increase Zn
mately 6 million Jews murdered poison scavenger such as Alzheimer’s disease supplies. In response, the roots
during the Holocaust were killed Nerve agents are neurotoxic (AD). Specifically, the ApoE «4 up-regulated expression of the
in one 100-day period in 1942. compounds found in pesticides allele is associated with a higher genes encoding metal transport/
Stone used an unusual dataset and chemical weapons. They risk of developing AD. However, tolerance protein 2 (MTP2) and
of railway transportation records act by blocking the transmis- individuals of African ancestry heavy metal ATPase 2 (HMA2).
to show that during this period, sion of nerve impulses to the that carry this variant appear Local Zn deficiency in roots left
the Nazis murdered more than muscles, and exposure can be to be less prone to developing these same genes unaffected. It
1.47 million Jews, a kill rate that fatal within minutes. Zhang et al. AD. Rajabli et al. examined AD seems that Zn taken up in lateral
is 10 times higher than previous developed a nanoparticle-based cases and controls in admixed roots is transported into the
estimates. Contradicting contem- bioscavenger that breaks down individuals of Puerto Rican endoplasmic reticulum by MTP2,
porary analyses of the Holocaust, organophosphate nerve agents and African-American descent thus gaining access to the inter-
the author shows that Operation into innocuous compounds. and found that individuals who cellular symplastic network. The
Reinhard was exceptionally Prophylactic treatment of rats carried an African ApoE «4 Zn then progresses from outer
violent in its extreme kill rate, and guinea pigs confirmed background had less risk of epidermal cells toward the core
low immunogenicity developing the disease. It seems of the root, where it is exported
and good biodistribu- the African variant of ApoE «4 by HMA2 into the xylem for trans-
tion. Treated animals contains protective genetic port to the shoot. The shoot asks
were protected from variants. —LMZ for what it needs, and the root
repeated exposure PLOS Genet. 14, e1007791 (2018). delivers. —PJH
to the nerve agent Plant Cell 30, 2463 (2018).
sarin over 7 days. This
PLANT SCIENCE
nanoscavenger might
SKIN
thus help prevent nerve- Essential metal for plants
agent poisoning in Although zinc (Zn) is an essen- Roots of acne
Transport records have been analyzed to at-risk subjects. —MM tial micronutrient for plants and Most people experience a bout
estimate the number of Jews murdered by the Sci. Transl. Med. 11, humans, much of the world’s of acne at some stage in their
Nazis in 1942. eaau7091 (2019). agricultural land is deficient in Zn. life. For an unlucky few, the skin
Published by AAAS
more than 48 days. The pres-
EVOLUTION ence of the smaller nanoparticles
in muscle tissue suggests that
Sing on high, dance the particles can cross epithelial
membranes. —JFU
on the floor Environ. Sci. Technol. 52, 14480 (2018).
T
he frugivorous, polygamous, and
wildly glamorous birds of para-
RELATIONSHIP SCIENCE
dise are a puzzle to evolutionary
biologists. What is sexual selection Ending a relationship
acting on to result in such extremely When deciding to end a relation-
visual, behavioral, and aural diversity ship, people may consider the
among these related species? Ligon et feelings of their partners as well as
al. analyzed 961 video clips, 176 audio their own. Joel et al. investigated
clips, and 393 museum specimens. They whether decisions to break up
concluded that females are selecting on are driven in part by perceptions
the combined sensory assault from song, of a partner’s dependence on the
display, and plumage color, resulting in relationship. They found that par-
a “courtship phenotype.” Although all ticipants were less likely to initiate
elements are required for successful a breakup with their partners when
courtship, there is room for variation they felt that their partners were
depending on environmental constraints. more dependent on the relation-
Song predominates in the canopy, where ship for psychological well-being,
it is unimpeded by twigs and branches, even when participants were
unsatisfied in the relationship. Even
whereas flashy behavioral display is most
participants who were actively
effective on the gloomy forest floor. —CA
considering breaking up with their
PLOS Biol. 16, e2006962 (2018).
partners were less likely to do so if
they felt their partners depended
on the relationship. These results
condition feels relentless and at predicted environmental whereas smaller nanoparticles suggest that people exhibit costly,
can evade treatment. Petridis concentrations. The authors use are dispersed through the entire prosocial preferences in relation-
et al. performed a DNA study of radiocarbon labeling to track the scallop body. After exposure to ships even when they may wish to
individuals with acne vulgaris nanoplastics within the scallop nanoplastics ceased, smaller leave them. —TSR
and found that those affected tissues. Uptake differs depending nanoparticles were no longer J. Pers. Soc. Psychol. 115, 805 (2018).
share similar, but surprising, on particle size: Larger nanopar- detected after 14 days, but some
genetic mutations. Homing in ticles accumulate in the intestine, larger nanoparticles persisted for
on 15 regions of the genome, OPPORTUNITY DENIED
they identified a series of culprit
genes that controlled hair
The inequality
growth and follicle formation. of innovation
This discovery lends weight to A lack of social capital can
the idea that hair follicle shape undermine a child’s likelihood of
creates a milieu susceptible becoming an inventor, regard-
to bacterial colonization and less of her inventive ability.
inflammation. —PNK Using U.S. patent records for
Nat. Commun. 9, 5075 (2018). 1.2 million inventors, combined
with tax records and other data,
Bell et al. show how children
PLASTIC POLLUTION from high-income families are
several times more likely to
Scallops seasoned become inventors than those
PHOTO: NATURE PICTURE LIBRARY/ALAMY STOCK PHOTO
Published by AAAS
that is prone to double-stranded a common monogenic etiol-
DNA breakage owing to a high ogy for the “white plague.” The
thymine-guanine content. This current frequency of the P1104A
enhanced region of breakage allele in European popula-
could lead to enhanced mutation tions is significantly decreased
rates that facilitate repeated compared with its frequency in
adaptations to new environ- ancient European DNA samples.
ments. —SNV These findings suggest that
Science, this issue p. 81 negative selection against the
TYK2 P1104A allele by endemic
tuberculosis in Europe may have
CONSERVATION contributed to a slow genetic
purge of this susceptibility allele
The distinctive sound of a during recent millennia. —IW
biodiverse forest Sci. Immunol. 3, eaau8714 (2018).
Assessing the state of
biodiversity in a forest is a time-
consuming task that typically CANCER
requires detailed on-the-ground
surveys. In a Perspective,
Altering membrane
Burivalova et al. explain that potential for cancer
recordings of soundscapes Polymorphisms in the G pro-
can provide an easier route to tein–coupled receptor GPR35
this information. By record- are associated with increased
ing soundscapes from a forest risk for certain inflammatory
over time and comparing them diseases that can progress to
to a regional baseline, scien- cancer. Schneditz et al. found
tists can determine whether a that GPR35 promoted the activ-
forest’s ecosystem is healthy ity of Na+- and K+-dependent
or not. If the soundscape of adenosine triphosphatase
a forest spared from conver- (Na+,K+-dependent ATPase),
sion becomes impoverished a transmembrane pump that
and altered, an on-the-ground sets the membrane potential in
survey would be warranted. This cells. This effect was enhanced
approach may be particularly by a disease-associated GPR35
useful for companies interested variant. Stimulation of Na+,K+-
in sustainability certification ATPase activity by GPR35
or zero-deforestation commit- increased glycolysis and pro-
ments. —JFU liferation in intestinal epithelial
Science, this issue p. 28 cells. Na+,K+-ATPase deficiency
or treatment with a pepducin
targeting GPR35 decreased
TUBERCULOSIS tumor burden in mouse models
of intestinal cancer. —WW
Faulty kinase purged by Sci. Signal. 12, eaau9048 (2019).
tuberculosis?
Rare mutations in genes involved
in interferon-g–dependent
immunity underpin human
genetic susceptibility to severe
mycobacterial diseases,
including primary tuberculosis.
Boisson-Dupuis et al. investi-
gated whether two common
missense variants of the TYK2
Janus kinase that have impaired
catalytic activity conferred an
increased risk of tuberculosis.
Individuals homozygous for
the P1104A (proline to alanine
substitution at residue 1104)
variant of TYK2 are markedly
predisposed to developing
primary tuberculosis, defining
CREDITS: IMAGE IN (A) BASED ON A CONCEPT FROM H. HODAEI ET AL., SCIENCE 346, 975 (2014); IMAGE IN (D) BASED ON CONCEPTS FROM W. CHEN ET AL., NATURE 548, 192 (2017).
growing interest in investigating such non- theoretically for several years, its controllable have allowed us to revisit
conservative systems, particularly in connec- realization has not been made possible until re- some of the well-established platforms with a
tion with the quantum mechanics notions of cently and with advances in exploiting gain and new angle of utilizing gain and loss as new
parity-time symmetry, after the realization loss in guided-wave photonic systems. As shown degrees of freedom, in stark contrast with the
that some non-Hermitian Hamiltonians ex- in a range of recent theoretical and experimental traditional approach of avoiding these elements.
hibit entirely real spectra. Lately, non-Hermitian works, this property creates opportunities for On the experimental front, progress in fabri-
systems have raised considerable attention ultrasensitive measurements and for manipu- cation technologies has allowed for harnessing
gain and loss in chip-scale photonic systems.
B Pump 1 Pump 2 C These theoretical and experimental develop-
ments have put forward new schemes for
a controlling the functionality of micro- and
µ nanophotonic devices. This is mainly based on
x the anomalous parameter dependence in the
response of non-Hermitian systems when op-
erating around exceptional point singularities.
µ Such effects can have important ramifications
A in controlling light in new nanophotonic device
designs, which are fundamentally based on en-
gineering the interplay of coupling and dis-
sipation and amplification mechanisms in
Eigenvalue
H
rich physics of exceptional points (24–27). Owing
ermiticity is a property of a wide variety Hamiltonian. Generally, nonconservative phenome- to the abundance of nonconservative processes,
of physical systems, under the assump- na are introduced as small perturbations to photonics provides the necessary ingredients to
tions of being conservative and obeying otherwise Hermitian systems. Thus, the overall realize controllable non-Hermitian Hamiltonians.
time-reversal symmetry. Hermitian oper- behavior of non-Hermitian systems has been large- Indeed, dissipation is ubiquitous in optics, be-
ators play a key role in the theory of linear ly extracted from their Hermitian counterparts. cause it arises from material absorption as well
algebraic and differential operators (1–4), and However, recent investigations have revealed that as radiation leakage to the outside environment.
they are known to exhibit real-valued eigenvalues, non-Hermitian phenomena can drastically alter In addition, gain can be implemented in a locally
a property that stems from energy conservation. the behavior of a system compared to its Hermi- controlled fashion through stimulated emission,
For a set of dynamical equations described through tian counterpart. The best example of such devi- which involves optical or electrical pumping of
a Hermitian operator, the relation between initial ation is the emergence of singularities, so-called energy through an external source, or through
and final states is governed by a unitary operation. exceptional points, at which two or more eigen- parametric processes. Therefore, photonics pro-
Hermiticity has long been considered one of the values, and their associated eigenvectors, simul- vides a fertile ground to systematically investigate
pillars of mathematical and physical models, such taneously coalesce and become degenerate (5). non-Hermitian Hamiltonians and exceptional
as in quantum mechanics and electromagnetics. The term “exceptional point” was first intro- points. Recent theoretical developments in the
The elegance of such theories lies in powerful prop- duced in studying the perturbation of linear non- area of non-Hermitian physics have opened ex-
erties, including the completeness and orthogonality Hermitian operators (6), described by a general citing opportunities to revisit fundamental con-
of the eigenbasis of the governing operators (1). class of matrices H(z) parameterized by the com- cepts in nonconservative photonic systems with
However, these models are based on idealizations, plex variable z = x + iy, where x is the real part, gain and loss, such as lasers, sensors, absorbers,
like the assumption of complete isolation of a i is the imaginary unit, and y is the imaginary and isolators. In these systems, exceptional points
system from its surrounding environment. In prin- part. The eigenvalues sn(z) and eigenvectors open pathways for totally new functionalities and
ciple, nonconservative elements arise ubiquitously jyn ðzÞi of H can be represented as analytic func- performance. The interested reader may find
in various forms; thus, a proper description of a tions except at certain singularities z = zEP (EP, detailed overviews of non-Hermitian and, in par-
realistic physical system requires a non-Hermitian exceptional point). At such exceptional points, ticular, PT-symmetric systems in the context of
two eigenvalues coalesce, and the matrix H can optics and photonics in recent review papers
1
Department of Electrical and Computer Engineering, no longer be diagonalized. The physical impor- (28–32). In the present work, we discuss instead
The University of Texas at Austin, Austin, TX 78712, USA.
2
Department of Physics, Queens College of the City University
tance of exceptional points was pointed out in more broadly the concept of exceptional points
of New York, Queens, NY 11367, USA. 3Physics Program, early works (7, 8), in which the terminology of non- in non-Hermitian systems. In the following, we
Graduate Center of the City University of New York, New York, Hermitian degeneracy was used to distinguish provide an introduction to exceptional point
NY 10016, USA. 4Photonics Initiative, Advanced Science such critical points from regular degeneracies oc- physics and explain some of the fundamental
Research Center, City University of New York, New York, NY
10031, USA. 5Department of Electrical Engineering, City College
curring in Hermitian systems (9, 10). In addition, concepts associated with such critical points.
of The City University of New York, New York, NY 10031, USA. exceptional points were referred to as branch- We then draw the connection with optics and
*Corresponding author. Email: aalu@gc.cuny.edu point singularities in investigating the quantum photonics and show the universal occurrence of
exceptional points in optical settings. Finally, we where w is the resonance frequency of the two coupling. Assuming, harmonic solutions of the
review recent theoretical and experimental ef- coupled modes, m is the coupling coefficient, and form ða1 ; a2 Þ ¼ ða1 ; a2 Þeisx , the eigenvalues of
forts in observing exceptional points in optics g is their decay rate. This particular choice of the system are
and their peculiar functionalities in practical Hamiltonian system, shown in Fig. 1A, represents
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
devices, presenting an outlook for the future of a large class of structures and devices of large
this exciting area of research. relevance in photonics, examples of which are sT ¼ wave igave T m2 þ ðwdiff þ igdiff Þ2 ð2Þ
given in Fig. 1, such as coupled cavities (Fig. 1B)
Theoretical background (33), coupled waveguides (Fig. 1C) (34), polar- where wave = (w1 + w2)/2 and gave = (g1 + g2)/2,
We begin by investigating exceptional points in a ization states in the presence of small pertur- respectively, represent the mean values of res-
generic two-level system. Assuming that a1,2 are bations in an optical waveguide (Fig. 1D) (35), onance frequencies and loss factors, whereas
the modal amplitudes of two states that evolve counter-propagating waves in Bragg gratings wdiff = (w1 − w2)/2 and gdiff = (g1 + g2)/2 are the
with the variable x, representing the evolution (Fig. 1E) (36), wave mixing in nonlinear crystals differences between their resonance frequencies
time or propagation distance, the coupled mode (Fig. 1F) (37), coupled optical and mechanical and loss factors.
equations can be generally written as modes in an optomechanical cavity (Fig. 1G) (38), The Hamiltonian in Eq. 1 is a function of mul-
! ! and a two-level atom in a cavity (Fig. 1H) (39). tiple parameters. In Fig. 2, A and B, we evaluate
d a1 w1 ig1 m a1 In the case of coupled optical resonators, for the evolution of real and imaginary parts of the
ð Þ ¼ i instance, w1,2 in Eq. 1 represent the individual eigenvalues in the parameter space (wdiff, gdiff),
dx a2 m w2 ig2 a2
frequencies of each element, g1,2 describe their assuming a constant coupling coefficient m. An
ð1Þ loss or gain rate, and m represents the mutual exceptional point occurs when the square-root
term in Eq. 2 is zero, as the two eigenvalues co-
alesce. Assuming a real coupling constant, this
Fig. 4. Experimental demonstration of exceptional points in various band merging effect at the exceptional point was experimentally demon-
(88). The impact of non-Hermiticity on non- which goes from being real to complex valued. standard perturbation theory, however, does not
linear waves in bulk and periodic systems has Other well-known examples of exceptional points apply at such points. The perturbation problem
been also explored, after the realization that PT- in the wave number space are the cut-off fre- can be introduced as H ¼ H0 þ eH1 where we
symmetric potentials support optical solitons (89). quency of a closed waveguide or the edge of a want to find the behavior of the eigenvalues sn(e)
Indeed, although dissipative nonlinear systems photonic bandgap in periodic structures. In and eigenvectors jyn ðeÞi of H for e≪ 1, where e is
have been largely investigated (90), recent de- addition, a volume Bragg grating, in which alter- the perturbation parameter. In general, such a
velopments in the area of PT symmetry have nating layers of two different materials with perturbation problem can be divided into regular
sparked interest in the exploration of new in- refractive indices n1 and n2 create a photonic and singular problems (96). In the regular case, a
tegrated nonlinear systems combining gain and bandgap for a range of incoming frequencies, power-series solution with integral powers of e
loss (29, 91, 92). In addition, solitary waves in supports an exceptional point. In this structure, X
∞
exists, that is, sðeÞ ¼ s0 þ cn en, where cn are
PT-symmetric potentials have been experimen- the wave number of the counter-propagating n¼1
tally demonstrated in time-domain lattices (93). waves follows a square-root dispersion in terms the series coefficients, with a finite radius of
Nonlinear wave-mixing processes, such as sum of the incoming wave frequency. Whereas in the convergence. However, in the case of an excep-
and difference frequency generation and optical propagation band the wavenumber is real, inside tional point singularity, such a solution does not
parametric amplification, are other examples of the bandgap it becomes complex, and an excep- converge. At a singularity, the exact solution at
non-Hermitian systems in which external cou- tional point marks this transition. Similar to the e = 0 is of a fundamentally different nature
pling through a pump beam mediates the inter- exceptional points emerging in complex poten- compared with its neighboring points e → 0
actions (94). tials, the photonic bandgap in gratings exhibits (96). At a second-order exceptional point, the
At this point, it is worth stressing that ex- interesting properties, such as a vanishing group series solution
ceptional points are not necessarily difficult to velocity (95). X
1
find in optical setups because they occur ubiq-
Applications in nanophotonics sT ðeÞ ¼ s0 þ ðT1Þn cn en=2 ð3Þ
uitously in the wave number space, even in con-
n¼1
servative systems in which no gain or loss is The exotic properties of exceptional points open
involved. In these scenarios, a part of a Hermitian interesting possibilities for advanced light ma- exists, where s0 is the eigenvalue at the ex-
system can be considered non-Hermitian, be- nipulation. In this section, we present an overview ceptional point. The radius of convergence of
cause it exchanges energy with the rest of the of some of the recent theoretical and experimental this series in the complex e plane is deter-
system. Possibly the best-known example of developments in the exploration of exceptional mined by the nearest exceptional point. In a
these trivial exceptional points is the total in- points for applications in photonics. As in other similar manner, for a kth-order exceptional
ternal reflection at the interface of two materials. areas of physics, in photonics, perturbation theory point the nth term in the perturbation series
In this case, light transmitted at the interface of is an important mathematical tool to tackle a is en/k, with a dominant first-order term of e1/k.
two media critically depends on the incidence range of problems without having to deal with For small perturbations, this term is considera-
angle of the impinging light. In particular, at a complex full-wave equations. Owing to the sin- bly larger than the linear term e, which occurs
critical angle, a phase transition occurs in the gularity at exceptional points, as well as the di- at regular points, enabling extra sensitivity to
propagation wave number of the second medium, mensionality collapse in the eigenvector space, the parameter e of a system when biased at the
exceptional point singularity. This property has (100) (Fig. 5B). Although it has been pointed out laser cavities (104). A common issue in laser
been proposed to achieve enhanced mode split- that enhanced sensitivity at the exceptional point systems is that often several transverse or long-
ting between counter-propagating whispering does not necessarily correspond to enhanced itudinal modes may simultaneously lase. In this
gallery modes of a microring resonator in the precision in sensing instruments (101) and that regard, it has been suggested to complement the
presence of nanoparticles (97). The prospect of quantum noise should be considered to assess active multimode laser cavity with a passive ca-
utilizing exceptional points for enhanced mode the ultimate performance of these exceptional vity that ideally exhibits an equal amount of loss.
splitting has been experimentally demonstra- point sensors (102), sensors appear to be an In this scenario, the overall level of loss is in-
ted in microtoroid cavities (98, 99) (Fig. 5A). In interesting application area for these concepts. creased in the entire system, given that each mode
addition, integrated microring resonators with In this area, it has also been shown that a scaled overlaps with the loss region, and thus the gain
externally controllable perturbations have been form of PT symmetry can be used for enhanced threshold is expected to increase. However, a large
utilized to induce second- and third-order excep- sensor telemetry (103). discrimination between lasing thresholds of dif-
tional points, where ½ and ⅓ power-law expo- Another interesting application of exceptional ferent modes is obtained at the exceptional point
nents in mode splitting have been demonstrated points is mode discrimination in multimode supported by this PT-symmetric system. In this
case, the modes are split into two classes that are
equally distributed between the active and pas-
sive regions, as well as modes that are localized
either in the gain or loss cavity. The first class of
modes remains neutral, whereas the modes lo-
cated in the gain enter the gain regime. As a result,
the passive cavity prevents some of the modes
from lasing. More interestingly, this structure
lasers (110). In addition, integrated coupled mi- pological properties. That their optical properties also been presented (118). An interesting prob-
croring lasers have been demonstrated with are related to a topological feature makes the lem in this context is to adiabatically change the
single-mode operation at telecommunication wave- response inherently robust to disorder and im- parameters of a non-Hermitian system such that
lengths (111) (Fig. 6D). perfections. Analogously, exceptional points rep- the exceptional point is dynamically encircled, as
As illustrated in Fig. 7A, an interesting aspect resent an interesting example of topological depicted in Fig. 7B. In a Hermitian system, when
of exceptional points consists of their exotic features arising in simple coupled dynamical adiabatically changing the parameters along a
topological features in the parameter space. This systems as a result of the interplay between closed path, the two eigenvectors are bound to
discussion falls into the broad context of topo- interaction and dissipation. According to Fig. 7A, return to their original form, apart from acquir-
logical photonics, an area of optics research that a loop of eigenvalues that encircle a base point ing a possible geometric phase (120). In the case
has produced considerable excitement in recent identifies a topological object, given that it can- of non-Hermitian systems, instead, parametric
years. Inspired by the unusual physics of topo- not be continuously deformed to a single point cycling an exceptional point interchanges the
logical insulators in condensed-matter physics, without crossing the base point. instantaneous eigenvectors, whereas only one
topological phenomena in photonics have been The rigorous analysis of these features can be picks up the geometric phase (13, 121–123). In
shown to arise in sophisticated periodic struc- carried out using results from condensed-matter principle, this behavior does not occur, even for
tures, ranging from gyromagnetic photonic crys- physics, in which the topological band theory of arbitrarily slow dynamic cycling of the excep-
tals (112), arrays of helical waveguides (113), arrays non-Hermitian Hamiltonians has been rigorously tional point, given that the adiabatic theorem
of microring resonators (114), bianisotropic or investigated in (118). Specifically, it was shown breaks down in case of non-Hermitian systems.
magnetized metacrystals (115), dielectric chiral that non-Hermitian band structures exhibit a Indeed, under such conditions, depending on
metasurfaces (116), and time-modulated lattices topological invariant associated with the gra- the direction of rotation, one of the two eigen-
(117). In these systems, highly unusual photon dient of the band in momentum space (119). states dominates at the end of the parametric
transport, characterized by one-way propagation Inspired by the periodic table of topological cycle. This interesting topological response pro-
arrangements for dispersion manipulation is dress the current challenges in integrated laser different spatial orders (135). As a result, adia-
still largely unexplored, and multiple coupled sources by taking advantage of the strong pa- batic tapering of the waveguide width along the
cavities or metamaterials may be envisioned to rameter dependence of such structures near propagation direction can efficiently convert
take full advantage of exceptional points in the exceptional points. polarization states as well as spatial-mode orders
context of dispersion engineering. Mode conversion in a compact integrated (136, 137). As shown schematically in Fig. 8C, the
In a similar fashion, coupled-cavity arrange- photonic device is another important function- inclusion of selective gain and loss in such
ments offer exciting prospects to design new ality that can largely benefit from exceptional geometries provides an alternative degree of
semiconductor lasers with highly desired func- points, in terms of reduced footprint and inherent freedom to control the mode-conversion ef-
tionalities. Although modern semiconductor laser robustness to disorder. Even though rigorous op- ficiency. In addition, hybridization between mul-
sources exist in the entire optical spectrum, their timization techniques allow for inverse design tiple modes through higher-order exceptional
coherence properties are not sufficient for many of such structures, often resulting in complex points can initiate the simultaneous conversion
applications. In particular, key requirements for structures that require advanced fabrication among a large number of modes. The full ram-
laser sources, such as stable and narrowband fre- technologies, alternative designs with reduced ifications of these concepts become very pow-
quency operation, as well as frequency tunability, complexity are highly desirable. In this vein, erful new tools in photonic engineering.
can be achieved through coupled-cavity geo- adiabatic perturbation of a structural parameter The quest for integration of optical setups on a
metries (131–134) (Fig. 8B). Even though this inducing an exceptional point–induced control- chip requires integrated implementation of
scheme has been previously applied to semi- lable level repulsion can provide a simple ap- fundamental elements such as laser sources
conductor lasers at specific frequencies, it re- proach for hybridization and adiabatic exchange with critical power and coherence demands, iso-
mains to be explored in other, arguably more of modes. Recently, it has been shown that in lators and circulators, mode convertors, and so
practical, sources and at different frequencies. optical ridge waveguides with different cladding on. In this regard, multimode structures have
In this regard, coupled-cavity techniques in and buffer materials, varying the waveguide proven to provide a great opportunity to achieve
that integrate other degrees of freedom beyond 11. N. Moiseyev, Quantum theory of resonances: Calculating 36. H. Kogelnik, Coupled wave theory for thick hologram
optics, exploiting the interaction between dif- energies, widths and cross-sections by complex scaling. gratings. Bell Syst. Tech. J. 48, 2909–2947 (1969).
Phys. Rep. 302, 212–293 (1998). doi: 10.1016/S0370-1573 doi: 10.1002/j.1538-7305.1969.tb01198.x
ferent phenomena. In particular, cavity optome- (98)00002-7 37. R. Stolen, J. Bjorkholm, Parametric amplification and
chanics, relying on the strong coupling between 12. E. Persson, I. Rotter, H. Stöckmann, M. Barth, Observation frequency conversion in optical fibers. IEEE J.
optics and mechanical motion, offers a reconfig- of resonance trapping in an open microwave cavity. Quantum Electron. 18, 1062–1072 (1982). doi: 10.1109/
urable, inherently non-Hermitian platform that Phys. Rev. Lett. 85, 2478–2481 (2000). doi: 10.1103/ JQE.1982.1071660
PhysRevLett.85.2478; pmid: 10978086 38. M. Aspelmeyer, T. J. Kippenberg, F. Marquardt, Cavity
can be externally controlled through pump lasers 13. C. Dembowski et al., Experimental observation of the optomechanics. Rev. Mod. Phys. 86, 1391–1452 (2014).
with proper intensity and phase (140) (Fig. 8D). topological structure of exceptional points. Phys. Rev. Lett. doi: 10.1103/RevModPhys.86.1391
Operating in the red and blue sideband detuning 86, 787–790 (2001). doi: 10.1103/PhysRevLett.86.787; 39. M. Fox, Quantum Optics: An Introduction (Oxford Univ.
of the pump beam can effectively control loss or pmid: 11177940 Press, 2006).
14. H. Wenzel, U. Bandelow, H. J. Wunsche, J. Rehberg, 40. E. M. Graefe, U. Günther, H. J. Korsch, A. E. Niederle,
gain for the optical modes involved, opening ex- Mechanisms of fast self pulsations in two-section DFB lasers. A non-Hermitian PT-symmetric Bose–Hubbard model:
citing opportunities for PT symmetry and ex- IEEE J. Quantum Electron. 32, 69–78 (1996). doi: 10.1109/ Eigenvalue rings from unfolding higher-order exceptional
ceptional points in a low-noise nanophotonic 3.481922 points. J. Phys. A Math. Theor. 41, 255206 (2008).
integrated environment. Similarly, cavity polar- 15. M. V. Berry, Mode degeneracies and the Petermann excess- doi: 10.1088/1751-8113/41/25/255206
noise factor for unstable lasers. J. Mod. Opt. 50, 63–81 41. G. Demange, E.-M. Graefe, Signatures of three coalescing
itons, because of their inherent non-Hermitian eigenfunctions. J. Phys. A Math. Theor. 45, 025303 (2012).
(2003). doi: 10.1080/09500340308234532
properties, can provide another platform for in- 16. S. Bernet et al., Matter waves in time-modulated complex doi: 10.1088/1751-8113/45/2/025303
vestigating and utilizing exceptional points (141) light potentials. Phys. Rev. A 62, 023606 (2000). 42. J. Franklin, Matrix Theory (Dover Publications, 1993).
(Fig. 8E). doi: 10.1103/PhysRevA.62.023606 43. M. V. Berry, M. Wilkinson, Diabolical points in the spectra
17. C. M. Bender, S. Boettcher, Real spectra in non-Hermitian of triangles. Proc. R. Soc. London Ser. A 392, 15–43 (1984).
Finally, it is worth mentioning the potential doi: 10.1098/rspa.1984.0022
Hamiltonians having PT symmetry. Phys. Rev. Lett. 80,
of utilizing exceptional point singularities in op- 5243–5246 (1998). doi: 10.1103/PhysRevLett.80.5243 44. D. R. Yarkony, Diabolical conical intersections. Rev. Mod.
tical scattering problems, where the coupling 18. G. Lévai, M. Znojil, Systematic search for PT-symmetric Phys. 68, 985–1013 (1996). doi: 10.1103/RevModPhys.68.985
64. M. Kulishov, J. Laniel, N. Bélanger, J. Azaña, D. Plant, 87. M. Brandstetter et al., Reversing the pump dependence of a 112. Z. Wang, Y. Chong, J. D. Joannopoulos, M. Soljacić,
Nonreciprocal waveguide Bragg gratings. Opt. Express 13, laser at an exceptional point. Nat. Commun. 5, 4034 (2014). Observation of unidirectional backscattering-immune
3068–3078 (2005). doi: 10.1364/OPEX.13.003068; doi: 10.1038/ncomms5034; pmid: 24925314 topological electromagnetic states. Nature 461, 772–775
pmid: 19495203 88. B. Peng et al., Loss-induced suppression and revival of lasing. (2009). doi: 10.1038/nature08293; pmid: 19812669
65. Z. Lin et al., Unidirectional invisibility induced by Science 346, 328–332 (2014). doi: 10.1126/science.1258004; 113. M. C. Rechtsman et al., Photonic Floquet topological
PT-symmetric periodic structures. Phys. Rev. Lett. 106, pmid: 25324384 insulators. Nature 496, 196–200 (2013). doi: 10.1038/
213901 (2011). doi: 10.1103/PhysRevLett.106.213901; 89. Z. H. Musslimani, K. G. Makris, R. El-Ganainy, nature12066; pmid: 23579677
pmid: 21699297 D. N. Christodoulides, Optical solitons in PT periodic 114. M. Hafezi, S. Mittal, J. Fan, A. Migdall, J. M. Taylor, Imaging
66. G. Castaldi, S. Savoia, V. Galdi, A. Alù, N. Engheta, PT potentials. Phys. Rev. Lett. 100, 030402 (2008). topological edge states in silicon photonics. Nat. Photonics 7,
metamaterials via complex-coordinate transformation optics. doi: 10.1103/PhysRevLett.100.030402; pmid: 18232949 1001–1005 (2013). doi: 10.1038/nphoton.2013.274
Phys. Rev. Lett. 110, 173901 (2013). doi: 10.1103/ 90. N. Akhmediev, A. Ankiewicz, Dissipative Solitons (Springer, 2005). 115. X. Ni et al., Spin- and valley-polarized one-way Klein tunneling
PhysRevLett.110.173901; pmid: 23679728 91. A. E. Miroshnichenko, B. A. Malomed, Y. S. Kivshar, in photonic topological insulators. Sci. Adv. 4, eaap8802
67. M.-A. Miri, A. B. Aceves, T. Kottos, V. Kovanis, Nonlinearly PT-symmetric systems: Spontaneous symmetry (2018). doi: 10.1126/sciadv.aap8802; pmid: 29756032
D. N. Christodoulides, Bragg solitons in nonlinear PT- breaking and transmission resonances. Phys. Rev. A 84, 116. M. A. Gorlach et al., Far-field probing of leaky topological
symmetric periodic potentials. Phys. Rev. A 86, 033801 012123 (2011). doi: 10.1103/PhysRevA.84.012123 states in all-dielectric metasurfaces. Nat. Commun.
(2012). doi: 10.1103/PhysRevA.86.033801 92. S. Nixon, L. Ge, J. Yang, Stability analysis for solitons in PT- 9, 909 (2018). doi: 10.1038/s41467-018-03330-9;
68. L. Feng et al., Experimental demonstration of a unidirectional symmetric optical lattices. Phys. Rev. A 85, 023822 (2012). pmid: 29500466
reflectionless parity-time metamaterial at optical frequencies. doi: 10.1103/PhysRevA.85.023822 117. R. Fleury, A. B. Khanikaev, A. Alù, Floquet topological
Nat. Mater. 12, 108–113 (2013). doi: 10.1038/nmat3495; 93. M. Wimmer et al., Observation of optical solitons in PT- insulators for sound. Nat. Commun. 7, 11744 (2016).
pmid: 23178268 symmetric lattices. Nat. Commun. 6, 7782 (2015). doi: 10.1038/ncomms11744; pmid: 27312175
69. Y. Yan, N. C. Giebink, Passive PT symmetry in organic doi: 10.1038/ncomms8782; pmid: 26215165 118. Z. Gong et al., Topological phases of non-Hermitian systems.
composite films via complex refractive index modulation. 94. R. W. Boyd, Nonlinear Optics (Academic Press, 2003). Phys. Rev. X 8, 031079 (2018). doi: 10.1103/
Adv. Opt. Mater. 2, 423–427 (2014). doi: 10.1002/ 95. J. P. Dowling, M. Scalora, M. J. Bloemer, C. M. Bowden, The PhysRevLett.120.146402; pmid: 29694133
adom.201400021 photonic band edge laser: A new approach to gain 119. H. Shen, B. Zhen, L. Fu, Topological band theory for
70. R. Fleury, D. Sounas, A. Alù, An invisible acoustic sensor enhancement. J. Appl. Phys. 75, 1896–1899 (1994). non-Hermitian Hamiltonians. Phys. Rev. Lett. 120,
based on parity-time symmetry. Nat. Commun. 6, 5905 doi: 10.1063/1.356336 146402 (2018). doi: 10.1103/PhysRevLett.120.146402;
136. D. Dai, Y. Tang, J. E. Bowers, Mode conversion in tapered 141. T. Byrnes, N. Y. Kim, Y. Yamamoto, Exciton–polariton 145. A. Regensburger et al., Observation of defect states in
submicron silicon ridge optical waveguides. Opt. Express 20, condensates. Nat. Phys. 10, 803–813 (2014). doi: 10.1038/ PT-symmetric optical lattices. Phys. Rev. Lett. 110, 223902
13425–13439 (2012). doi: 10.1364/OE.20.013425; pmid: 22714370 nphys3143 (2013). doi: 10.1103/PhysRevLett.110.223902;
137. Z. Zhang, X. Hu, J. Wang, On-chip optical mode exchange 142. Y. Plotnik et al., Experimental observation of optical bound pmid: 23767725
using tapered directional coupler. Sci. Rep. 5, 16072 (2015). states in the continuum. Phys. Rev. Lett. 107, 183901 146. J. B. Khurgin, How to deal with the loss in plasmonics and
doi: 10.1038/srep16072; pmid: 26530728 (2011). doi: 10.1103/PhysRevLett.107.183901; metamaterials. Nat. Nanotechnol. 10, 2–6 (2015).
138. T. Goldzak, A. A. Mailybaev, N. Moiseyev, Light pmid: 22107630 doi: 10.1038/nnano.2014.310; pmid: 25559961
stops at exceptional points. Phys. Rev. Lett. 120, 143. A. Kodigala et al., Lasing action from photonic bound states
013901 (2018). doi: 10.1103/PhysRevLett.120.013901; in continuum. Nature 541, 196–199 (2017). doi: 10.1038/ AC KNOWLED GME NTS
pmid: 29350937 nature20799; pmid: 28079064 Funding: This work was supported by the Office of Naval Research,
139. S. Longhi, Exceptional points and photonic catastrophe. 144. H. M. Doeleman, F. Monticone, W. den Hollander, the Simons Foundation, the Air Force Office of Scientific
Opt. Lett. 43, 2929–2932 (2018). doi: 10.1364/ A. Alù, A. F. Koenderink, Experimental observation Research, and the National Science Foundation. Competing
OL.43.002929; pmid: 29905726 of a polarization vortex at an optical bound state interests: None declared.
140. E. Verhagen, A. Alù, Optomechanical nonreciprocity. in the continuum. Nat. Photonics 12, 397–401 (2018).
Nat. Phys. 13, 922–924 (2017). doi: 10.1038/nphys4283 doi: 10.1038/s41566-018-0177-5 10.1126/science.aar7709
plasticity promotes rapid tissue with tissue damage and inflammation, such
as IL-1, IL-18, IL-25, and IL-33, were able to
superimpose a type 2 effector program on
adaptation to injury ON OUR WEBSITE
◥
both TC17 and TH17 cells
in the context of T cell re-
Oliver J. Harrison, Jonathan L. Linehan, Han-Yu Shih, Nicolas Bouladoux, Read the full article ceptor engagement. Using
Seong-Ji Han, Margery Smelkinson, Shurjo K. Sen, Allyson L. Byrd, Michel Enamorado, at http://dx.doi. an IL-17A fate-mapping
org/10.1126/ strategy, we found that
Chen Yao, Samira Tamoutounour, Francois Van Laethem, Charlotte Hurabielle,
science.aat6280 IL-17A–committed RORgt+
Nicholas Collins, Andrea Paun, Rosalba Salcedo, John J. O’Shea, Yasmine Belkaid* ..................................................
T cells and their IL-17A−
+
INTRODUCTION: Barrier tissues are con- challenges relies on rapid and coordinated local RORgt counterparts both produced type 2
stitutive targets of environmental stressors responses tailored to both the microenviron- cytokines in response to tissue alarmins. Such
Il5, Alarmins
IL-17A IL-13
Il13 mRNA IL-1 IL-5
IL-18 IL-13
IL-25
IL-33
Commensal-specific Alarmin-licensed Foxp3+ Treg
CD4+ and CD8+ T cells T cell plasticity
Poised type 2 immunity of commensal-specific T cells promotes rapid adaptation to tissue injury. Commensal-specific T cells produce
IL-17A under homeostatic conditions for antimicrobial defense while harboring a poised type 2 transcriptome. Tissue injury licenses type 2
immune potential of commensal-specific type 17 T cells, thereby promoting tissue repair. Impaired immune regulation unleashes type 2
cytokine production from commensal-specific CD8+ TC17 cells.
B
sue residency markers CD69 and CD103 (9) (Fig. 1,
arrier tissues are constitutive targets of T cell responses (1–4). This tonic recognition pro- A to C). To assess tissue residency, we generated
environmental stressors as well as primary motes a highly physiological form of adaptive S. epidermidis–colonized parabiotic mice, which
sites of exposure to symbiotic and patho- immunity that can control distinct aspects of establish chimerism through joint circulation
genic microbes. As such, under homeosta- tissue function, including antimicrobial defense (10) (fig. S1A). In contrast to lymphoid organs,
sis, barrier tissues are home to vast numbers and tissue repair (5, 6). Because of the extraor- where cells equilibrated, f-MIIINA:H2-M3+ CD8+
of antigen-experienced lymphocytes. The numer- dinary number of antigens expressed by the T cells within the skin were host-derived (97.1 ±
ous and diverse microbes that colonize these microbiota, a substantial fraction of barrier tissue- 2.4%) and coexpressed CD103 and CD69 (Fig. 1,
tissues, referred to as the microbiota, play a fun- resident T cells are expected to be commensal- D and E). Thus, commensal-specific T cells can
damental role in the induction and quality of specific, accumulating over time in response to develop as long-lived tissue-resident memory
these local immune responses, including those successive exposure to new commensals. This T cells.
that are directed at the microbiota itself (1–4). understanding of host-microbiota interactions Given the fundamental role of the skin as a
Indeed, far from being ignored, microbes at all has important implications for our understand- protective barrier, we sought to determine the
barrier surfaces are actively recognized by the ing of host immunity and pathologies. Because impact of environmental stressors on commensal-
immune system. Encounters with noninvasive barrier tissues are defined by the constitutive specific tissue-resident T cells. After colonization,
symbionts can lead to the induction of cognate coexistence of commensals (and associated anti- S. epidermidis–specific polyclonal CD8+ T cells
gens) and commensal-reactive lymphocytes, our were identified as T-bet + CCR6 − TC1 cells or
1
Mucosal Immunology Section, Laboratory of Parasitic Diseases,
understanding of tissue homeostasis, response to RORgt+CCR6+ TC17 cells [of which ~30% have
National Institute of Allergy and Infectious Diseases, Bethesda, injury, and tissue-specific pathologies must occur interleukin (IL)–17A production potential] (Fig.
MD 20892, USA. 2Molecular Immunology and Inflammation in the context of this fundamental dialog. 1, F and G). Although the intradermal injection
Branch, National Institute of Arthritis and Musculoskeletal and The skin serves as a primary interface with of chitin or sand fly (Lutzomyia longipalpis)
Skin Diseases, Bethesda, MD 20892, USA. 3NIAID Microbiome
Program, National Institute of Allergy and Infectious Diseases,
the environment and is consequently a consti- bites had no impact on the potential for IL-17A
Bethesda, MD 20892, USA. 4Biological Imaging, Research tutive target of environmental stressors medi- and interferon (IFN)–g production by TC17 and
Technology Branch, National Institute of Allergy and Infectious ated by physical damage, invasive pathogens, TC1 cells, respectively (Fig. 1H), both stressors
Diseases, Bethesda, MD 20892, USA. 5Leidos Biomedical impaired immune regulation, or the nutritional revealed a surprising potential for the produc-
Research Inc., Basic Science Program, Cancer and Inflammation
Program, Frederick National Laboratory for Cancer Research,
state of the host. Tissue protection from these tion of IL-5 and IL-13 from S. epidermidis–
Bethesda, MD 20892, USA. 6Experimental Immunology Branch, challenges relies on rapid and coordinated local elicited TC17 cells, including f-MIIINA:H2-M3+
National Cancer Institute, Bethesda, MD 20892, USA. 7Inserm responses tailored to both the microenvironment CD8+ T cells (Fig. 1, H and I, and fig. S1, B and
Unité 976, Hôpital Saint-Louis, Paris, France. 8Intracellular and the nature of the instigating injury. Recently, C). Increased type 2 cytokine production after
Parasite Biology Section, Laboratory of Parasitic Diseases,
National Institute of Allergy and Infectious Diseases, Bethesda,
the discovery that cells such as innate lymphoid chitin or sand fly challenge was also observed
MD 20892, USA. 9Cancer and Inflammation Program, National cells (ILCs) can rapidly respond to mediators from RORgt-expressing CD4 + T cells (TH17)
Cancer Institute, Bethesda, MD 20892, USA. released during tissue damage has provided a elicited by S. epidermidis (fig. S1D). Thus, RORgt+
*Present address: Department of Cancer Immunology, Genentech, framework to begin to understand this phenom- T cells (both CD8+ and CD4+ T cells) elicited
South San Francisco, CA 94080, USA. †Present address: Institut
de Génétique Moléculaire de Montpellier, University of Montpellier,
enon. Whether tissue-resident T cells, particu- by encounter with a commensal may have the
CNRS, Montpellier, France. ‡Corresponding author. Email: larly those specific to commensals, can also act unexpected potential to produce type 2 cytokines
ybelkaid@niaid.nih.gov as tissue sentinels allowing rapid adaptation to in response to defined tissue challenges.
A Polyclonal B Polyclonal
CD8+ T cells BowieTg T cells f-MIIINA:H2-M3+ T cells CD8+ T cells BowieTg T cells f-MIIINA:H2-M3+ T cells
23±3 2±1 20±4 2±1 18±2 3±1 18±2 66±6 19±3 73±8 11±1 72±5
CD103
IL-17A
IFN-γ CD69
C CD8α CD45.1 CD8α CD45.1
150µm 50µm
45±4
RORγt
RORγt
IL-17A
Tc17
50
Tc1 47±5
25 34±8
41±5
0 7±1
0
en
in
H 30 30 10 ** 6 **
8 ** **
IL-17A+ (%)
IL-13+ (%)
IFN-γ+ (%)
IL-5+ (%)
20 20 4
6
4
10 10 2
2
0 0 0 0
fly
fly
nd in
nd n
i.d PB l
i.d . PB l
fly
fly
.C S
.C S
fly
fly
nd in
nd n
fly
fly
nd in
nd n
nd in
nd in
i.d PB l
. P rl
. r
i.d PB l
i.d . PB l
i.d PB l
i.d PB l
.C S
.C S
.C S
.C S
.C S
.C S
Sa hiti
. r
. r
. r
. r
i.d Ct
i.d Ct
Sa hiti
Sa hit
Sa iti
i.d Ct
i.d Ct
i.d Ct
i.d Ct
i.d Ct
i.d Ct
Sa hit
Sa hit
Sa hit
Sa hit
i.d B
h
CCR6
RORγt
RORγt
commensal-specific
T cells. (A) Represent-
ative contour plots of 0.8±0.3 9±2
RORgt and GATA-3
Isotype GATA-3 Foxp3 DAPI CD8α
expression by skin
CD8+ T cells from B D E
S. epidermidis–colonized S. epidermidis C. albicans Foxp3YFP-CreGata3fl/wt Foxp3YFP-CreGata3fl/fl
100 RORγt
wild-type mice. (B) Rep-
Foxp3
% max
plots of GATA-3 60
expression by RORgt+ 40
in
Lu T
ng
M LP
e
ym P
M s
AT
Sp LN
en
PP
Li N
M d
LN
BM
Bl er
colonized wild-type CD25
oo
cl
VA
GATA-3
Th siL
PL
Sk
v
le
c
S
us
mice. (C) Representa-
tive confocal imaging F G H I
Eosinophils (%)
along the z axis of
CD4+ IL-5+ (%)
Skin inflammation
CD4+ IL-13+ (%)
Basophils (%)
penetrance (%)
fl/wt fl/fl 40
Gata3 Gata3
epidermal skin from 10 10 30
10
S. epidermidis–colonized 50
SLN 20
Foxp3gfp mice. (D) Fre- 5 5 5
10
quencies of Foxp3+ Treg Foxp3YFP-CreGata3fl/wt
MLN
0 0 0 0
cells coexpressing PLN 0
Skin Skin Skin Skin 0 100 200 300
lineage-defining Spleen
Age (days)
YFP-Cre fl/wt YFP-Cre fl/fl
transcription factors Foxp3 Gata3 Foxp3 Gata3
(LDTFs) within indicated
tissues of naïve wild- J K L Foxp3YFP-CreGata3fl/wt Foxp3YFP-CreGata3fl/fl
type mice. VAT, visceral Foxp3YFP-CreGata3fl/wt Foxp3YFP-CreGata3fl/wt Foxp3YFP-CreGata3fl/fl
adipose tissue; cLP, 2.5 *** 2.5 ***
lymph node; BM, bone 51±5 0.6±0.3 52±6 5±2 44±5 0.7±0.5 46±6 4±3
Recipient
+
CD8 T cells
CCR6
CCR6
BowieTg Donor
Local defects in immunoregulation vealed colocalization of S. epidermidis–induced were associated with discrete elevated fre-
unleash type 2 immunity from CD8+ T cells and Foxp3+ Treg cells (Fig. 2C). quencies and absolute numbers of eosinophils
commensal-specific T cells As such, we assessed the possibility that skin and basophils in the skin of Foxp3YFP-CreGata3fl/fl
Flow cytometric analysis revealed that TC17 cells Foxp3+ Treg cells could limit type 2 cytokine mice relative to control mice (Fig. 2H and fig.
coexpressed GATA-3, the lineage-defining tran- production by commensal-specific type 17 cells. S2L). Of note, and in agreement with a skin-
scription factor (LDTF) for both TH2 cells and Because complete ablation of Foxp3+ Treg cells specific defect, naïve Foxp3YFP-CreGata3fl/fl mice,
group 2 ILC (ILC2) (Fig. 2A). Such a phenotype results in severe local and systemic inflamma- with an endogenous skin microbiota but not
was also detected among the very few CD8+ tory responses and aberrant accumulation of S. epidermidis, spontaneously developed severe
T cells present in the skin of naïve mice (fig. TC1 cells within the skin (11) (fig. S2, D and E), we skin inflammation (but not systemic inflamma-
S2A), and coexpression of RORgt and GATA-3 used an approach allowing for a tissue-specific tion) with ~70% penetrance by 8 months of age
by S. epidermidis–specific BowieTg CD8+ T cells defect in immunoregulation. Within the skin, (Fig. 2, I and J).
was restricted to the skin and not detectable Treg cells express high levels of GATA-3 (but not To assess the possibility that T cells producing
in secondary lymphoid organs; these findings other LDTFs) (Fig. 2D and fig. S2F), a factor type 2 cytokines within the skin of these mice
suggested that GATA-3 expression is imprinted that contributes to Treg cell stability and fitness are commensal-specific, we colonized young
within the tissue microenvironment (fig. S2B). (12–15). In mice in which Treg cells were condi- Foxp3YFP-CreGata3fl/fl mice (before inflammation)
This phenotype was conserved across T cell tionally deleted of GATA-3 (Foxp3YFP-CreGata3fl/fl), and control mice with S. epidermidis and tracked
lineages and distinct microbial exposures. Nota- Foxp3+ cells were reduced in frequency and ex- the fate of S. epidermidis–specific T cells. Adop-
bly, TH17 cells elicited by skin colonization with hibited decreased Foxp3 and CD25 expression tively transferred BowieTg CD8+ T cells (as well
S. epidermidis or Candida albicans also expressed in the skin, but not in other tissues (Fig. 2E as host polyclonal S. epidermidis–induced CD8+
GATA-3 (Fig. 2B and fig. S2C). Thus, homeostatic and fig. S2, G and H). Consistent with this ob- T cells) expressed IL-5 and IL-13 proteins in the
encounter with bacterial or fungal commensal servation, by 10 weeks of age, skin-draining skin of Foxp3YFP-CreGata3fl/fl mice but not con-
A B C
Global ATAC-seq analysis Ifng Il17a Il17f
200 350
Tc1 Tc17 Naïve Memory
ATAC
ATAC
Tc17 Tc17
Enriched 200 350
motifs Tc1 Tc1
100 250
RNA
RNA
Tc17 Tc17
100 250
Tc17 specific RORγt Tc1 Tc1
Tc1 specific
T-bet
Eomes D E
Canonical CD8 Rad50 Il5 Il4 Il13
100 25
ATAC
ATAC
Tc17
RNA
50 75
Tc1 Tc1
-1kb 0 +1kb
Il1 21
Tb g
G 3
F G
Il1 2
Kl es
Il1 b
Il1 r
R a
C f
C
2r
Il2
Il1 c
at
m
Pr 1
Ifn
x
Il1
7r
rg
or
cr
cr
b
a3
r l1
7
Il5
3
f1
*
Il5 Promoter/TSS (RPM)
−1
80 * 60
Tc1 60
40
0
40
20
1 Tc17 20
0 0
type 17 type 1 type 2 17 c1 17 Tc1
Tc T Tc
Fig. 3. S. epidermidis–specific TC17 cells express a broad type 2 the right. (B to E) Genomic tracks of ATAC-seq and RNA-seq signal profiles
signature. TC17 (CD8+CCR6+) and TC1 (CD8+CCR6−) cells were isolated in TC17 and TC1 cells across signature cytokine genes. Genomic location of
by FACS from the skin of S. epidermidis–colonized wild-type mice for TC17-specific regulatory elements with GATA-3 binding motifs are denoted by
transcriptomic and epigenetic analysis by RNA-seq and ATAC-seq. ATAC-seq red triangles. (F) Heat map of lineage-specific signature genes expressed
signals from canonical naïve and memory CD8+ T cells were from lymphoid by TC17 and TC1 populations. (G) Chromatin accessibility at transcription
tissue. (A) Global comparison of ATAC-seq signals in S. epidermidis–induced start site (promoter ± 500 bp) of Il5 and Il13 in TC17 and TC1 cells. Bar graphs
TC17 and TC1 and canonical naïve and memory CD8+ T cells. Representative show means ± SD. Sequencing data represent two or three independent
transcription factor binding motifs enriched in indicated groups are listed on biological replicates. *P < 0.05 (Student t test).
tSNE 2
−20 0
CCR6- Tc1 IL-17AFM- Tc17
−40 −20 0 20 40 −20
tSNE 1
−40 −20 0 20 40
tSNE 1
C Tc17 D
IFN-γ IL-17A IL-5 IL-13 Tc17 Tc17
IL-17A Protein
IL-17A Protein
1±1 2±1 11±3 19±4 0.3± 0.2±0.1 0.2± 0 28±5 0.2±0.1 27±6 4±2
0.2 0.1
Protein
CreERT2Gata3 fl/fl
IL-17A Protein
10 10 30
0.4±0.3 14±3
0 0 0
IL-13 Protein IL-13 mRNA Tc1 Tc17 Tc1 Tc17 Tc1 Tc17
Fig. 4. S. epidermidis–specific TC17 cells harbor a poised type 2 tran- production potential and Il5 or Il13 mRNA expression by TC17 cells from the
scriptome. (A and B) TC1 (CD8+CCR6−), IL-17AFM+ TC17 (CD8+CCR6+eYFP+), skin of S. epidermidis–colonized wild-type mice. (F) S. epidermidis–colonized
and IL-17AFM− TC17 (CD8+CCR6+eYFP−) cells were isolated by FACS from the CreERT2Gata3fl/fl mice received tamoxifen or vehicle control before cell
skin of S. epidermidis–colonized Il17aCreR26ReYFP (IL-17AFM) mice and sorting of skin TC1 and TC17 cells. Gene expression in the indicated
analyzed by scRNA-seq. (A) tSNE plots of scRNA-seq expression highlighting populations was assessed by quantitative reverse transcription polymerase
TC1 (gray), IL-17AFM+ TC17 (orange), and IL-17AFM− TC17 (blue) populations. chain reaction (qRT-PCR). Numbers in representative plots indicate means ±
(B) Expression of LDTFs and cytokine genes projected onto a tSNE plot. SD. Flow cytometric data represent at least two experiments with four to
(C) Representative dot plots of cytokine protein production potential and six mice per group. qRT-PCR data represent three biological replicates
mRNA expression by TC17 cells from the skin of S. epidermidis–colonized of eight pooled mice per group. *P < 0.05, **P < 0.01 (one-way ANOVA with
wild-type mice. (D and E) Representative dot plots of IL-17A and IL-5 or IL-13 Holm-Šidák multiple-comparison test).
expressing CCR6; this result shows that in the tissue (16). Regulatory elements unique to skin relative to TC1 cells (Fig. 3, D to G, and fig. S3C).
context of local immune defects, type 2 cytokines TC17 or TC1 cells were enriched in binding sites Furthermore, TC17 cells expressed a broad type 2
can be unleashed from RORgt-committed T cells for RORgt, and for T-bet and Eomes, respectively transcriptome, including a LDTF (Gata3) and
(Fig. 2M). Thus, impaired local immunoregu- (Fig. 3A), consistent with subset-specific expres- cytokine and chemokine receptors (Ccr8, Il1rl1,
lation promotes type 2 cytokine production by sion of these LDTFs (Fig. 1F). Elevated chroma- and Il17rb), but neither Il4 nor Il10 mRNA, as
commensal-specific type 17 cells—a property that tin accessibility and transcript abundance of the previously described for tissue-derived TH2 cells
may predispose tissue to inflammation. signature cytokines Ifng, Il17a, and Il17f also (18) (Fig. 3F and fig. S3D). The type 2–associated
confirmed the clear distinction between TC1 and cytokine amphiregulin (Areg) was detectable in
S. epidermidis–specific TC17 cells harbor TC17 cell subsets (Fig. 3, B and C, and fig. S3, A both cell subsets, albeit at higher abundance in
a poised type 2 transcriptome and B). Among regulatory elements unique to TC17 cells (fig. S3D). As such, commensal-specific
To gain insight into the transcriptional and epi- TC17 cells, we identified previously described TC17 cells express a broad type 2 transcriptome
genetic landscape of commensal-specific T cells GATA-3–binding sites within Il13 and the Rad50/ under homeostatic conditions.
under homeostatic conditions, we identified TH2 locus control region (17) (Fig. 3, D and E). Of S. epidermidis–induced TC17 cells, ~30%
global regulatory elements shared between, and Consequently, TC17 cells demonstrated elevated displayed the potential for IL-17A production
unique to, S. epidermidis–specific polyclonal TC17 chromatin accessibility at type 2 immune gene (Fig. 1G), supporting the idea of possible pheno-
(CCR6+) and TC1 (CCR6−) cells from the skin and loci encoding Il5 and Il13 and expressed ele- typic heterogeneity. However, using cells from IL-
naïve and memory CD8+ T cells from lymphoid vated levels of Il5 and Il13 mRNA transcripts 17A fate-mapping mice (IL-17AFM–Il17aCreR26ReYFP)
and single-cell RNA sequencing (scRNA-seq), IL-1a significantly increased the ex vivo pro- are found during allergic asthma and helminth
t-distributed stochastic neighbor embedding duction of IL-17A from TC17 cells in the context infection (25–29). Previous studies also demon-
(tSNE) projection of TC1, IL-17AFM+ TC17, and of TCR stimulation (Fig. 5A). As previously re- strated plasticity of effector TH17 cells to convert
IL-17AFM− TC17 cells demonstrated consider- ported, IL-18 and IL-33 promoted IFN-g pro- to TH1, follicular helper (TFH), and Treg cell
able transcriptional overlap between IL-17AFM+ duction by TC1 cells (23, 24) (Fig. 5B). Notably, phenotypes in a context-dependent manner
and IL-17AFM− TC17 cell fractions, with type 2 several alarmins promoted the production of (26, 30, 31). Our work supports the idea that
cytokine mRNA–expressing cells present in both IL-5 (IL-18, IL-25, and IL-33) or IL-13 (IL-1a, such plasticity may be a fundamental fea-
fractions (Fig. 4, A and B, and fig. S4A). Thus, IL-1b, IL-18, and IL-33) (Fig. 5, C and D). IL-25 ture of tissue-resident commensal-specific T
commensal-specific TC17 cells, including those potently promoted the production of IL-5 but cells. To specifically address this point, we used
already committed to IL-17A production, can be not IL-13 (Fig. 5, C and D), supporting the idea IL-17AFM mice to assess in vivo the heritage of
superimposed with the expression of a type 2 that distinct classes of injury may have differ- TC17 cells licensed for type 2 cytokine produc-
transcriptome. Furthermore, in situ hybridiza- ent impacts on commensal-specific T cell re- tion. In line with the finding that both IL-
tion for mRNA detection by flow cytometry sponses. Strikingly, IL-18, a cytokine widely 17AFM− and IL-17AFM+ TC17 cells display poised
revealed that Il5 and Il13 transcripts, but not linked to the initiation of type 1 responses, was Il5 and Il13 mRNA expression (Fig. 4, B to E),
protein, were expressed selectively by TC17 cells particularly potent at eliciting the release of IL-18 triggered type 2 cytokine production
from the skin of S. epidermidis–colonized mice both IL-5 and IL-13 from TC17 cells ex vivo from both TC17 and TH17 cells regardless of
(Fig. 4C and fig. S4B). In line with our scRNA- (Fig. 5, C and D). IL-18 also promoted IL-17A whether they had previously expressed IL-17A
seq data (Fig. 4B and fig. S4A), Il5+ and Il13+ production by TC17 cells, further supporting (IL-17AFM+ and IL-17AFM−) (Fig. 6, A and B).
cells were found within both IL-17A–producing the idea that this alarmin can superimpose Thus, within commensal-induced TC17 and TH17
and IL-17A–nonproducing fractions of TC17 cells type 2 responses upon a precommitted type 17 cell populations, plasticity among IL-17AFM+ cells
(Fig. 4, D and E); this suggests that during ho- program (Fig. 5A). Under these conditions, IL- and local licensing of IL-17AFM− cells both con-
A B C ** D
** *
2.0 150 200
** 500 **
* ** *
IL-17A (ng/ml)
** *
IFN-γ (ng/ml)
400
IL-13 (pg/ml)
*
IL-5 (pg/ml)
1.5 150
100
300
1.0 100
200
50
0.5 50
100
0 0 0 0
IL α
IL ia
IL 8
IL 5
TS 33
LP
IL β
IL α
IL α
IL α
IL ia
IL 8
IL 5
TS 33
LP
IL ia
IL 8
IL 5
TS 3
LP
IL ia
IL 8
IL 5
TS 3
LP
IL β
IL β
IL β
-1
-1
-1
-2
-1
-1
-1
-2
-1
-1
-1
-2
-3
-1
-1
-1
-2
-3
ed
ed
ed
ed
-
-
M
M
IL-17A
IL-17A
IL-5 IL-5
G * H
20 ** 30 25 i.d. PBS 20 * 8
*
** 10
15 * 6
IFN-γ+ (%)
IL-13+ (%)
IL-5+ (%)
15 20
15
10 5 10 4
10
10
5 5 2
5
0 0 0 0 0 0
Tc1 Tc17 Tc1 Tc17 Tc1 Tc17 Tc1 Tc17 PBS IL-18 Chitin PBS IL-18 Chitin
fl/fl
Il18r1 Cd4 Il18r1fl/fl Cre
Fig. 5. Tissue alarmins license type 2 cytokine production from commensal-specific
I 20 8
T cells. (A to D) TC17 (CD8+CCR6+) and TC1 (CD8+CCR6−) cells were isolated from * *
15 * 6 *
anti-CD3e mAb and the indicated cytokines. Cell culture supernatants were assayed
for cytokine production after 24 hours of culture. (E) Representative contour plots 10 4
of IL-5 and IL-17A production potential by S. epidermidis–induced TC17 cells after i.d.
injection with PBS or IL-18. (F) Representative contour plots of IL-5 and IL-17A production 5 2
potential by skin CD4+Foxp3− T cells from S. epidermidis–colonized wild-type mice after
i.d. injection with PBS or IL-18. (G) Frequencies of TC17 and TC1 cells with indicated 0 0
cytokine production potential from the skin of S. epidermidis–colonized wild-type mice PBS IL-18 Chitin PBS IL-18 Chitin
after i.d. injection of PBS or IL-18. (H and I) Frequencies of TC17 (H) and TH17 (I) cells with
Il18r1fl/fl Cd4CreIl18r1fl/fl
indicated cytokine production potential from the skin of S. epidermidis–colonized
Cd4 Il18r1
Cre fl/fl
and control mice after i.d. injection with PBS, IL-18, or chitin. Numbers in
representative plots indicate means ± SD. Bar graphs show means ± SD. Data represent at least two experiments with three to six mice per group.
*P < 0.05, **P < 0.01 as calculated using one-way [(A) to (D), (G)] or two-way [(H), (I)] ANOVA with Holm-Šidák multiple-comparison test.
to promote these responses (fig. S6C). Thus, the Our results show that adaptation of tissue to and contextual functions including tissue repair.
poised type 2 immune potential of commensal- injuries can also be mediated by immunity to Thus, we describe a tissue checkpoint that relies
specific TC17 cells allows for local adaptation to the microbiota, a fundamental but poorly under- on the remarkable plasticity and adaptability of
injury, thereby promoting tissue repair. stood class of immunity. Notably, we found that tissue-resident commensal-specific T cells. We pro-
homeostatic immunity to bacteria or fungal com- pose that this feature may also have important
Conclusion mensals is characterized by the coexpression of implications in the etiology of tissue-specific
Barrier tissues are constitutively exposed to en- paradoxical programs, allowing commensal- inflammatory disorders. Given the extraordinary
vironmental stressors and are primary targets of specific T cells, when entering and persisting number of both commensal-derived antigens and
chronic inflammatory disorders. The mainte- within tissues, to adopt a type 17 program com- T cells at barrier sites, such a feature may represent
nance of tissue integrity and function represent patible with tissue homeostasis and immunity a fundamental component of host immunity.
a complex challenge that requires both resilience while maintaining a type 2–poised state. As such,
and adaptation. Under steady-state conditions, in the context of injury and consequent exposure Materials and methods
tissue resilience is, in part, mediated by innate to inflammatory mediators and cognate antigens, Mice
and adaptive immunity to the microbiota, which commensal-specific T cells rapidly release type 2 Wild-type (WT) C57BL/6 Specific Pathogen
reinforces barrier function and immunity (5). cytokines, allowing these cells to exert pleiotropic Free (SPF) mice were purchased from Taconic
Cytokine+ (%)
* IL-5+ ** IL-5+
Cytokine+ (%)
IL-17A
20 20
CD8+ T cells **
eYFP (Il17aFM)
10 10
0.6±0.4 12±4
0 0
IL-5 PBS IL-18 PBS IL-18
30 IL-17A+ 30 IL-17A+
15±3 0.4±0.1 9±3 2±1 * IL-17A+IL-5+
IL-17A+IL-5+ **
Cytokine+ (%)
CCR6
Cytokine+ (%)
* IL-5+ IL-5+
IL-17A
20 * 20
**
10 10 **
0.5±0.3 15±4
0 0
IL-5 PBS IL-18 PBS IL-18
C D E
anti-IL-5
Eosinophils (x104)
Tc17 3 1.5
4 2
2 1.0
2 1
1 0.5
0 0 0 0
0 24 48 72 96 0 24 48 72 96 S. epidermidis
BS
i.d. IL-18
trl
F Naive S. epidermidis WT
G
Il13-/-
Epidermal tongue (×103 µm)
Biosciences. Gata3fl/fl (37), Foxp3YFP-Cre (38) and NIAID-Taconic Exchange. Tcra+/− mice were American Association for the Accreditation of
Il17aCre (26) have been previously described and generated by breeding Tcra−/− mice with C57BL/6 Laboratory Animal Care (AAALAC)–accredited
were generously provided by J. Zhu (NIAID, NIH), WT mice. Foxp3DTR (B6.129(Cg)-Foxp3tm3(DTR/GFP) animal facility at NIAID and housed in accord-
A. Rudensky (Memorial Sloan Kettering Cancer Ayr/J) (11) and R26ReYFP (B6.129X1-Gt(ROSA) ance with the procedures outlined in the Guide
Center), and B. Stockinger (Francis Crick Insti- 26Sortm1(EYFP)Cos/J) (43) mice were purchased for the Care and Use of Laboratory Animals. All
tute), respectively. Foxp3gfp (39), CD45.1 (B6.SJL- from The Jackson Laboratory. CD4CreIl18r1fl/fl experiments were performed at NIAID under an
Ptprca Pepcb/BoyJ), Tcra−/− (B6.129S2-Tcratm1Mom/J) and Il18r1fl/fl control mice were kindly provided Animal Study Proposal (LPD-11E or LPD-68E)
(40), CD45.1 Rag1−/−, Il13−/− (41), and CreERT2- by G. Trinchieri (NCI, NIH). All mice were bred approved by the NIAID Animal Care and Use
Gata3fl/fl mice (42) were purchased from the and maintained under SPF conditions at an Committee. Sex- and age-matched mice between
6 and 35 weeks of age were used for each was removed and mice were joined at the joints. tured directly ex vivo in a 96-well U-bottom plate
experiment. The skin of the two animals was then connected in complete medium (RPMI 1640 supplemented
and sutured together. Animals were kept on oral with 10% fetal bovine serum, 2 mM L-glutamine,
Commensal culture and colonization antibiotics for 2 weeks and remained conjoined 1 mM sodium pyruvate, 1 mM nonessential amino
Staphylococcus epidermidis NIHLM087 (44) was for 90 to 95 days before analysis. Analysis was acids, 20 mM HEPES, 100 U/ml penicillin, 100 mg/
cultured for 18 hours in Tryptic Soy Broth at performed on ear pinnae skin tissue. ml streptomycin, and 50 mM b-mercaptoethanol)
37°C. Candida albicans (8) was cultured for and stimulated with 50 ng/ml of phorbol myris-
18 hours in Tryptic Soy Broth at 37°C (shaking Acute intradermal challenge tate acetate (PMA) (Sigma-Aldrich) and 5 mg/ml
180 rpm). For colonization with commensal S. epidermidis–colonized mice were anesthetized of ionomycin (Sigma-Aldrich) in the presence of
microbes, as before (45), each mouse was topically with ketamine-xylazine and injected intrader- brefeldin A (1:1000, GolgiPlug, BD Biosciences)
associated by placing 5 ml of culture suspension mally (10 ml per ear pinnae) with either sterile for 3 hours at 37°C in 5% CO2. After stimulation,
(approximately 109 CFU/ml) across the entire PBS (vehicle control), 250 ng of carrier-free re- cells were assessed for intracellular cytokine pro-
skin surface (approximately 36 cm2) using a sterile combinant IL-18 (R&D Systems), or 500 ng of duction as described below.
swab. Application of commensal microbes was chitin (Sigma-Aldrich). Unless otherwise indicated,
repeated every other day a total of four times. Skin skin tissue was analyzed for cytokine production Flow cytometric analysis
tissue was analyzed 14 days after initial coloniza- potential 48 hours after injury. Single-cell suspensions were incubated with com-
tion, unless otherwise indicated. binations of fluorophore-conjugated antibodies
Sand fly bite exposure against the following surface markers: CCR6 (29-
Inducible deletion of Gata3 S. epidermidis–colonized mice were exposed to 2L17), CD3e (145-2C11), CD4 (RM4-5), CD8b (53-
Deletion of Gata3 in CreERT2Gata3fl/fl mice was sand fly bites as described (48). Briefly, mice were 6.7), CD11b (M1/70), CD19 (6D5), CD44 (IM7),
induced by intraperitoneal injection of 5 mg anesthetized with ketamine-xylazine. Twenty fe- CD45 (30-F11), CD45.1 (A20), CD45.2 (104), CD69
and enriched for bead-bound cells on magnetized Single-cell RNA sequencing analysis or 1 mg of anti–IL-5 monoclonal antibody (clone
columns. Sequence reads were processed and aggregated TRFK5, BioXCell) or rat IgG1 isotype control
using Cell Ranger software. Aggregated data were (clone TNP6A7, BioXCell), or 1 mg of anti–IL-18
RNA-sequencing and further analyzed using Seurat (55). monoclonal antibody [clone SK113AE-4 (57)] or
transcriptome analysis isotype control by i.p. injection 1 day before skin
T cells were isolated by flow cytometric cell sorting Confocal microscopy injury.
from the ear skin tissue of C57BL/6 mice 2 weeks Ear pinnae were split with forceps, fixed in 1%
after colonization with S. epidermidis NIHLM087. paraformaldehyde in PBS (Electron Microscopy Total tissue RNA-seq
Groups included: TC1 (Viable Lineage−CD45+ Sciences) overnight at 4°C, and blocked in 1% A ~1-mm skin region surrounding the wound
CD90.2+TCRb+CD8b+CCR6−) and TC17 cells (Viable BSA + 0.25% Triton X in PBS for 2 hours at room site was microdissected at indicated time points
Lineage−CD45+CD90.2+TCRb+CD8b+CCR6+). temperature. Tissues were first stained with anti- after wounding, submerged in RNAlater (Sigma-
Sorted cells were lysed in Trizol reagent and CD4 (RM4-5, eBioscience), anti-CD8a (clone 53- Aldrich), and stored at −20°C. Total tissue RNA
total RNA isolated by phenol-chloroform extrac- 6.7, eBioscience), anti-CD45.1 (A20, eBioscience), was isolated from skin tissue using the RNeasy
tion with GlycoBlue as a co-precipitant (7 mg per anti-CD49f (GoH3, eBioscience), and/or anti-GFP Fibrous Tissue Mini kit (Qiagen), as per manu-
sample; Life Technologies). Single-end libraries (A21311, Life Technologies) antibodies overnight facturer’s instructions. A 3′ mRNA sequencing
were prepared with 0.25 to 1 mg of total RNA at 4°C, washed three times with PBS and then library was prepared using 200 to 500 ng of total
using the TruSeq RNA Sample Preparation Kit stained with 4,6-diamidino-2-phenylindole (DAPI, input RNA with the QuantSeq 3′ mRNA-Seq
V2 and sequenced for 50 cycles with a HiSeq Sigma-Aldrich) overnight before being mounted Library Prep Kit FWD for Illumina (Lexogen) as
2500 instrument (4 to 6 samples multiplexed with ProLong Gold (Molecular Probes) antifade per manufacturer’s instructions. Libraries were
per lane; Illumina). Sequencing quality of the reagent. Ear pinnae images were captured on a quantified using an Agilent Tapestation (High
raw read data was assessed using FASTQC Leica TCS SP8 confocal microscope equipped Sensitivity D1000 ScreenTape) and Qubit (Thermo
8. V. K. Ridaura et al., Contextual control of skin immunity and responses. Nat. Immunol. 14, 372–379 (2013). doi: 10.1038/ 53. H. Xu et al., FastUniq: A fast de novo duplicates removal tool
inflammation by Corynebacterium. J. Exp. Med. 215, 785–799 ni.2552; pmid: 23475182 for paired short reads. PLOS ONE 7, e52249 (2012).
(2018). doi: 10.1084/jem.20171079; pmid: 29382696 31. N. Gagliani et al., Th17 cells transdifferentiate into regulatory doi: 10.1371/journal.pone.0052249; pmid: 23284954
9. J. M. Schenkel, D. Masopust, Tissue-resident memory T cells. T cells during resolution of inflammation. Nature 523, 221–225 54. S. Heinz et al., Simple combinations of lineage-determining
Immunity 41, 886–897 (2014). doi: 10.1016/ (2015). doi: 10.1038/nature14452; pmid: 25924064 transcription factors prime cis-regulatory elements
j.immuni.2014.12.007; pmid: 25526304 32. K. Nakanishi, T. Yoshimoto, H. Tsutsui, H. Okamura, required for macrophage and B cell identities. Mol. Cell
10. D. E. Wright, A. J. Wagers, A. P. Gulati, F. L. Johnson, Interleukin-18 regulates both Th1 and Th2 responses. 38, 576–589 (2010). doi: 10.1016/j.molcel.2010.05.004;
I. L. Weissman, Physiological migration of hematopoietic stem Annu. Rev. Immunol. 19, 423–474 (2001). doi: 10.1146/ pmid: 20513432
and progenitor cells. Science 294, 1933–1936 (2001). annurev.immunol.19.1.423; pmid: 11244043 55. A. Butler, P. Hoffman, P. Smibert, E. Papalexi, R. Satija,
doi: 10.1126/science.1064081; pmid: 11729320 33. O. J. Harrison et al., Epithelial-derived IL-18 regulates Th17 cell Integrating single-cell transcriptomic data across
11. J. M. Kim, J. P. Rasmussen, A. Y. Rudensky, Regulatory T cells differentiation and Foxp3+ Treg cell function in the intestine. different conditions, technologies, and species. Nat.
prevent catastrophic autoimmunity throughout the lifespan of Mucosal Immunol. 8, 1226–1236 (2015). doi: 10.1038/ Biotechnol. 36, 411–420 (2018). doi: 10.1038/nbt.4096;
mice. Nat. Immunol. 8, 191–197 (2007). doi: 10.1038/ni1428; mi.2015.13; pmid: 25736457 pmid: 29608179
pmid: 17136045 34. N. Arpaia et al., A Distinct Function of Regulatory T Cells in 56. B. E. Keyes et al., Impaired Epidermal to Dendritic T Cell
12. E. A. Wohlfert et al., GATA3 controls Foxp3+ regulatory T cell Tissue Protection. Cell 162, 1078–1089 (2015). doi: 10.1016/ Signaling Slows Wound Repair in Aged Skin. Cell 167,
fate during inflammation in mice. J. Clin. Invest. 121, j.cell.2015.08.021; pmid: 26317471 1323–1338.e14 (2016). doi: 10.1016/j.cell.2016.10.052;
4503–4515 (2011). doi: 10.1172/JCI57456; pmid: 21965331 35. R. R. Ricardo-Gonzalez et al., Tissue signals imprint ILC2 pmid: 27863246
13. M. Delacher et al., Genome-wide DNA-methylation landscape identity with anticipatory function. Nat. Immunol. 19, 57. M. Lochner, H. Wagner, M. Classen, I. Förster, Generation of
defines specialization of regulatory T cells in tissues. 1093–1099 (2018). doi: 10.1038/s41590-018-0201-4; neutralizing mouse anti-mouse IL-18 antibodies for inhibition of
Nat. Immunol. 18, 1160–1172 (2017). doi: 10.1038/ni.3799; pmid: 30201992 inflammatory responses in vivo. J. Immunol. Methods 259,
pmid: 28783152 36. S. A. Eming, T. A. Wynn, P. Martin, Inflammation and metabolism in 149–157 (2002). doi: 10.1016/S0022-1759(01)00505-1;
14. Y. Wang, M. A. Su, Y. Y. Wan, An essential role of the tissue repair and regeneration. Science 356, 1026–1030 (2017). pmid: 11730850
transcription factor GATA-3 for the function of regulatory doi: 10.1126/science.aam7928; pmid: 28596335
T cells. Immunity 35, 337–348 (2011). doi: 10.1016/ 37. J. Zhu et al., Conditional deletion of Gata3 shows its essential AC KNOWLED GME NTS
j.immuni.2011.08.012; pmid: 21924928 function in T(H)1-T(H)2 responses. Nat. Immunol. 5, 1157–1165 We thank the National Institute of Allergy and Infectious Diseases
15. D. Rudra et al., Transcription factor Foxp3 and its protein (2004). doi: 10.1038/ni1128; pmid: 15475959 (NIAID) animal facility staff; K. Holmes, E. Stregevsky, and
◥ Results
RESEARCH ARTICLE Syt3 is on postsynaptic
plasma membranes
To examine the location of Syt3, we developed
NEUROSCIENCE a highly specific antibody (fig. S1, A and B) that
recognized a single band in brain homogenates,
synapse strength, and forgetting striatum (fig. S1D). Expression in the brain began
embryonically and remained high throughout
adulthood (fig. S1E). Immunostains revealed Syt3
Ankit Awasthi1*, Binu Ramachandran1*, Saheeb Ahmed1†, Eva Benito2,3, Yo Shinoda1‡, signal on neuronal cell bodies and dendrites in
Noam Nitzan1, Alina Heukamp1§, Sabine Rannio1, Henrik Martens4, Jonas Barth2,3, the CA1 (Fig. 1B), CA3, and dentate gyrus (fig. S1F)
Katja Burk1, Yu Tian Wang5, Andre Fischer2,3, Camin Dean1¶ in wild-type, but not Syt3 knockout, hippocam-
pal slices.
Forgetting is important. Without it, the relative importance of acquired memories in a To localize Syt3 subcellularly, we expressed
changing environment is lost. We discovered that synaptotagmin-3 (Syt3) localizes to cytosolic green fluorescent protein (GFP) in cul-
postsynaptic endocytic zones and removes AMPA receptors from synaptic plasma tured hippocampal neurons and immunostained
A
of Syt3 signal was at excitatory synapses (fig.
fundamental property of the brain is the GluA2-containing AMPA receptors from the plas- S1G), and 29.4 ± 1.9% was at inhibitory synapses
ability to learn from experience by mod- ma membrane (8, 12, 13). Ca2+ influx into den- (P < 0.001) (fig. S1H). In subcellular fractions,
ulating the strength of synaptic connec- drites is critical for virtually all types of synaptic Syt3 was associated with synaptosomal plasma
tions between neurons. The trafficking of plasticity (4), including decay of LTP (14, 15) and membranes and not with synaptic vesicles (fig. S1I),
AMPA receptors to and from the surface active internalization of GluA2-containing AMPA which is in agreement with a previous report (20).
of postsynaptic membranes is a key determinant receptors (16, 17). The same signaling entity can Immuno-organelle isolation of synaptic vesicles
in the regulation of synaptic strength (1–3). High- have divergent consequences for the synapse: Fast, with antibodies to Syt1 or Syb2 further confirmed
frequency stimulation increases surface recep- high [Ca2+] influx can promote LTP, whereas that Syt3 is not present on synaptic vesicles (fig. S1J).
tors and promotes long-term potentiation (LTP) gradual, low [Ca2+] influx can promote LTD (4). We further tested whether Syt3 is specifically local-
of synaptic strength. Low-frequency stimulation Plasma membrane–localized Ca2+-binding pro- ized to postsynaptic membranes using a trypsin
removes receptors from the postsynaptic mem- teins are likely needed to remove or add receptors cleavage assay of synaptosomes (26). Synapto-
brane and causes long-term depression (LTD) of to the postsynaptic membrane through regulated somes form in such a way that the presynaptic
synaptic strength. This phenomenon has been endo- or exocytosis. Synaptotagmins (Syts) are terminal seals, trapping synaptic vesicles and
most extensively studied in N-methyl-D-aspartate candidates for such a function (18). This family other presynaptic components inside (Fig. 1E),
(NMDA)–receptor–dependent plasticity of CA3- of integral membrane proteins contain a short whereas the postsynaptic membrane does not re-
CA1 synapses in the hippocampus (4). LTP is luminal tail, transmembrane domain, and two seal. Presynaptic proteins were therefore protected
widely believed to underlie learning (5–7). Con- conserved cytoplasmic Ca2+-binding C2 domains from trypsin cleavage, whereas postsynaptic pro-
versely, weakening of potentiated synapses, and (19) that regulate Ca2+-dependent membrane re- teins, including Syt3, were cleaved (Fig. 1F).
LTD, can promote forgetting (5, 8, 9). cycling events.
Both LTD (10, 11) and the decay of LTP depend Of the 17 mammalian Syt isoforms, Syt3 is the Stimulation induces endocytosis of Syt3
on activity-dependent removal of postsynaptic third most abundant in the brain. Unlike Syt1 The presence of Syt3 on postsynaptic membranes
and Syt2, which are predominantly thought to be suggests it may regulate a post-synaptic re-
1
Trans-synaptic Signaling Group, European Neuroscience localized to synaptic vesicle membranes, Syt3 was cycling event. Time-lapse imaging of pHluorin-
Institute, 37077 Goettingen, Germany. 2German Center for reported to be localized to the plasma membrane Syt3 in transfected hippocampal neurons during
Neurodegenerative Disease, 37075 Goettingen, Germany. (20, 21) and to have a 10-fold higher Ca2+ affinity depolarization with 45 mM KCl (23) or field stim-
3
Department of Psychiatry and Psychotherapy, University
Medical Center Goettingen, 37075 Goettingen, Germany.
than that of Syt1 and Syt2 (22). In a pHluorin-Syt ulation revealed a calcium-dependent fluores-
4
Synaptic Systems GmbH, 37079 Goettingen, Germany. 5Brain screen of Syt isoforms in response to stimulation, cence decrease, requiring NMDA/AMPA receptors
Research Center and Department of Medicine, University of Syt3 exhibited distinct recycling properties: It was and L-type calcium channels, likely corresponding
British Columbia, Vancouver, BC V6T2B5, Canada. the only isoform to endocytose in response to to endocytosis (fig. S2, A to D). PHluorin-Syt3 also
*These authors contributed equally to this work.
†Present address: Department of Diagnostic and Interventional
stimulation and to recycle exclusively in den- exhibited calcium-dependent endocytosis in re-
Radiology, University Medical Center Goettingen, 37075 Goettingen, drites (23). Because the kinetics of stimulus- sponse to AMPA (Fig. 2A) and NMDA (Fig. 2B)—
Germany. induced pHluorin-Syt3 endocytosis resembled stimuli that promote AMPA receptor internalization
‡Present address: Department of Environmental Health, School of those of pHluorin-GluA2 (24, 25), we hypothe- —with kinetics similar to those of pHluorin-tagged
Pharmacy, Tokyo University of Pharmacy and Life Sciences, Tokyo
192-0392 Japan. §Present address: Department of Neurobiology,
sized that Syt3 may regulate Ca2+- and activity- AMPA receptors (24, 25).
Weizmann Institute of Science, 7610001 Rehovot, Israel. dependent postsynaptic receptor endocytosis to Because interpretation of pHluorin experiments
¶
Corresponding author. Email: c.dean@eni-g.de affect synaptic plasticity. may be confounded by intracellular acidification
tr
´
´
´
´
´
´
´
´
´
´ of the GluA2 C-terminal tail (Fig. 2F) (1). Syt3
no
10
20
30
60
90
no
10
20
30
60
90
A B
0s 100 s 300 s 0s 100 s 300 s
intensity (%)
intensity (%)
intensity (%)
100 100 100 100
80 80 80 80
60 60 60 60
40 40 40 40
20 20 20 20
0 50 100 0 50 100
0 time (s) 0 time (s)
0 100 200 300 0 100 200 300
time (s) time (s)
1.0
0.5
NMDA
0.0
AM trl
PA
A
D
c
M
N
D Homer-GFP / CLC-DsRed GFP-Syt3 / CLC-DsRed GFP-Syt3 / Homer-myc
E F
+
–
ut
t3
t3
inp
Sy
Sy
GluN2A
G H
a 2+
µM +
C
00 a 2
0 a 2+
GABAARα1
µM
10 M C
.
EG rl.
10 C
trl
10 +
ct
0
.c
µM
a2
TA
10
t
pu
g.
pu
AP-2
C
ne
ne
in
in
Fig. 2. Syt3 endocytoses in response to stimulation and binds GluA2, GFP-Syt3/CLC-Dsred; 34/18 GFP-Syt3/Homer-myc from three cultures).
AP-2, and BRAG2. (A) pHluorin-Syt3 endocytoses in response to Scale bars, 5 mm. (E) Recombinant Syt3 C2AB pulls down GluA2, AP2, and
stimulation with AMPA or NMDA (B) in 2 mM calcium (left), but not in the BRAG2 from brain homogenates. Syt3– is beads only. (F). Binding sites,
absence of calcium (right) [n; ROI/neurons/cultures, AMPA 2 mM Ca2+ 37/ on the GluA2 C-terminal tail, of proteins implicated in receptor recycling
7/3 (left); 0 and 2 mM Ca2+ 42/6/3 (right); NMDA, 2 mM Ca2+ 35/3/3 and tested in pull downs. (G) Calcium-dependence of Syt3 C2AB pull
(left); 0 and 2 mM Ca2+ 40/3/3 (right)]. NH4Cl dequenches internalized down of GluA2, AP2, and BRAG2 from brain homogenate. In 0 Ca2+
pHluorin-Syt3 fluorescence. Scale bars, 5 mm. (C) GFP-Syt3 expressed conditions, brains were homogenized and solubilized in calcium-free
in Syt3 knockout hippocampal neurons internalizes in response to buffer, but endogenous buffered calcium in internal stores remains.
stimulation with AMPA and NMDA (n = 28, 25, and 26 neurons per 2 Addition of EGTA eliminates any potential effects of these additional
cultures for control, AMPA, and NMDA, respectively; one-way ANOVA, sources of calcium. (H) Western blot of GluA2 pulled down from brain
Tukey’s test). (D) GFP-Syt3 colocalizes with CLC (clathrin light chain)– homogenate by Syt3 C2AB in 100 mM calcium with or without
Dsred at postsynaptic endocytic zones, and not with Homer-myc preincubation with 1 mM Tat-GluA2-3Y peptide. Negative controls are
at PSDs (n; ROI/neurons, 34/20 Homer-GFP/CLC-DsRed; 29/19 beads only.
receptors [Fig. 3, A to C, and fig. S4, A to D; Syt3 Syt3 does not affect basal transmission wild-type and Syt3 knockout cultures and again
short hairpin RNA (shRNA) knockdown valida- We found no change in miniature excitatory found no difference in mEPSC amplitude or
tion is provided in fig. S4, E and F]. Manipulation postsynaptic current (mEPSC) amplitude, fre- frequency (frequency P = 0.2671; t test, Welch’s
of Syt3 did not affect surface versus internal quency, or decay time in Syt3 overexpressing correction) (fig. S5, E to G). After stimulation,
receptors in basal conditions. Syt3 knockout or knockdown neurons compared with GFP- however, mEPSC amplitude decreased in wild-
neurons yielded similar results; GluA2 receptors transfected controls (decay time GFP, 2.3 ± 0.2 ms; type but not in Syt3 knockout neurons, and this
were internalized in response to AMPA and GFP-Syt3, 2.1 ± 0.2 ms; Syt3 KD, 1.9 ± 0.2 ms) effect was rescued by reintroducing GFP-Syt3
NMDA stimulation in wild-type neurons but (fig. S5, A to D), further confirming that post- postsynaptically into knockout neurons (fig. S5H),
not in Syt3 knockout neurons or in wild-type synaptic Syt3 does not affect surface receptor confirming a lack of stimulation-induced inter-
neurons treated with the Tat-GluA2-3Y peptide number in basal conditions. To exclude pre- nalization of synaptic AMPA receptors in Syt3
(Fig. 3, D and E, and fig. S4G). synaptic effects, we also compared mEPSCs in knockouts.
A control AMPA
GFP GFP-Syt3 Syt3 KD Syt3 Ca2+ mut GFP GFP-Syt3 Syt3 KD Syt3 Ca2+ mut
EGFP
B C *
* *** **
2.0 * 2.0 GFP
*** GFP-Syt3
internal / surface GluA2
** ** Syt3 KD
1.5 *** 1.5 *** Syt3 Ca2+ mut
* *
1.0 ** 1.0
**
0.5 0.5
0.0 0.0
control AMPA NMDA control AMPA NMDA
D control AMPA E *
2.0
WT Syt3 KO WT Syt3 KO WT+GluA2-3Y **
internal / surface GluA2
1.5
surface
GluA2
WT
Syt3 KO
WT+ 3Y
1.0
internal
GluA2
0.5
0.0
control AMPA NMDA
Fig. 3. Syt3 internalizes AMPA receptors in response to stimulation. 64/69 ctrl, 68/46 AMPA, 28/47 NMDA; GFP-Syt3, 46/65 ctrl, 46/47 AMPA,
(A) Hippocampal neurons transfected with GFP, GFP-Syt3, Syt3 knockdown 23/43 NMDA; Syt3 KD, 51/41 ctrl, 69/38 AMPA, 23/24 NMDA; Syt3 Ca2+ mut,
(Syt3 KD), or Syt3 calcium-binding deficient mutant (Syt3 Ca2+ mut) 42/37 ctrl, 28/36 AMPA, 27/31 NMDA from six cultures). (D and E)
constructs in control and AMPA-stimulated conditions, immunostained for Stimulation-induced GluA2 internalization is abolished in Syt3 knockout
surface and internalized GluA2 receptors. (B) Stimulation-induced GluA2 and neurons, and in WTneurons treated with the Tat-GluA2-3Y peptide (n; Syt3 KO/
GluA1 (C) internalization is increased by overexpression of GFP-Syt3 and WTneurons, 31/29 ctrl, 24/22 AMPA, 18/17 NMDA; WT+GluA2-3Y, 18 AMPA,
blocked by Syt3 KD or Syt3 Ca2+ mut (n; neurons for GluA2/GluA1; GFP, from four cultures). Scale bars, 10 mm; two-way ANOVA, Dunnett’s test.
Basal synaptic transmission was also unchanged increased potentiation in Syt3 knockouts com- When the platform was shifted to the opposite
in Syt3 knockouts. Recordings of synaptic re- pared with wild-type slices (Fig. 4G). quadrant in reversal training, Syt3 knockout
sponses from CA1 neurons, elicited by Schaffer To test whether calcium-sensing by post- mice learned the new platform position as well
collateral stimulation in acute hippocampal synaptic Syt3 is important for receptor internal- as did wild-type mice in the probe test (probe test
slices, displayed no change in NMDA/AMPA, ization in these plasticity paradigms, we injected 3) (Fig. 5, B, C, and D) but continued to persevere
g-aminobutyric acid (GABA)/AMPA, or GABA/ wild-type or calcium-binding–deficient mutant to the original platform position during reversal
NMDA receptor–mediated response ratio in Syt3 Syt3 AAV1/2 postsynaptically into the dorsal CA1 training (fig. S7G) and in the probe test after
knockout compared with wild-type neurons region of the hippocampus of mice in which Syt3 reversal (Fig. 5F), exhibiting a lack of forgetting
(fig. S5, I to L). There was also no change in the had been knocked out (Syt3 knockout mice) of the previous platform position.
AMPA EPSC decay time (wild type, 19.4 ± 4 ms; (Fig. 4H). We found that LTD (Fig. 4I), decaying In a fourth cohort, we extended the training
knockout, 21.9 ± 4.6 ms) or GABA inhibitory 1XTET-induced LTP (Fig. 4J), and ZIP-mediated days after reversal (fig. S7H). Syt3 knockout mice
postsynaptic current (IPSC) decay time (wild type, decay of 3XTET LTP (Fig. 4K) were rescued by persevered to the previous platform position sig-
76 ± 4.9 ms; knockout, 58.8 ± 7 ms). In addition, expression of wild-type Syt3 but not calcium- nificantly more than did wild-type mice, even
we found no change in stimulus intensity versus binding–deficient Syt3. after 7 days of reversal training (Fig. 5G). Injec-
fEPSP (field excitatory postsynaptic potential) tion of Syt3 AAV1/2 specifically into the dorsal
slope or fiber volley amplitude (fig. S5, M and Syt3 knockout mice learn normally but CA1 (postsynaptic) region of the hippocampus
N) and no change in paired pulse ratio (fig. S5O), have impaired forgetting of Syt3 knockout mice rescued this perseverence
suggesting that Syt3 does not affect the number Because Syt3 knockout mice had normal LTP but phenotype, compared with Syt3 knockout or wild-
of synaptic inputs from CA3 onto CA1 neurons or lacked LTD, we hypothesized that they would type mice injected with control GFP AAV1/2
short-term presynaptic plasticity. learn normally but have deficits in forgetting. To (Fig. 5G).
test this, we used the water maze spatial memory To test whether the lack of forgetting exhibited
fEPSP (mV/ms) %
hippocampal slices (n; slices/mice, 12/8 Syt3
fEPSP (mV/ms) %
KO, 8/6 WT, and 8/5 WT + Tat-GluA2-3Y); 100 125
***P < 0.001 for Syt3 KO/WT; **P < 0.05 for WT
+GluA2-3Y/WT. (B) 1XTET-induced LTP is rein- 75 100
forced in Syt3 KO slices compared with WT
(n = 10/7 Syt3 KO, 10/10 WT); **P < 0.05. 50 Syt3 KO 75 Syt3 KO
1 µM GluA2-3Y WT
(C) 1XTET-induced LTP in WT slices treated with WT
WT + GluA2-3Y
the Tat-GluA2-3Y peptide is reinforced and 25 50
-20 0 20 40 60 80 -30 0 30 60 90 120
ZIP-insensitive (n = 7/7). (D) Reinforced 1XTET- time (min) time (min)
induced LTP in Syt3 KOs is unchanged by the C D
Tat-GluA2-3Y peptide and is ZIP-insensitive 5 mV
5 mV 5 ms
(n = 6/6 Syt3 KO, 7/7 Syt3 KO + GluA2-3Y 1 µM ZIP
200 5 ms 150
peptide, 7/7 Syt3 KO + ZIP). (E) 3XTET-induced 1 µM ZIP
fEPSP (mV/ms) %
175
fEPSP (mV/ms) %
LTP is unchanged in Syt3 KO compared with 125
WT (n = 6/6). (F) 3XTET-induced LTP in Syt3 150
KOs is ZIP-insensitive (n = 6/6); **P < 0.01. 125 100
(G) fEPSP changes in Syt3 KO and WT slices
100 1 µM GluA2-3Y Syt3 KO
induced by different stimulation frequencies, 75
WT + GluA2-3Y Syt3 KO + GluA2-3Y
fEPSP (mV/ms) %
175 175
fEPSP (mV/ms) %
WT
140 ** 5 mV
AAV-Syt3-P2A-GFP 5 ms
120 CA1
100
1 µM ZIP
fEPSP (mV/ms) %
175
fEPSP (mV/ms) %
125
150
100 125
100
75 Syt3 KO + WT Syt3
75 Syt3 KO + WT Syt3
Syt3 KO + Ca2+ mut Syt3 Syt3 KO + Ca2+ mut Syt3
50 50
-20 0 20 40 60 80 100 120 0 60 120 180 240
time (min) time (min)
in subsequent probe tests gives a readout of that (i) Syt3 knockout mice would exhibit a lack type of Syt3 knockouts; and (iii) injection of the
spatial memory. We tested four groups simulta- of forgetting—persevere more to the original GluA2-3Y peptide in Syt3 knockout mice would
neously: wild-type mice and Syt3 knockout mice, hole after reversal as compared with wild-type; have no effect on their lack of forgetting.
injected with saline or GluA2-3Y peptide, during (ii) disruption of Syt3:GluA2 interaction through In initial training, all four groups (injected
“reversal” training to a new hole after initial injection of the GluA2-3Y peptide in wild-type intraperitoneally daily with saline only, 1 hour
learning of an original hole position. We predicted mice would mimic the lack of forgetting pheno- before training) learned the target hole equally
A B C D
platform crossings
45 70 50 16
WT cohort 2
* 14
KO
PT1
PT2
60
PT3
40
40 50 12
40 30 10
35 8
30 20 6
30 20
10 4
10 2
25 0 0 0
PT1 PT2 PT3 PT1 PT2 PT3 PT1 PT2 PT3
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Days
E F
PT2:0-10s 10-20s 20-30s 30-40s 40-50s 50-60s 0-60s WT PT3 WT
WT
45
proximity to
40
Syt3 KO
Syt3 KO
40
30
35
20 30
s
0
-6
10
50
G H I
Day 22 Syt3 KO + GFP PT2:10-20s 50-60s 0-60s WT + sal. PT5 WT + sal.
KO + 3Y WT + 3Y WT+ sal.
WT + 3Y WT + 3Y
KO + 3Y WT + 3Y WT+ sal.
WT + GFP
KO + 3Y KO + 3Y
WT
Syt3 KO + Syt3
**
proximity to original platform (cm)
% time original TQ
40 50
*
***
45
45
40
35 30
35 40
30
20
35
25 25
30 10
20
15 25 0
s
s
17
18
19
20
21
22
23
60
-2
Days
10
50
PT1-2
KO + sal.
100 KO + sal.
KO + 3Y
* KO + 3Y
0.8 * 0.8 *
Day 8-13 perseverence
75
** *
PT4-6 perseverence
Day 8-13
50 0.6 0.6
25 0.4 0.4
PT4-6
0
0.2 0.2
1
2
3
PT1
4
5
6
7
PT2
8
9
10
11
PT3
12
13
PT4
PT5
PT6
Fig. 5. Syt3 knockout mice learn as well as wild-type mice but have KO+GFP, and 15 WT+GFP). (H) Injection of the Tat-GluA2-3Y peptide mimics
impaired forgetting. (A) Syt3 KO and WT mice had similar proximity to the the lack of within-trial-extinction in probe test 2 after initial training, and
platform during training (genotype effect, P = 0.1052; two-way ANOVA, (I) perseverence to the previous platform position in probe tests after reversal
Bonferroni’s test) and in probe tests exhibited similar percent of time in training, exhibited by Syt3 knockouts (n = 8 WT saline, 7 WT+3Y, and 10 Syt3
(B) target quadrant, (C) proximity to platform, and (D) platform crossings. KOs KO+3Y); one-way ANOVA, Bonferroni’s correction. (J) All mice learned
in cohort 1 had lower proximities than those of WT in probe tests (P = 0.027; (decreased latency to) the escape hole in the Barnes maze equally well during
Student’s t test). (E) Syt3 KO mice lack within-trial-extinction in time-binned training (two-way ANOVA, Tukey’s test) and (K) (top) in probe tests 1 and 2
average occupancy plots of all mice and proximity to the platform position after training. (Middle) In reversal training and (bottom) probe tests 4 to 6 after
(red in schematics) in probe test 2. (F) Syt3 KO mice persevere to the previous reversal training, WT saline mice learned the new hole position (red), but
platform position (orange) in the probe test after reversal training (to the WT+3Y, KO saline, and KO+3Y mice persevered to the previous hole position
red platform position) (n = 9/13 Syt3 KO and 10/14 WT mice for cohort (orange). (L) WT+3Y, KO saline, and KO+3Y mice had a higher perseverence
1/cohort 2); Student’s t test, Welch’s correction in (B), (C), (E), and (F) and ratio [time spent exploring original hole (orange) divided by total time spent
Mann-Whitney U test in (D). (G) Expression of Syt3 in the hippocampal exploring original and reversal (red) holes] as compared with that of WT
CA1 region rescues the perseverence phenotype of Syt3 KOs in training after saline mice (n = 10 WT saline, 11 WT+3Y, 11 Syt3 KO saline, 12 Syt3 KO+3Y;
reversal; two-way ANOVA, Tukey’s test. Black, red, and blue asterisks are P = 0.060 for WT saline/Syt3 KO+3Y in probe tests 4 to 6); one-way ANOVA,
significance between WT+GFP/Syt3 KO+Syt3, Syt3 KO+GFP/WT+GFP, and Bonferroni’s correction. All occupancy plots show average search path
Syt3 KO+GFP/Syt3 KO+Syt3, respectively (n = 10 Syt3 KO+Syt3, 7 Syt3 densities across all mice in a group.
well (Fig. 5J) and spent the majority of their time original hole region as compared with wild-type memory in the delayed matching to place (DMP)
exploring the target hole region in probe tests saline-injected mice throughout reversal training water maze task, in which the platform position
(Fig. 5K, top). Beginning on the day of probe test (Fig. 5K, middle) and in probe tests after reversal is moved to a new position each day (42). Each
2 and during reversal training, in which the training (Fig. 5, K, bottom, and L), which is in day, the mice have four trials to learn the new
target hole was positioned in a different quad- agreement with our prediction. platform position and forget the previous plat-
rant, mice were injected with saline or GluA2-3Y form position. We first trained the mice to a
peptide 1 hour before training each day. Saline- Syt3 knockouts have impaired working visible platform for 3 consecutive days, in which
injected Syt3 knockout mice and GluA2-3Y- memory owing to lack of forgetting Syt3 knockout and wild-type mice performed
injected wild-type and Syt3 knockout mice all To further test deficits in forgetting exhibited equally well (fig. S8A). Because swimming speed
showed a similar increased perseverence to the by Syt3 knockout mice, we examined working of Syt3 knockout mice was again faster than that
Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Day 8 Day 9 Day 10 Day 11 Day 12 Day 13 Day 14 Day 15 Day 16
proximity savings (cm)
B WT Syt3 KO C
Day 4
40
% Trials classified as perseverance
to previous day’s platform position
WT
Syt3 KO
30
Day 6
20
Day 9
10
0
Day 14
10
11
12
13
14
15
16
1
2
3
4
5
6
7
8
9
V1
V2
V3
Training Day
D
WT
Day 16
Syt3 KO
Training Day
proximity norm.
V1
V2
V3
10
11
12
13
14
15
16
1
2
3
4
5
6
7
8
9
to WT (cm)
Probe test
0
-2
-4 * * * *
-6
Fig. 6. Syt3 knockout mice show deficits in the delayed matching to trials averaged across all mice on training days, and in the probe test after
place task because of impaired forgetting. (A) WT mice had a closer training, reveal impaired forgetting in Syt3 KO mice—higher perseverence to
proximity to the platform in trials 2 to 4 relative to trial 1 (higher proximity previous days’ platform positions as compared with that of WT. In maze
savings) as compared with that of Syt3 KO mice, indicating that Syt3 KOs had schematics, the current day’s platform is red, the previous day’s is orange, and
deficits in finding the platform when it appeared in a new position each day. the platform position 2 days previous is yellow. (C) Syt3 KOs have significantly
Hidden platform positions presented each day are indicated above the graphs. more perseverence trials compared with those of WT in strategy analysis (P =
Blue-outlined mazes indicate counter-balancing, in which half the cohort is 0.0383; unpaired t test, Welch’s correction). (D) In the probe test on day 16,
trained to one of the positions and the other half is trained to the other Syt3 KO mice persevere more (have closer proximity as compared with WT) to
position, to avoid biased search of inner- or outer-platform positions (n = 14 all previous positions. V1, V2, and V3 indicate visible platform training days;
Syt3 KO and 20 WT mice); Student’s t test. (B) Occupancy plots of individual two-way ANOVA for genotype effect, P < 0.0001; Bonferroni’s test, *P < 0.05.
of wild-type mice (fig. S8B), we quantified prox- PICK1 could sequester receptors internally after formaldehyde and immunostained with primary
imity savings in hidden platform training endocytosis (44) and act downstream of Syt3. antibodies, followed by secondary labeling with
(Fig. 6A). In the first 4 days of training, mice Alternatively, PICK1 could transiently bind GluA2 Alexa dyes for confocal imaging.
became accustomed to the task. In the second and then AP-2 after stimulation, to cluster AMPA Hippocampi from P0 mouse brains were dis-
4-day block, mice had learned the task, and wild- receptors at endocytic zones and promote their sected in ice cold dissection medium (HBSS (Gibco),
type mice performed significantly better than subsequent internalization (45). Thus, it is also 20 mM HEPES (Gibco), 1.5 mM CaCl2, 10 mM
Syt3 knockouts. In the third block, from day 10 possible that PICK1 acts upstream of or in concert MgCl2, pH adjusted to 7.4 with NaOH) and
onward, the intertrial interval between trial 1 and with Syt3 to bring GluA2 to endocytic zones. then incubated in a papain digestion solution
trial 2 was increased from 5 to 75 min, and wild- Blockade of postsynaptic expression of Syt1/ (dissection medium, 0.2 mg/ml L-Cysteine, 0.5 mM
type mice continued to perform better than Syt3 Syt7 was recently reported to abolish LTP but NaEDTA, 1 mM CaCl2, 3 mM NaOH, 1% Papain
knockout mice; this difference was most pro- have no effect on LTD (18). Thus, distinct Syts equilibriated in 37°C and 5% CO2 + 0.1 mg/ml
nounced in the fourth 4-day block of training may insert and remove receptors from the post- DNAseI) for 30 min at 37°C and 5% CO2. Papain
(Fig. 6A). Quantitation of escape latency savings synaptic membrane to mediate LTP and LTD, was inactivated with serum medium [DMEM,
(fig. S8D) and path savings (fig. S8E) yielded respectively. Syts may regulate both exo- and 2 mM Glutamax, 5% FBS, 1X Mito+ supplements
similar results. To test whether the poor perform- endocytosis (46) but be predisposed to one or (VWR), 0.5X MEM vitamins (Gibco)] + 2.5 mg/ml
ance of Syt3 knockouts was due to difficulty the other depending on their calcium affinity. BSA + 0.1 mg/ml DNAseI, followed by 3 washes
forgetting previous platform positions, we exam- Endocytosis occurs on slower time scales than with serum medium. After trituration in serum
ined perseverance to previous positions. Occu- does exocytosis. As calcium concentration de- medium, the cell suspension was centrifuged for
pancy plots indicated that Syt3 knockouts indeed clines, high-affinity Syts such as Syt3 (22) may 5 min at 500 × g at room temperature. The cell pellet
persevered to previous platform positions more remain active, whereas low-affinity Syts such was resuspended in plating medium (Neurobasal
than did wild-type mice throughout training and as Syt1 inactivate. Alternatively, Syts predisposed medium, 100 U/ml Pen/Strep, 2% B27, 0.049 mM
then incubating for an additional 20 min, before Daniel Choquet (30) (University of Bordeaux). pH 7.4 with NaOH) with 10 strokes at 900 rpm.
adding the mixture to wells of a 24-well plate. The calcium-binding deficient mutant of Syt3 was Samples were then centrifuged at 1000 × g for
generated by Genscript by mutagenesis of D386, 10 min. The supernatant (S1) was collected; the
Immunohistochemistry 388N and D520, 522 N, corresponding to the resulting pellet (P1) contains large cell frag-
Acute hippocampal slices were prepared from calcium-binding sites of syt1: D230, 232 N and ments and nuclei. S1 was then centrifuged at
8-week-old mice anesthetized with isoflurane D363, 365 N (48). Syt3 shRNA knockdown con- 15,000 × g for 15 min. The supernatant (S2) con-
and decapitated. The hippocampus was removed structs, transfected in equal amounts, were KD1; tains soluble proteins and the pellet (P2) contains
and 200 mm thick slices were cut transversely TGCTGTTGACAGTGAGCGACAAGCTCATCGGT- synaptosomes. The pellet was then carefully
using a tissue chopper (Stoelting) in ice-cold CAGATCAATAGTGAAGCCACAGATGTATTGAT- resuspended in 1 ml homogenization buffer, 9 ml
artificial cerebrospinal fluid (ACSF) containing, CTGACCGATGAGCTTGGTGCCTACTGCCTCGGA, ice-cold ddH20 was added and three strokes at
in mM 124 NaCl, 4.9 KCl, 1.2 KH2PO4, 2 MgSO4, KD2; TGCTGTTGACAGTGAGCGCAGGTGTCAA- 2,000 rpm were performed. 50 ml 1M HEPES and
2 CaCl2, 24.6 NaHCO3, and 10 D-glucose (saturated GAGTTCAACGAATAGTGAAGCCACAGATGTA- protease inhibitors were added. The lysate was
with 95% O2 and 5% CO2, pH 7.4, ~305 mOsm). TTCGTTGAACTCTTGACACCTATGCCTACTGC- centrifuged at 17,000 × g for 25 min to separate
Slices were fixed in 4% paraformaldehyde in PBS CTCGGA and KD3; TGCTGTGACAGTGAGCCAG synaptosomal membranes (LP2) from synapto-
for 30 min and washed 3 X 20 min in PBS. After GATTGTCAGAGAAAGAGAATAGTGAAGCCACA- somal cytosol (LS2). The LP2 pellet was resus-
washing, slices were incubated in antibody buffer GATGTATTCTCTTTCTCTGACAATCCTTTGCC- pended in 6 ml 40 mM sucrose and layered over a
(2% donkey serum, 0.1% Triton X-100 and 0.05% TACTGCCTCGGA in a pGIPZ vector co-expressing continuous sucrose gradient from 50 mM to
NaN3 in PBS) for 30 min at room temperature. turboGFP (Thermo Scientific Openbiosystems). 800 mM. The sucrose cushion was then centri-
Then slices were incubated with primary anti- fuged at 28,000 rpm for 2 hours. Following centri-
bodies in antibody buffer overnight at 4°C. Slices Receptor internalization assays fugation, the region between approximately
were then washed with PBS 3 X 20 min and Neurons were labeled with primary extracellular 200 mM and 400 mM sucrose was collected
4°C. The pellet was resuspended in 320 mM sucrose, custom-made recording chamber in extracellular Apparatus, cat. no. 300060, 1.5 mm OD, 0.86 mm
5 mM HEPES, pH 8. For trypsin cleavage, a solution containing, in mM: 142 NaCl, 2.5 KCl, 10 ID) using a P-97 puller (Sutter Inst, Novato, CA).
0.1 mg/ml trypsin stock solution was added to HEPES, 10 D-Glucose, 2 CaCl2, 1.3 MgCl2 (295 P12-P17 male and female mouse pups were
yield a final protein-protease ratio of 100:1. Synap- mOsm, pH adjusted to 7.2 with NaOH). The anesthetized with isoflurane (Abbott, Wiesbaden,
tosomes were incubated for 10, 20, 30, 60, or temperature of the bath was maintained at 30 Germany), decapitated, and the brain extracted
90 min at 30°C with gentle agitation. This mix- to 32°C. To record miniature excitatory post- and transferred to cold NMDG buffer containing
ture was then centrifuged for 3 min at 8700 × g, synaptic currents (mEPSCs), 1 mM TTX (to block (in mM) 45 NMDG, 0.33 KCl, 0.4 KH 2PO 4 ,
and the resulting pellet resuspended in sucrose action potentials) and 50 mM picrotoxin (to inhibit 0.5 MgCl2, 0.16 CaCl2, 20 choline bicarbonate,
buffer containing 400 mM Pefabloc (Roche) to GABAA receptors) was added to the extracellular 12.95 glucose. 300 mm coronal hippocampal
stop trypsin cleavage activity. Samples were then solution. An Olympus upright BX51WI microscope slices were made with a Leica VT1200 vibratome
analyzed by SDS-PAGE and immunoblotting. equipped with a 40X water-immersion objective, (Wetzlar, Germany) and a stainless steel blade
fluorescent light source (Lumen 200Pro, Prior (Feather) in ice cold NMDG buffer. Slices were
AAV preparation and Scientific), and filters for GFP fluorescence imaging transferred to a preincubation chamber with a
hippocampal injections were used to visualize neurons transfected with mesh bottom filled with ACSF containing (in mM)
AAV ESYN-GFP-P2A-Syt3 or calcium-binding defi- GFP, GFP-Syt3 or Turbo GFP-expressing Syt3 124 NaCl, 4.4 KCl, 1 NaH2PO4, 26.2 NaHCO3, 1.3
cient mutant Syt3 (D386, 388N, and D520, 522N) knockdown constructs. Patch pipettes were pulled MgSO4, 2.5 CaCl2, and 10 D-Glucose, bubbled with
constructs were synthesized and subcloned by from borosilicate glass (1.5 mm OD, 0.86 mm ID, 95% O2/5% CO2 (carbogen) and incubated at 35°C
Genscript, and AAV1/2 viral particles prepared 3 to 6 megohms) using a P-97 micropipette puller for 0.5 hours followed by another 0.5 hours at room
by transfecting 10 cm dishes of 70-80% confluent (Sutter Instruments). The internal solution con- temperature. Hippocampi were then dissected
HEK293 cells with 12.5 mg of viral construct con- tained, in mM: 130 K-gluconate, 10 NaCl, 1 EGTA, using a Zeiss Stemi 2000 stereoscopic microscope.
taining Syt3 or calcium-binding deficient mutant 0.133 CaCl2, 2 MgCl2, 10 HEPES, 3.5 Na2-ATP,1 Na- A cut perpendicular to the CA3 pyramidal cell
EPSC is considered to be purely NMDA receptor- All experimenters were blinded to genotype. Mice tracking data was analyzed using Matlab to
mediated, since the measured AMPA receptor were individually housed at the European Neuro- extract time-tagged xy-coordinate information
EPSC decay time constant t ≈ 20 ms. The input science Institute Göttingen, Germany animal and quantify escape latency, platform crossings,
and series resistance (Rs) were monitored every facility in standard environmental conditions proximity [mean distance of all tracked path
10 s. Recordings where Rs was > 25 megohms or (temperature, humidity), with ad libitum access points to platform center, which is reported to be
changed by more than ± 20% during recording to food and water and a 12 hours light/dark cycle. the most reliable parameter to quantify spatial
were excluded from analysis. Input resistances Mice were allowed to habituate to different hold- specificity of water maze search patterns (41)],
ranged from 100 to 400 megohms and did not ing rooms for behavioral experiments for two percent time spent in target quadrant, and aver-
change by more than ± 20% during the course of weeks before testing, and to experimenters for at age swimming speed. Occupancy plots were
the recording. Matlab was used to calculate cur- least three days before experiments . All experi- generated by super-imposing all path points
rent ratios and decay times. ments were performed during the light cycle. Video of all mice in a group. Densities of path points
tracking was done with the TSE monitoring system (normalized to total number of path points in a
Extracellular recordings from acute Videomot2. All behavioral experiments were ap- group of mice) within a grid size of 2.1 cm × 2.1 cm
hippocampal slices proved under project number G15.1794 by the (43) were calculated. Density data was smoothened
Acute hippocampal slices were prepared from Niedersächsisches Landesamt für Verbraucherschutz and interpolated to plot heat maps (Scattercloud
8 to 12-week-old male mice anesthetized with und Lebensmittelsicherheit (LAVES, Lower function, Matlab File ID 6037). Occupancy plot
isoflurane and decapitated. The hippocampus Saxony, Germany). color maps were linearly scaled using the global
was removed and 400 mm thick dorsal hippo- minimum and maximum densities for all groups,
campal slices were cut transversely using a tissue Open field, elevated plus maze to allow comparison between them. The last 0.5 s
chopper (Stoelting) in ice-cold artificial cerebro- In the open field test, mice were introduced near of the trial, when mice were on the platform and
spinal fluid (ACSF) containing, in mM: 124 NaCl, the wall of an empty, opaque square plexiglas not searching, was excluded in occupancy plots
from the pool center (11 in an outer ring and 5 in an ≥50% of path points inside wider wall zone did not perform in the Barnes maze, but still
inner ring) over 16 days. Mice underwent 4 trials of starting 0.75 X pool radius; Random Search strat- received saline (maximum volume injected, 10 ml
2 min every day. The platform was shifted to a new egy: % pool area scanned ≥50%. 0.9% NaCl/g body weight) or GluA2-3Y (5 mmol/kg
random position every day in a different quadrant body weight) i.p. injections.
alternating between inner and outer rings as much Barnes Maze Three-point (head, center, tail) tracking data
as possible. A trial ended when the mouse spent at The Barnes maze consisted of a white circular was exported into Matlab for further analysis.
least 2 s on the platform, after which they were left platform made of plexiglass, 92cm in diameter, Occupancy plots were generated using Matlab as
on the platform for 15 s and then returned to their with 20 equally spaced holes (5 cm in diameter) described above for the water maze, except that
home cage. Mice were warmed with infrared along the perimeter. The platform was elevated head instead of center coordinates were used.
lamps after every trial. The drop-off points with 40 cm above the ground. An escape chamber Video tracking errors in which head and tail
respect to the platform position of that day were (15.5 × 9 × 6 cm3) was placed under one of the coordinates were erroneously swapped (mostly
in a random order. Mice were divided into two holes, defined as the target hole. To encourage close to hole regions) were detected by a distance
groups for counterbalancing in which each group mice to enter the escape chamber, it contained a threshold and excluded. Mice that did not find
experienced different alternations of platform plastic ramp to enable the mice to climb into it the original target hole in either of the first two
positions between inner and outer rings, to and an odorless paper towel, resembling nesting probe tests (did not learn the target hole) were
prevent non-spatial chaining search strategies material. Before every trial, urine was removed excluded from analysis of perseverance after
in which mice search for platforms within a with Kimwipes, and the arena was cleaned with reversal. Target area was defined as the area of
certain distance of the pool wall. Inter-trial water and 70% EtOH to eliminate olfactory cues. the target hole and its two neighboring holes
intervals were 5 min; from day 10 onwards, the For each trial a mouse was placed onto the mid- using center tracked coordinates, for calculation
inter-trial interval between trial 1 and trial 2 dle of the maze, such that the target hole was not of the perseverance ratio (time spent in reversal
was increased to 1 hour 15 min. Trial 2 on day distinguishable from any other hole and the target area divided by total time spent in original
12. P. V. Migues et al., PKMzeta maintains memories by regulating potentiation. Neuron 63, 92–105 (2009). doi: 10.1016/ 47. G. A. Banker, W. M. Cowan, Rat hippocampal neurons in
GluR2-dependent AMPA receptor trafficking. Nat. Neurosci. 13, j.neuron.2009.05.025; pmid: 19607795 dispersed cell culture. Brain Res. 126, 397–42 (1977).
630–634 (2010). doi: 10.1038/nn.2531; pmid: 20383136 31. M. Rosendale, D. Jullié, D. Choquet, D. Perrais, Spatial and doi: 10.1016/0006-8993(77)90594-7; pmid: 861729
13. Z. Dong et al., Long-term potentiation decay and memory loss temporal regulation of receptor endocytosis in neuronal 48. J. Rizo, T. C. Südhof, C2-domains, structure and function of a
are mediated by AMPAR endocytosis. J. Clin. Invest. 125, dendrites revealed by imaging of single vesicle formation. universal Ca2+-binding domain. J. Biol. Chem. 273,
234–247 (2015). doi: 10.1172/JCI77888; pmid: 25437879 Cell Reports 18, 1840–1847 (2017). doi: 10.1016/ 15879–15882 (1998). doi: 10.1074/jbc.273.26.15879;
14. M. Y. Xiao, Y. P. Niu, H. Wigström, Activity-dependent decay of j.celrep.2017.01.081; pmid: 28228251 pmid: 9632630
early LTP revealed by dual EPSP recording in hippocampal 32. S. H. Lee, L. Liu, Y. T. Wang, M. Sheng, Clathrin adaptor AP2 49. A. Bhalla, M. C. Chicka, E. R. Chapman, Analysis of the
slices from young rats. Eur. J. Neurosci. 8, 1916–1923 (1996). and NSF interact with overlapping sites of GluR2 and play synaptotagmin family during reconstituted membrane fusion.
doi: 10.1111/j.1460-9568.1996.tb01335.x; pmid: 8921282 distinct roles in AMPA receptor trafficking and hippocampal Uncovering a class of inhibitory isoforms. J. Biol. Chem. 283,
15. D. M. Villarreal, V. Do, E. Haddad, B. E. Derrick, NMDA receptor LTD. Neuron 36, 661–674 (2002). doi: 10.1016/S0896-6273 21799–21807 (2008). doi: 10.1074/jbc.M709628200;
antagonists sustain LTP and spatial memory: Active processes (02)01024-3; pmid: 12441055 pmid: 18508778
mediate LTP decay. Nat. Neurosci. 5, 48–52 (2002). 33. W. Lu et al., Subunit composition of synaptic AMPA receptors 50. U. Frey, R. G. Morris, Weak before strong: Dissociating synaptic
doi: 10.1038/nn776; pmid: 11740500 revealed by a single-cell genetic approach. Neuron 62, tagging and plasticity-factor accounts of late-LTP.
16. M. D. Ehlers, Reinsertion or degradation of AMPA receptors 254–268 (2009). doi: 10.1016/j.neuron.2009.02.027; Neuropharmacology 37, 545–552 (1998). doi: 10.1016/
determined by activity-dependent endocytic sorting. Neuron 28, pmid: 19409270 S0028-3908(98)00040-9; pmid: 9704995
511–525 (2000). doi: 10.1016/S0896-6273(00)00129-X; 34. J. W. Lin et al., Distinct molecular mechanisms and divergent
pmid: 11144360 endocytotic pathways of AMPA receptor internalization. AC KNOWLED GME NTS
17. E. C. Beattie et al., Regulation of AMPA receptor endocytosis Nat. Neurosci. 3, 1282–1290 (2000). doi: 10.1038/81814; We thank R. Morris for recommendations of intertrial intervals in
by a signaling mechanism shared with LTD. Nat. Neurosci. 3, pmid: 11100149 the DMP task, H. Urbanke for the Barnes maze protocol, and
1291–1300 (2000). doi: 10.1038/81823; pmid: 11100150 35. Z. Dong et al., Hippocampal long-term depression mediates J. Schrader for technical assistance. Funding: This work was
18. D. Wu et al., Postsynaptic synaptotagmins mediate AMPA spatial reversal learning in the Morris water maze. supported by a Sofja Kovalevskaja grant from the Alexander von
receptor exocytosis during LTP. Nature 544, 316–321 (2017). Neuropharmacology 64, 65–73 (2013). doi: 10.1016/ Humboldt Foundation, European Research Council (ERC) starting
doi: 10.1038/nature21720; pmid: 28355182 j.neuropharm.2012.06.027; pmid: 22732443 grant SytActivity FP7 260916, and Deutsche
19. R. B. Sutton, B. A. Davletov, A. M. Berghuis, T. C. Südhof, 36. S. Sajikumar, S. Navakkode, J. U. Frey, Identification of Forschungsgemeinschaft (DFG) grants DE1951/1 and -3 and the
S. R. Sprang, Structure of the first C2 domain of compartment- and process-specific molecules required for Center for Nanoscale Microscopy and Molecular Physiology of the
P
addition to the expression of the AP genes, we
opulation growth, increasing global afflu- oxygenation of RuBP by RuBisCO, which becomes designed a long hairpin RNA interference (RNAi)
ence, and an expanding bioeconomy are more prevalent at higher temperatures and under construct and added it to the library of multigene
conspiring to increase mid-century agri- drought conditions (6, 7). Toxic by-products of the constructs to reduce the expression of the chloro-
cultural demand by 60 to 120% over 2005 RuBisCO oxygenation reaction (2-phosphoglycolate plast glycolate-glycerate transporter PLGG1 with
levels, a challenge that current rates of crop and glycolate) and of the glycine decarboxylation the goal of minimizing glycolate flux out of the
productivity improvement averaging <2% per reaction (ammonia) are recycled by photorespi- chloroplast and into the native pathway (Fig. 1 and
year cannot meet (1–3). In the 45 years after ration into nontoxic products but at the expense table S1) (18, 19). In total, we successfully trans-
1960, global crop productivity increased 135% of energy and net loss of fixed carbon (6, 7). Some formed 17 different constructs of the three AP
from 1.84 to 3.96 metric tons per hectare (4). photosynthetic algae, bacteria, and plants have designs into tobacco with and without the in-
The increased use of pesticides, fertilizers and evolved mechanisms to reduce the oxygenation clusion of an RNAi module targeting the PLGG1
irrigation, and mechanization, along with the reaction by RuBisCO via carbon-concentrating transporter.
adoption of higher-yielding crop varieties that mechanisms (CCMs), including C4 photosynthesis
drove this remarkable global increase in produc- (8, 9), inspiring efforts to introduce CCMs into C3 Gene and protein analysis
tivity, are now largely optimized for major crops plants (8–12). Here we have taken an alterna- confirm chloroplast-localized
and are unlikely to generate sufficient yield in- tive approach of introducing non-native and transgene expression
creases to meet mid-century agricultural demand. synthetic metabolic pathways to recycle the pro- Transgene expression analysis conducted on three
However, photosynthetic efficiency remains stand- ducts of RuBisCO oxygenation more efficiently independent transformants of each AP design
ing as a determinant of yield potential with the (13). Previously, two alternative photorespiratory selected for further analysis confirmed strong
improvement capacity to double crop producti- pathways implemented in Arabidopsis improved expression of the transgenes along with ~80%
vity (1–3, 5, 6). In C3 crops such as wheat, rice, photosynthesis and plant size in chamber and RNAi suppression of PLGG1 expression (Fig. 1B
and soybeans, photorespiration reduces the pho- greenhouse experiments (14, 15). These results and fig. S1). Immunoblot analysis of whole-cell
tosynthetic conversion efficiency of light into inspired us to optimize these alternative photo- extract was normalized on the basis of total pro-
biomass by 20 to 50%, with the largest losses respiratory pathways in tobacco, a useful agri- tein content and verified using antibodies against
occurring in hot dry climates where yield in- cultural model crop, for field trials. Computer the RuBisCO large subunit and actin (fig. S2).
creases are sorely needed. Whereas ribulose-1,5- modeling of these alternative pathways revealed Immunoblot analysis of isolated intact chlo-
bisphosphate carboxylase-oxygenase (RuBisCO) the importance of optimized expression of non- roplasts from AP3 plants (Fig. 1C) verified that
carboxylates ribulose-1,5-bisphosphate (RuBP) dur- native genes to achieve maximum flux through the construct design of AP3 directs CrGDH and
ing photosynthesis, the unproductive and energy- the alternative pathway and thus maximize the MS protein to the chloroplast and that RNAi
intensive process of photorespiration results from benefits for crop plants under field conditions suppresses expression of the PLGG1 transporter
(16). Additionally, we sought to minimize flux protein. The cytoplasmic marker protein actin
1
Global Change and Photosynthesis Research Unit, United through the native photorespiratory pathway and was undetectable in the isolated chloroplast frac-
States Department of Agriculture–Agricultural Research
Service, Urbana, IL 61801, USA. 2Carl R. Woese Institute for
maximize flux through the introduced pathways tion, ensuring that the AP3 proteins in the chloro-
Genomic Biology, University of Illinois, Urbana, IL 61801, USA. by inhibiting glycolate export from the chloroplast. plast fraction was not a result of cytoplasmic
3
Department of Crop Sciences, University of Illinois, Urbana, IL contamination (Fig. 1C). Moreover, the chloro-
61801, USA. 4Department of Plant Biology, University of Illinois, Results plast marker PGL35 was only faintly detectable
Urbana, IL 61801, USA. Transgene assembly
*Present address: Department of Plant and Microbial Biology,
in the whole-leaf extracts but was greatly en-
University of California, Berkeley, CA 94720, USA. We transformed Nicotiana tabacum cv. Petite riched in the isolated chloroplast fraction (Fig.
†Corresponding author. Email: d-ort@illinois.edu Havana (tobacco) with three different photores- 1C). Whereas MS was also greatly enriched in the
events 200-4 and 200-6 revealed that CrGDH and tron transport (Jmax) in any AP design (fig. S6). from increased mesophyll conductance (gm; i.e., the
MS expression was greatly reduced compared Increases in Vcmax, which is a property of RuBisCO diffusion of CO2 into mesophyll cell chloroplasts)
to transgenic events 200-8,9,10 (fig. S5B). enzymatic activity, could be due to increased or from the direct release of photorespiratory
RuBisCO protein content or increased availabil- CO2 in the chloroplast by the decarboxylation of
AP3 plants have an altered
Fig. 4. Photorespiratory and AP3 metabolic intermediates. (A to F) Relative amount of the indicated
metabolite detected from ~40 mg of leaf tissue (fresh weight; FW) sampled in the late morning.
photorespiratory flux can enhance photosyn- timistic that use of alternative metabolic path- chamber (fig. S1). The light levels were increased
thetic rate and plant growth. Overexpression of ways to photorespiration will also lead to increases to 1200 mmol m−2 s −1 for 24 hours and [CO2] was
the H-protein in the glycine decarboxylase com- in seed yield. Indeed, in this work, the observed maintained below 38 mbar (fig. S1). For PLGG1
plex or overexpression of plant glycolate oxidase stimulation of whole-plant biomass production RNAi-only plants, which have strongly depressed
(GO) can lead to increased photosynthesis and was much larger than the stimulation of photo- photorespiratory capacity, T1 lines were germi-
biomass production (30, 31). In both of these re- synthesis on a leaf area basis (5 to 8% increase in nated on soil under elevated [CO2] conditions
ports, the overexpression of these photorespira- CO2 assimilation resulting in 25 to 41% increase for 9 days and transferred to ambient air for 3 days
tion genes was accompanied by an increase in in dry-weight biomass; compare Fig. 6A with Fig. prior to screening. Fv′/Fm′ was determined on
stomatal conductance that itself would be ex- 6, D and E), showing the benefit of compound each plate using the CF Imager Technologica
pected to increase photosynthesis and growth interest from creating greater leaf area earlier in (http://www.technologica.co.uk/). Maximum flash
under water-replete conditions. Conversely, four the growth cycle. intensity was 6800 mmol m−2 s−1 for 800 ms. Image
different photorespiration mutants (pglp1, shm1, values were obtained for each individual plant by
hpr1, and glyk1) partially lost stomatal respon- Materials and Methods detecting colonies within the fluorimager soft-
siveness to altered CO2 availability, possibly in- Plant genetic transformation ware program defining each position as described
dicating that alternative pathways could influence Nicotiana tabacum cv. Petite Havana was genet- (19, 22, 40).
plant adaptation through stomatal signaling (32). ically transformed using Agrobacterium tume-
We saw no statistical differences in stomatal con- faciens strain C58C1-mediated transformation Gene expression and protein detection
ductance (fig. S15, A and B) or the expression of (37). The 17 binary plasmids used in this study Plants were grown under greenhouse or field
GO (fig. S15C) in AP3 tobacco plants, indicating were assembled as described and listed in table conditions as described below. Five leaf discs
that neither of these contributed to the stimula- S1 (19). AP1 genes originated from E. coli (14). were harvested from three plants per line (2.9 cm2,
tions observed in AP3 plant lines. Whether the AP2 genes originated from Arabidopsis thaliana ~100 mg). RNA and protein were extracted from
modifications following (42). Leaf tissue was col- Growth analysis (greenhouse) (Asat) was determined at 1200 mmol m−2 s−1 light
lected from 6-week-old WT and AP3 plants, Homozygous single-insert T2 seeds were germi- intensity at the indicated [CO2]. Leaf and stem
briefly homogenized in extraction buffer [50 mM nated on LC1 Sunshine mix (Sun Gro 202 Horti- biomass were determined for 16 plants per plot
MES-NaOH (pH 6.1), 0.33 M sorbitol, 2 mM EDTA, culture, Agawam, MA, USA). Ten days after at 7 weeks post planting. Aboveground biomass
2 mM MgCl2, 1 mM MnCl2, 20 mM NaCl, 2 mM germination, seedlings were transferred to 4L was harvested and separated into leaf and stem
isoascorbic acid, and 1% polyvinypyrrolidone- pots (400C, Hummert International, Earth City, fractions. Plant material was dried at 65°C to
40], filtered through three layers of Miracloth MO, USA) with LC1 Sunshine mix supplemented constant weight for a minimum of 2 weeks prior
(Calbiochem), and centrifuged at 4°C for 4 min with slow-release fertilizer (Osmocote Plus 15/9/ to biomass measurements.
at 2500g to pellet chloroplasts. Pelleted chloro- 12, The Scotts Company LLC, Marysville, OH, To increase the statistical power of the field
plasts were resuspended in 5 ml of buffer [50 mM USA). Pots were randomized within the green- experiment, the 2017 growing season focused on
HEPES-NaOH (pH 6.8), 0.33 M sorbitol, 2 mM house and positions were changed before each six independent transgenic AP3 lines. The field
EDTA, 2 mM MgCl2, 1 mM MnCl2, 5 mM iso- watering approximately every 4 to 5 days. Green- design consisted of five replicate blocks with
ascorbic acid, 1 mM sodium pyrophosphate, 5 mM house growth conditions are tabulated in sup- seven randomized 6 × 6 plants plots per block
glutathione] using a fine paintbrush, applied to a plementary dataset 12. Aboveground biomass was (fig. S11). The central 16 plants were the AP3
20-ml Percoll density gradient [top to bottom: harvested and dried for 2 weeks to attain constant transgenic line or WT surrounded by a WT
40% (v/v) and 90% (v/v) Percoll in resuspension weight, and dry weights determined for stem and border. The entire 35 plot-area was surrounded
buffer], and centrifuged at 4°C for 30 min at leaf fractions. Stem fractions included reproduc- by an additional row of WT as a border. Single-
2500g. Intact chloroplasts accumulated at the tive material developed at time of final harvest. insert homozygous T2 lines generated from the
40 to 90% interface and were removed by aspira- same harvest time were sown on LC1 Sunshine
tion, washed twice in 10 volumes of resuspension Field experiments mix and germinated for 7 days. After 7 days,
buffer, and collected by centrifugation for 10 min In 2016, five independent transformation events seedlings were transplanted to floating trays as
photosynthesis reached steady state and then Sci. U.S.A. 107, 12052–12057 (2010). doi: 10.1073/ photosystem II by suppression of repair but not acceleration of
measured at 150, 120, 90, 70, 50, and 30 mbar pnas.0914216107; pmid: 20551223 damage processes in Arabidopsis. Plant Physiol. 144, 487–494
5. E. A. Ainsworth, S. P. Long, What have we learned from (2007). doi: 10.1104/pp.107.097253; pmid: 17400706
CO2 under light intensities of 250, 165, 120, 80,
15 years of free-air CO2 enrichment (FACE)? A meta-analytic 25. R. M. Benstein et al., Arabidopsis phosphoglycerate
and 50 mmol m−2 s−1. The x-intersection point review of the responses of photosynthesis, canopy dehydrogenase1 of the phosphoserine pathway is essential for
was converted to Ci* according to (29). properties and plant production to rising CO2. New Phytol. development and required for ammonium assimilation and
To determine the net photosynthetic assimila- 165, 351–371 (2005). doi: 10.1111/j.1469-8137.2004.01224.x; tryptophan biosynthesis. Plant Cell 25, 5011–5029 (2013).
pmid: 15720649 doi: 10.1105/tpc.113.118992; pmid: 24368794
tion rate from a CO2 dose response, the fifth leaf
6. H. Bauwe, M. Hagemann, A. R. Fernie, Photorespiration: 26. C. J. Bernacchi, E. L. Singsaas, C. Pimentel, A. R. Portis Jr.,
from the base of 7-week-old N. tabacum plants Players, partners and origin. Trends Plant Sci. 15, 330–336 S. P. Long, Improved temperature response functions for
was measured using a Li-Cor 6800 infrared gas (2010). doi: 10.1016/j.tplants.2010.03.006; pmid: 20403720 models of Rubisco‐limited photosynthesis. Plant Cell Environ.
analyzer (Li-Cor Biosciences, Lincoln, NE, USA) 7. C. Peterhansel, I. Horst, M. Niessen, C. Blume, R. Kebeish, 24, 253–259 (2001). doi: 10.1111/j.1365-3040.2001.00668.x
with leaf temperature controlled at 25°C and S. Kürkcüoglu, F. Kreuzaler, Photorespiration. The Arabidopsis 27. D. Tholen, G. Ethier, B. Genty, S. Pepin, X. G. Zhu,
Book, e0130 (2010). Variable mesophyll conductance revisited: Theoretical
light intensity set at 1500 mmol m−2 s −1. Leaves 8. G. D. Price et al., The cyanobacterial CCM as a source of genes background and experimental implications. Plant Cell Environ.
were acclimated at a [CO2] of 400 mbar to achieve for improving photosynthetic CO2 fixation in crop species. 35, 2087–2103 (2012). doi: 10.1111/j.1365-3040.2012.02538.x;
a steady-state rate of assimilation. The [CO2] of J. Exp. Bot. 64, 753–768 (2013). doi: 10.1093/jxb/ers257; pmid: 22590996
the response curve was set at 400, 200, 100, 50, pmid: 23028015 28. B. J. Walker et al., Uncertainty in measurements of the
9. U. Schlüter, A. P. Weber, The road to C4 photosynthesis: photorespiratory CO2 compensation point and its impact on
30, 400, 600, 800, 1000, 1500, 2000 mbar, and Evolution of a complex trait via intermediary states. models of leaf photosynthesis. Photosynth. Res. 132, 245–255
measurements were taken when assimilation Plant Cell Physiol. 57, 881–889 (2016). doi: 10.1093/pcp/ (2017). doi: 10.1007/s11120-017-0369-8; pmid: 28382593
reached a steady state rate. To determine the pcw009; pmid: 26893471 29. B. J. Walker, D. C. Skabelund, F. A. Busch, D. R. Ort, An
maximum rate of carboxylation (Vcmax) and max- 10. M. Matsuoka, R. T. Furbank, H. Fukayama, M. Miyao, Molecular improved approach for measuring the impact of multiple CO2
engineering of C4 photosynthesis. Annu. Rev. Plant Physiol. conductances on the apparent photorespiratory CO2
imum electron transport rate (Jmax), a model for Plant Mol. Biol. 52, 297–314 (2001). doi: 10.1146/annurev. compensation point through slope-intercept regression.
leaf photosynthesis with temperature corrections arplant.52.1.297; pmid: 11337400 Plant Cell Environ. 39, 1198–1203 (2016). doi: 10.1111/
membranes. Bio Protoc. 5, e1405 (2015). doi: 10.21769/ ACKN OWLED GMEN TS included in the article that is credited to a third party; obtain
BioProtoc.1405 We thank D. Drag and B. Harbaugh for plant care and management authorization from the rights holder before using such material. Author
43. J. Kromdijk et al., Improving photosynthesis and crop in the greenhouse and field studies; and N. Ferrari, R. Field, contributions: P.F.S, D.R.O, and A.P.C. designed experiments; P.F.S,
productivity by accelerating recovery from photoprotection. G. Lambruschini, J. Ayers, M. Oraweic, R. Devries, R. Gossens, A.P.C., and H.W.L performed experiments; and P.F.S, D.R.O, A.P.C.,
Science 354, 857–861 (2016). doi: 10.1126/science.aai8878; K. Brown, R. Edquilang, and C. Keller for assistance during laboratory and H.W.L analyzed data and wrote the manuscript. Competing
pmid: 27856901 and field work. We thank M. Balasubmaranian for tobacco interests: The authors declare no competing interests Data materials
44. A. Brooks, G. D. Farquhar, Effect of temperature on the transformation. We thank C. Benjamin for graphic design. We also availability: The data reported in this paper have been tabulated in
CO2/O 2 specificity of ribulose-1,5-bisphosphate thank E. Ainsworth, S. Long, B. Walker, and R. Slattery for critical review the supplementary materials. Plants and constructs reported are
carboxylase/oxygenase and the rate of respiration in the light: of the manuscript. Funding: This work is supported by the research available from the University of Illinois for research purposes, subject to
Estimates from gas-exchange measurements on spinach. project Realizing Increased Photosynthetic Efficiency (RIPE) that is the conditions of the Uniform Biological Material Transfer Agreement.
Planta 165, 397–406 (1985). doi: 10.1007/BF00392238; funded by the Bill & Melinda Gates Foundation, Foundation for Food
pmid: 24241146 SUPPLEMENTARY MATERIALS
and Agriculture Research, and the Department for International
45. A. Laisk, Kinetics of photosynthesis and photorespiration in C3 Development under grant no. OPP1172157. This work is licensed under www.sciencemag.org/content/363/6422/eaat9077/suppl/DC1
plants. Nauka, Moscow (in Russian) (1977). a Creative Commons Attribution 4.0 International (CC BY 4.0) license, Figs. S1 to S15
46. S. von Caemmerer, J. R. Evans, Temperature responses of which permits unrestricted use, distribution, and reproduction in any Table S1 to S3
Data S1 to S20
mesophyll conductance differ greatly between species. medium, provided the original work is properly cited. To view a copy of
Plant Cell Environ. 38, 629–637 (2015). doi: 10.1111/pce.12449; this license, visit https://creativecommons.org/licenses/by/4.0/. This 17 April 2018; accepted 20 November 2018
pmid: 25224884 license does not apply to figures/photos/artwork or other content 10.1126/science.aat9077
Dynamic response and hydrodynamics interaction rules (19). A different strategy for
predicting collective motion ignores the individ-
ual interaction rules and instead describes the
of polarized crowds large-scale motions in creature groups as spon-
taneous flows of active materials (20–23). Exist-
ing active hydrodynamic theories successfully
Nicolas Bain* and Denis Bartolo*
account for a host of emergent patterns found in
assemblies of microscopic motile bodies such as
Modeling crowd motion is central to situations as diverse as risk prevention in mass events
swimming bacteria (24, 25), cell tissues (26–28),
and visual effects rendering in the motion picture industry. The difficulty of performing
and synthetic self-propelled particles (29–31). The
quantitative measurements in model experiments has limited our ability to model
success of the hydrodynamic approach has been
pedestrian flows. We use tens of thousands of road-race participants in starting corrals to
limited to microscopic bodies, and observations
elucidate the flowing behavior of polarized crowds by probing its response to boundary
of large-scale creature groups have not been quan-
motion. We establish that speed information propagates over system-spanning scales
titatively described hydrodynamically.
through polarized crowds, whereas orientational fluctuations are locally suppressed.
To establish an active hydrodynamic descrip-
Building on these observations, we lay out a hydrodynamic theory of polarized crowds and
M
onstrate that information propagates over system-
esmerizing impressions of virtually all response to physical, social, or biological imper- spanning scales in the form of hybrid waves
patterns observed in bird flocks, fish atives, however, remains a formidable challenge. combining density and speed fluctuations in this
schools, insect swarms, and even human Predictive models of collective motion have been polarized crowd. Guided by the spectral proper-
crowds are effectively rendered in silico developed following two opposite strategies. One ties of the velocity waves, we build on conserva-
by simple algorithms (1, 2). Going be- strategy identifies local interaction rules be- tion laws and symmetry principles to construct a
yond visual impressions and predicting the col- tween individuals (3). This method has been predictive theory of pedestrian flows without
lective dynamics of groups of living creatures in successful, to some extent, for some animal resorting to any behavioral assumption.
explicit symmetry breaking. The variations of an^ depends in principle on the local crowd phenomenologically constructed in the spirit of a
with q around a⊥ , however, are consistent with a density, velocity, and orientation (32). Pedes- Landau expansion. At lowest order in gradients,
quadratic increase of the form a⊥ þ DðqÞq2 (32) trians are polar bodies, and we classically the frictional body force is given by
(Fig. 3H). Such variations suggest that interac- quantify the level of local alignment between
tions between pedestrians penalize deformations the individuals by a polarization field pðr; tÞ F ðfrg; fngÞ ¼ G∥ ½n n0 ðrÞ x̂ þ Oð∇Þ ð2Þ
of the flow field as would viscosity in a Newtonian (20). In (32), we built on a systematic theoret-
fluid or orientational elasticity in polar active ical framework to simplify this hydrodynamic and represents the self-propulsion mechanism
fluids (36). description. In short, we take advantage of three of the polarized crowd. The density-dependent
The consistency between data collected from robust key observations. First, given the mea- speed n0 ðrÞ quantifies the active frictional force
four different crowd-gathering events hints sured densities, the crowd is far from a jammed driving the flow along x ̂ , and G∥ is a friction
toward a unified hydrodynamic description of regime (15, 17). We therefore ignore elastic coefficient that constrains the longitudinal veloc-
density and speed excitations. We elucidate the stresses arising from contact interactions. Sec- ity fluctuations to relax in a finite time. In the
dynamical response quantified in Fig. 2 and ond, the local direction of the flow, n̂ , quickly hydrodynamic limit, momentum conservation
Fig. 3 from this perspective without resorting relaxes toward the local orientation p̂ . Simply and Eq. 2 therefore the fundamental
reduce to
to any behavioral assumption (32). Mass con- put, queuing pedestrians do not walk sideways. relation nðr; tÞ ¼ n0 rðr; tÞ þ Oð∇Þ (32). This
servation gives the first hydrodynamic equation: Third, the crowd is strongly polarized; all in- relation explains two of our main experimental
dividuals align toward the x ̂ direction. In the findings. It shows that the fast variable n in-
@t r þ ∇ ðrnÞ ¼ 0 ð1Þ
hydrodynamic limit, we can therefore safely herits the slow dynamics of the conserved den-
Momentum conservation, at lowest order in assume p̂ =n̂ =x ̂ . This simplification does not sity field, and it readily implies that the density
gradients, reduces to the balance between the allow the description of orientational fluctua- of static queuing crowds self-adjusts to a con-
local rate of change of momentum and the fric- tions, which we explain in (32). It conveys, stant value r0 ¼ n1 0 ð0Þ (Fig. 1C). In the limit of
is the crowd longitudinal compressibility (32). We show that reorienting the direction of mo- 21. R. L. Hughes, Annu. Rev. Fluid Mech. 35, 169–182 (2003).
Together with mass conservation, this con- tion of a polarized crowd at once is impossible 22. R. Ni, J. G. Puckett, E. R. Dufresne, N. T. Ouellette,
Phys. Rev. Lett. 115, 118104 (2015).
stitutive relation defines the analog of the Navier- when relying only on locally accessible signals. 23. R. Ni, N. T. Ouellette, Phys. Biol. 13, 045002 (2016).
Stokes equations for polarized crowds: Orientational cues must be provided to the en- 24. H. Wioland, F. G. Woodhouse, J. Dunkel, J. O. Kessler,
tire assembly to change its direction of motion. R. E. Goldstein, Phys. Rev. Lett. 110, 268102 (2013).
0 r0 b 2 We also predict the time it takes to set in mo- 25. H. H. Wensink et al., Proc. Natl. Acad. Sci. U.S.A. 109,
@t v þ r0 n0 ðr0 Þ@x v @ v¼0 ð3Þ 14308–14313 (2012).
G∥ x tion, or to stop, a crowd of a given extent by 26. G. Duclos et al., Nat. Phys. 14, 728–732 (2018).
providing information at its boundary. Beyond 27. T. B. Saw et al., Nature 544, 212–216 (2017).
Equations 1 and 3 effectively predict the dy- these predictions, the description of crowds as 28. S. Banerjee, K. J. C. Utuje, M. C. Marchetti, Phys. Rev. Lett. 114,
namical response we observed in our experi- continua should be useful to elucidate their re- 228101 (2015).
29. A. Zöttl, H. Stark, J. Phys. Condens. Matter 28, 253001
ments. The linear stability analysis of Eqs. 1 and sponse to large-amplitude perturbations and their (2016).
3 readily shows that polarized crowds support transitions from flowing liquids to amorphous 30. A. Morin, D. Bartolo, Phys. Rev. X 8, 021037 (2018).
unidirectional and nondispersive speed wave prop- solids, two situations where crowd dynamics be- 31. D. Geyer, A. Morin, D. Bartolo, Nat. Mater. 17, 789–793
0
agating downstream at a speed c0 ¼ r0 n0 ðr0 Þ. come hazardous. (2018).
32. Materials and methods are available as supplementary
Equations 1 and 3 also predict that their damp- materials.
ing rate varies as q2x , in agreement with our RE FERENCES AND NOTES
33. D. Helbing, A. Johansson, J. Mathiesen, M. H. Jensen,
experimental measurements (Fig. 3, E and F). 1. C. W. Reynolds, ACM SIGGRAPH Computer Graphics, vol. 21 A. Hansen, Phys. Rev. Lett. 97, 168001 (2006).
(ACM, 1987), pp. 25–34. 34. Y. Sugiyama et al., New J. Phys. 10, 033001 (2008).
Unlike in conventional fluids, the (weak) attenua- 2. D. Helbing, P. Molnár, Phys. Rev. E Stat. Phys. Plasmas Fluids 35. A. Tordeux, G. Costeseque, M. Herty, A. Seyfried,
tion of the speed waves does not originate from Relat. Interdiscip. Topics 51, 4282–4286 (1995). SIAM J. Appl. Math. 78, 63–79 (2018).
viscous stresses but instead from the competition 3. T. Vicsek, A. Zafeiris, Phys. Rep. 517, 71–140 (2012). 36. J. Toner, Y. Tu, Phys. Rev. E Stat. Phys. Plasmas Fluids Relat.
between substrate friction and compressive stresses 4. A. Cavagna, I. Giardina, Annu. Rev. Condens. Matter Phys. 5, Interdiscip. Topics 58, 4828–4858 (1998).
183–207 (2014).
resolution of the C60 fullerene the spectral window of this apparatus to the long-
wave IR (LWIR) region (30). We have targeted the
8.5-mm vibrational band because it is the lowest-
P. Bryan Changala1*, Marissa L. Weichman1, Kevin F. Lee2, energy IR active mode that falls within our ac-
Martin E. Fermann2, Jun Ye1* cessible wavelength region.
Figure 1A depicts a simplified view of the ap-
The unique physical properties of buckminsterfullerene, C60, have attracted intense research paratus used for C60 cooling and spectroscopy. A
activity since its original discovery. Total quantum state–resolved spectroscopy of isolated 950 K copper oven sublimates solid C60 samples,
C60 molecules has been of particularly long-standing interest. Such observations have, to date, generating gas-phase molecules with an average
been unsuccessful owing to the difficulty in preparing cold, gas-phase C60 in sufficiently high internal energy of 6 to 8 eV per molecule pop-
densities. Here we report high-resolution infrared absorption spectroscopy of C60 in the ulating 1026 to 1030 vibrational quantum states,
8.5-micron spectral region (1180 to 1190 wave number). A combination of cryogenic buffer-gas as shown in Fig. 1B. These hot molecules flow into
cooling and cavity-enhanced direct frequency comb spectroscopy has enabled the observation a cell anchored to a cryogenic cold finger, where
of quantum state–resolved rovibrational transitions. Characteristic nuclear spin statistical they are thermalized close to the cell-wall temper-
intensity patterns confirm the indistinguishability of the 60 carbon-12 atoms, while rovibrational ature via collisions with cold buffer-gas atoms
fine structure encodes further details of the molecule’s rare icosahedral symmetry. introduced through an annular slit inlet plate
U
rogate the cold gas-phase molecules with CE-DFCS
nderstanding molecules as quantum me- troscopy has also played a central role in the by coupling a frequency comb into a high-finesse
chanical systems is a central objective of astronomical detection of C60 and its derivatives optical cavity surrounding the cold cell, which
chemical and molecular physics. The com- (21, 22). High-resolution IR absorption measure- enhances the absorption signal by a factor on the
plex internal dynamics of these systems ments may help resolve current uncertainties order of the cavity finesse (F = 6000). The LWIR
evolve over wide energy and time scales, as regarding the physical state of astronomical frequency comb light centered near 8.5 mm is
exhibited by the various electronic, vibrational, C60 (18). However, to date, there have been no produced by difference frequency generation
rotational, and spin degrees of freedom. Poly- reports of rovibrational quantum state–resolved (DFG) with two near-IR frequency combs orig-
atomic molecules, in particular, offer the pros- measurements of C60 molecules. The experiments inating from a single mode-locked fiber laser
pect of probing many-body physics in strongly reported here thus establish C60 as the largest (31). The comb contains narrow teeth at optical
interacting systems. The most comprehensive molecule, and the only example of rare icosahe- frequencies nm = m × frep + f0, where m is the
characterization of a molecular Hamiltonian, dral symmetry, for which a complete internal quan- integer mode index, frep is the repetition rate,
which governs intramolecular dynamics, is pro- tum state–resolved spectrum has been observed. and the offset frequency f0 can be introduced
vided with high-resolution spectroscopy. When a Although quantum state–resolved rovibrational via an external acousto-optic modulator before
polyatomic molecule is sufficiently cold to con- spectroscopy is routine for small, light molecules, the difference frequency step. The intensity of
centrate the population into, and thereby spec- systems as large and heavy as C60 are much less each comb tooth transmitted through the cavity
trally probe, a single rovibrational state, we achieve amenable to high-resolution characterization is read out using a broadband scanning-arm
the unimolecular equivalent of a pure quantum owing to several intrinsic and technical chal- Fourier transform interferometer (32, 33). Ad-
state at absolute zero in the rest frame of the mol- lenges. The increase in both the number of vibra- ditional experimental details are provided in
ecule. The precise measurement of transition tional modes and the magnitude of the moment the materials and methods (34).
energies between individual molecular eigen- of inertia for every additional atom results in Our first attempts at observing cold gas-phase
states yields detailed information about strong, considerably more rotation-vibration states pop- C60 with low-pressure helium buffer gas condi-
multibody interactions between atoms in a uni- ulated at a given internal temperature. Rovibra- tions similar to our previous work (26, 27) yielded
molecular polyatomic lattice, thus providing pro- tional states excited by an IR photon may be no detectable absorption. However, when the
found insights into complex molecular structure strongly coupled to a highly congested manifold vacuum chamber was flooded with a high pres-
and ensuing interaction dynamics. of background dark states, the density of which sure of helium buffer gas, a single broad, unre-
Here we report a rotationally resolved spec- grows rapidly with increasing internal energy, solved absorption feature appeared, as shown
trum of the 8.5-mm vibrational band of buckmin- leading to intramolecular vibrational redistrib- by the red trace in Fig. 2A. We attribute this
sterfullerene, C60. Following the discovery of C60 ution (IVR) (23). The Doppler broadening of spectrum to partially cooled C60 molecules that
by Kroto et al. in 1985 (1), infrared (IR) and 13C optical transitions due to finite translational tem- remain warm enough to occupy many vibra-
nuclear magnetic resonance spectroscopy con- perature serves only to exacerbate this spectral tional quantum states. This is not surprising: As
firmed its caged, icosahedral structure (2–7). Sub- congestion. Furthermore, the low gas-phase den- can be seen in Fig. 1B, even at room temperature,
sequent spectroscopic and analytical techniques, sities achievable for heavy, nonvolatile species the vibrational partition function is greater than
including x-ray and electron diffraction (8, 9), require high detection sensitivity. 103. This finding suggested that both a higher
optical Raman and neutron scattering (10–15), These various experimental challenges are number of collisions and more-efficient energy
matrix isolation IR spectroscopy [see (16–18) addressed by cooling the translational and in- transfer per collision would be required to ther-
and references therein], and photoelectron spec- ternal temperatures of gas-phase molecular sam- malize C60 to its ground vibrational state (35).
troscopy (19, 20), have greatly advanced our ples and probing them at lower internal energy Indeed, we ultimately produced a sufficiently
understanding of this unique molecule. Spec- with longer wavelength light. The method of dense, cold C60 sample by (i) increasing the
cryogenic buffer-gas cooling is particularly effec- buffer-gas mass by switching from helium to
1
JILA, National Institute of Standards and Technology and tive for large, heavy molecules (24, 25). We have argon and (ii) carefully optimizing the buffer-
University of Colorado, Department of Physics, University of recently demonstrated the integration of a buffer- gas flow and oven positioning relative to the
Colorado, Boulder, CO 80309, USA. 2IMRA America, Inc.,
Ann Arbor, MI 48105, USA.
gas cooling source with cavity-enhanced direct inlet slit. The spectrum acquired at these conditions
*Corresponding author. Email: bryan.changala@colorado.edu frequency comb spectroscopy (CE-DFCS) in the is shown by the blue trace in Fig. 2A and exhibits
(P.B.C.); ye@jila.colorado.edu (J.Y.) mid-IR (26, 27), which enables sensitive, broad- well-resolved rovibrational fine structure, with
narrow linewidths on the order of 20 MHz (fig. eigenfunctions of J2, ‘2, Jz, ‘z, and JZ . It is useful
S1). The peak absorption, near the band origin, is to define the “pure rotational” angular momen- Table 1. Fitted spectroscopic parameters
10% of the cavity-transmitted comb mode inten- tum R ¼ J ‘, the eigenfunctions of which can of Eq. 6 for the R branch. The residuals
sity. From the magnitude of the integrated ab- be constructed by transforming the uncoupled (Fig. 4B) have a small root-mean-square
sorption cross section (17), we estimate the number product wavefunctions using standard angular error of 7.4 × 10−5 cm−1, slightly larger than
density of cold C60 to be 4 × 1011 cm−3. Observing momentum coupling relations (36). This yields the 1s line-center measurement uncertainty
the appearance and evolution between the broad total coupled rovibrational wavefunctions of the of 2.5 × 10−5 cm−1.
and narrow signals was greatly facilitated by the form jR; kR ; J; ‘; n; mi , where R is the angular
wide spectral bandwidth of the frequency comb, momentum quantum number of R and kR = Parameter Value (cm−1)
which covers the entire breadth of the observed −R, …, +R is the body-fixed projection. As usual,
n.............................................................................................
0 + (2 B + DB)(1 − 2z)
vibrational band. The inferred rotational temper- the values of R satisfy the triangle inequality 1184.86196(3)
2B(1 − z) + DB(2 − z)
ature is about 150 K (34), nearly equal to the cell- R ¼ jJ ‘j; …; J þ ‘. In this work, we are con- 0.0078300(3)
.............................................................................................
wall temperature of 135 K, which is kept well cerned only with the ground vibrational state with DB –2.876(6) × 10−7
.............................................................................................
above argon’s condensation point of 87 K. n ¼ ‘ ¼ 0 and the excited T1u vibrational state,
The observed fine structure in the infrared populated by the IR photon, with n ¼ ‘ ¼ 1 .
spectrum encodes fundamental details of the Therefore, in the ground vibrational state, R = J;
quantum mechanical structure of C60. To the zeroth similarly, in the excited state where ‘ ¼ 1, R is The excited vibrational state is described to
order, the rotations of C60 can be considered as restricted to J; jJ T 1j. lowest order by a slightly more sophisticated
those of a spherical top with total angular mo- The energies of the states we observe are de- effective Hamiltonian,
mentum operator J (36). The associated rota- termined by effective rotational Hamiltonians
tional quantum states are jJ; k; mi, where J = 0, for each vibrational state. The simplest possible Hex ¼ n0 þ B′J2 2B′zðJ ‘ Þ ð3Þ
1, 2, … is the total angular momentum quantum effective Hamiltonian for the ground vibrational
number and k, m = −J, …, +J are the projection state is that of a rigid spherical top where n0 is the vibrational band origin, and B′
quantum numbers of the body-fixed compo- is the excited state rotational constant, which
nent (Jz) and lab-fixed component (JZ) of J, Hgr ¼ B″J2 (1) differs slightly from B″ owing to changes of the
respectively. The triply degenerate vibrational moment of inertia upon vibrational excitation.
mode of T1u symmetry that gives rise to the infra- where B″ is the ground state rotational constant, The new rightmost term arises from Coriolis
red band can be modeled as a three-dimensional which is inversely proportional to the moment of forces that couple the total angular momentum
isotropic harmonic oscillator with vibrational inertia. The ground state wavefunctions jR ¼ J; J and the vibrational angular momentum ‘, with
angular momentum operator ‘ . Its quantum kR ; J; ‘ ¼ 0; n ¼ 0; mi are eigenstates of Hgr with ‘ ¼ 1. The z constant encodes the strength of this
states are jn; ‘; k‘ i, where n is the total number energies coupling, which is determined by the geometric
of vibrational quanta; ‘ ¼ n; n 2; n 4; … is details of the vibrational normal mode. The ex-
the vibrational angular momentum quantum Egr ¼ B″J(J + 1) (2) cited state wavefunctions jR; kR ; J; ‘ ¼ 1; n ¼ 1; mi
number; and k‘ ¼ ‘; …; þ‘ is the projection are eigenstates of Hex with energy levels at
quantum number of the body-frame projec-
tion (‘z ) of ‘. This energy is independent of kR and m, leading
The uncoupled rovibrational product wave- to the usual (2R + 1)(2J + 1) = (2J + 1)2 spherical- Eex ¼ n0 þ B′JðJ þ 1Þ B′z½JðJ þ 1Þþ
functions jJ; k; mijn; ‘; k‘ i are simultaneously top ground-state degeneracy factor. ‘ð‘ þ 1Þ RðR þ 1Þ ð4Þ
Fig. 2. Spectroscopic patterns of the IR active vibrational band of ground vibrational state. norm., normalized to peak absorption.
12
C60 near 8.5 mm. (A) A simulated (sim.) spectrum (black trace) is (B) Rovibrational transitions between the ground vibrational state and
the excited state follow zeroth-order selection rules of D J = 0, ±1 and
again with a degeneracy of (2R + 1)(2J + 1). As 12, 15, 16, 18, 20 to 22, and 24 to 28, with other scopic constants. The energy expressions in Eqs. 2
R ¼ J; jJ T 1j, the excited state energies sort into values of R < 30 having no allowed states. (For and 5 yield expected transition frequencies of
three distinct manifolds (37) levels with R ≥ 30, the number of allowed states
is equal to 1 plus the number of states for R minus þ DBÞð1 2zÞ þ
n½RðJÞ ¼ n0 þ ð2B
ðþÞ
Eex ¼ EJ þ 2B′zJ; R¼J þ1 30.) The unusual patterns of allowed angular mo- zÞ þ DBð2 zÞ þ
J½2Bð1 ð6Þ
ð0Þ
Eex ¼ EJ 2B′z; R¼J mentum quantum numbers are intimately related J 2 DB
ðÞ
Eex ¼ EJ 2B′zðJ þ 1Þ; R ¼ J 1 ð5Þ to the two-, three- and fivefold symmetry axes
of an icosahedron. In the high-R limit, only 1 in where B ≡ ðB′ þ B″Þ=2 is the mean value of the
where EJ = n0 + B′J(J + 1) is the pure vibrational 60 states exist, owing to the drastic effects of lower- and upper-state rotational constants and
and rigid rotor contribution to the energy. Phys- these 12C nuclear spin statistics. DB ≡ B′ B″ ≪ B is their difference. Figure 4A
ically, these manifolds correspond to states where Taking the zeroth-order energies, selection shows the measured positions (34) as a function
J and ‘ are mutually antiparallel, perpendicular, rules, and spin statistics all together leaves the of lower state J, which follow the expected nearly
and parallel, respectively. predicted spectrum plotted in black in Fig. 2A. linear dependence. Figure 4B shows the residuals
Rovibrational transitions between the ground It consists of a sharp Q branch surrounded by P from a fit of Eq. 6 to the measured line positions,
and excited T1u vibrational states of spherical tops and R branches containing lines evenly spaced displaying two avoided crossings arising from
such as C60 are governed by the usual strict D J = 0, by approximately (B″ + B′)(1 – z) ≈ 0.0078 cm−1. perturbations in the excited state. The fitted spec-
±1 rule and an additional DR = DkR = 0 rule (36). The qualitative appearance of the measured R troscopic parameters are summarized in Table 1.
These allowed transitions are illustrated in the and Q branch regions is consistent with the The R branch transition frequencies are well re-
level diagram of Fig. 2B. Unlike less symmetric simulation, whereas there is substantial disagree- produced despite the simplicity of the zeroth-
molecules, these selection rules dictate that the ment in the P branch. The portions of the spec- order Hamiltonian, which ignores centrifugal
usual P (D J = −1), Q (D J = 0), and R (D J = +1) trum shown in Fig. 3 provide a closer view of this distortion effects, and the very high range of J.
transitions reach mutually exclusive sets of up- behavior. A complete listing of the ~300 transition frequen-
per state quantum levels. These three manifolds The R branch exhibits a regularly spaced pro- cies used in this fit is given in data S1 (39).
are labeled T1u(+), T1u(0), and T1u(−), according to gression of transitions R(J) that we have assigned The quantum state–resolved spectrum of C60
the energy expressions in Eq. 5. from J ≈ 60 to 360. Transitions outside this range provides structural information of isolated gas-
Inspection of the level diagram in Fig. 2B are below our detection sensitivity. Such high phase molecules through the rotational fine struc-
shows that states with certain values of R are values of the total angular momentum quantum ture. Although the transitions included in our
missing. This is, in fact, an exceptional example of number have been rarely observed, if ever, by initial analysis do not yet allow an independent
nuclear spin statistics at work. The carbon nuclei rotationally resolved frequency domain spectros- determination of B″ and z, if we assume a range
in pure 12C60 are each identical spin-0 bosons, so copy. Portions of the measured and simulated R of z = −0.30 to −0.45 based on theoretical cal-
culations (37), we can estimate B″ ¼ hc1 ℏ2I ≈ 0.0027
2
any permutation of nuclei must leave the total branch from J = 160 to 200 are shown in Fig. 3A.
−1
molecular wavefunction unchanged. This im- Despite the noise in the measured absorption, to 0.0030 cm , where I is the effective moment
poses the strict condition that only states with a these transitions clearly show the expected dis- of inertia of the ground vibrational state, ħ is
total rovibronic symmetry of Ag (+ parity) or Au crete intensity variations in the correct integer Planck’s constant h divided by 2p, and c is the
(− parity) in the Ih point group may exist. Group ratios. Such patterns are a basic consequence of speed of light. Given I ¼ 23 mr2 for a spherical
theoretical analysis (38) of the rovibrational the quantum mechanical indistinguishability shell of mass m and radius r, the corresponding
wavefunctions shows that this condition is met and the perfect icosahedral arrangement of the range of radii is 3.4 to 3.6 Å. This is consistent
only with certain linear combinations of kR states carbon nuclei that make up 12C60. with a previous gas-phase electron diffraction
for a given value of R. In fact, only a single such Quantitative analysis of the R branch transi- measurement of 3.557(5) Å, which includes ther-
linear combination is possible for R = 0, 6, 10, tion frequencies permits extraction of spectro- mal averaging effects that lengthen the measured
radius relative to that of the vibrational ground Fig. 4. Fit results for the R branch. (A) The
state (8). Further analysis of the rotational fine R(J) line positions plotted versus lower-state
structure of 12C60 (and ultimately 12C5913C) will be J display a very linear trend over J = 60 to 360.
necessary to constrain B″ and z independently The individual line positions are listed in (39).
and completely determine the gas-phase struc- (B) The residuals from the fit of Eq. 6 to these
tural parameters. Our measured value of DB im- line positions, summarized in Table 1, exhibit
plies that the effective C60 radius increases by apparent avoided crossings near J = 215 and 275,
only 0.005% upon excitation of the observed which are possible signatures of local dark-state
vibrational mode, which is primarily of a surface- perturbers in the upper state. The error bars
tangent C–C bond stretching character. The are 1s line-center uncertainties determined from
narrow IR transition linewidths (about 20 MHz) lineshape fit residuals (34).
to the excited vibrational state provide a lower
bound for its IVR lifetime of at least 8 ns, despite
being embedded in a dense manifold of dark
vibrational states. This is consistent with our
expectation that the high degree of icosahedral
symmetry substantially restricts rovibrational
coupling.
The Q branch region is shown in Fig. 3B. There
are several unresolved features here, though
each is still quite narrow on an absolute scale of metry of C60, splitting the threefold degeneracy body-fixed projections of R. Whereas most of
0.01 to 0.03 cm−1. The highest frequency fea- of the vibrational level and nullifying the nu- these substates are eliminated by the 12C nuclear
ture is assigned as the Q branch of the 12C60 clear spin statistics. Many more rotational spin statistics, the degeneracy of the remaining
isotopologue in its ground vibrational state. Cen- levels and transitions are expected, which will substates can be broken by nonscalar centrifu-
trifugal distortion effects create a band head be further split by the nonspherical moments gal distortion terms. These so-called “icosahedral
observed near J = 250 (inset of Fig. 3B). The of inertia (40). splitting” terms (41) lead to subsequent splittings
remaining features in the Q branch region are Finally, two representative portions of the P of the observed transitions. In the ground state,
not definitively assigned. Although they are pos- branch are shown in Fig. 3C. Here, the zeroth-order the lowest-order nonscalar centrifugal distortion
sibly hot-band transitions of the 12C60 isotopo- simulation fails to capture either the position or term scales as J 6, whereas such terms can appear
logue, we believe they most likely derive from number of observed transitions. This complicated in the excited state that scale only as J 4. Owing to
the singly substituted 12C5913C isotopologue. fine structure is likely due to high-order centrif- the large J values observed here, it is not surpris-
Despite a 13C natural abundance of only 1.1%, ugal distortion terms not included in the simulated ing that such effects become important. However,
the 60 equivalent substitution sites lead to a spectrum (41). The zeroth-order Hamiltonians, to date, there have been no theoretical predictions
notably high (12C5913C):12C60 ratio of about 2:3. Eqs. 1 and 3, contain only scalar terms that pre- of the magnitude of these icosahedral splitting
The substitution breaks the icosahedral sym- serve the spherical degeneracy of the (2R + 1) terms. A full analysis of this portion of the spectrum
is most effectively treated within the irreducible 11. L. Pintschovius, Rep. Prog. Phys. 59, 473–510 (1996). 35. J. T. Stewart, B. E. Brumfield, B. M. Gibson, B. J. McCall, ISRN
spherical tensor formalism (42). 12. D. S. Bethune, G. Meijer, W. C. Tang, H. J. Rosen, Chem. Phys. Lett. Phys. Chem. 2013, 675138 (2013).
174, 219–222 (1990). 36. C. di Lauro, in Rotational Structure in Molecular Infrared
The present experiments point toward an ex- 13. D. S. Bethune et al., Chem. Phys. Lett. 179, 181–186 (1991). Spectra (Elsevier, 2013), chap. 10, pp. 225–245.
citing future direction of fullerene research. The 14. K. Prassides et al., Chem. Phys. Lett. 187, 455–458 37. D. E. Weeks, W. G. Harter, Chem. Phys. Lett. 176, 209–216
general applicability of buffer-gas cooling estab- (1991). (1991).
lishes the possibility of similar studies, using vi- 15. R. L. Cappelletti et al., Phys. Rev. Lett. 66, 3261–3264 38. P. R. Bunker, P. Jensen, Mol. Phys. 97, 255–264 (1999).
(1991). 39. P. B. Changala, M. L. Weichman, K. F. Lee, M. E. Fermann,
brational, electronic, or other spectroscopies, 16. N. Sogoshi et al., J. Phys. Chem. A 104, 3733–3742 (2000). J. Ye, External data for “Rovibrational quantum state resolution
on larger fullerenes such as C70; endofullerenes, 17. S. Iglesias-Groth, F. Cataldo, A. Manchado, Mon. Not. R. of the C60 fullerene,” Version 1, Harvard Dataverse (2018);
wherein an atom or small molecule is encap- Astron. Soc. 413, 213–222 (2011). https://doi.org/10.7910/DVN/RVVAN6.
sulated in a closed fullerene cage; or even pure 18. A. C. Brieva, R. Gredel, C. Jäger, F. Huisken, T. Henning, 40. T. C. Reimer, W. G. Harter, J. Chem. Phys. 106, 1326–1335
13 Astrophys. J. 826, 122 (2016). (1997).
C60, which represents a pristine example of a 19. X.-B. Wang, C.-F. Ding, L.-S. Wang, J. Chem. Phys. 110, 41. W. G. Harter, D. E. Weeks, J. Chem. Phys. 90, 4727–4743
spin-½ network on a spherical lattice. Ultimately, 8217–8220 (1999). (1989).
precision spectroscopy of such targets is the first 20. D.-L. Huang, P. D. Dau, H.-T. Liu, L.-S. Wang, J. Chem. Phys. 42. V. Boudon et al., J. Mol. Spectrosc. 228, 620–634 (2004).
step toward single quantum state preparation 140, 224315 (2014).
21. J. Cami, J. Bernard-Salas, E. Peeters, S. E. Malek, Science 329, AC KNOWLED GME NTS
and control of large molecular systems. 1180–1182 (2010). The authors thank H. Green for technical advice during the design of
22. E. K. Campbell, M. Holz, D. Gerlich, J. P. Maier, Nature 523, the oven source and J. Doyle for insightful discussions. Funding: This
322–323 (2015). work was supported by AFOSR grant no. FA9550-15-1-0111, the
RE FE RENCES AND N OT ES
23. D. J. Nesbitt, R. W. Field, J. Phys. Chem. 100, 12735–12756 Gordon and Betty Moore Foundation, the DARPA SCOUT Program,
1. H. W. Kroto, J. R. Heath, S. C. O’Brien, R. F. Curl, R. E. Smalley, (1996). NIST, and NSF PHYS-1734006. M.L.W. is supported through an NRC
Nature 318, 162–163 (1985). 24. D. Patterson, E. Tsikata, J. M. Doyle, Phys. Chem. Chem. Phys. Postdoctoral Fellowship. Author contributions: P.B.C., M.L.W., and
2. H. Ajie et al., J. Phys. Chem. 94, 8630–8633 (1990). 12, 9736–9741 (2010). J.Y. performed the experiment. K.F.L. and M.E.F. built the DFG-based
3. R. Taylor, J. P. Hare, A. K. Abdulsada, H. W. Kroto, J. Chem. 25. J. Piskorski, D. Patterson, S. Eibenberger, J. M. Doyle, comb. All authors contributed to the writing of the paper. Competing
Soc. Chem. Commun. 1990, 1423–1424 (1990).
MESOSCOPIC PHYSICS
Counter-propagating charge
transport in the quantum Hall
effect regime
Fabien Lafont1,2*†, Amir Rosenblatt1*, Moty Heiblum1, Vladimir Umansky1
The quantum Hall effect, observed in a two-dimensional (2D) electron gas subjected to a
perpendicular magnetic field, imposes a 1D-like chiral, downstream, transport of charge
carriers along the sample edges. Although this picture remains valid for electrons and
Laughlin’s fractional quasiparticles, it no longer holds for quasiparticles in the so-called
hole-conjugate states. These states are expected, when disorder and interactions are
weak, to harbor upstream charge modes. However, so far, charge currents were observed
to flow exclusively downstream in the quantum Hall regime. Studying the canonical
spin-polarized and spin-unpolarized v = 2/3 hole-like states in GaAs-AlGaAs
heterostructures, we observed a significant upstream charge current at short propagation
E
lementary charge excitations in the quan- (0, ↑) and (0, ↓) (Fig. 1B) (28), and a polarized
tum Hall effect (QHE) flow downstream state, emerging at high magnetic fields, with two
along the edge of a two-dimensional elec- quantum levels having the same spin but dif-
tron gas (2DEG), with the downstream ferent orbitals (0, ↑) and (1, ↑) (29). The majority
chirality imposed by the magnetic field (1). of previous experiments in the unpolarized state
In the fractional regime (2), this statement re- focused on characterizing the spin domains
mains valid only for particle-like (Laughlin’s) states structure in the bulk (23, 24, 30) or the nuclear
(3–5); by contrast, hole-like states (filling factors spin polarization occurring at high currents
v so that 1/2 + n < v < 1 + n with n = 0, 1, 2...) are (18, 19, 21, 22, 30–35). Still, the configuration of
expected to harbor counter-propagating (down- edge channels for this state remains elusive: On
stream and upstream) charge excitations (6). In the one hand, no upstream channel is expected
a noninteracting and scattering-free model, a in the CF picture; on the other, because the ef-
downstream v = 1 charge mode was predicted to fective K-Matrix in the CF basis is the same for Fig. 1. Longitudinal and transverse magnetore-
be accompanied by an upstream v = 1/3 mode, both v = 2/3 states, an upstream mode should sistances measured in a 40-mm-wide Hall bar
leading to a two-terminal conductance of 4e2/3h, occur also in the unpolarized case (36). We studied sample. (A) Longitudinal four-terminal magneto-
where e and h are the electron charge and the the two flavors of the v = 2/3 state along a short resistance versus backgate voltage measured by
Planck constant, respectively. However, experi- distance (a few micrometers) and found a sub- using I = 1 nA at T = 40 mK. A clear nondissipated
mentally, only downstream charge modes (7, 8) stantial upstream charge current only in the spin- state, Rxx ≈ 0, is visible for the v = 2/3 polarized and
with a two-terminal conductance of 2e2/3h ac- unpolarized state. Consequently, the two-terminal unpolarized states. (B) Sketch of the evolution of the
companied by upstream neutral modes (9–15) resistance deviates from the quantized one at v = relevant energy scales. At low field, a gap exists
have been found. A recent experiment (16) mea- 2/3. The GaAs-AlGaAs heterostructure used to between the (0, ↑) and (0, ↓) states,corresponding
sured conductance of an unequilibrated down- study the two v = 2/3 states had to be carefully to the spin unpolarized state, whereas at higher
stream channels at narrow regions (4 mm wide) designed (with the 2DEG confined in a narrow, fields, thanks to the different B dependency of the
of the polarized v = 2/3 state; the results were 12-nm-wide quantum-well) because we aimed to pffiffiffiffi
Coulomb (ºl1 B e B,where lB is the magnetic length)
consistent with the model from (6), but no di- have the transition between the two states at a
and Zeeman (ºB) energies, the gap exists between
rect measurement of the upstream current was sufficiently high carrier density (and magnetic
the (0, ↑) and the (1, ↑) l levels corresponding to the
made. Although the majority of the studies were field), corresponding to having high mobility
polarized state. (C) Four-terminal transverse mag-
concentrated on the spin-polarized v = 2/3 throughout the transition region in the phase
netoresistance as function of the backgate voltage.
state, there has been recent interest in its spin- space between the two states. A conductive
The v = 2/3 polarized and unpolarized quantum
unpolarized counterpart (17–24) as a potential n + GaAs layer was grown ~1 mm below the 2DEG
Hall plateaus exhibit a resistance Rxy ≈ (2e2/3h)–1 ≈
host for para-fermions when coupled to super- and served as a backgate, capable of tuning the
38.7 kilohms (dashed line on the color bar).
conducting contacts (25–27). In the composite density from 1 × 1011 to 2.5 × 1011 cm–2, with a
fermion (CF) picture, one can construct two kinds corresponding low-temperature dark mobility
of states in the v = 2/3: an unpolarized state, of 1.5 × 106 to 3.5 × 106 cm2 V–1 s–1. Lock-in two-spin varieties of the v = 2/3 states is visible
emerging at lower magnetic fields, with two measurements were performed at ~80 Hz with in Rxx (around Vbg = –0.5 V and B = 10 T) (Fig.
quantum levels that have the same orbital quan- an input current I = 1 nA and an electron tem- 1A). The finite Rxx region corresponds to the
tum number but opposite spin configurations: perature of ~35 mK [additional fabrication in- point at which the system undergoes a first-
formation is provided in (37), section 1]. order quantum phase transition between the spin-
1
Braun Center for Submicron Research, Department of The evolution of the four-terminal longitudinal unpolarized and the spin-polarized v = 2/3 state.
Condensed Matter Physics, Weizmann Institute of Science, (Rxx) and transverse resistance (Rxy), measured The transverse resistance Rxy ≃ ð2e 2 =3hÞ1 ≃
Rehovot 76100, Israel. 2College de France, 11 place Marcelin
Berthelot, 75231 Paris Cedex 05, France.
in a 40-mm-wide Hall-bar geometry, is plotted 38:7 kilohms, however, remains constant on both
*These authors contributed equally to this work. on Fig. 1, A and C. As reported previously sides of the transition. As predicted in (6), the
†Corresponding author. Email: lafont.fabien@gmail.com (17, 21, 22, 30, 31), a clear transition between the presence of an upstream current leads to the
grant agreement 339070; the partial support of the Minerva experimental work and contributed in data interpretation and SUPPLEMENTARY MATERIALS
Foundation, grant 711752; and, together with V.U., the German- writing of the paper. V.U. contributed in molecular beam epitaxy www.sciencemag.org/content/363/6422/54/suppl/DC1
Israeli Foundation (GIF), grant I-1241-303.10/2014, and the Israeli growth. Competing interests: The authors declare that they Supplementary Text
Science Foundation (ISF). Author contributions: F.L. and A.R. have no competing financial interests. Data and materials Figs. S1 to S5
contributed equally to this work in sample design, device availability: All data needed to evaluate the conclusions in the
fabrication, measurement set-up, data acquisition, data analysis paper are present in the paper or the supplementary materials 1 November 2017; accepted 8 November 2018
and interpretation, and writing of the paper. M.H. guided the and deposited at (42). 10.1126/science.aar3766
C
troscopy (XPS), and mass spectrometry (MS)
arbon-based nanostructures synthesized nanostructures directly on technologically rele- studies, were performed in situ under UHV condi-
through rational surface-assisted C–C cou- vant nonmetallic substrates, such as metal oxide tions. We deposited precursor molecules by using
pling on single-crystal metal surfaces (1, 2) surfaces (20–22). However, all reported attempts standard Knudsen cells on the (2×1) reconstructed
include individual isomers of fullerenes to perform the cyclization on metal oxides have (011) face of the rutile TiO2 (for details, see the
(3, 4) and fullerene fragments (5, 6), the been unsuccessful because of the lack of catalytic supplementary materials). To thermally induce
chirality-pure carbon nanotubes (7), atomically activity in the cyclodehydrogenation process the transformation of P1, we started with sub-
precise nanographenes (NGs) (8–10), and graphene (20) (Fig. 1C). The cyclization of PAH precursors monolayer deposition of precursor molecules on
nanoribbons (GNRs) with a well-defined pe- on such surfaces requires high temperatures, the substrate kept at room temperature (RT) and
riphery (6, 11–15). The consecutive, thermally which leads to a loss of selectivity. Thus, the then heated the substrate to ~570 K (bulk activa-
triggered cyclodehydrogenation of the polycyclic rational synthesis of tailored carbon-based nano- tion temperature) for 10 min. Under these mild
aromatic hydrocarbon (PAH) precursor bearing architectures on metal oxide surfaces requires conditions, most P1 molecules desorbed from the
required C–C connectivity to the target nano- the development of an alternative cyclization surface, leaving almost bare surface terraces with
structure represents the key transformation in technique. Previously, we have found that in- no clear evidence of successful HF elimination
the on-surface synthesis strategy. The synthesis tramolecular aryl-aryl coupling can be effectively (see the supplementary materials). At a higher
of hexabenzo[bc,ef,hi,kl,no,qr]coronene (HBC) realized through C–F bond activation on g-Al2O3 annealing temperature of ~670 K, particularly
by Weiss et al. showed that this step can be under relatively mild conditions (23–27). Fur- flat molecules with the specific rhomboid shape
realized efficiently under ultrahigh vacuum ther exploration revealed that metal oxides of expected for DBPP were observed in our STM
(UHV) conditions on atomically clean metal III and IV groups also displayed activity in experiment. However, because of the appreciable
surfaces (16) (Fig. 1A). The catalytic activity of cyclodehydrofluorination at elevated temper- thermal desorption of P1, DBPP molecules were
the metals substantially reduced the activation atures (28). Among them, bulk powders of ti- adsorbed only on chemically active sites (step
barrier of the cyclization (8). In 2010, Cai et al. tanium dioxide activated C–F bonds at 570 K, edges or domain boundaries), which compli-
applied a similar strategy to form atomically which made it an attractive candidate for on- cated the accurate interpretation of their non-
precise GNRs on the Au(111) surface (11) (Fig. 1B). surface investigations performed under UHV uniform STM contrast (see the supplementary
This discovery paved the way toward the fabrica- conditions. materials).
tion of complex molecular nanoarchitectures We present the rational on-surface synthesis of With the larger precursor P2, after deposi-
on selected noble metal surfaces (17). However, NGs on a semiconducting rutile TiO2(011) surface tion onto an RT substrate, P2 molecules were
for most practical applications, a carbon-based through dominolike HF zipping of programmed found mostly in globular form on reconstructed
nanostructure must be transferred onto insulat- fluoroarene precursors (Fig. 1D). The high poten- terraces of rutile (011) with STM. However,
ing or semiconducting surfaces (18, 19). tial of the approach was demonstrated by a chal- after annealing at ~570 K, the molecules re-
An attractive yet challenging way to tackle this lenging transformation consisting of the formal mained on the surface (Fig. 2C). Moreover, we
problem is the controlled synthesis of carbon rolling up of the linear oligophenylene chain observed a general change in P2 appearance
around a phenyl moiety, yielding NG HBC (Fig. and observed elongated geometries with lengths
1
Centre for Nanometer-Scale Science and Advanced Materials, 1D). In contrast to the commonly used rigid up to ~2.5 nm. These geometries correspond
NANOSAM, Faculty of Physics, Astronomy and Applied design of precursors, our approach allows the to different possible configurations of P2 on the
Computer Science, Jagiellonian University, Łojasiewicza 11,
30-348 Kraków, Poland. 2Center for Nanophase Materials
regioselectivity of the cyclization to be unam- surface (see detailed analysis in the supplemen-
Sciences, Oak Ridge National Laboratory, Oak Ridge, TN biguously programmed by F atom positions, tary materials), consistent with the expected
37831, USA. 3Department of Organic Chemistry, Friedrich providing sufficient flexibility in the design of flexibility of the precursors. This observation
Alexander University Erlangen-Nuremberg, 91058 Erlangen, precursor molecules. points out that the globular geometry, the fa-
Germany. 4Espeem S.A.R.L., L-4365 Esch-sur-Alzette,
Luxembourg.
To investigate the HF-zipping process on a vorable gas-phase configuration of P2 preserved
*Corresponding author. Email: konstantin.amsharov@fau.de rutile surface, two model NGs—namely, DBPP after deposition, was only metastable on the
(K.A.); kolmerma@ornl.gov (M.K.) (dibenzo[ij,rst]phenanthro[9,10,1,2-defg]pentaphene) surface.
HF elimination reaction, we combined the STM of two peaks separated by ~2 eV in binding peak observed at EB = 686.8 eV is related to an
data with the XPS chemical analysis. The C1s energy (EB), which correspond to C–C (red line, organofluorine component (13, 36, 37). The ab-
core-level photoemission spectrum of P2 mole- EB = 284.4 eV) and C–F (green line, EB = 286.3 eV) sence of a peak at ~684.5 eV suggests the lack of
cules deposited on the rutile (011) surface at RT contributions (36, 37). Figure 4B presents the F1s a F–Ti component (38). Thus, the XPS analysis
(Fig. 4A) showed an asymmetric signal composed core-level region. For RT deposition, the single confirmed that the C–F bonds in the precursor
molecules were intact after deposition on the
surface at RT.
After annealing at 670 K for 10 min, the
XPS signal from the C1s region consisted of
only a single peak at EB = 284.5 eV, corre-
sponding to a C–C component (Fig. 4A), con-
firming global scission of C–F bonds in P2
molecules caused by efficient HF elimination.
The corresponding STM images (Fig. 3, A and
E) show that the flat-lying HBC molecules
were found on the newly formed reconstructed
areas of the surface, forming ad-islands attached
to TiO2(011)-(2×1) step edges or domain bound-
aries. These structures were not observed in a
control experiment, where we directly deposited
HBC molecules on the rutile (011) and annealed
exceeded 670 K, consistent with our previous nologically relevant semiconducting or insulat- 31. W. H. Soe et al., ACS Nano 6, 3230–3235 (2012).
experimental observations. ing surfaces. 32. L. Gross et al., Science 337, 1326–1329 (2012).
33. T. Ardhuin, O. Guillermet, A. Gourdon, S. Gauthier,
Desorption of TiOF2 points to strong Ti–F J. Phys. Chem. C 122, 11905–11910 (2018).
covalent bonding of F to the surface during the RE FERENCES AND NOTES 34. J. Ichikawa, M. Yokota, T. Kudo, S. Umezaki, Angew. Chem. Int.
HF zipping, which may indirectly explain the 1. J. Méndez, M. F. López, J. A. Martín-Gago, Chem. Soc. Rev. 40, Ed. Engl. 47, 4870–4873 (2008).
observed surface reconstruction under newly 4578–4590 (2011). 35. D. Sharapa, A.-K. Steiner, K. Amsharov, Phys. Status Solidi B
2. P. A. Held, H. Fuchs, A. Studer, Chemistry 23, 5874–5892 10.1002/pssb.201800189 (2018).
formed HBC molecules. Adsorbates strongly in- (2017). 36. F. Blobner et al., J. Phys. Chem. C 119, 15455–15468
teracting with the surface are known to induce 3. G. Otero et al., Nature 454, 865–868 (2008). (2015).
changes in rutile titania reconstructions, as pre- 4. K. Amsharov et al., Angew. Chem. Int. Ed. Engl. 49, 9392–9396 37. R. Han et al., Chem. Commun. 52, 9805–9808 (2016).
viously reported for (110) (39) and (011) (40, 41) (2010). 38. J.-Y. Ruzicka et al., RSC Adv. 4, 20649–20658 (2014).
5. K. T. Rim et al., Angew. Chem. Int. Ed. Engl. 46, 7891–7895 39. D. Silber et al., Nat. Commun. 7, 12888 (2016).
faces. Recent work by Balajka et al. (41) reported (2007). 40. Q. Cuan, J. Tao, X. Q. Gong, M. Batzill, Phys. Rev. Lett. 108,
a water-induced reconstruction of a rutile (011) 6. N. Abdurakhmanova et al., Carbon 84, 444–447 (2015). 106105 (2012).
surface to form a bulk-terminated (1×1) face 7. J. R. Sanchez-Valencia et al., Nature 512, 61–64 (2014). 41. J. Balajka et al., J. Phys. Chem. C 121, 26424–26431
covered with a hydroxyl group overlayer form- 8. M. Treier et al., Nat. Chem. 3, 61–67 (2011). (2017).
9. C. Rogers et al., Angew. Chem. Int. Ed. Engl. 54, 15143–15146
ing (2×1) reconstruction. In the case of a HF (2015). AC KNOWLED GME NTS
elimination reaction, the desorption of TiOF2 10. R. Zuzak et al., Chem. Commun. 54, 10256–10259 (2018).
Funding: The research was supported by the Polish Ministry
species also formally leads to the formation of 11. J. Cai et al., Nature 466, 470–473 (2010).
of Science and Higher Education, contract no. 0341/IP3/2016/74.
water molecules, TiO2 + 2HF → TiOF2 + H2O, 12. P. Ruffieux et al., Nature 531, 489–492 (2016).
R.Z. acknowledges support received from the National
13. H. Hayashi et al., ACS Nano 11, 6204–6210 (2017).
which then could dissociate and locally create Science Center, Poland (2017/24/T/ST5/00262). A.K.S. and
14. C. Ma et al., Nat. Commun. 8, 14815 (2017).
the hydroxyl-rich reconstruction. Close inspec- K.A. thank the Deutsche Forschungsgemeinschaft (DFG-SFB
15. D. J. Rizzo et al., Nature 560, 204–208 (2018).
953 “Synthetic Carbon Allotropes” project A6, and AM407) for
tion of the ad-island structure performed by 16. K. Weiss et al., Angew. Chem. Int. Ed. Engl. 38, 3748–3752
financial support. Work was partially conducted at the Center
T
he application of laser cooling to trapped With the use of standard methods for UNP create an environment that differs markedly from
36. Further experimental and simulation details are available as ACKN OWLED GMEN TS competing interests. Data and materials availability: All data
supplementary materials. We thank I. Plompen for experimental assistance. Funding: This work shown in this work can be found in the Harvard Dataverse (41).
37. P. McQuillen, T. Strickler, T. K. Langin, T. C. Killian, was supported by the Air Force Office of Scientific Research through
Phys. Plasmas 22, 033513 (2015). grant FA9550-17-1-0391 and by the NSF/DOE Partnership in Basic SUPPLEMENTARY MATERIALS
38. M. Lyon, S. D. Bergeson, M. S. Murillo, Phys. Rev. E 87, 033101 (2013). Plasma Science and Engineering through the DOE/SC Office of Fusion
www.sciencemag.org/content/363/6422/61/suppl/DC1
39. S. D. Baalrud, J. Daligault, Contrib. Plasma Phys. 57, 238–251 (2017). Energy Sciences grant DE-SC0014455. Author contributions: T.K.L.
Supplementary Text
40. H. Grad, Containment in Cusped Plasmas Systems (Courant constructed the apparatus, performed experiments, analyzed data,
Figs. S1 to S4
Institute of Mathematical Sciences, New York Univ., 1961). and performed numerical simulations. G.M.G. performed experiments
References (42–49)
41. T. K. Langin, G. M. Gorman, T. C. Killian, Replication data for: and analyzed data. T.C.K. conceived of and designed the experiment.
Laser cooling of ions in a neutral plasma, Version 1, Harvard All authors discussed results and contributed to the preparation of 14 February 2018; accepted 13 November 2018
Dataverse (2018); https://doi.org/10.7910/DVN/8ZOVUB. the manuscript. Competing interests: The authors declare no 10.1126/science.aat3158
Neocortical space for an ancient activity to POR. However, the pulvinar is also a
key node of the colliculo-cortical pathway be-
cause it receives direct input from SC (10, 20).
midbrain visual structure If there were pulvinar neurons whose visually
evoked activity was driven by SC and unaffected
Riccardo Beltramo1,2,3* and Massimo Scanziani1,2,3*
by V1 silencing, then such neurons could me-
diate responses in POR that are independent
Visual responses in the cerebral cortex are believed to rely on the geniculate input to of V1. We first determined whether there are
the primary visual cortex (V1). Indeed, V1 lesions substantially reduce visual responses neurons in the pulvinar that are visually driven
throughout the cortex. Visual information enters the cortex also through the superior by SC (Fig. 2). Injections in V1 and SC with viral
colliculus (SC), but the function of this input on visual responses in the cortex is less clear.
anterograde tracers revealed that axons origi-
SC lesions affect cortical visual responses less than V1 lesions, and no visual cortical nating from SC preferentially target the caudal
area appears to entirely rely on SC inputs. We show that visual responses in a mouse lateral pulvinar, whereas axons originating from V1
visual cortical area called the postrhinal cortex are independent of V1 and are abolished preferentially target the rostral pulvinar (Fig. 2A).
upon silencing of the SC. This area outperforms V1 in discriminating moving objects. We
To determine whether V1 and SC inputs are also
thus identify a collicular primary visual cortex that is independent of the geniculo-cortical separated functionally, we recorded responses
T
We presented dark moving dots, visual stimuli
he mammalian cerebral cortex receives sen- the respective recording sites overlapped (Fig. 1 known to drive robust activity in the SC (21).
sory information from several modalities. and fig. S1A). Visual areas in mice are anatom- Photoinhibition of SC strongly attenuated its re-
Even within the same modality, sensory ically defined by their retinotopic afferent input sponses to the visual stimuli, particularly in the
information reaches the cortex via anatom- originating from V1 (14, 16). We thus injected the stratum opticum (Fig. 2B) (79.34 ± 4.31% average
ically distinct parallel pathways. The rela- anterograde viral tracer AAV1.CAG.TdTomato decrease ± SEM in visually evoked firing rate; P <
tive roles of these distinct pathways in driving in the posterior portion of V1 and identified POR 0.0001, Wilcoxon signed-rank test, n = 33, 5 mice)
cortical responses to a sensory stimulus and the via transcranial epifluorescence illumination (see also fig. S7). SC silencing similarly attenuated
extent to which their sensory representations are of the labeled V1 axons projecting to the visual the visually evoked responses recorded simulta-
spatially segregated in the cortex are still matters areas surrounding V1 (Fig. 1A and fig. S2). Drift- neously in the caudal pulvinar (Fig. 2B) (80.02 ±
of debate (1). ing gratings displayed on a monitor at the center 5.96% average decrease ± SEM in visually evoked
In the visual system, dorsolateral geniculate of the receptive field triggered responses in 40% firing rate; P < 0.0001, Wilcoxon signed-rank test,
nucleus (dLGN) innervation of the primary visual (81 of 209) of the units isolated from POR [aver- n = 34, 5 mice). Silencing of V1 had little effect
cortex (V1) is considered the primary entry point age firing rate ± SEM of visually evoked responses on visually evoked activity in the caudal pul-
of retinal input to the cortex (2). V1 lesions abol- for regular-spiking (RS), putative excitatory neu- vinar (Fig. 2C) (24.64 ± 5.33% average decrease ±
ish or strongly reduce visually evoked activity in rons: 1.61 ± 0.25 Hz, n = 41; for fast-spiking (FS), SEM in visually evoked firing rate; P = 0.0004,
several higher cortical visual areas (3–6). The putative inhibitory interneurons: 3.14 ± 0.43 Hz, Wilcoxon signed-rank test, n = 63, 7 mice) while
colliculo-cortical pathway provides visual input n = 40; 5 mice]. We silenced V1 by photoactivat- strongly reducing visual responses in the rostral
to the cortex from the superior colliculus (SC) via ing cortical inhibitory interneurons expressing pulvinar (Fig. 2D) (91.43 ± 4.82% average de-
the pulvinar nucleus of the thalamus (7–10). channelrhodopsin-2 (ChR2). This approach abol- crease ± SEM in visually evoked firing rate; P =
Its inactivation has either no or only a slight ished visual responses in RS neurons across the 0.0005, Wilcoxon signed-rank test, n = 16, 3 mice).
and feature-selective effect on cortical visual re- entire cortical depth (fig. S3) and over large areas Could the SC be disynaptically connected to
sponses (9, 11–13). Thus, despite a clear anatom- of V1 (fig. S4) (17). Despite this extensive silencing POR through the pulvinar? We used anterograde
ical link from SC to visual cortex, no cortical area of V1, however, most of the visual response in trans-synaptic tracing in which transfection of
has been identified yet whose visual responses POR persisted (Fig. 1, C and D) [21.65 ± 6.51% virus harboring Cre recombinase in the presynaptic
rely entirely on visual activity originating from average decrease ± SEM in visually evoked firing neuronal population leads to the conditional ex-
the SC. rate of RS cells (P = 0.022, n = 41); 34.5 ± 5.03% pression of a reporter gene in the postsynaptic
Visual responses in the mouse cortical area of FS cells (P < 0.0001, n = 40, 5 mice; Wilcoxon neuronal population (22) (Fig. 3, A and B, and
postrhinal cortex (POR) are well documented signed-rank test)]. Whereas the response latencies fig. S8). We injected this virus in the SC and a
(14–16). Although generally assumed to rely on in V1 and POR were quite similar (fig. S5), the virus containing conditional green fluorescent
V1, their dependence on V1 has not been directly time courses of the peristimulus time histogram protein (GFP) in the caudal pulvinar. Histologi-
assessed. We determined the impact of V1 on (PSTH) in V1 and POR were markedly different cal analyses revealed cell bodies expressing GFP
POR’s visual responses in awake, head-fixed mice. (Fig. 1, C and D, and fig. S6). in the caudal pulvinar and axonal arborizations
We optogenetically silenced V1 while performing Which structure other than V1 could relay vi- densely innervating layers 4 and 1 in POR as well
simultaneous electrophysiological recordings from sual input to POR? The dLGN is also a source as other cortical visual areas, albeit with the ex-
V1 and POR, ensuring that the receptive fields of of afferent input to other visual areas (16). To ception of the laterointermediate area (LI), to a
determine whether POR directly receives input much lesser extent than POR (Fig. 3, A and B, and
1
Center for Neural Circuits and Behavior, Neurobiology Section,
from the dLGN, we injected cholera toxin sub- fig. S8), consistent with recent observations (20).
and Department of Neuroscience, University of California San unit B (CTB) in POR (Fig. 1E). The dLGN was To determine whether visually evoked activity in
Diego, La Jolla, CA, USA. 2Department of Physiology, University almost devoid of retrogradely labeled neurons. POR depends on SC, we performed simultaneous
of California San Francisco, San Francisco, CA, USA. 3Howard The vast majority (>99%) of retrogradely labeled recordings from POR and SC while optogeneti-
Hughes Medical Institute, University of California San
Francisco, San Francisco, CA, USA.
cell bodies in the visual thalamus were found in cally silencing SC (Fig. 3, C to F). We presented
*Corresponding author. Email: ric.beltramo@gmail.com (R.B.); the pulvinar (18) [also called the latero-posterior dark moving dots and ensured that the receptive
massimo@ucsf.edu (M.S.) nucleus in rodents (10)]. fields at the recording sites in POR and in the
medial
GAD-Cre
lateral
medial
lateral
PM LI AAV9-Flex-ChR2
LI
LM V1 injected in V1
POR
POR V1 POR V1
P 1 mm P
posterior posterior
Elevation
Elevation
0° 0° 0.4 0.4
0.2 0.2
-45° -45° 0 0
-45° 0° +45° -45° 0° +45° -1 -0.5 0 +0.5 +1 -1 -0.5 0 +0.5 +1
Azimuth Azimuth Time from stimulus onset (s) Time from stimulus onset (s)
LED LED 8
20
8
2
6
Firing rate (Hz)
0 0 0 0
-1 -0.5 0 +0.5 +1 -1 -0.5 0 +0.5 +1 0 2 4 6 8 10 15 20 0 1 2 4 6 8
Time from stimulus onset (s) Time from stimulus onset (s) V1 firing rate LED OFF (Hz) POR firing rate LED OFF (Hz)
E anterograde F G Pulvinar
retrograde AAV1-CAG 1.0
TdTomato V1
CTB
Fig. 1. Visual responses in POR are not driven by the geniculate-V1 as described for (C) (33 non-GABAergic RS units in V1 and 41 RS units
pathway. (A) Injection of the anterograde tracer AAV1.TdTomato in in POR from five animals). (Top) Summary average PSTHs. The PSTH
V1 enabled the visualization of higher visual areas. Delineated cortical values for individual units were normalized by their maximum value and
areas are as shown in fig. S2. The weaker fluorescence of POR is consistent then averaged together. (Bottom) Scatter plots reporting the responses
with its weaker V1 input (31). (B) Drifting gratings (diameter, 20°) were of all units measured during the stimulus presentation period (0.9 s).
presented to awake mice conditionally expressing ChR2 in V1 inhibitory Green data points, example units in (C). (E) Injection of the retrograde
neurons. Recordings were simultaneously performed in POR and in tracer CTB in POR. (F) (Left) TdTomato injection site in V1 with
V1. A light-emitting diode (LED)–coupled optic fiber was used to anterograde projection to POR (white) and CTB injection in POR (red).
silence V1. (C) Example experiment. (Left) V1 recordings; (right) POR (Middle) CTB+ neurons in dLGN and pulvinar nuclei. (Right) Higher-
recordings. (Top) Heatmaps of the receptive fields of multiunit activity. magnification image of the region delineated by the square in the middle
Dotted circle shows position of the visual stimulus. (Bottom) Raster plots image. (G) Distribution of retrogradely labeled dLGN and pulvinar neurons
and PSTH of RS units under control conditions (black) and during V1 along the thalamic rostro-caudal axis (ratio of CTB+ cells in pulvinar or
silencing (blue). Black horizontal bar, duration of stimulus presentation; in dLGN to the total CTB+ cells counted in the two nuclei; 45 coronal
blue horizontal bar, period of V1 silencing. (D) Summary of all experiments sections, three mice).
superficial layers of SC overlapped (see materials 0.0001, Wilcoxon signed-rank test, n = 96, 5 mice), receptive field silenced in SC. That was evident
and methods and figs. S1B and S9). SC silencing across cortical depths in a homogeneous manner for dot trajectories covering a large fraction
almost completely abolished the response of POR (fig. S10). The reduction of POR responses to dots of visual space, where SC silencing created a
to the dots (Fig. 3D) (93.77 ± 1.95% average de- was particularly pronounced for the portion of “scotoma” in the response of POR neurons
crease ± SEM in visually evoked firing rate; P < the POR receptive field that overlapped with the (fig. S9). To directly compare the effect of SC
silencing with that of V1 silencing, we also pre- highlighting the much stronger impact of SC than Because SC sends sparse inhibitory GABAergic
sented drifting gratings (Fig. 3, E and F) iden- V1 on visually evoked activity in POR (79.83 ± projections to the dLGN (21), our optogenetic
tical to those used to measure V1 silencing (Fig. 1, 4.46% average decrease ± SEM in visually evoked activation of GABAergic projection neurons in
C and D). Optogenetic silencing of SC suppressed firing rate; P < 0.0001, Wilcoxon signed-rank test, SC might suppress dLGN neurons. The dLGN
the response of POR to drifting gratings (Fig. 3F), n = 44, 2 mice). projects to other visual areas in addition to V1 (16)
V1
dLGN Pulv
Pulv dLGN
(A) (Top) Coronal
sections showing the
injection sites of AAV1.
CAG.TdTomato in V1
500 µm 500 µm 500 µm 500 µm
and AAV1.CAG.GFP in
SC
Normalized Fluorescence Density
1
SC (left) and of V1 and SC to pulvinar
V1 to pulvinar
SC projections to 0.8 V1
dLGN and pulvinar
(Pulv) for three repre- 0.6
SC
sentative sections
of stimulus presentation; 0
0 +1 +2 +3
0
0 +1 +2 +3 0 +1 +2 +3 0 +1 +2 +3
blue horizontal bar, period Time from stimulus onset (s) Time from stimulus onset (s) Time from stimulus onset (s) Time from stimulus onset (s)
C.Pulv.firing rate-laser SC ON (Hz)
of SC silencing. (Right)
15 20
PSTH of a simultaneously 20 30
recorded unit in the 15 15
10 20
caudal pulvinar. (Third
10 10
row) Average PSTH
5 10
for 33 (left) and 34 (right) 5 5
isolated units in SC and
0 0 0 0
in caudal pulvinar (five
0 5 10 15 0 5 10 15 20 0 10 20 30 0 5 10 15 20
animals). (Bottom row) SC firing rate-laser SC OFF (Hz) C.Pulv..firing rate-laser SC OFF (Hz) C.Pulv..firing rate-LED V1 OFF (Hz) R.Pulv..firing rate-LED V1 OFF (Hz)
Scatter plots of firing
rates averaged over a 450-ms interval (i.e., the response window; see caudal pulvinar. (Second row) PSTH of a unit in caudal pulvinar. Black,
materials and methods for details on the moving dot analysis) during the control; blue, V1 silencing. (Third row) Average PSTH for 63 isolated units
period of visual stimulation. Green data points, example units shown in the (seven animals). (Bottom row) Scatter plot as in (B). (D) Similar experiment
second row. (C) (Top row) V1 silencing and simultaneous recordings in as shown in (C) but recording from rostral pulvinar (16 units; three animals).
(although not POR) (Fig. 1E). If visual responses mediated visual responses in POR. We therefore the receptive field of the recording site in POR.
in POR depended on a geniculate input relayed blocked neuronal activity in SC with tetrodotoxin TTX application abolished visually evoked re-
via other visual areas, rather than on a collicular (TTX) injected in the stratum opticum of SC (Fig. 3, sponses in POR to both moving dots (Fig. 3H)
input, optogenetic activation of GABAergic SC G and H, and fig. S11). Again, we ensured that the (94.46 ± 3.18% average decrease ± SEM in
neurons could reduce putative geniculate- receptive field of the TTX injection site matched visually evoked firing rate; P < 0.0001, n = 44,
POR
injected in SC and AAV8. Bregma: -3.07mm
L4
POR V1
P
CAG.Flex.GFP was injected AAV8-CAG
0.4
Flex-GFP
in caudal pulvinar. AAV1. SC L5
CAG.TdTomato injected in Pulv 0.2
(caudal) L6
V1 was used to identify Pulv
Caudal Rostral
higher visual areas. 1mm 150 µm 300 µm
Caudal pulvinar 0
Td-Tomato / GFP / DAPI GFP axons (GFP) POR LI TEa TEp A/RL LM AL AM P PM
Delineated cortical areas
are as shown in fig. S8.
(B) (Left) Double labeling C Moving dot D POR single unit 0.6
POR average
0.6
4
along POR cortical depth
(five animals). (Right) Laser Rec. 10 0.4
2
Firing rate (Hz)
Fluorescence density 8
POR 6
distribution of trans- 4
0.2 0
synaptically labeled caudal 2
SC 0
pulvinar axons across -1 -0.5 0 +0.5 +1
0
-1 -0.5 0 +0.5 +1
-2
-2 0 2 4 6 10 30
cortical areas. Green bars, Time from stimulus onset (s) Time from stimulus onset (s) POR firing rate-laser SC OFF (Hz)
normalized averages
and SEM (five animals) G Moving dot H POR single unit 0.8
POR average
-20
Time from TTX inj.(min)
8
POR firing rate after TTX injection (Hz)
3 mice) and drifting gratings (fig. S11) (92.46 ± respond to small objects moving in the field of that occur as the dot moves along its trajectory.
3.79% average decrease in visually evoked firing view is a characteristic property of the SC (21). If so, the exact sequence of the changes in lumi-
rate; P < 0.0001, Wilcoxon signed-rank test, n = 39, We compared the response of V1 and POR to nance along the trajectory may not be relevant
3 mice). Baseline activity in POR was unaffected, small moving objects. The response of a neuron for eliciting a response. In the other case, the
indicating that the suppression of visual responses to a dot moving on a monitor may report differ- neuron may selectively respond to the motion
was not due to a direct action of TTX on POR. ent aspects of the stimulus. In one case, the neu- of the dot, i.e., to changes in luminance occurring
Compared with V1, does POR capture distinct ronal response may simply report local changes sequentially at adjacent spatial positions. We
properties of the visual world? The ability to in luminance within the neuron’s receptive field therefore presented two different stimuli: a
iteration showed
2
a different random
sequence. (Right) 4 4 1
Recordings were
performed in V1 or 0
0 0
POR. (B) Raster plot -1 0 +1 -1 0 +1 0 1 2 3 4 5 10 20
and PSTH of a V1 unit Time from stimulus onset (s) Time from stimulus onset (s) V1 firing rate - Moving Dot (Hz)
in response to a
moving dot (left) or a C POR Moving Dot Random Dot 20
2
versus random dots
(67 units, five animals). 4 4 1
Green data point,
0
example unit shown 0 0
on the left. (C) As -1 0 +1 -1 0 +1 0 1 2 3 4 5 10 20
Time from stimulus onset (s) Time from stimulus onset (s) POR firing rate - Moving Dot (Hz)
in (B) but for POR
(56 units, five animals).
Note that the shown D V1 POR
p<0.001
1 1
POR unit did not 1 p>0.001
POR p(Moving Dot > cut-off)
V1 p(Moving Dot > cut-off)
0.8
Fraction of trials
Fraction of trials
“moving dot” and a “random dot” (Fig. 4A). The areas (23, 24). However, though this selectivity to 6. S. Molotchnikoff, F. Hubert, Brain Res. 510, 223–228
moving dot stimulus consisted of a small dot moving objects was believed to result from the (1990).
7. R. A. Berman, R. H. Wurtz, J. Neurosci. 30, 6342–6354
shifting position incrementally along a linear hierarchical cortical processing of geniculate (2010).
trajectory through the receptive field of the inputs entering V1 (23, 24), our data indicate 8. D. C. Lyon, J. J. Nassi, E. M. Callaway, Neuron 65, 270–279
neuron (the same type of stimulus as used in that this property of POR depends on collicular (2010).
experiments described above). For the random input and could be directly inherited from SC. 9. M. Tohmi, R. Meguro, H. Tsukano, R. Hishida, K. Shibuki,
Curr. Biol. 24, 587–597 (2014).
dot stimulus, the dot positions along the same Similarly, the expanded representation of the 10. N. A. Zhou, P. S. Maire, S. P. Masterson, M. E. Bickford,
trajectory were randomized (Fig. 4A). Except for upper visual hemifield reported in POR (24, 25) Vis. Neurosci. 34, E011 (2017).
the temporal order of the dot positions, the two could also be directly inherited from the equally 11. H. R. Rodman, C. G. Gross, T. D. Albright, J. Neurosci. 10,
stimuli were identical. V1 neurons responded biased representation in SC (26). Because the 1154–1164 (1990).
12. T. Ogino, K. Ohtsuka, Invest. Ophthalmol. Vis. Sci. 41, 955–960
almost equally well to moving and to random colliculo-cortical pathway is believed to be phylo- (2000).
dots (Fig. 4B) [25.19% (67 of 266) of the units genetically older than the geniculate-V1 pathway 13. A. Zénon, R. J. Krauzlis, Nature 489, 434–437 (2012).
isolated from V1 responded to moving and/or (27), it is tempting to regard POR as an ancestral 14. Q. Wang, A. Burkhalter, J. Comp. Neurol. 502, 339–357
random dots; average firing rate ± SEM for mov- primary visual area. (2007).
15. C. R. Burgess et al., Neuron 91, 1154–1169 (2016).
ing dot: 1.62 ± 0.19 Hz; for random dot: 1.13 ± Previous reports of SC lesions in cats (12) and 16. L. L. Glickfeld, S. R. Olsen, Annu. Rev. Vision Sci. 3, 251–273
0.16 Hz; n = 67; 5 mice]. For all responsive V1 rodents (9) described only a slight reduction, if (2017).
neurons, the moving dot produced only a 1.4-fold- any, of visually evoked activity in various visual 17. A. D. Lien, M. Scanziani, Nat. Neurosci. 16, 1315–1323
higher average firing response than the random cortical areas. Furthermore, in rodents, this re- (2013).
18. N. Zhou, S. P. Masterson, J. K. Damron, W. Guido,
dot. The response of POR neurons to the same duction depends on the features of the stimulus M. E. Bickford, J. Neurosci. 38, 347–362 (2018).
stimuli, however, showed a marked preference (9). However, none of these recordings was per- 19. D. B. Bender, Brain Res. 279, 258–261 (1983).
for the moving dot over the random dot (Fig. 4C). formed in POR. In primates, SC silencing and 20. C. Bennett, S. D. Gale, M. E. Garrett, M. L. Newton, E. M. Callaway,
deep Pacific cooling in the Little Ice Age relative to the 1990s, the mag-
nitude of our results is altered (fig. S3), but not the
qualitative pattern. In a general circulation model
G. Gebbie1* and P. Huybers2 not subject to such simplified assumptions, the
centennial-scale subsurface temperature response
Proxy records show that before the onset of modern anthropogenic warming, globally is also well approximated by the transport of an
coherent cooling occurred from the Medieval Warm Period to the Little Ice Age. The unchanging circulation (16). Of course, it cannot
long memory of the ocean suggests that these historical surface anomalies are be excluded that changes in deep circulation—for
associated with ongoing deep-ocean temperature adjustments. Combining an ocean example, in response to altered deep water forma-
model with modern and paleoceanographic data leads to a prediction that the deep tion rates or winds (17)—counteract the basic pattern
Pacific is still adjusting to the cooling going into the Little Ice Age, whereas temperature of temperature response expected from modern
trends in the surface ocean and deep Atlantic reflect modern warming. This prediction circulation. The results of EQ-0015 are thus con-
is corroborated by temperature changes identified between the HMS Challenger expedition sidered a prediction that requires further testing.
of the 1870s and modern hydrography. The implied heat loss in the deep ocean since Differences in the simulated timing and mag-
1750 CE offsets one-fourth of the global heat gain in the upper ocean. nitude of temperature trends between the Atlantic
D
and Pacific offer a fingerprint of historical changes
23. S. G. Purkey, G. C. Johnson, J. Clim. 23, 6336–6351 33. P. J. Durack, P. J. Gleckler, F. W. Landerer, K. E. Taylor, Competing interests: The authors declare that they
(2010). Nat. Clim. Chang. 4, 999–1005 (2014). have no competing financial interests. Data and materials
24. D. G. Desbruyères, S. G. Purkey, E. L. McDonagh, 34. J. M. Gregory et al., Geophys. Res. Lett. 40, 1600–1604 availability: Data to reproduce the findings are available
G. C. Johnson, B. A. King, Geophys. Res. Lett. 43, (2013). at the National Centers for Environmental Information,
10356–10365 (2016). accession number 0178641.
25. M. Palmer et al., Clim. Dyn. 49, 909–930 (2017). ACKN OWLED GMEN TS
26. I. Fukumori, Mon. Weather Rev. 130, 1370–1383 (2002). We thank C. Wunsch for highlighting the potential influence SUPPLEMENTARY MATERIALS
27. A. Köhl, Q. J. R. Meteorol. Soc. 141, 166–181 (2015). of past climate events in the modern ocean; D. Halpern for www.sciencemag.org/content/363/6422/70/suppl/DC1
28. A. Atwood, E. Wu, D. Frierson, D. Battisti, J. Sachs, J. Clim. 29, pointing us to the HMS Challenger data; U. Ninnemann, Materials and Methods
1161–1178 (2016). K. Nisancioglu, T. Eldevik, T. Furevik, Y. Rosenthal, Supplementary Text
29. H. Stommel, Proc. Natl. Acad. Sci. U.S.A. 76, 3051–3055 D. Roemmich, L. H. Smedsrud, and T. Stocker for discussions; Table S1
(1979). and three anonymous reviewers for suggestions. Funding: Figs. S1 to S9
30. Y. Rosenthal, B. K. Linsley, D. W. Oppo, Science 342, 617–621 Supported by the James E. and Barbara V. Moltz Fellowship Movie S1
(2013). and NSF grant OCE-1357121 (G.G.) and by NSF grant References (35–46)
31. Y. Rosenthal, J. Kalansky, A. Morley, B. Linsley, Quat. Sci. Rev. OCE-1558939 (P.H.). Author contributions: G.G. and P.H.
155, 1–12 (2017). performed the research and the writing. G.G. contributed 15 September 2018; accepted 12 November 2018
32. S. Levitus et al., Geophys. Res. Lett. 39, L10603 (2012). as lead author; P.H. contributed as the co-author. 10.1126/science.aar8413
epicenter of the Nigeria 2018 Lassa coding the RNA polymerase and the zinc-binding
protein) and S (small segment encoding the
glycoprotein and the nucleoprotein) segments,
fever outbreak respectively (9), even PCR-based laboratory
diagnosis poses a serious challenge. Designing
L. E. Kafetzopoulou1,2,3, S. T. Pullan1,2, P. Lemey4, M. A. Suchard5, D. U. Ehichioya3,6,
targeted whole-genome sequencing approaches,
such as those using PCR amplicons or bait-and-
M. Pahlmann3,6, A. Thielebein3,6, J. Hinzmann3,6, L. Oestereich3,6, D. M. Wozniak3,6,
capture probes, without prior knowledge of the
K. Efthymiadis7, D. Schachten3, F. Koenig3, J. Matjeschk3, S. Lorenzen3, S. Lumley1,
targeted LASV lineage is therefore cumbersome.
Y. Ighodalo8, D. I. Adomeh8, T. Olokor8, E. Omomoh8, R. Omiunu8, J. Agbukor8,
Random reverse-transcription (RT) and am-
B. Ebo8, J. Aiyepada8, P. Ebhodaghe8, B. Osiemi8, S. Ehikhametalor8, P. Akhilomen8, plification by sequence-independent single primer
M. Airende8, R. Esumeh8, E. Muoebonam8, R. Giwa8, A. Ekanem8, G. Igenegbale8, amplification (SISPA) for metagenomic sequenc-
G. Odigie8, G. Okonofua8, R. Enigbe8, J. Oyakhilome8, E. O. Yerumoh8, I. Odia8, ing to identify RNA viruses has been demon-
C. Aire8, M. Okonofua8, R. Atafo8, E. Tobin8, D. Asogun8,9, N. Akpede8, strated to work on the MinION (10), and our
P. O. Okokhere8,9, M. O. Rafiu8, K. O. Iraoyah8, C. O. Iruolagbe8, P. Akhideno8, previous work highlighted the feasibility of re-
C. Erameh8, G. Akpede8,9, E. Isibor8, D. Naidoo10, R. Hewson1,2,11,12, J. A. Hiscox2,13,14, trieving complete viral genomes directly from
L
Selected samples covered the wide range of
assa fever is an acute viral hemorrhagic trol (NCDC) and the World Health Organization clinical viral loads observed, including several
illness, first described in 1969 in the town of (WHO) urgently requested sequencing informa- samples testing negative in one of the two real-
Lassa, Nigeria (1). It is contracted primarily tion and preliminary results from our pilot-scale time RT-PCR assays used (fig. S3 and data S1).
through exposure to urine or feces of in- study, in which we used a metagenomic ap- Up to six samples were run in multiplex per
fected Mastomys spp. rodents or, less fre- proach with the Oxford Nanopore MinION de- MinION flow cell, along with a negative con-
quently, through the bodily fluids of infected vice (Oxford Nanopore Technologies) to conduct trol. To produce high-confidence consensus se-
humans. Lassa virus (LASV) is endemic in parts in-country, mid-outbreak viral genome sequencing. quences for phylogenetic inference, we chose
of West Africa, including Nigeria, Benin, Côte This instigated a major uptick in sequencing efforts, to map both basecalled reads and raw signal
d’Ivoire, Mali, Sierra Leone, Guinea, and Liberia leading to the sequencing of 120 samples. data to a reference sequence and call variants
(2). The upsurge of Lassa fever cases during the Nanopore sequencing is an emerging technol- using Nanopolish software, as developed for
2018 endemic season in Nigeria—referred to ogy with great potential. The MinION is a small, the West African Ebola virus disease outbreak
here as the 2018 Lassa fever outbreak—has been robust sequencing device suited for the genetic (5); basecalled reads were then remapped to
the largest on record, reaching 1495 suspected analysis of pathogens in remote or resource- the consensus and a further round of correc-
cases and 376 confirmed cases and affecting limited settings (4). Nanopore sequencing of tion was applied (fig. S4). Owing to the di-
more than 18 states by 18 March (fig. S1). This polymerase chain reaction (PCR) amplicons of versity of LASV, selection of an individual
notably exceeds the 102 confirmed cases reported Ebola virus genomes provided important data reference genome for read alignment was re-
during the same period in 2017 (fig. S1) (3). The from the field in real time during the 2014–2016 quired for each sample. To select the closest
unprecedented scale of the outbreak raised fears Ebola virus disease outbreak in West Africa (5), existing LASV reference genome, nonhuman
of the emergence of a strain with a higher rate and a more sophisticated multiplex amplicon se- reads from each sample were assembled de
of transmission. Because of these concerns, on quencing methodology (6) has been used effective- novo using Canu (12). A notable proportion of
28 February the Nigeria Centre for Disease Con- ly during recent Zika and yellow fever outbreaks reads generated per sample were LASV at an
1
Public Health England, National Infection Service, Porton Down, UK. 2National Institute of Health Research (NIHR), Health Protection Research Unit in Emerging and Zoonotic Infections, University of
Liverpool, Liverpool, UK. 3Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany. 4Department of Microbiology and Immunology, Rega Institute, KU Leuven – University of Leuven, Leuven,
Belgium. 5Departments of Biomathematics, Biostatistics, and Human Genetics, University of California, Los Angeles, CA, USA. 6German Center for Infection Research (DZIF), partner site Hamburg,
Germany. 7Artificial Intelligence Laboratory, Vrije Universiteit Brussel, Brussels, Belgium. 8Irrua Specialist Teaching Hospital, Irrua, Nigeria. 9Faculty of Clinical Sciences, College of Medicine, Ambrose Alli
University, Ekpoma, Nigeria. 10World Health Organization, Geneva, Switzerland. 11Faculty of Infectious and Tropical Diseases, Department of Pathogen Molecular Biology, London School of Hygiene and
Tropical Medicine, London, UK. 12Faculty of Clinical Sciences and International Public Health, Liverpool School of Tropical Medicine, Liverpool, UK. 13Singapore Immunology Network, Agency for Science,
Technology and Research (A*STAR), Singapore. 14Institute of Infection and Global Health, University of Liverpool, Liverpool, UK. 15Nigeria Centre for Disease Control, Abuja, Nigeria.
*These authors contributed equally to this work.
†Corresponding author. Email: guenther@bni.uni-hamburg.de
V
III
IV
I
VI
0.1 subst./site
100
91
99
93
100
88
100
0.02
Fig. 1. Phylogenetic reconstruction of the S segment data. The circular highlights the human LASV sequences obtained from previous years
tree includes 96 sequences from 2012 to 2017, 88 sequences from 2018, (light gray); sequences obtained from rodent samples (dark gray); and, for
and sequences available from GenBank. The rectangular tree focuses on 2018, the first seven sequences generated in Nigeria (light pink), the
the genotype II clade (in blue in the circular tree), which includes most of remaining 28 sequences analyzed on-site (medium pink), and the
the 2018 sequences. The six genotypes are indicated with different colors remaining sequences finalized in Europe (dark pink). The same color code
and roman numerals. Bootstrap support >90% is indicated with a small is used in the genotype II rectangular tree. Bootstrap values >80% are
gray circle at the middle of their respective branches. The color strip shown for the major genotype II lineages.
average frequency of 4.26% with a maximum of at 20-fold depth. LASV accounted for 0.83% of as a frame of reference to document how the
42.9%, allowing for sufficient genomic sequence reads in the same sample, providing 96% genome genomic data generated in real time (made pub-
(>70%) for phylogenetic comparison of at least coverage. These findings demonstrate the po- licly available at virological.org) provided valu-
one segment in 91 of the samples tested (figs. tential of this simple approach to identify mul- able epidemiological insights into the unfolding
S3 to S6). tiple RNA viruses, including those present as outbreak dynamics.
Additionally, sequences were validated by co-infections. In all other samples tested, LASV Maximum likelihood phylogenetic reconstruc-
Illumina resequencing of 14 SISPA prepara- was the sole pathogen identified despite a small tion of the S segment sequences indicates that all
tions, which matched with their Oxford Nano- number of reads classified as other viruses (fig. 2018 viruses fall within the Nigerian LASV
pore counterparts with little to no divergence, S7 and data S1). diversity, specifically within genotypes II and
confirming the accuracy of the Oxford Nano- To dissect the molecular epidemiology of the III, and they are phylogenetically interspersed
pore approach (table S1). 2018 Lassa fever outbreak in Nigeria, we per- with Nigerian LASV sequences from previous
Metagenomic classification using the Centri- formed phylogenetic analysis of all newly gen- years (Fig. 1). This phylogenetic pattern is
fuge software system (13) identified 0.10% of erated LASV sequences together with unpublished mimicked by the L segment reconstruction
reads from sample 110 as originating from hepa- sequences from previous years (data S2) and (fig. S8). Only seven viruses in the entire genome
titis A virus, providing 74% genome coverage sequences available in GenBank. We used this dataset (n = 348) were identified as clustering
significantly differently in the L and S segments substitutions per site per year) (Fig. 2 and coding region of human-to-human LASV trans-
(supplementary methods), which is in line with figs. S9 and S10), in agreement with previous mission (14). Four clusters of sequences showing
the small number of potential LASV reassort- estimates (9). We used these rate estimates ≤4 and ≤12 nucleotide differences in the S and L
ments identified previously (9). The phylogenetic together with an estimate of the time be- segments, respectively, were identified (035-045,
pattern implicates independent spillover from tween successive cases in a transmission chain 035-058, 137-138, and 053-089-106; for some of
rodent hosts as the major driver of Lassa to assess how many substitutions can be ex- them, only the S or L segment sequence was
fever incidence during the outbreak (Fig. 1 and pected between directly linked infections. We available). Retrospective tracing revealed that
fig. S8). compared conservative to more liberal expec- the sequences for pairs 137-138 and 035-058
However, a number of sequences from the tations, the latter accommodating an indepen- were derived from the same patients. Epide-
2018 outbreak clustered as pairs in the phyloge- dent upper estimate of potential sequencing miological investigation of the remaining clus-
netic reconstructions, raising concerns over errors (Fig. 2 and fig. S9). In the S segment, for ters did not provide evidence for transmission
human-to-human transmission. We illustrate example, more than two substitutions between chains, though direct linkage cannot be ex-
such cluster pairs in a Bayesian time-measured sequences from directly linked infections is cluded. Even when applying liberal assumptions
tree estimated from genotype II S (Fig. 2) and L highly unlikely (P < 0.01 and P = 0.03, respectively, for the number of mutations during human-to-
segment sequences (fig. S9). These analyses for the conservative and liberal probability es- human transmission, the vast majority of cases
resulted in highly similar evolutionary rate timates). This expectation is consistent with during the 2018 outbreak resulted from spillover
estimates for both segments (mean, ~1.2 × 10−3 the low number of substitutions observed in the from the natural reservoir.
1850
0.8
0.0014
probability
1900
0.6
0.0013
0.4
0.0012
0.2
0.0011
0.0
0.0010
0 1 2 3 4
substitutions
1950
2000
5 0 6 5 2 59 6 19 0 39 46 31 19 156 6 18 15 91
88 175 137/138 4
035-045 096-115 053-089/106 089-106
Fig. 2. Assessing the potential for direct linkage between pairs of 2018 on the mean evolutionary rate estimate and a mean estimate for the
sequences in the S segment. The maximum clade credibility tree generation time, whereas the light blue distribution is based on upper
summarizes a Bayesian evolutionary inference for the genotype II sequences estimates and also incorporates an upper estimate for the MinION
in the S segment. A time scale and a marginal posterior distribution for the sequencing error (supplementary methods). At the bottom of the tree,
time to the most recent common ancestor are shown to the left. The size of clusters of sequences for which human-to-human transmission cannot be
the internal node circles reflects posterior probability support values. 2018 excluded according to the upper estimates of generation time are indicated.
sequences clustering as pairs are indicated in dark pink; the number of A pair of identical sequences (137-138) that was retrospectively found
substitutions between them is indicated at their respective tips. A posterior to be derived from the same patient is marked with a gray box. One pair
estimate of the evolutionary rate and probability distributions for observing (096-115) was disregarded as a potential transmission chain because
a given number of substitutions during a human-to-human transmission of 21 differences in the L segment (fig. S9). The temporal signal before BEAST
event are shown as insets. The distribution represented by gray bars is based inference was explored in fig. S10.
A request for information on circulating 4. M. Jain, H. E. Olsen, B. Paten, M. Akeson, Genome Biol. 17, 239 and ZMV I 1-2517WHO010) and through the Global Health
strains was made on 28 February at the height (2016). Protection Program (agreement ZMVI1-2517-GHP-704), the
5. J. Quick et al., Nature 530, 228–232 (2016). German Federal Ministry for Economic Cooperation and
of the outbreak; within 10 days, our pilot study Development through the Rapid Deployment Expert Group to
6. J. Quick et al., Nat. Protoc. 12, 1261–1276 (2017).
was expedited and the initial analysis com- Combat Threats (SEEG), the European Union’s Horizon
7. N. R. Faria et al., Nature 546, 406–410 (2017).
pleted. The fact that the 2018 outbreak was 2020 research and innovation program to S.G. (grant 653316-
8. N. R. Faria et al., Science 361, 894–899 (2018).
fueled by the circulating LASV diversity and EVAg), and the German Research Foundation (DFG) to S.G.
9. K. G. Andersen et al., Cell 162, 738–750 (2015).
and D.U.E. (GU 883/4-1). D.U.E. acknowledges fellowships from
not by transmission of a new or divergent lin- 10. A. L. Greninger et al., Genome Med. 7, 99 (2015). Alexander von Humboldt Foundation and Kirmser Foundation.
eage was already evident from the first seven 11. L. E. Kafetzopoulou et al., Euro Surveill. 23, 1800228 (2018). The funders had no role in the design and interpretation
genomes generated by 10 March (fig. S1). This 12. S. Koren et al., Genome Res. 27, 722–736 (2017). of the data and preparation of the manuscript. Author
information was promptly communicated 13. D. Kim, L. Song, F. P. Breitwieser, S. L. Salzberg, Genome Res. contributions: L.E.K., S.G., S.D., S.T.P., and P.L. conceptualized
26, 1721–1729 (2016). the study; L.E.K., S.T.P., and P.L. set up the methodology;
to the NCDC, forming the basis of its report L.E.K., J.H., A.T., S.D., and D.U.E. performed sequencing and
14. S. L. M. Whitmer et al., Emerg. Infect. Dis. 24, 599–602
released on 12 March 2018 (15). Whereas this (2018). data validation; L.E.K., P.L., M.A.S., S.T.P., D.S., F.K., J.M.,
small sample was restricted to genotype II, 15. Nigeria Centre for Disease Control, “Early Results of Lassa and S.Lo. performed the formal sequencing data analysis; L.E.K.,
the final collection of 36 LASV genome se- Virus Sequencing & Implications for Current Outbreak S.D., J.H., A.T., M.P., and L.O. performed sample selection,
Response in Nigeria” (2018); https://ncdc.gov.ng/news/121/ data collection, and organization of sequencing datasets; D.M.
quences generated on-site also included a W., K.E., D.S., F.K., and J.M. set up and assisted with the
early-results-of-lassa-virus-sequencing-%26-implications-for-
representative of genotype III (Fig. 1 and fig. current-outbreak-response-in-nigeria. bioinformatics pipeline; M.A.S., D.U.O., M.P., L.O., Y.I., D.I.A.,
S9), further supporting the spillover of long- 16. P. Lemey, ISTH-BNITM-PHE/LASVsequencing: T.O., E.O., R.O., J.Ag., B.E., J.Ai., P.E., B.O., S.E., P.A., M.A.,
standing LASV diversity in the outbreak. The LASVrelease, Zenodo (2018); http://doi.org/10.5281/ R.Es., E.M., R.G., A.E., G.I., G.Od., G.Ok., R.En., J.O., E.O.Y., I.O.,
zenodo.1481015. C.A., M.O., R.A., E.T., D.A., N.A., P.O.O., M.O.R., K.O.I.,
conclusions drawn from the first set of ge- C.O.I., P.A., C.E., G.A., and E.I. performed diagnostic analysis;
nome sequences immediately eased fears of L.E.K., S.T.P., P.L., and S.D. visualized data presentation;
extensive human-to-human transmission and L.E.K., S.T.P., P.L., and S.D. wrote the manuscript; all authors
synapsid with erect limbs the posture of the hindlimbs was erect (12). By
contrast, most authors agree that Triassic dicyn-
odonts had sprawling forelimbs with the hori-
Tomasz Sulej1 and Grzegorz Niedźwiedzki2* zontal position of the humerus (13). Lisowicia has
a relatively conventional dicynodont hindlimb
Here, we describe the dicynodont Lisowicia bojani, from the Late Triassic of Poland, a construction but departs from the standard
gigantic synapsid with seemingly upright subcursorial limbs that reached an estimated forelimb posture (Fig. 1). In many respects, its
length of more than 4.5 meters, height of 2.6 meters, and body mass of 9 tons. Lisowicia is forelimb position resembles that of large quad-
the youngest undisputed dicynodont and the largest nondinosaurian terrestrial tetrapod rupedal dinosaurs, but forelimb elements of
from the Triassic. The lack of lines of arrested growth and the highly remodeled cortex Lisowicia are morphologically similar to other
of its limb bones suggest permanently rapid growth and recalls that of dinosaurs and dicynodonts (Fig. 2). The result is a subcursorial
mammals. The discovery of Lisowicia overturns the established picture of the Triassic tetrapod with upright limb posture, unlike any
megaherbivore radiation as a phenomenon restricted to dinosaurs and shows that other known stem-group mammal but compa-
stem-group mammals were capable of reaching body sizes that were not attained again rable with that of large crown-group mammals
in mammalian evolution until the latest Eocene. such as rhinoceroses and hippopotami, as well as
T
quadrupedal dinosaurs such as sauropodomorphs
of the largest bones of Lisowicia suggests that Triassic land nondinosaur tetrapod. Gigantism faunas suggest evolutionary decline, the con-
the studied material represents either a fast- in herbivorous dinosaurs first emerged in the cept of the Late Triassic kannemeyeriiforms as
growing taxon or juvenile/subadult individuals Late Triassic, with the evolution of the first highly geographically restricted relicts is no longer
of extremely large body size. However, the sec- large sauropodomorphs (16, 17) and then the valid (22). The recognition of dicynodonts in
ond explanation is rather unlikely because of its earliest true sauropods (18). Until now, gigan- the late Norian–earliest Rhaetian of Europe (10)
size and that these two bones are well ossified. tism in the Triassic appeared to be entirely a and Karoo Basin (21) conflicts with some ideas
Lisowicia demonstrates that Late Triassic di- dinosaur adaptation (19), and previously known on early Late Triassic dicynodont extinction and
cynodonts became specialized herbivores. It dis- Triassic dicynodonts were substantially smaller. survival, namely their supposed absence during
plays several features in the limb skeleton that The discovery of Lisowicia suggests that general the radiation of early sauropodomorphs (Fig. 3B).
suggest that this group evolved new postural ecological factors may have been driving the Upright posture has been associated with de-
adaptations. The massive scapula of Lisowicia process, rather than clade-specific attributes of creased joint stress and energetic cost of loco-
lacks a distinct acromion process for articulation dinosaurs (20). motion (23). Selection pressures on some aspects
with the clavicle, the scapula articulates with the The find of Lisowicia shows that at least of lifestyle or ecology were likely drivers of the
humerus on its posteroventrally (instead of pos- one dicynodont lineage also participated in the evolution of the distinct posture of Lisowicia
terolaterally) located glenoid, and distal articu- “push for gigantism” at the same time as the among dicynodonts. Increase in the body size of
lation surfaces of the humerus are in the same sauropodomorphs (20) but also suggests that dicynodonts across the Late Triassic may have
plane instead of being rotated (formal taxonomic their evolutionary history in the Late Triassic is been driven by selection pressure to reach a size
description is provided in the supplementary poorly documented (Fig. 3A). In addition, rec- refuge from large predators (24). It is possible
materials). ognition of Lisowicia as a placeriine dicynodont also that the gigantism of the latest dicynodonts
On the basis of published scaling relationships together with the resurrection and recent de- was a metabolic adaptation that allowed these
(14), we estimate an adult body mass of 9000 kg, scription of Pentasaurus from South Africa (21) animals to maximize food retention time and
Fig. 2. Comparison of the reconstructed pectoral girdle of Lisowicia of articulation areas. (B) Reconstruction of large dicynodont Stahleckeria
bojani with another dicynodont, dinosaur, and recent mammal. (GPIT/RE/8001) in anterior and lateral views. (C and D) Hypothetical
(A) Position of bones of L. bojani in anterior and lateral views. Some flexibility of the humerus in protraction-retraction. (E) Reconstruction
proportions of the bones were estimated by means of comparison of rhinoceros Diceros in anterior and lateral views based on MPUWr 502223.
with articulated skeletons of Parakannemeyeria (IVPP V. 979) and (F) Reconstruction of Triceratops in anterior and lateral views based on
Sinokannemeyeria (IVPP V.974), but most were inferred from the size (27). Scale bars, 10 cm.
Fig. 3. Phylogeny of
kannemeyeriiform
dicynodonts and its
relationship with the
changes in femur
length of dicynodonts
and sauropodomorphs.
(A) Time-calibrated
phylogeny of the Triassic
dicynodonts simplified
after (22) (numerical ages
for the base and top of
Norian are based on the
Chronostratigraphic Chart
of the ICS v. 2018/8)
with position of L. bojani.
(B) Femur length
(body size proxy) of
sauropodomorph (black
squares) and dicynodont
(gray circles) taxa from the
to that observed in the evolution of herbivorous 11. T. Sulej, R. Bronowicz, M. Tałanda, G. Niedzwiedzki, Proc. R. PAS) for help with preparation of dicynodont shoulder girdle
dinosaurs in the Mesozoic and mammalian line- Soc. Edinb. 101, 261–269 (2011). virtual model, P. E. Ahlberg (Uppsala University) for discussion,
12. J. Fröbisch, Can. J. Earth Sci. 43, 1297–1308 (2006). D. Snitting (Uppsala University) for help with phylogenetic
ages in the mid-late Paleogene (26). All suggest 13. L. R. Walter, in The Beginning of the Age of Dinosaurs and computed tomography data, N. Campione (University
that in the Late Triassic, there was a substantial (Cambridge Univ. Press, 1986), pp. 89–97. of New England) for his help with body mass estimate, and
temporal overlap in the occurrence of very large 14. N. E. Campione, D. C. Evans, BMC Biol. 10, 60 (2012). K. Zaremba-Niedźwiedzka (Uppsala University) for help during
herbivores: the previously dominant dicynodonts 15. D. Macdonald, The New Encyclopedia of Mammals (Oxford preparation of the manuscript. We are very thankful to
Univ. Press, 2001). anonymous reviewers whose comments radically improved
and their emerging ecological analogs among 16. A. M. Yates, Palaeontology 46, 317–337 (2003). the final version of the paper. Funding: The study was supported
archosaurs, the sauropodomorph dinosaurs. 17. P. M. Sander et al., Biol. Rev. Camb. Philos. Soc. 86, 117–155 by Polish grant (2012/07/B/NZ8/02707) and Swedish
(2011). Vetenskapsrådet grant (2017-05248). Author contributions:
RE FE RENCES AND N OT ES 18. A. M. Yates, J. W. Kitching, Proc. Biol. Sci. 270, 1753–1758 T.S. designed the study. T.S. and G.N. performed the
1. H.-D. Sues, N. C. Fraser, Triassic Life on Land: The Great (2003). comparative and analytical work, participated in morphological
Transition (Columbia Univ. Press, 2010). 19. P. C. Sereno, Science 284, 2137–2147 (1999). studies, and wrote the paper. Competing interests: The authors
2. G. M. King, Anomodontia, Encyclopedia of Paleoherpetology 20. R. B. Sookias, R. J. Butler, R. B. J. Benson, Proc. Biol. Sci. 279, declare no competing interests. Data and materials
(Part 17C) (Gutsav Fischer Verlag, 1988). 2180–2187 (2012). availability: All described specimens are accessioned at the
3. Z. Kielan-Jaworowska, R. L. Cifelli, Z.-X. Luo, Mammals from 21. Ch. F. Kammerer, Palaeontologia Africana 52, 102–128 (2018). Institute of Paleobiology, PAS (Poland).
the Age of Dinosaurs: Origins, Evolution, and Structure 22. C. F. Kammerer, J. Fröbisch, K. D. Angielczyk, PLOS ONE 8,
(Columbia Univ. Press, 2004). e64203 (2013).
SUPPLEMENTARY MATERIALS
4. T. S. Kemp, The Origin and Evolution of Mammals (Oxford Univ. 23. A. A. Biewener, Science 245, 45–48 (1989).
24. G. Niedźwiedzki, P. Gorzelak, T. Sulej, Lethaia 44, 87–92 www.sciencemag.org/content/363/6422/78/suppl/DC1
Press, 2005).
(2011). Materials and Methods
5. J. Fröbisch, Earth Sci. Rev. 95, 119–157 (2009).
25. P. Bajdek, K. Owocki, G. Niedźwiedzki, Palaeogeogr. Supplementary Text
6. J. Fröbisch, PLOS ONE 3, e3733 (2008).
Palaeoclimatol. Palaeoecol. 411, 1–17 (2014). Figs. S1 to S16
7. A. R. Fiorillo, K. Padian, C. Musikasinthorn, Palaios 15, 373–386
26. D. Prothero, Rhinoceros Giants: The Palaeobiology of Tables S1 to S7
(2000).
Indricotheres (Indiana Univ. Press, 2013). References (28–74)
8. R. R. Schoch, Neues Jahrb. Geol. Palaontol. Abh. 263, 119–123
27. S. Fujiwara, J. Vertebr. Paleontol. 29, 1136–1147 (2009). Movies S1 to S4
(2012).
9. M. W. Maisch, C. S. Vega, R. R. Schoch, Palaeodiversity 2, 28 November 2016; resubmitted 4 August 2018
271–278 (2009). ACKN OWLED GMEN TS Accepted 19 October 2018
10. J. Dzik, T. Sulej, G. Niedźwiedzki, Acta Palaeontol. Pol. 53, We thank J. Dzik (Institute of Paleobiology, PAS) for proposing Published online 22 November 2018
733–738 (2008). this research and support, M. Dec (Institute of Paleobiology, 10.1126/science.aal4853
of pelvic reduction in stickleback fish DNA double-strand breaks in yeast artificial chro-
mosomes (Fig. 2A). Constructs without added
test regions broke at background rates of 3.37
Kathleen T. Xie1,2,3, Guliang Wang 4, Abbey C. Thompson1,5, Julia I. Wucherpfennig1, breaks per 106 divisions (Fig. 2B), consistent with
Thomas E. Reimchen6, Andrew D. C. MacColl7, Dolph Schluter8, Michael A. Bell9*, previous reports (14). Chromosomes containing
Karen M. Vasquez4, David M. Kingsley1,2† marine Pel broke ~25 to 50 times more fre-
quently (Fig. 2B), a rate even higher than that
Evolution generates a remarkable breadth of living forms, but many traits evolve repeatedly, by of previously analyzed human fragile sites (14).
mechanisms that are still poorly understood. A classic example of repeated evolution is the loss Pel from freshwater pelvic-reduced populations
of pelvic hindfins in stickleback fish (Gasterosteus aculeatus). Repeated pelvic loss maps to [but not freshwater pelvic-complete populations
recurrent deletions of a pelvic enhancer of the Pitx1 gene. Here, we identify molecular features (fig. S1)] broke at rates similar to that of the con-
contributing to these recurrent deletions. Pitx1 enhancer sequences form alternative DNA trol (Fig. 2B), suggesting that natural Pel muta-
structures in vitro and increase double-strand breaks and deletions in vivo. Enhancer mutability tions remove breakage-prone regions.
depends on DNA replication direction and is caused by TG-dinucleotide repeats. Modeling Reverse complements of marine Pel broke
shows that elevated mutation rates can influence evolution under demographic conditions ~10 to 20 times less frequently than identical
relevant for sticklebacks and humans. DNA fragility may thus help explain why the same loci sequences in the forward orientation (Fig. 2B).
M
any phenotypic traits evolve repeatedly tributions of plasmid topoisomers (11) (Fig. 1A). affect Pel fragility (Fig. 2C). In contrast, adding a
in organisms adapting to similar envi- A control stickleback genomic region showed replication origin on the opposite side of Pel did
ronments, and studying these cases can smooth curves characteristic of B-DNA (Fig. 1B). switch fragility, making the forward sequence
reveal ecological and genetic factors shap- In contrast, Pel sequences from marine popula- stable and the reverse complement fragile (Fig.
ing parallel evolution (1, 2). For example, tions showed mobility shifts characteristic of 2C). Thus, Pel fragility is markedly dependent
loss of pelvic appendages has evolved repeatedly alternative DNA structure formation (Fig. 1B). on DNA replication direction.
in mammals, amphibians, reptiles, and fishes. Structural transitions started at a negative super- Pel contains abundant runs of alternating
Marine stickleback fish (Gasterosteus aculeatus) helical density of –s = 0.043 and changed ap- pyrimidine-purine repeats (Fig. 3A and data S1),
develop a robust pelvic apparatus, whereas many parent linking numbers by 10 to 16 helical turns, which can adopt alternative structures, such as
freshwater populations have lost pelvic struc- similar to shifts produced by Z-DNA (left-handed Z-DNA, previously associated with deletions in
tures (3). Pelvic reduction is associated with par- DNA, starting –s = 0.046) of ~105 to 170 base bacteria, mice, and humans (16, 17). Three stretches
ticular ecological conditions, is likely adaptive, pairs (bp) (12, 13). Pel sequences from pelvic- of ~15, ~20, and ~50 TG-dinucleotide repeats in
and maps to recurrent and independent dele- reduced populations did not show unusual marine Pel total ~170 bp (consistent with linking
tions of a pelvic enhancer (Pel) upstream of the
homeodomain transcription factor gene (Pitx1)
that show repeatable molecular signatures of pos- A Fig. 1. Marine but not
itive selection (4–7). This unusual spectrum of freshwater Pel alleles
regulatory deletions contrasts with the accu- form alternative
mulation of single-nucleotide changes in other structures in vitro.
studies (6, 8, 9), hinting that special DNA fea- (A) 2D electrophoresis of
tures may shape adaptive variation at the Pitx1 circular DNA topoisomers.
locus (6). A distribution of plasmid
Pel enhancer sequences show high predicted Canonical Structure changes Structure topoisomers is separated
helical twist flexibility (6), a DNA feature asso- topoisomer distribution apparent supercoiling shifts distribution on an agarose gel; each
ciated with delayed replication and fragile site B topological class forms
instability (10). To examine whether Pel forms one spot. Canonical B-DNA
alternative DNA structures in vitro, we used two- forms a smooth distribution.
dimensional (2D) electrophoresis to analyze dis- Alternative structures
cause mobility shifts.
Distribution shifts at the
1
Department of Developmental Biology, Stanford University linking number that induces
School of Medicine, Stanford, CA, USA. 2Howard Hughes alternative structure. Dagger
Medical Institute, Stanford University School of Medicine, Rabbit Slough Little Campbell River Bodega Bay
Stanford, CA, USA. 3Department of Biochemistry, Stanford
symbol, mobility shift.
Marine
University School of Medicine, Stanford, CA, USA. 4Division of (B) Pel from marine and
Pharmacology and Toxicology, University of Texas at Austin, freshwater pelvic-reduced
Austin, TX, USA. 5Department of Genetics, Stanford University populations. Control, Atp1a1.
School of Medicine, Stanford, CA, USA. 6Department of Biology,
University of Victoria, Victoria, BC, Canada. 7School of Life
Sciences, University of Nottingham, Nottingham, UK.
8
Department of Zoology, University of British Columbia,
Vancouver, BC, Canada. 9Department of Ecology and Evolution,
Stony Brook University, Stony Brook, NY, USA.
*Present address: University of California Museum of
Toad Lake Paxton Lake Control
Paleontology, Berkeley, CA, USA.
†Corresponding author. Email: kingsley@stanford.edu Freshwater pelvic-reduced
A B C ori
URA3
URA3
LEU2 seed Test region
Marine Pel region Reverse URA3 ori
Centromere Breakage Telomere
Freshwater transcription direction URA3
Pel region
pelvic-reduced ori ori
LEU2 seed Test region
URA3
Pel region Reverse DNA
Marine RC
URA3
replication direction
New telomere formation
* * * * * * *
LEU2 seed
-4 -4
10 10
Control
(10 cultures each). RC, reverse complement. *P <
RABS RC
RABS RC
RABS RC
BDGB
BDGB
TOAD
RABS
RABS
PAXB
LITC
LITC
Control
Control
Control
RABS
RABS
RABS
0.01 (table S5). See table S6 for population names.
Mutation frequency (x 10 )
60
-4
Pel 50
GC KFSY GC 30
HUMP
20
TG CMCB TG
CA BEPA CA 10
BOOT 0
Control
(TG)30
(TG)41
(CA)30
(CA)41
B C YAC breakage rates F Recovered deletions in mammalian mutation assay
(TG)n (TG)41
supF
(CA)n
* * *
-4
10
GACTTCG GACTTCG
Breaks per division
-5
10
GGT GGT
GT GT
-6
(TG)30 10
(TG) 14
(TG) 43
(TG) 79
(CA) 16
(CA) 50
Control
TGAGCTCGA TGAGCTCGA
Fig. 3. TG-dinucleotide repeats recapitulate structure formation, high Dagger symbol, mobility shift. (C) Yeast artificial chromosome (YAC) breakage
breakage rate, orientation dependence, and deletion spectrum. (A) To- rates for TG- or CA-repeats of varying lengths. *P < 0.01 (table S5). (D) Reporter
scale maps of Pel in different freshwater pelvic-reduced populations (table S6). shuttle plasmid schematic. (E) Mammalian mutation frequencies. Error
Green, Pel sequence driving pelvis expression (6). Tan, TG-repeats. White bars indicate SEM of four or five independent experiments. *P < 0.05
boxes, DNA deletions in indicated populations. Blue, DNA remaining. Letters (Student’s t test). Dagger symbol, deletions dominate mutation spectrum
indicate microhomologies at deletion junctions. (B) 2D gel for (TG)30. (fig. S2A). (F) To-scale map of (TG)41-induced deletions in mammalian cells.
number changes seen in the topoisomer assays microhomology-mediated end-joining repair and and macroscopic loss of pelvic structures in ge-
above). TG-repeats alone induced mobility shifts similar to junctions seen in stickleback pelvic- netic crosses (fig. S5).
in topoisomer assays (Fig. 3B) (18) and elevated reduction alleles (6) (Fig. 3A). Ligation-mediated Could elevated mutation rates contribute to
chromosome breakage in yeast, with longer re- polymerase chain reaction suggested that breaks reuse of Pel deletions in parallel evolution? Pop-
peats stimulating more breaks (Fig. 3C). In con- initiated near the dinucleotide repeats (fig. S2C). ulation genetic modeling indicates that new
trast, both long and short versions of the reverse Taken together, our results indicate that TG- mutations occurring at the low rates of typical
complement sequence (CA-repeats) were stable repeats form alternative DNA structures in vitro single-nucleotide changes (~10−9 mutations per
(Fig. 3C), recapitulating the orientation depen- and can recapitulate the high mutation rates, site per generation) would rarely arise at a parti-
dence of Pel fragility. orientation dependence, and propensity to stim- cular locus in postglacial stickleback populations,
We also tested the effect of TG- and CA-repeats ulate breaks and deletions of the full Pel region. whereas mutations occurring at elevated rates
in mammalian COS-7 cells (Fig. 3D) (19). Dinu- To determine the orientation of Pel sequences (~10−5 mutations per site per generation, for fragile
cleotide repeats elevated mutation frequencies, relative to DNA replication in sticklebacks (Fig. sites) would arise often. When new mutations do
with TG-repeats being more mutagenic than CA- 4A and fig. S3), we sequenced S- and G-phase occur, their subsequent fate is controlled by drift
repeats of comparable length, and longer repeats cells from developing embryos and calculated and selection (21). Neutral or small-effect point
being more mutagenic than shorter repeats (Fig. S/G read-depth ratios to determine replication mutations will usually be lost or rise to fixation
3E), in accordance with results from yeast assays. timing (20). Pel is located in a timing transition slowly, whereas deletions may cause larger pheno-
Mutations stimulated by the most mutagenic se- region (Fig. 4B and fig. S4), consistent with uni- typic effects and can sweep if environmental
quence, (TG)41, were predominantly >100-bp dele- directional replication. The replication direction conditions favor pelvic reduction (Fig. 4D and
tions that removed part or all of the repeat and through Pel matches the fragile orientation (Fig. figs. S6 and S7). The combined effects on both
adjacent reporter gene (Fig. 3F and fig. S2A). 4C), suggesting that Pel would form a TG-repeat– the “arrival of the fittest” and the “survival of the
Approximately 70% of deletion junctions con- associated fragile site in vivo. Experimental CRISPR fittest” may explain why recurrent Pel deletions
tained microhomologies and insertions (Fig. 3F targeting confirmed that initiation of breaks in are the predominant mechanism for evolving
and fig. S2, A and B), consistent with error-prone Pel was sufficient to trigger local DNA deletions stickleback pelvic reduction. For other traits,
ancient standing variants provide an alternative DNA breakage sites in humans (fig. S10). As 23. R. D. Barrett, D. Schluter, Trends Ecol. Evol. 23, 38–44 (2008).
way to overcome the demographic constraints causative changes are identified for a greater 24. 1000 Genomes Project Consortium, Nature 526, 68–74 (2015).
25. R. Moxon, C. Bayliss, D. Hood, Annu. Rev. Genet. 40, 307–333 (2006).
of waiting for de novo mutations in small popu- number of phenotypic traits, it will be interesting 26. A. Stoltzfus, L. Y. Yampolsky, J. Hered. 100, 637–647 (2009).
lations and can also lead to reuse of similar alleles to see the extent to which DNA fragility has in- 27. X. Du et al., Nucleic Acids Res. 42, 12367–12379 (2014).
in different populations (22, 23). fluenced the genes and mutations that underlie 28. S. C. Galen et al., Proc. Natl. Acad. Sci. U.S.A. 112,
13958–13963 (2015).
The demographic parameters typical of stickle- evolutionary change in nature. 29. A. Bacolla, J. A. Tainer, K. M. Vasquez, D. N. Cooper, Nucleic
backs apply to many vertebrates evolving with Acids Res. 44, 5673–5688 (2016).
small population sizes or facing rapid environ- RE FERENCES AND NOTES 30. A. D. Hargreaves et al., Proc. Natl. Acad. Sci. U.S.A. 114,
mental changes. For example, migration of mod- 1. D. Schluter, E. A. Clifford, M. Nemethy, J. S. McKinnon, Am. 7677–7682 (2017).
Nat. 163, 809–822 (2004). 31. C. B. Lowe et al., Genome Res. 28, 256–265 (2018).
ern humans out of Africa occurred with relatively
2. D. L. Stern, V. Orgogozo, Science 323, 746–751 (2009).
small populations adapting to new environments 3. M. A. Bell, Biol. J. Linn. Soc. Lond. 31, 347–382 (1987). AC KNOWLED GME NTS
in 3000 generations or fewer (24). Notably, nearly 4. T. E. Reimchen, Can. J. Zool. 58, 1232–1244 (1980). We thank V. Tien, J. Le, M. Yau, M. Thakur, A. Muralidharan,
half of currently known mutations underlying 5. M. A. Bell, G. Ortí, J. A. Walker, J. P. Koenings, Evolution 47, M. Whitlock, B. Belotserkovskii, R. Driscoll, K. Cimprich, J. Wang,
adaptive traits in modern humans also appear 906–914 (1993). S. Quake, and A. Casper for experimental assistance or advice;
6. Y. F. Chan et al., Science 327, 302–305 (2010). R. Daugherty, J. Rollins, B. Lohman, R. Mollenhauer, M. Reyes, and
to be produced by mechanisms with elevated 7. M. Karhunen, J. Merilä, T. Leinonen, J. M. Cano, O. Ovaskainen, F. von Hippel for help with fieldwork; C. Freudenreich for yeast
mutation rates (table S1). Mol. Ecol. Resour. 13, 746–754 (2013). strains; and Z. Weng and B. Carter for help with high-throughput
High mutation rates have been described at 8. B. Prud’homme et al., Nature 440, 1050–1053 (2006). sequencing and cell sorting. Funding: NIH grants 5P50HG2568
contingency loci in bacteria and other systems 9. D. L. Stern, N. Frankel, Philos. Trans. R. Soc. London Ser. B (D.M.K.), CA093729 (K.M.V.), and 2T32GM007790 (J.I.W.); NSF
368, 20130028 (2013). grant DEB0919184 (M.A.B.); NSF and Stanford CEHG Graduate
(25–30). Our study reveals an example of DNA 10. R. G. Thys, C. E. Lehman, L. C. T. Pierce, Y.-H. Wang, Fellowships (K.T.X.); NIH Predoctoral Fellowship (A.C.T.); HHMI
fragility contributing to repeated morphological Curr. Genomics 16, 60–70 (2015). investigator (D.M.K.). Author contributions: K.T.X. and D.M.K.
evolution in vertebrates. Our data also highlight 11. R. Bowater, F. Aboul-Ela, D. M. Lilley, Methods Enzymol. 212, designed the study. K.T.X., G.W., A.C.T., and J.I.W. performed
T
al gate) of the Sec61 channel, interacting with
he eukaryotic Sec61 or prokaryotic SecY Saccharomyces cerevisiae Sec complex at 3.7-Å the TMs of Sec61b and Sec61g as well as TM1
complex forms a universally conserved resolution by cryo–electron microscopy (cryo-EM) and TM5 of Sec61a (Fig. 2C). Considering the
protein-conducting channel that is essen- (Fig. 1 and figs. S1 and S2). Many side chains extensive interactions between these elements,
tial for biogenesis of many proteins (1–3). are clearly visible in the density map, enabl- the TMs of Sec63 likely make a main contribu-
The channel mediates transport of soluble ing modeling of an accurate atomic structure tion to the association between Sec61 and the
(e.g., secretory) proteins across the eukaryotic (Fig. 1B and fig. S2C). The map also allowed rest of the Sec complex. In the cytosolic region,
endoplasmic reticulum (ER) membrane or the us to improve the model for the eukaryotic the FN3 domain of Sec63 interacts with the loop
prokaryotic plasma membrane through its water- Sec61 channel, which was previously built into between TM6 and TM7 (L6/7) of Sec61a through
filled pore and integration of membrane pro- maps at ~4- to 5-Å local resolutions (14, 15). antigen-antibody–like binding. Like other FN3 do-
teins into the lipid phase through its lateral However, Sec62 and the ER-luminal J domain mains, FN3 of Sec63 has a canonical b-sandwich
gate. The Sec61/SecY channel consists of an of Sec63, which transiently interacts with BiP fold composed of seven b strands (referred to as
hourglass-shaped a subunit, which contains 10
transmembrane segments (TMs 1 to 10), and
two small b and g subunits, which are single- Fig. 1. Structure of
pass membrane proteins in eukaryotes (4). Often, the yeast Sec
translocation is coupled with translation (i.e., complex. (A) Cryo-EM
cotranslational translocation) by direct docking density map and
of a translating ribosome onto the channel. The (B) atomic model
channel also translocates many proteins in a of the yeast post-
posttranslational manner, the mechanisms of translational protein
which differ between eukaryotes and prokary- translocation complex.
otes. In eukaryotes, posttranslational transloca- The front view is a view
tion requires two essential membrane proteins, into the lateral gate.
Sec63 and Sec62, which associate with the chan-
nel (5–8), and the ER-resident Hsp70 chaperone
BiP, which grasps the substrate polypeptide in
the ER lumen and prevents it from backsliding
to the cytosol (9–12). In fungal species, the com-
plex (hereafter referred to as the Sec complex) is
further associated with the nonessential Sec71
and Sec72 subunits (10, 11, 13). The molecular
architecture of the Sec complex and the func-
tions of its subunits are poorly defined.
To gain insight into Sec-mediated protein
translocation, we determined a structure of the
1
Biophysics Graduate Program, University of California,
Berkeley, Berkeley, CA 94720, USA. 2Department of
Molecular and Cell Biology and California Institute for
Quantitative Biosciences, University of California, Berkeley,
Berkeley, CA 94720, USA.
*Corresponding author. Email: eunyong_park@berkeley.edu
A to G) but contains unusually long A-B, B-C, and Compared with previous Sec61/SecY structures static potential around the pore may disfavor
D-E interstrand loops (fig. S3, B and C). With (4, 14, 21–24), the channel in the Sec complex permeation of positively charged species (fig. S7C).
both A-B and B-C loops, FN3 creates a binding displays a substantially wider opening at its later- Yeast Sec61 has a relatively less hydrophobic
surface for L6/7, which uses a combination of sur- al gate, through which a signal sequence can pore constriction compared with nonfungal Sec61
face complementarity and electrostatic and hy- readily pass as an a helix (Fig. 3 and fig. S6). This and prokaryotic SecY (fig. S7D). In prokaryotes,
drophobic interactions (Fig. 2E and fig. S3D). contrasts with structures of channels associated reduction of hydrophobicity in the pore con-
Although sequence conservation is not obvious, with the ribosome or the bacterial posttransla- striction has been shown to lead to membrane
metazoan Sec63s have similar extensions in the tional translocation motor SecA (14, 21–24), in potential dissipation (26), and similarly, in higher
A-B and B-C loops. We expect analogous interac- which the channel shows an only partially open eukaryotes it might cause calcium leakage from
tions between Sec63 and Sec61 in other eukary- lateral gate (Fig. 3, C to F), which was proposed the ER. However, yeast may tolerate ion leakage
otes. The interaction between FN3 and L6/7 is to be further opened by interaction with the because calcium is stored primarily in the vacuole.
noteworthy because L6/7, together with L8/9, hydrophobic signal sequence during the initial In resting or primed channels, the pore is closed
forms a docking site for the ribosome (14, 19, 20) substrate insertion. The opening is achieved by or narrow (<2 Å in radius) and further blocked
(fig. S5A). Accordingly, superimposition of the a largely rigid-body movement between the two by a small a-helical plug in the luminal funnel
Sec complex with a ribosome-bound Sec61 struc- halves (TMs 1 to 5 and 6 to 10) of Sec61a and (4, 14, 21). By contrast, in our structure, the plug
ture shows massive steric clashes between the additional motions of the lateral gate helices. seems flexible and displaced from the pore (Fig.
ribosome and the cytosolic domains of Sec63 The fully open conformation appears to be a 3, A and B).
and Sec62 (fig. S5B), explaining why Sec61 in the result of the extensive interactions with Sec63. The spatial arrangement of Sec63 and Sec71-
Sec complex cannot bind to the ribosome (7, 11). For example, binding between FN3 and L6/7 Sec72 with respect to the Sec61 channel suggests
In the ER luminal side, a segment preceding TM3 perhaps pulls the C-terminal half of Sec61a to how these components play roles in accepting a
of Sec63 is directed into the luminal funnel of the open the lateral gate. However, further investi- polypeptide substrate from a cytosolic chaperone
Sec61 channel through the crevice present be- gation will be necessary to understand the pre- and handing it over to the channel and subse-
tween TM5 of Sec61a and the TM of Sec61g (Fig. cise mechanism and the dynamics of channel quently to BiP. Studies of C. thermophilum Sec72
2D). This segment makes an antiparallel b sheet gating in the native membrane environment. At have suggested that Sec72 provides a docking site
together with a b hairpin looping out in the the open lateral gate slit, there is a weak density for the cytosolic Hsp70 chaperone Ssa1p (18),
middle of Sec61a’s TM5. This b-augmentation feature, which likely represents bound detergent which prevents substrates from premature fold-
is further buttressed by hydrophobic interactions molecules (Fig. 3, A and B). In the native mem- ing or aggregation before translocation (6). Super-
with the N-terminal segment of Sec63. These brane, lipid molecules may occupy this site and imposition of the cocrystal structure of Sec72 and
features are highly conserved throughout eukary- facilitate initial binding of signal sequences. an Ssa1p C-terminal tail shows that the Ssa1p-
otes and thus likely play an important role in Our channel structure likely also represents a binding site is ~60 Å above the channel’s pore
optimal positioning of the J domain. fully open state of the translocation pore (Fig. 3B (Fig. 4A). While the cytosolic domain of Sec63-71-
One pronounced feature of the Sec complex and fig. S7). The radius of the pore constriction is 72 sits on top of Sec61, its position is tilted such
structure is a fully open channel (Fig. 3, A and ~3 Å, large enough to pass an extended polypep- that the polypeptide can insert straight down to
B). The Sec61/SecY channel has a characteristic tide chain. The opening would also permit pass- the pore. Similarly, Sec62 is also positioned off
clamshell-like topology, in which its central pore age of small hydrated ions and polar molecules the translocation path (Fig. 1A). Thus, upon re-
can open toward the lipid phase through the in the absence of a translocating polypeptide lease from Ssa1p, a substrate would efficiently
lateral gate formed between TM2 and TM7. (25, 26), although the relatively positive electro- engage with the pore without obstruction. The
structure also allows us to propose how BiP Hsp70 RE FERENCES AND NOTES 23. R. M. Voorhees, R. S. Hegde, Science 351, 88–91 (2016).
may catch the substrate in the ER lumen. Despite 1. E. Park, T. A. Rapoport, Annu. Rev. Biophys. 41, 21–40 (2012). 24. L. Li et al., Nature 531, 395–399 (2016).
2. R. M. Voorhees, R. S. Hegde, Curr. Opin. Cell Biol. 41, 91–99 (2016). 25. D. Heritage, W. F. Wonderlin, J. Biol. Chem. 276, 22655–22662
the low resolution of the J domain (Fig. 1A), we (2001).
could dock a homology model into the EM den- 3. E. C. Mandon, S. F. Trueman, R. Gilmore, Cold Spring Harb.
Perspect. Biol. 5, a013342 (2013). 26. E. Park, T. A. Rapoport, Nature 473, 239–242 (2011).
sity map based on the shape of the feature and 27. R. Kityk, J. Kopp, M. P. Mayer, Mol. Cell 69, 227–237.e4 (2018).
4. B. Van den Berg et al., Nature 427, 36–44 (2004).
the orientations of the flanking segments (Fig. 28. D. T. Ng, J. D. Brown, P. Walter, J. Cell Biol. 134, 269–278 (1996).
5. J. A. Rothblatt, R. J. Deshaies, S. L. Sanders, G. Daum,
29. M. A. Smith, W. M. Clemons Jr., C. J. DeMars, A. M. Flower,
4A). We then superimposed a recent crystal struc- R. Schekman, J. Cell Biol. 109, 2641–2652 (1989).
J. Bacteriol. 187, 6454–6465 (2005).
ture of a bacterial J domain–Hsp70 complex (27) 6. R. J. Deshaies, S. L. Sanders, D. A. Feldheim, R. Schekman,
30. S. F. Trueman, E. C. Mandon, R. Gilmore, J. Cell Biol. 199,
Nature 349, 806–808 (1991).
to our EM structure (Fig. 4A). This modeling ex- 907–918 (2012).
7. H. A. Meyer et al., J. Biol. Chem. 275, 14550–14557 (2000).
ercise showed that a peptide-binding cleft of the 8. J. Tyedmers et al., Proc. Natl. Acad. Sci. U.S.A. 97, 7214–7219 AC KNOWLED GME NTS
Hsp70 [called substrate-binding domain b (SBDb)] (2000).
We thank D. Toso for help with electron microscope
would be placed directly below the translocation 9. D. Feldheim, J. Rothblatt, R. Schekman, Mol. Cell. Biol. 12,
operation and J. Hurley, S. Brohawn, and K. Tucker for
pore. Thus, the J domain seems optimally posi- 3288–3296 (1992).
critical reading of the manuscript. Funding: This work was
10. J. L. Brodsky, R. Schekman, J. Cell Biol. 123, 1355–1363 (1993).
tioned to allow BiP to grasp the substrate poly- funded by UC Berkeley (E.P.) and an NIH training grant
11. S. Panzner, L. Dreier, E. Hartmann, S. Kostka, T. A. Rapoport, (T32GM008295; S.I.). Author contributions: S.I. and E.P.
peptide as it emerges from the channel. Cell 81, 561–570 (1995). performed experiments, interpreted results, and wrote the
Our structure offers a model for how Sec63 12. K. E. Matlack, B. Misselwitz, K. Plath, T. A. Rapoport, Cell 97, manuscript; E.P. conceived and supervised the project.
enables posttranslational translocation (Fig. 4B 553–564 (1999). Competing interests: None declared. Data and materials
and fig. S8) and provides a more complete pic- 13. N. Green, H. Fang, P. Walter, J. Cell Biol. 116, 597–604 (1992). availability: The cryo-EM density maps and atomic model have
14. R. M. Voorhees, I. S. Fernández, S. H. Scheres, R. S. Hegde, been deposited in EM Data Bank (accession code: EMD-0336) and
ture of how the Sec61/SecY channel works Cell 157, 1632–1643 (2014). Protein Data Bank (accession code: 6N3Q), respectively.
together with different binding partners (i.e., 15. K. Braunger et al., Science 360, 215–219 (2018).
ribosomes, Sec63, or SecA) to enable transport of 16. K. E. Matlack, K. Plath, B. Misselwitz, T. A. Rapoport, Science
C
ssDNA in the presence of sense RNA (hereafter,
ompetition between prokaryotes and vi- signment of separate subtypes, V-G, V-H, and V-I target RNA), and this activity increased in ef-
ruses has led to the evolution of diverse (Fig. 1A, fig. S1, and table S1). Whereas Cas12h ficiency from 37° to 50°C (Fig. 2E and fig. S8A).
defense strategies, with more being iden- and -i cluster with Cas12b, albeit at a large evo- No ssDNA cleavage was observed for any other
tified through the mining of growing lutionary distance, Cas12g clusters with the pre- DNA-RNA substrate combination (fig. S8, B to D).
genomic and metagenomic sequence data- dicted subtype V-U effectors and TnpBs (Fig. 1A). In the presence of target RNA, Cas12g1 ternary
bases (1–3). Class 2 CRISPR-Cas systems are of The subtype V-U effectors, including the recently complex also cleaved unrelated collateral ssDNA
particular interest, because their programmable identified Cas14a, -b, and -c (subtype V-F), are (Fig. 2E and fig. S9), demonstrating that target
single-effector nucleases have enabled genome much smaller than the typical CRISPR effec- RNA activates nonspecific collateral ssDNA
engineering and nucleic acid detection tools (4–8). tors and show greater similarity to TnpB (11, 20). cleavage in trans by Cas12g1.
Class 2 systems include types II, V, and VI, which Cas14a and Cas12g appear to have evolved from The weak ssDNA cleavage observed at 37°C is
are based on Cas9, Cas 12, and Cas13 effectors, re- distinct TnpB ancestors (Fig. 1A). Thus, exper- likely not responsible for the robust Cas12g1 in-
spectively (9–11). Cas9 contains an HNH nuclease imental characterization of subtype V-G is of terference activity observed in vivo. Thus, we
domain inserted into a RuvC nuclease domain particular interest to elucidate the routes of evo- investigated the intrinsic ribonuclease (RNase)
(12–14), and the two domains together cleave lution of TnpB proteins into functional CRISPR activity of Cas12g1 and observed strong target
double-stranded DNA (dsDNA). Cas12 contains a effectors. RNA cleavage with the ternary complex at 37°C
single RuvC nuclease domain that cleaves dsDNA To functionally characterize the type V-G, -H, (Fig. 2F), and this was further enhanced at 50°C
adjacent to protospacer adjacent motif (PAM) and -I systems, we used an Escherichia coli nega- (fig. S10 and tables S4 to S8). At 50°C, detectable
sequences (15) and single-stranded DNA (ssDNA) tive selection screen, in which RNA-guided inter- target RNA cleavage was observed at ternary
nonspecifically (16). Cas13 contains two HEPN ference activity of reconstituted CRISPR-Cas complex concentrations as low as 125 pM (fig.
domains that cleave RNA exclusively (10, 17, 18). systems reduces bacterial viability at 37°C (19). S11A), with no background cleavage of nontarget
We aggregated more than 10 terabytes of se- Each screen included: (i) an effector plasmid car- RNA at the highest complex concentration tested
quence data and generated a database of 293,985 rying predicted Cas genes; (ii) a CRISPR array (250 nM) (figs. S10B and S11B). Cas12g1 ternary
putative CRISPR-Cas systems (19). From this data- library targeting pACYC184 and E. coli essential complex also cleaved dye-labeled collateral RNA
base we identified type V systems with predicted genes; and (iii) a noncoding plasmid containing accompanying unlabeled target RNA at target
effectors ranging in size from 720 to 1093 amino concatenated cas gene-flanking noncoding sequenc- concentrations as low as 100 pM, demonstrating
acids, each of which contained a C-terminal RuvC es for the unbiased detection of trans-activating that the stand-alone RNA detection sensitivity of
domain (fig. S1). The classification tree of type V crRNA (tracrRNA) elements (Fig. 1, B and C). Cas12g1 is comparable to that of the highest per-
effectors splits into three major branches: (i) In vivo screening of the compact subtype V-G forming Cas13 variants (Fig. 2F and fig. S11, C
Cas12a, -c, -d, and -e; (ii) Cas12b and its distant effector, Cas12g1 (767 amino acids), revealed in- and D) (21). Both RNA and ssDNA cleavage by
homologs; and (iii) subtype V-U variants closely terference activity that specifically targeted the Cas12g1 are metal ion dependent and require an
related to transposon-encoded TnpB. Predicted sense DNA strand of actively transcribed sub- intact RuvC domain that was previously known
type V effectors in this study showed weak se- strate regions (Fig. 2A, fig. S2A, and table S2). to cleave only DNA (Fig. 2, G and H, and figs. S4
quence similarity (E > 10−3) with previously char- Analysis of target-flanking sequences revealed and S12). The thermostability and nucleic acid
acterized ones. Combined with differences in no PAM requirements for interference (fig. S2, B detection sensitivity of Cas12g1 has the potential
locus organization and subsequently uncovered to D). Mutation of the RuvC-I motif of Cas12g1 to enhance the performance and durability
functional differences, our work supports the as- [Asp513→Ala (D513A)] or omission of the non- of nucleic acid diagnostic methods, such as
coding plasmid substantially decreased inter- SHERLOCK and DETECTR (16, 18, 22). Addi-
1
Arbor Biotechnologies, Cambridge, MA 02139, USA. ference activity (Fig. 2B and fig. S2, E to G). tionally, the small size of Cas12g1 is likely to
2
National Center for Biotechnology Information, National RNA sequencing of screen samples revealed a facilitate delivery for diverse in vivo transcrip-
Library of Medicine, National Institutes of Health, Bethesda,
MD 20894, USA.
tracrRNA expressed from the noncoding plasmid tome engineering applications (23, 24).
*These authors contributed equally to this work. and a mature crRNA from the CRISPR array li- We next investigated subtype V-H and V-I sys-
†Corresponding author. Email: dscott@arbor.bio brary (Fig. 2, C and D, and fig. S3). However, tems containing effectors Cas12h (870 to 933
A TnpB
B [Accessory] Effector CRISPR array Fig. 1. Discovery and screening of type V
Natural
Locus
CRISPR-Cas diversity. (A) Classification tree
V-F
Cas14b T7 lac of type V effectors (Cas12 proteins) with the
Effector [Accessory]
V-F Effector
corresponding CRISPR-Cas loci organization
Cas14a
plasmid LacO RBS + mH6 shown for each branch. Cas12 proteins analyzed
V-U3 in pET-28a(+)
C2c10 in this work are highlighted in red. (B) Design
T7 lac
V-U4 of in vivo screen effector and noncoding
C2c9 Noncoding
(NC) plasmid Concatenated NC sequences
plasmids. CRISPR array libraries were
V-U2 LacO
C2c8
in pACYC184 designed with spacers uniquely and uniformly
J23119 J23119 sampled from both strands of pACYC184 or
V-F
Cas14c CRISPR Array
Library
DR DR + DR DR E. coli essential genes, then flanked by two
V-U1 UMI reverse array direction DRs and transcribed by a J23119 promoter.
C2c4 (spacers targeting pACYC184 and E. coli essential genes)
(C) Workflow schematic of the in vivo
V-G
Cas12g E. coli screen.
V-C
C CRISPR array library
Cas12c (C2c3)
Assembly
V-D
Cas12d (CasY) + Noncoding
Effector plasmid
plasmid
V-A
Cas12a (Cpf1) or pACYC
transformation components
V-E
Cas12e (CasX) antibiotic
Reaction
selection
V-U5
V-B
Cas12b (C2c1)
E. coli with depletion of E. coli with
V-I CRISPR systems active CRISPR systems
Cas12i
output and
V-H input plasmid
Readout
A B C
S
Spacer target
DNA strand
12 0 nt
AS 0 102
6 mature crRNA
0
E. coli EG
S
ORI TetR CamR
D
# bottom strand spacers
0 AS Native
6 locus
T A D T A D
12 W 13 13 W 13 13
D5 A5 D5 A5 12 Noncoding
18 plasmid
Cas12g1 6
24
3 (log) 10 1 (log) 14000
30 Screen Hits nt
fold depletion RNA expression (count) 0
<5 (log) 400 0 1230
tracrRNA
E 37°C 50°C
F G 37°C 50°C
H
Collateral ssDNA Collateral ssRNA Collateral ssDNA 37°C 50°C
Target ssRNA Target ssRNA Target ssRNA Target ssRNA
Nontarget ssRNA Nontarget ssRNA tracrRNA tracrRNA
tracrRNA tracrRNA Mature-crRNA Mature-crRNA
Mature-crRNA Mature-crRNA Cas12g1-WT Cas12g1-WT
Cas12g1-WT Cas12g1-WT Cas12g1-D513A Cas12g1-D513A
150 150 150 150 150
15% TBE-Urea
80 75 80
15% TBE-Urea
15% TBE-Urea
75 80
50 50 50
50
cleaved cleaved 50 cleaved cleaved
TBE-Urea
Fig. 2. Cas12g displays RNA-activated target cleavage of RNA and were subtracted from this and similar analyses. (C and D) Mature crRNA
collateral trans-cleavage of RNA and ssDNA. (A) Strongly depleted (C) and tracrRNA (D) identified from small RNA sequencing of in vivo
CRISPR arrays from in vivo screening of Cas12g1 and its noncoding screen samples containing Cas12g1 and noncoding plasmid. The
plasmid mapped to pACYC184. (B) Heatmap showing strongly depleted schematic above tracrRNA shows construction of noncoding plasmid
CRISPR arrays (screen hits) to evaluate RuvC and substrate strand from native locus sequences. (E and F) Target ssRNA activated collateral
dependencies of Cas12g1 (S, sense; AS, antisense; EG, essential genes). ssDNA cleavage at 37°C and 50°C (E) and target and collateral ssRNA
A513D was cloned from the D513A construct to rescue its activity. Strongly cleavage at 37°C (F). (G and H) Cleavage assays targeting collateral
depleted CRISPR arrays in negative control screens without the effector ssDNA (G) and ssRNA (H) with purified RuvC mutant dCas12g1 D513A.
Fig. 3. In vivo and in vitro activity of Cas12i. A CRISPR array expression B Cas12i1 depleted motifs
(A) Evaluation of a minimal active system for top strand bottom strand 3nt (6): No 3nt motifs detected
Cas12i, with heatmaps showing strongly depleted 2nt (3,5):
pACYC
S
Spacer target
1nt (1,2,4):
CRISPR arrays from in vivo screening in
DNA strand
Cas12i1
AS 5 6
different Cas12i system compositions (S, sense;
E. coli EG
AS, antisense; EG, essential genes). (B) (Top) S 4
5 1nt 2nt 3nt
Distribution of bit scores for all permutations of
Bit score
3 # nt in motif permutation
AS 3
1- to 3-nucleotide (nt) motifs within the target
2 4
and 15-nt flanking sequences corresponding to 2 1
pACYC
S
Spacer target
strongly depleted in vivo arrays, calculated as
DNA strand
Cas12i2
AS 1
described in (19). The box above describes
E. coli EG
motif analysis for Cas12i1 as an example. (Bottom) S 0
Web logos from target-flanking sequences. Cas12i1 Cas12i2
2 2
Bit score
AS
(C to E) Titration of a Cas12i1 binary complex 1 1
200
Screen Hits
on target and nontarget ssDNA (C), collateral Cas12i (WT) 0 0
dCas12i (log) -6 -1 -6 -1
ssDNA with target and nontarget ssDNA Distance before 5’ target start
Noncoding
(D), and target and nontarget dsDNA (E). (F) S1 <5
15% TBE-Urea
15% TBE-Urea
nicked dsDNA
15% TBE-Urea
150 150
4-20% TBE
100 dsDNA substrate 100
cleaved 75 cleaved dsDNA 50
dsDNA 50
amino acids) and Cas12i (1033 to 1093 amino collateral ssDNA in the presence of unlabeled nomic data (10). With our expanded database, we
acids), respectively. These effectors show distant target ssDNA, consistent with collateral ssDNA detected and synthesized in vivo screen plasmids
similarity to Cas12b, with substantial truncation cleavage activity (Fig. 3D). for complete subtype V-C systems containing the
of N-terminal regions responsible for PAM recog- We observed Cas12i1-mediated cleavage of effectors OspCas12c (from Oleiphilus sp. HI0009),
nition and DNA unwinding (25, 26). In vivo dsDNA under denaturing conditions, which was Cas12c1, and Cas12c2. All these systems showed
screening of Cas12h1 (870 amino acids), Cas12i1 suggestive of dsDNA nicking. While reactions broad and symmetrical targeting of both DNA
(1093 amino acids), and Cas12i2 (1054 amino containing dsDNA with a labeled non-spacer- strands, consistent with autonomous dsDNA
acids) demonstrated robust and broadly distrib- complementary strand showed robust DNA interference (Fig. 4A and fig. S18). RNA sequenc-
uted targeting of both strands of dsDNA sub- cleavage over a wide range of binary complex ing of screening samples for the minimal subtype
strates that was dependent on an intact RuvCI concentrations, those containing dsDNA with V-C systems demonstrated pre-crRNA process-
domain (Fig. 3A and figs. S13A and S14, A to F). the spacer-complementary strand labeled showed ing and highly expressed tracrRNAs (fig. S19).
The noncoding plasmid was not required, in- only small amounts of cleavage at the highest A 5′ TG PAM was required for Cas12c1 and
dicating that, unlike subtype V-B systems, the concentrations tested (Fig. 3E and fig. S17, A OspCas12c, and a minimal 5′ TN PAM was re-
minimal V-H and V-I interference modules in- and B). Under nondenaturing conditions, Cas12i1 quired for Cas12c2 (Fig. 4B). The single-nucleotide
clude only the effector and crRNA (Fig. 3A and cleavage reactions yielded products with lower TN PAM for Cas12c2 dsDNA targeting comple-
fig. S14, G and H). Analysis of target-flanking electrophoretic mobility than the input dsDNA, ments recently engineered Cas9 effectors with
sequences corresponding to strongly depleted and these products were then converted to minimal PAMs (28), potentially expanding the
arrays from in vivo screens showed that dsDNA double-strand breaks by S1 nuclease treatment, target space for genome editing.
interference by Cas12h1 depends on a 5′ RTR PAM consistent with nicking of dsDNA substrates We have presented here a framework for sys-
(fig. S13B), whereas Cas12i1 and Cas12i2 prefer a (Fig. 3F). These results suggested that Cas12i1 tematic discovery, screening, and characteri-
5′ TTN PAM (Fig. 3B). preferentially nicks the non-spacer-complementary zation of class 2 CRISPR-Cas systems, and we
Small RNA sequencing of Cas12i1 in vivo screen strand, and it cleaves the spacer-complementary demonstrated a range of activities for four type
samples demonstrated biogenesis of a mature strand with a lower efficiency to yield a dsDNA V CRISPR-Cas subtypes, including target and
crRNA (fig. S15), which was confirmed in vitro break. Together, the small size, autonomous pro- collateral cleavage of ssRNA and ssDNA as well
using purified Cas12i1 and a minimal pre-crRNA cessing of multiplexed crRNAs, and nicking ac- as dsDNA nicking and cleavage (Fig. 4C). These
(DR-spacer-DR-spacer-DR) (fig. S16 and table tivity of Cas12i could enhance double-nicking findings reveal the transition in the properties
S3). Binary complexes containing Cas12i1 and applications for high-fidelity genome editing (27). of Cas12 proteins along the proposed evolution-
pre-crRNAs efficiently cleaved target contain- Subtype V-C loci have been previously observed ary path from TnpB to large type V effectors.
ing ssDNA substrates (Fig. 3C) as well as labeled but never characterized due to incomplete ge- Additionally, future applications could include
Bit score
Cas12c1
# nt in motif permutation with heatmaps showing strongly depleted CRISPR
2
(log) arrays from in vivo screening in different Cas12c
Cas12c2
<5
1 system compositions. Gray boxes indicate data not
OspCas12c Screen available. (B) (Top) Distribution of bit scores for
0
Hits
Cas12c (WT)
Cas12c1 Cas12c2 OspCas12c all permutations of 1- to 3-nt motifs within the
Bit score
2 2 2
dCas12c 1 target and 15-nt flanking sequences corresponding
Cas1 0 to strongly depleted arrays. (Bottom) Web logos
-6
Noncoding Distance to 5’ target end from target-flanking sequences. (C) Overview
of minimal components and interference
C Subtype V-C Subtype V-H, I Subtype V-G mechanisms of Cas12g, -h, -i, and -c. Asterisks
Cas12c ternary complex Cas12h,i binary complex Cas12g ternary complex
denote putative mechanisms subject to
components
5’ 3’
5’
crRNA 3’ 5’
crRNA 3’ 3’
5’ 5’
3’
tracrRNA
tracrRNA
Cas12c: 1209 - 1330aa Cas12h: 870 - 924aa; Cas12g: 720 - 830aa
Cas12i: 1033 - 1093aa
ssDNA or ssRNA
?
* ? ?
ssRNA
cleavage
ssDNA 3’ 5’
3’ 5’ 3’ 5’
ssRNA
*
cleavage
5’ 3’ 5’ 3’
dsDNA
expanded genomic targeting via the minimal 10. S. Shmakov et al., Mol. Cell 60, 385–397 (2015). D.R.C., L.E.A., J.M.C., E.K.S., S.S., S.C., and A.J.G., conceived
Cas12c2 PAM, high-fidelity genome editing using 11. S. Shmakov et al., Nat. Rev. Microbiol. 15, 169–182 (2017). and designed the study. D.R.C. and D.A.S. designed and
12. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, implemented the computational searches, with additional input
Cas12i nicking (27), or sensitive and durable from K.S.M. and E.V.K., including phylogenetic analysis and
Proc. Natl. Acad. Sci. U.S.A. 109, E2579–E2586 (2012).
nucleic acid detection via collateral cleavage by 13. M. Jinek et al., Science 337, 816–821 (2012). classification. W.X.Y., D.A.S., P.H., L.E.A., J.C., E.K.S., S.S., S.C.,
the thermostable Cas12g1 (18, 22). We antici- 14. E. V. Koonin, K. S. Makarova, F. Zhang, Curr. Opin. Microbiol. and A.J.G. performed all of the experimental work and analyzed
pate that our discovery framework will yield 37, 67–78 (2017). the data. W.X.Y. and D.A.S. wrote the manuscript with input
15. B. Zetsche et al., Cell 163, 759–771 (2015). from E.V.K. and help from all authors. Competing interests:
new CRISPR-Cas variants as genomic and meta- W.X.Y., P.H., L.E.A., J.M.C., E.K.S., S.S., S.C., A.J.G., D.R.C.,
16. J. S. Chen et al., Science 360, 436–439 (2018).
genomic sequence databases grow, expanding the and D.A.S. are employees and shareholders of Arbor
17. O. O. Abudayyeh et al., Science 353, aaf5573 (2016).
understanding of CRISPR biology and the nucleic 18. A. East-Seletsky et al., Nature 538, 270–273 (2016). Biotechnologies, Inc. W.X.Y., D.R.C., and D.A.S. are current or
acid manipulation toolbox. 19. W. X. Yan et al., Mol. Cell 70, 327–339.e5 (2018). former officers and D.R.C. is a director of Arbor Biotechnologies.
20. L. B. Harrington et al., Science 362, 839–842 (2018). Arbor Biotechnologies has filed patents related to this work.
21. J. S. Gootenberg et al., Science 360, 439–444 (2018). Data and materials availability: All data are available in the
RE FE RENCES AND N OT ES manuscript or the supplementary material. All reagents are
22. J. S. Gootenberg et al., Science 356, 438–442 (2017).
1. D. Burstein et al., Nature 542, 237–241 (2017). 23. D. B. T. Cox et al., Science 358, 1019–1027 (2017). available to the academic community through Addgene.
2. S. Doron et al., Science 359, eaar4120 (2018). 24. S. Konermann et al., Cell 173, 665–676.e14 (2018). Sequencing data are available on the NCBI Sequence Read
3. E. V. Koonin, K. S. Makarova, Y. I. Wolf, Annu. Rev. Microbiol. 71, 25. D. Dong et al., Nature 532, 522–526 (2016). Archive under Bioproject ID PRJNA496291.
233–261 (2017). 26. T. Yamano et al., Cell 165, 949–962 (2016).
4. R. Barrangou, P. Horvath, Nat. Microbiol. 2, 17092 (2017). 27. F. A. Ran et al., Cell 154, 1380–1389 (2013). SUPPLEMENTARY MATERIALS
5. R. Barrangou et al., Science 315, 1709–1712 (2007). 28. J. H. Hu et al., Nature 556, 57–63 (2018). www.sciencemag.org/content/363/6422/88/suppl/DC1
6. D. B. T. Cox, R. J. Platt, F. Zhang, Nat. Med. 21, 121–131 Materials and Methods
(2015). ACKN OWLED GMEN TS Figs. S1 to S19
7. S. E. Klompe, S. H. Sternberg, Harnessing “A Billion Years We thank the entire Arbor Biotechnologies team for support and Tables S1 to S10
of Experimentation”: The Ongoing Exploration and comments on this work. Funding: Arbor Biotechnologies is a References (29–33)
Exploitation of CRISPR–Cas Immune Systems. CRISPR J. 1, privately funded company. K.S.M. and E.V.K. are supported by
141–158 (2018). the intramural program of the U.S. Department of Health 14 October 2018; accepted 20 November 2018
8. G. J. Knott, J. A. Doudna, Science 361, 866–869 (2018). and Human Services (to the National Library of Medicine). Published online 6 December 2018
9. K. S. Makarova et al., Nat. Rev. Microbiol. 13, 722–736 (2015). Author contributions: W.X.Y. and D.A.S., with input from P.H., 10.1126/science.aav7271
www.sciencemag.org/prizes/pins
Submission Deadline: March 15, 2019
F O R C E F O R S C I E N C E . O R G
Alaska
Au
urora Borealis
March 28 - April 3, 2019!
Come discover the great beauty
of Alaska in winter, and
see the greatest light show on
earth! See Alaskan wildlife in
winter and take the train to
Fairbanks, passing 20,310 foot
Denali en route! See the
Aurora Borealis dance across
the night sky!
$2,995 pp twin + air
Tahiti Total
Solar Eclipse
June 25-July 4, 2019
@SciMagWebinars
March 29-April 3 | Georgia World Congress Center | Atlanta, GA
All ads submitted for publication must comply with In partnership with:
applicable U.S. and non-U.S. laws. Science reserves
the right to refuse any advertisement at its sole
discretion for any reason, including without limitation
for ofensive language or inappropriate content,
and all advertising is subject to publisher approval.
Science encourages our readers to alert us to any ads
that they feel may be discriminatory or ofensive.
ways that Science Careers
can help advance your career
Visit ScienceCareers.org
today — all resources are free
SCIENCECAREERS.ORG
online @sciencecareers.org
Advance your
career with expert
advice from
Science Careers.
Featured Topics:
§ Networking
§ Industry or Academia
§ Job Searching
§ Non-Bench Careers
§ And More
online @sciencecareers.org
Career Development Center
REGISTER TODAY
CareerDevelopment.aaas.org
WORKING LIFE
By Barbara A. Wanchisen
W
hen I left my tenured professorship for a nonacademic job, I thought I had already done
the hard part: making the decision to leave the professional world that had been my home
for many years. I had little inkling of the culture shock that awaited me in my new sphere
of science policy and how disorienting it would be. In the 17 years since, I’ve seen that I’m
far from the only one who struggles with this transition. Regardless of career stage, leaving
academia requires some adjusting. For those who, like me, make the move later in their
careers, after decades as established academics, it can be even harder. Knowing what to expect before-
hand can take some of the shock out of the transition to the world outside academia.
of background research, talk to colleagues, and cogitate article convinces you that academia is the right place for
before producing a decision or a publication. But in the you and that you should stay and flourish there, then that
outside world, you may have 30 minutes to come up with is a win, too. j
an answer. This was a particularly hard lesson for me to
learn. Sage advice from someone more junior than I but Barbara A. Wanchisen is the director of the Board on
with more “real world” work experience helped immensely. Behavioral, Cognitive, and Sensory Sciences at the National
They said that sometimes I just had to go with my gut and Academies of Sciences, Engineering, and Medicine in Wash-
call it a day. ington, D.C. Send your story to SciCareerEditor@aaas.org.
Published by AAAS