Vaccine xxx (xxxx) xxx

Contents lists available at ScienceDirect

Vaccine
journal homepage: www.elsevier.com/locate/vaccine

Enhancing the immunogenicity of a DNA vaccine against Streptococcus

mutans by attenuating the inhibition of endogenous miR-9
Rong Jia a,1, Lingyan Yan a,1, Jihua Guo a,b,⇑
a
The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Laboratory of Oral Biomedicine Ministry of Education, School & Hospital of
Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079, PR China
b
Department of Endodontics, School & Hospital of Stomatology, Wuhan University, Wuhan, PR China

a r t i c l e i n f o a b s t r a c t

Article history: DNA vaccine provides a promising method for preventing and treating diseases. However, the low
Received 22 June 2019 immunogenicity restricts its application. New approaches are urgent to be explored to enhance the
Received in revised form 10 November 2019 immune response of DNA vaccine. MicroRNAs are endogenous, small non-coding RNAs which play parts
Accepted 29 November 2019
in gene expression inhibition. In this study, microRNA-9 (miR-9) was found to inhibit the expression of
Available online xxxx
the GLU-A-P antigen protein encoded by the anti-caries DNA vaccine. Mutation of miR-9 binding sites in
the gene fragment encoding GLU-A-P antigen protein significantly increased the expression of antigen
Keywords:
protein. Moreover, miR-9 sponge can improve the expression of the GLU-A-P antigen protein. The co-
DNA vaccine
MicroRNA
immunization with miR-9 sponge and anti-caries DNA vaccine significantly enhanced the specific
miR-9 immune response in vivo. In conclusion, attenuating the inhibition of endogenous miR-9 enhanced the
Immunogenicity antigen expression and immunogenicity of the anti-caries DNA vaccine.
Ó 2019 Elsevier Ltd. All rights reserved.

1. Introduction gene, which improved the transcription efficiency of DNA vaccine

DNA vaccine, a new type of vaccine developed in the 1990s [1],
can carry antigen-coding genes of a pathogen and express antigen
protein within the body’s own cells, which can not only mimic the
ability of live attenuated vaccines resulting in coordinated activa-
tion of both humoral and cell-mediated responses, but also avoid
the safety problems related to live vaccines [2]. Additionally, it is
convenient to synthesize and maintain DNA vaccine.
Although DNA vaccine is extremely effective in small animal
models, it has not worked well in human clinical trials [3]. Ineffi-
cient uptake of DNA vaccine plasmids by cells and poor immuno-
genicity of the encoded antigens are the possible reasons for this
issue [4]. Another important reason for this limitation is the poor
expression of antigen in human tissues after immunization [5].
Therefore, it is of great interest to improve the expression effi-
ciency of antigen protein encoded by DNA vaccine. One way to
solve this problem is modifying the DNA vaccine design. For exam-
ple, codon optimization for mammal can enhance mammalian
expression of pathogen proteins [6]. Furthermore, others inserted
an internal ribosomal entry site (IRES) upstream of the antigen
⇑ Corresponding author at: 237 Luoyu Road, Wuhan City 430079, PR China.
E-mail address: jihuaguo@whu.edu.cn (J. Guo).
1
These authors contributed equally to this work.
[7]. However, it is urgent to find more novel strategies to enhance
the expression of antigen encoded by DNA vaccine.
Streptococcus mutans (S. mutans) is one of the major etiologic
agents of caries [8]. Glucosyltransferase-I (GTF-I) and a surface pro-
tein antigen (PAc) are the important virulence factors of S. mutans.
Glucan binding region (GLU) and the alanine-rich and proline-rich
regions (A-P) are the major immunogenic regions of GTF-I and PAc
[9,10], respectively. We have constructed anti-caries DNA vaccines
against GLU and A-P, and demonstrated their immune efficacy
[11,12]. However, the immunogenicity of these anti-caries DNA
vaccines needs to be improved.
MicroRNAs (miRNAs) are endogenous, small non-coding RNAs
of ~23 nucleotides in length, which function primarily as post-
transcriptional regulators by directly binding to the 30 untranslated
regions (30 UTR) of target genes [13,14]. MiRNAs have been
reported to suppress gene expression through inhibition of transla-
tion or induction of mRNAs degradation. Because antigen genes in
a DNA vaccine undergo transcription and translation in cells, they
may be targeted by microRNAs as cellular genes.
MicroRNA-9 (miR-9) is a member of the miRNA family and has
been reported to participate in the neuronal differentiation [15],
different types of cancers [16,17], post-traumatic stress [18], exo-
cytosis of insulin from pancreatic islets [19,20] and immune
response [21,22]. MiR-9 has been found to participate in host

https://doi.org/10.1016/j.vaccine.2019.11.083
0264-410X/Ó 2019 Elsevier Ltd. All rights reserved.

Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
2 R. Jia et al. / Vaccine xxx (xxxx) xxx
immune response through forming a feedback control of the
nuclear factor kappa-B (NF-jB)-dependent immune response [22]
or the peroxisome proliferator-activated receptor d (PPARd)-
dependent response [21].
In this study, we found miR-9 has multiple binding sites in gene
fragment of GLU and A-P (GLU-A-P). Mutation of these miR-9 bind-
ing sites enhanced the expression of GLU-A-P antigen protein
encoded by the anti-caries DNA vaccine. A miR-9 sponge plasmid
was able to enhance the expression and in vivo immunogenicity
of GLU-A-P antigen protein encoded by the anti-caries DNA
vaccine.
2. Materials and methods
2.1. Cells and transfection
HEK 293 (a human embryonic kidney epithelial cell line) and
C2C12 (a mouse myoblast cell line) were cultured in Dulbecco’s
modified Eagle medium (DMEM; Hyclone, USA) supplemented
with 10% fetal bovine serum (FBS, Hyclone, USA) and 1%
antibiotic-antimycotic (Gibco, USA). One microgram DNA vaccine
plasmids or 20 nM microRNA mimics and inhibitors were trans-
fected into HEK 293 cells using Lipofectamine 3000 Reagent (Invit-
rogen, USA) according to the manufacturer’s protocol, respectively.
C2C12 cells were transfected using a SE cell line 4D-Nucleofector X
Kit and Unit (Lonza, Basel, Switzerland) in accordance with the
manufacturer’s protocol. Total RNA and protein were harvested
48 hrs later.
2.2. DNA vaccines and microRNA sponge expression plasmids
Previously, we constructed a DNA vaccine, pGLUA-P (Fig. S1),
which can express GLU-A-P antigen protein [including the
glucan-binding domain (GLU) of the glucosyltransferase-I and the
alanine-rich and proline-rich regions (A-P) of the cell-surface pro-
tein antigen (PAc) from S. mutans] [11]. pGJA-P/VAX (Fig. S1) can
express GLU-A-P antigen fused with the signal peptide and extra-
cellular regions of the human cytotoxic T lymphocyte-associated
antigen 4 (CTLA4) gene and Fc region of the human IgG1 [12].
Because the shortage of specific anti-GLU-A-P antibody for Wes-
tern blot, the expression of GLU-A-P protein was analyzed by
anti-CTLA4 antibody. To monitor the transfection efficiency of
DNA vaccine plasmid, the vector backbone of pGJA-P/VAX was
replaced by pcDNA3.1 to obtain pGJA-P/cDNA plasmid (Fig. S1),
which can not only express GLU-A-P antigen protein, but also
express neomycin resistance gene.
MiR-9 binding sites in GLUA-P were predicted by an online
microRNA prediction tool from Segal lab (https://genie.weiz-
mann.ac.il/pubs/mir07/mir07_prediction.html) (Table S1). Overlap
extension PCR method was used to mutate miR-9 binding sites in
GLUA-P fragment in pGJA-P/cDNA plasmid. Mutations were
designed by using degenerate codons to avoid changes in encoded
amino acids (Table S1).
MiR-9 sponge was designed according to the miR-9 binding
sites in CDH1, NFKB1, MDGA2, and LYVE1 (Fig. 3A and S2)
and targeted has-miR-9-5p. The mature has-miR-9-5p sequence
is UCUUUGGUUAUCUAGCUGUAUGA, the conservatism of which
is 100% in mice. A DNA fragment (Fig. S2) including the miR-
9 binding sites in CDH1, NFKB1, MDGA2, and LYVE1 were syn-
thesized by Genechem company (Shanghai, China) and cloned
into the 30 UTR region of a green fluorescence protein (GFP)
gene in GV262 vector (Genechem company) at XhoI and EcoRI
sites. The information of GV262 vector could be found in Gen-
echem company (http://www.genechem.com.cn/Zaiti.aspx?zt=
GV262).
Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
2.3. MicroRNA mimics and inhibitors
MicroRNA mimics of miR-9, miR-29b, miR-33a, miR-33b, miR-
96, miR-103, miR-135a, miR-140-5P, miR-145, miR-182, miR-
375, and miR-NC as well as microRNA inhibitors of miR-9, miR-
96, and miR-NC were bought from Genepharma (Suzhou, China).
2.4. RNA extraction, reverse transcription PCR (RT-PCR), and
quantitative RT-PCR (qRT-PCR)
Total RNA was extracted using Total RNA Miniprep Kit (AXY-
GEN, USA). RNA samples were treated with DNase I (Invitrogen,
USA) to eliminate DNA contamination and reverse-transcribed
using random primers and Moloney Murine Leukemia Virus
(MMLV) Reverse Transcriptase (Promega, USA). PCR was per-
formed using rTaq DNA polymerase (TaKaRa, Japan) with following
primers: 50 -ATTGAACAAGATGGATTGCACGC-30 and 50 -TCAA
GAAGGCGATAGAAGGCG-30 for Neomycin resistance gene, 50 -GAA
GGTGAAGGTCGGAGTC-30 and 50 -GAAGATGGTGATGGGATTTC-30
for GAPDH.
Total RNA including microRNA was purified using miRNeasy Kit
(QIAGEN, Germany). The endogenous miR-9 levels were analyzed
using TaqMan Advanced miRNA Assays (Applied Biosystems,
USA) in accordance with the manufacturer’s protocol. U6 was used
as an internal control.
2.5. Western blot
Total cellular protein was extracted with 2  SDS sample buffer,
and denatured for 3 min in 95 °C. Protein samples were separated
in 10% Nu-PAGE Bis-Tris gel (Invitrogen) and transferred to nitro-
cellulose membranes (Pall Corporation, USA). The membranes
were blocked in 5% milk for 1 h and incubated at 4 °C overnight
with the following antibodies: mouse monoclonal anti-CTLA4
(Epitomics, USA), mouse monoclonal anti-NF-jB1 (Santa Cruz,
USA), followed by horseradish peroxidase (HRP) conjugated anti-
mouse IgG antibody (Sigma-Aldrich, USA) or mouse IgG binding
protein (Santa Cruz, USA), respectively. b-actin was set as an inter-
nal control detected by HRP-labelled mouse anti-b-actin antibodies
(Sigma-Aldrich, USA).
2.6. Immunization of mice
Twenty four of 6-week-old female BALB/c mice were divided
randomly into four groups. Each mouse was injected with 200 lg
of plasmid DNA (dissolved in 200 lL sterile saline) via quadriceps
muscle injection (100 lg per site, total 200 lg) under isoflurane
inhalation anesthesia. Group DNA vaccine + miR-9 sponge (n = 6)
mice were immunized with the mixture of pGLUA-P and miR-9
sponge (100 lg of each plasmid). Group DNA vaccine + NC sponge
(n = 6) mice were immunized with the mixture of DNA vaccine
pGLUA-P and NC sponge (100 lg of each plasmid). Group
Vector + miR-9 sponge (n = 6) mice were immunized with the mix-
ture of pCI vector plasmid and miR-9 sponge (100 lg of each plas-
mid). Group Vector + NC sponge (n = 6) mice were immunized with
the mixture of pCI vector plasmid and NC sponge (100 lg of each
plasmid). All mice were boosted at 2 weeks using the same strat-
egy as primary immunization. Peripheral blood was collected on
0, 2, 4, 6 and 8 weeks after the second immunization from the
retro-orbital plexus with a syringe and maintained at 4 °C over-
night. And sera were obtained by centrifugation at room tempera-
ture next day and kept at 20 °C. All the experimental procedures
were approved by the ethics committee at School of Stomatology
in Wuhan University. All animal experiments presented in our
study were conducted in compliance with NIH guidelines for care
and use of laboratory animals.
 R. Jia et al. / Vaccine xxx (xxxx) xxx
2.7. Antibody assays
The specific anti-GLU serum IgG antibody levels in mice were
determined by enzyme-linked immunosorbent assay (ELISA). The
96-well microtiter plates were coated with 100 lL recombinant
GLU protein [synthesized by Sangon Biotech, China, 5 lg/mL in
ELISA Coating Buffer (BioLegend, USA)] per well at 4 °C overnight,
and then were blocked with blocking buffer [3% bovine serum
albumin in ELISA Assay Diluent (BioLegend, USA)] for 2 h at
37 °C. Then the mice sera diluted in ELISA Assay Diluent were
added to the plates and incubated overnight at 4 °C, followed by
the incubation with goat anti-mouse IgG (Thermo scientific, USA)
for 1 h at 37 °C. Bound antibodies were detected by incubation
with HRP conjugated donkey anti-goat IgG antibody (Thermo sci-
entific, USA) for 1 h at 37 °C. TMB Substrate Set (BioLegend, USA)
was used to develop the reaction and Stop Solution (BioLegend,
USA) was used to stop the reaction. Optical density (OD) readings
were performed at 450 nM. A positive mouse anti-GLU serum
was used as standard serum to establish the standard curve. The
relative concentration of serum specific anti-GLU IgG was calcu-
lated according to the standard curve using four-parameter logistic
regression method [23].
2.8. Statistical analysis
The relative concentrations of serum specific anti-GLU antibody
were logarithmic transformed. The differences in relative serum
antibody concentrations between four mice groups were analyzed
using one-way analysis of variance followed by Tukey’s range test.
Two-group statistical comparisons of means were calculated with
Student’s t-test.
3. Results
3.1. MiR-9 inhibits the expression of the antigen protein encoded by a
DNA vaccine
To detect which microRNA regulates the expression of the anti-
gen protein (GLU-A-P) encoded by a DNA vaccine, pGJA-P/VAX, we
previously constructed [12], we utilized an online microRNA pre-
diction tool from Segal lab (https://genie.weizmann.ac.il/pubs/
mir07/mir07_prediction.html). Many microRNAs were found to
have potential binding sites on the gene fragment coding the anti-
gen. And particularly, miR-9 had the most binding sites of all that is
23 binding sites (Fig. 1A and Table S1). Then we co-transfected
pGJA-P/VAX plasmid with the mimics of 11 types of microRNA
which have the most binding sites in GLU-A-P antigen gene frag-
ment into 293 cells. Western blots showed that the expression
levels of antigen protein are lower in miR-9, miR-96, miR-145,
miR-375 and miR-135a mimic groups compared with miR-NC
(Fig. 1B). MiR-9 and miR-96 showed the lowest expression of
GLU-A-P antigen protein than other microRNAs. To analyze the
plasmid transfection efficiency, we replaced vector backbone of
pGJA-P/VAX with pcDNA3.1 to obtain pGJA-P/cDNA plasmid,
which can also express neomycin resistance gene after transfec-
tion. Co-transfection of pGJA-P/cDNA with miR-9 or miR-96 mim-
ics also repressed GLU-A-P antigen protein expression (Fig. 1C).
Moreover, we suppressed the expression of miR-9 and miR-96
with their inhibitors. Compared with miR-96 and the negative con-
trol, inhibition of miR-9 induced the highest levels of the GLU-A-P
antigen protein expression (Fig. 1C). The transfection efficiency of
plasmids is similar in all treatments, suggesting that the repression
of antigen protein expression is not due to lower transfection effi-
ciency of DNA vaccine (Fig. 1D). All these results indicated that
miR-9 could inhibit GLU-A-P antigen expression encoded by DNA
vaccine.
Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
3
3.2. Mutation of miR-9 binding sites improved the expression level of
GLU-A-P antigen
To overcome effect of miR-9 on the expression of GLU-A-P anti-
gen protein, the binding sites of miR-9 on GLU-A-P gene fragment
were mutated without altering the amino acid sequence (Fig. 2A
and B, Table S1). As expected, mutation of miR-9 binding sites sig-
nificantly enhanced the expression of GLU-A-P antigen protein
(Fig. 2C). The transfection efficiency of plasmids is similar in all
treatments (Fig. 2D).
3.3. MiR-9 sponge can prevent miR-9 from inhibiting the expression of
GLU-A-P antigen protein
MicroRNA sponge is a new type of microRNA inhibitor which
contains multiple, tandem binding sites to a target microRNA
and obstructs this microRNA from binding to the gene of interest
[24]. We constructed a miR-9 sponge DNA fragment and cloned
it to the 30 UTR region of a GFP gene (Fig. 3A). Then we co-
transfected miR-9 sponge or NC sponge plasmid with miR-9 or
NC mimic into 293 cells, respectively. And it turned out miR-9
mimic significantly down-regulated the GFP expression of miR-9
sponge plasmid in contrast to other three groups (Fig. 3B, C,
p < 0.01), which illustrated that this miR-9 sponge responded to
miR-9. NF-jB1 is a known target gene of miR-9 [22]. In this study,
transfection of the miR-9 sponge increased the expression of NF-
jB1 in 293 cells (Fig. 3D), confirming the function of the miR-9
sponge. As expected, co-transfection with miR-9 sponge signifi-
cantly enhanced the protein level of GLU-A-P antigen (Fig. 3E).
The transfection efficiency of plasmids is similar in both the treat-
ments (Fig. 3F). MiR-9 sponge transfection significantly down-
regulated cellular miR-9 level compared with miR-NC control
sponge (Fig. 3G). These results suggested that miR-9 sponge may
be able to attenuate the suppression effect of miR-9 on the expres-
sion of GLU-A-P antigen protein.
3.4. MiR-9 sponge enhanced the immune response of DNA vaccine
pGLUA-P in vivo
DNA vaccine pGLUA-P encodes GLU-A-P antigen [11]. To evalu-
ate the effect of miR-9 sponge on the vaccination efficacy of
pGLUA-P DNA vaccine in vivo, we designed following experiment:
mice of 4 groups were immunized two weeks apart with pGLUA-
P + miR-9 sponge, pGLUA-P + NC sponge, Vector + miR-9 sponge,
or Vector + NC sponge intramuscularly, respectively. To avoid the
effect of muscle injury on the expression of microRNAs, we avoided
to apply bupivacaine to treat muscles before immunization. There-
fore, DNA vaccine pGLUA-P + NC sponge group showed no induc-
tion of specific serum IgG antibody. However, we noticed a rise
in the serum specific anti-GLU IgG antibody level in pGLUA-
P + miR-9 sponge group although no significant differences among
these groups at 2 weeks (Fig. 4A, P > 0.05). At 4 weeks, pGLUA-
P + miR-9 sponge group showed a significantly higher specific
anti-GLU IgG antibody level (Fig. 4A, P < 0.01) than other groups.
At 6 weeks, the mean specific serum anti-GLU IgG antibody level
in pGLUA-P + miR-9 sponge group decreased by almost 50%, but
still distinctly higher than other groups (Fig. 4A, P < 0.01). Finally,
at 8 weeks, although the mean serum specific anti-GLU IgG anti-
body level of group pGLUA-P + miR-9 sponge was still higher, a sig-
nificant difference was only observed between this group and
Vector + miR-9 sponge group (P < 0.05).
Because muscle cells were transfected with DNA vaccine and
sponge plasmid and expressed antigen proteins, we also analyzed
miR-9 expression in a mouse myoblast cell line, C2C12 cells. We
found that C2C12 expressed lower level of miR-9 than HEK 293 cell
(Fig. 4B). However, the co-transfection of miR-9 sponge could also
4 R. Jia et al. / Vaccine xxx (xxxx) xxx

Fig. 1. MiR-9 inhibits the expression of GLU-A-P antigen protein. (A) Diagram of the miR-9 binding sites on the gene fragment of GLU-A-P antigen. (B) Expression of GLU-A-P
antigen was detected by western blots. MiRNA mimics of miR-9, miR-29b, miR-33a, miR-33b, miR-96, miR-103, miR-135a, miR-140-5P, miR-145, miR-182, miR-375, and
miR-NC control, were co-transfected with pGJA-P/VAX DNA vaccine plasmid into 293 cells. Actin served as a loading control. (C) The mimics or inhibitors of miR-9, miR-96
and miR-NC were co-transfected with pGJA-P/cDNA into 293 cells, respectively. Western blots were used to detect the expression levels of GLU-A-P antigen protein. (D) The
transfection efficacy of plasmid was monitored by analyzing the transcription levels of the neomycin resistance gene using RT-PCR. Neor represents neomycin resistance gene.

enhance the expression of GLUA-P antigen protein encoded by
anti-caries DNA vaccine in C2C12 cells (Figs. 4C and S3), and
down-regulate cellular miR-9 level (Fig. 4E). The transfection effi-
ciency of plasmids is similar in both the treatments (Fig. 4D). These
results suggested that attenuating miR-9 function was a potent
method to enhance vaccination efficacy of DNA vaccine encoding
GLU-A-P antigen protein.
4. Discussion
MiRNAs play the role of gene silencing, which has been utilized
in vaccines according to reports. In order to balance the immuno-
genicity and safety, Barnes et al. inserted a neuronal-specific
miRNA target sequence into the viral genome of live poliovirus
vaccine to reduce the viral replication in the central nervous sys-
tem but still maintain peripheral replication to elicit strong neu-
tralizing antibody titers at the same time [25]. Perez et al.
inserted the response elements of a non-avian miRNA (miR-93)
into the open-reading frame of the viral nucleoprotein of influenza
A virus and significantly improved vaccine safety in mice [26]. On
the other hand, by incorporating an intron expressing miR-155,
which targets cellular antiviral proteins, into an HIV DNA vaccine,
the immune response toward the HIV-1 envelope (Env) was signif-
icantly enhanced [27]. In this work, we demonstrated that the
expression of antigen protein could be suppressed by microRNAs.
Abolishing the effect of microRNA by mutating binding sites or
microRNA sponge did enhance the expression of antigen proteins.
Moreover, we found that co-administration with anti-microRNA
sponge significantly enhanced the serum immune response to anti-
gen encoded by DNA vaccine. To the best of our knowledge, this is
the first study to indicate that attenuating the effect of an endoge-
nous microRNA can enhance the expression and immunogenicity
of a DNA vaccine.
Generally, three methods are used for miRNA loss-of-function:
genetic knockouts, antagomirs [28] and sponges [24]. We selected

Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
 R. Jia et al. / Vaccine xxx (xxxx) xxx 5

Fig. 2. Mutation of miR-9 binding sites improved the expression level of GLU-A-P antigen. (A) Schematic diagram of mutation of miR-9 binding sites in the gene fragment of
GLU-A-P antigen. (B) Mutation of the first miR-9 binding site in GLU-A-P antigen without changing encoded amino acids as a representative of mutations. (C) Expression of
wild-type (wt) or miR-9 binding sites mutated (mt) GLU-A-P antigen proteins in HEK 293 cells. Data are representative of three independent experiments. (D) The
transfection efficacy of plasmid was monitored by analyzing the transcription levels of the neomycin resistance gene using RT-PCR.

Fig. 3. MiR-9 sponge promotes the expression of GLU-A-P antigen protein. (A) Schematic diagram of a miR-9 sponge plasmid. MiR-9 sponge plasmid was constructed by
cloning the miR-9 binding sites of CDH1, NFKB1, MDGA2, and LYVE1 to the 30 UTR region of green fluorescent protein (GFP) gene. (B and C) miR-9 sponge responded to miR-9.
HEK 293 cells were co-transfected with miR-9 sponge + miR-9 mimic, miR-9 sponge + miR-NC mimic, NC sponge + miR-9 mimic or NC sponge + miR-NC mimic. MiR-NC is a
non-specific microRNA. NC sponge is a non-specific sponge plasmid. The expression of green fluorescent protein was analyzed by flow cytometer. Representative data of three
experiments are shown. (C) The histogram summarized the geometric means of fluorescent intensity of GFP positive cells in each treatment. (D) MiR-9 sponge promotes the
expression of NF-jB1 in HEK 293 cells. MiR-9 sponge or NC sponge were transfected into 293 cells. Western blots were used to analyze the expression of NFjB1. Actin serves
as a loading control. Representative data of two experiments are shown. (E) MiR-9 sponge enhanced the expression of GLU-A-P antigen protein. HEK 293 cells were co-
transfected with pGJA-P/cDNA and microRNA sponge plasmid. The protein expression of GLU-A-P antigen protein was detected by Western blot. Representative data of two
experiments are shown. (F) The transfection efficacy of plasmid was monitored by analyzing the transcription levels of the neomycin resistance gene using RT-PCR. (G) MiR-9
sponge down-regulated the expression level of endogenous miR-9 in HEK 293. The expression levels of endogenous miR-9 were detected by qRT-PCR. Data are representative
of two independent experiments.

Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
6 R. Jia et al. / Vaccine xxx (xxxx) xxx

Fig. 4. MiR-9 sponge enhanced the immune response of DNA vaccine pGLUA-P in vivo. (A) Groups of mice were immunized twice with indicated plasmids. ELISA was used to
detect the serum specific anti-GLU IgG antibody. The relative concentration of serum specific anti-GLU IgG was calculated according to a standard curve constituted by using a
positive mouse anti-GLU serum. Data are expressed as the mean ± SE. *, significantly different from other groups at P < 0.01; **, significantly different from Vector + miR-9
sponge group at P < 0.05. (B) Expression levels of miR-9 in HEK 293 or C2C12 cells were analyzed by qRT-PCR. (C) MiR-9 sponge enhanced the expression of GLU-A-P antigen
protein in C2C12 cells. C2C12 cells were co-transfected by pGJA-P/cDNA and microRNA sponge plasmid. The protein expression of GLU-A-P antigen protein was detected by
Western blot. Data are representative of three independent experiments. (D) The transfection efficacy of plasmid was monitored by analyzing the transcription levels of the
neomycin resistance gene using RT-PCR. (E) MiR-9 sponge downregulated the expression level of endogenous miR-9 in C2C12 cells. The expression levels of endogenous miR-
9 were detected by qRT-PCR. Data are representative of two independent experiments.

microRNA sponge, which express mRNAs with the tandem repeats
of binding sites of a specific miRNA to absorb the endogenous tar-
get miRNA and saturate its function [29]. Using miRNA sponge
technology in vaccination may have several potential benefits. 1)
MicroRNA sponge can attenuate the inhibition of endogenous
microRNA and enhance the antigen expression. 2) MicroRNA
sponge can be designed to target not only single specific miRNA
but also miRNA family members sharing the same seed region
[30]. 3) MicroRNA sponge against immunosuppressive microRNAs
may enhance immunogenicity of vaccination. 4) MicroRNA sponge
can be expressed by plasmid DNA. Therefore, it is convenient to use
the similar methods to produce and use both DNA vaccine and
sponge plasmid. However, like DNA vaccine, microRNA sponge
plasmid may also have the potential risks of chromosomal integra-
tion and inducing autoimmunity.
MiR-9 is a multifunctional microRNA. Suppression of its func-
tion by sponge plasmid may affect cellular processes. For example,
miR-9 is required for neural progenitor cell proliferation and
upregulated in Alzheimer’s disease [31,32] and glioma [33]. MiR-
9 promotes the tumorigenesis of glioma [33]. Therefore, miR-9
sponge may potentially inhibit glioma and Alzheimer’s disease.
NF-jB, including five mammalian proteins (Rel, RelA, RelB, NF-
jB1 and NF-jB2), is a family of transcription factors involved in
inflammatory and immune responses [34]. NF-jB1 can form het-
erodimer with RelB, and promotes the production and secretion
of CCL19, and then enhances the antigen-presenting ability of den-
dritic cells and immune responses [35]. NF-jB1 is involved in the
regulation of both acquired and innate responses, and the patients
with NF-jB1 deficiency showed combined immunodeficiency [36].
MiR-9 binds to NF-jB1 mRNA and inhibit its protein expression
[37,38]. We found that miR-9 sponge can enhance the expression
of NF-jB1 (Fig. 3D). Therefore, miR-9 sponge may also enhance
immune response via promoting NF-jB1 expression. It is a two
birds one stone approach by co-administration of a DNA vaccine
with a microRNA sponge against a microRNA which inhibits both
antigen expression and immune response.
Intramuscular inoculation is a common method to deliver DNA
vaccine. Muscle cells can uptake plasmid DNA and express antigen
protein [1]. We found that the co-transfection of miR-9 sponge can
increase the expression of GLUA-P antigen protein encoded by
anti-caries DNA in a mouse myoblast cell line, C2C12 cells, and
enhance immune responses in vivo. These results suggest that
attenuating the inhibition of endogenous microRNAs may be a
promising method to enhance the antigen expression and
immunogenicity of intramuscular DNA vaccination. Because the
expression of GLUA-P antigen protein is driven by cytomegalovirus
(CMV) promoter in anti-caries DNA vaccine, and CMV promoter
works well in many types of human cells, we speculated that
GLUA-P antigen protein could be expressed in many types of pri-
mary human cells. Co-transfection of miR-9 sponge may also
increase the expression of GLUA-P antigen protein in primary
human cells with miR-9 expression. In this study, we mainly used
human embryonic kidney 293 cell line (HEK 293), which expresses
miR-9. HEK 293 is widely used in gene expression experiments. In
general, the transfection efficiency of plasmid DNA and the expres-
sion level of gene encoded by plasmid DNA are high in HEK 293
cell. Therefore, HEK 293 cell is a satisfying cell type to study the
effect of miR-9 on the expression of GLUA-P antigen protein
encoded by anti-caries DNA vaccine.
In summary, miR-9 inhibited the expression of antigen protein
encoded by the anti-caries DNA vaccine. Attenuating the inhibition
of endogenous miR-9 enhanced the antigen expression and

Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
 R. Jia et al. / Vaccine xxx (xxxx) xxx
immunogenicity of the anti-caries DNA vaccine. Our study may
provide useful information for the design of DNA vaccine.
CRediT authorship contribution statement
Rong Jia: Conceptualization, Data curation, Formal analysis,
Investigation, Methodology, Validation, Writing - original draft,
Writing - review editing. Lingyan Yan: Data curation, Formal anal-
ysis, Methodology, Investigation, Writing - original draft, Writing -
review editing. Jihua Guo: Conceptualization, Data curation, For-
mal analysis, Funding acquisition, Investigation, Methodology, Pro-
ject administration, Supervision, Validation, Writing - original
draft, Writing - review editing.
Declaration of Competing Interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
Acknowledgements
This work was supported by Grant 81571024 and 81170955
from the National Natural Science Foundation of China.
Appendix A. Supplementary material
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.vaccine.2019.11.083.
References
[1] Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, et al. Direct gene
transfer into mouse muscle in vivo. Science 1990;247:1465–8.
[2] Gurunathan S, Klinman DM, Seder RA. DNA vaccines: immunology,
application, and optimization*. Annu Rev Immunol 2000;18:927–74.
[3] Romero NB, Braun S, Benveniste O, Leturcq F, Hogrel JY, Morris GE, et al. Phase I
study of dystrophin plasmid-based gene therapy in Duchenne/Becker
muscular dystrophy. Hum Gene Ther 2004;15:1065–76.
[4] Liu MA. DNA vaccines: an historical perspective and view to the future.
Immunol Rev 2011;239:62–84.
[5] Garmory HS, Brown KA, Titball RW. DNA vaccines: improving expression of
antigens. Genet Vaccines Ther 2003;1:2.
[6] Stachyra A, Gora-Sochacka A, Sirko A. DNA vaccines against influenza. Acta
Biochim Pol 2014;61:515–22.
[7] Tan X, Wan Y. Enhanced protein expression by internal ribosomal entry site-
driven mRNA translation as a novel approach for in vitro loading of dendritic
cells with antigens. Human Immunology 2008;69:32–40. https://doi.org/
10.1016/j.humimm.2007.11.009.
[8] Hamada S, Slade HD. Biology, immunology, and cariogenicity of Streptococcus
mutans. Microbiol Rev 1980;44:331–84.
[9] Koga T, Okahashi N, Takahashi I, Kanamoto T, Asakawa H, Iwaki M. Surface
hydrophobicity, adherence, and aggregation of cell surface protein antigen
mutants of Streptococcus mutans serotype c. Infect Immun 1990;58:289–96.
[10] Monchois V, Willemot RM, Monsan P. Glucansucrases: mechanism of action
and structure-function relationships. FEMS Microbiol Rev 1999;23:131–51.
[11] Guo JH, Jia R, Fan MW, Bian Z, Chen Z, Peng B. Construction and immunogenic
characterization of a fusion anti-caries DNA vaccine against PAc and
glucosyltransferase I of Streptococcus mutans. J Dent Res 2004;83:266–70.
[12] Jia R, Guo JH, Fan MW, Bian Z, Chen Z, Fan B, et al. Immunogenicity of CTLA4
fusion anti-caries DNA vaccine in rabbits and monkeys. Vaccine
2006;24:5192–200.
[13] Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell
2009;136:215–33.
Please cite this article as: R. Jia, L. Yan and J. Guo, Enhancing the immunogenicity of a DNA vaccine against Streptococcus mutans by attenuating the inhi-
bition of endogenous miR-9, Vaccine, https://doi.org/10.1016/j.vaccine.2019.11.083
7
[14] Marin RM, Sulc M, Vanicek J. Searching the coding region for microRNA
targets. RNA 2013;19:467–74.
[15] Roese-Koerner B, Stappert L, Berger T, Braun NC, Veltel M, Jungverdorben J,
et al. Reciprocal regulation between bifunctional miR-9/9(*) and its
transcriptional modulator notch in human neural stem cell self-renewal and
differentiation. Stem Cell Rep 2016;7:207–19.
[16] D’Ippolito E, Plantamura I, Bongiovanni L, Casalini P, Baroni S, Piovan C, et al.
miR-9 and miR-200 Regulate PDGFRbeta-mediated endothelial differentiation
of tumor cells in triple-negative breast cancer. Cancer Res 2016;76:5562–72.
[17] Cui M, Xiao Z, Wang Y, Zheng M, Song T, Cai X, et al. Long noncoding RNA HULC
modulates abnormal lipid metabolism in hepatoma cells through an miR-9-
mediated RXRA signaling pathway. Cancer Res 2015;75:846–57.
[18] Zhang Y, Liao Y, Wang D, He Y, Cao D, Zhang F, et al. Altered expression levels
of miRNAs in serum as sensitive biomarkers for early diagnosis of traumatic
injury. J Cell Biochem 2011;112:2435–42.
[19] Ramachandran D, Roy U, Garg S, Ghosh S, Pathak S, Kolthur-Seetharam U. Sirt1
and mir-9 expression is regulated during glucose-stimulated insulin secretion
in pancreatic beta-islets. FEBS J 2011;278:1167–74.
[20] Plaisance V, Abderrahmani A, Perret-Menoud V, Jacquemin P, Lemaigre F,
Regazzi R. MicroRNA-9 controls the expression of Granuphilin/Slp4 and the
secretory response of insulin-producing cells. J Biol Chem
2006;281:26932–42.
[21] Thulin P, Wei T, Werngren O, Cheung L, Fisher RM, Grander D, et al. MicroRNA-
9 regulates the expression of peroxisome proliferator-activated receptor delta
in human monocytes during the inflammatory response. Int J Mol Med
2013;31:1003–10.
[22] Bazzoni F, Rossato M, Fabbri M, Gaudiosi D, Mirolo M, Mori L, et al. Induction
and regulatory function of miR-9 in human monocytes and neutrophils
exposed to proinflammatory signals. Proc Natl Acad Sci USA 2009;106:5282–7.
[23] Nummer SA, Weeden AJ, Shaw C, Snyder BK, Bridgeman TB, Qian SS. Updating
the ELISA standard curve fitting process to reduce uncertainty in estimated
microcystin concentrations. MethodsX. 2018;5:304–11.
[24] Ebert MS, Neilson JR, Sharp PA. MicroRNA sponges: competitive inhibitors of
small RNAs in mammalian cells. Nat Methods 2007;4:721–6.
[25] Barnes D, Kunitomi M, Vignuzzi M, Saksela K, Andino R. Harnessing
endogenous miRNAs to control virus tissue tropism as a strategy for
developing attenuated virus vaccines. Cell Host Microbe 2008;4:239–48.
[26] Perez JT, Pham AM, Lorini MH, Chua MA, Steel J, tenOever BR. MicroRNA-
mediated species-specific attenuation of influenza A virus. Nat Biotechnol
2009;27:572–6.
[27] Wheatley AK, Kramski M, Alexander MR, Toe JG, Center RJ, Purcell DF. Co-
expression of miRNA targeting the expression of PERK, but not PKR, enhances
cellular immunity from an HIV-1 Env DNA vaccine. PLoS ONE 2011;6:e18225.
[28] Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, et al.
Silencing of microRNAs in vivo with ’antagomirs’. Nature 2005;438:685–9.
[29] Tay FC, Lim JK, Zhu H, Hin LC, Wang S. Using artificial microRNA sponges to
achieve microRNA loss-of-function in cancer cells. Adv Drug Deliv Rev
2015;81:117–27.
[30] Ebert MS, Sharp PA. MicroRNA sponges: progress and possibilities. RNA
2010;16:2043–50.
[31] Lukiw WJ. NF-kappaB-regulated, proinflammatory miRNAs in Alzheimer’s
disease. Alzheimers Res Ther. 2012;4:47.
[32] Lukiw WJ, Surjyadipta B, Dua P, Alexandrov PN. Common micro RNAs
(miRNAs) target complement factor H (CFH) regulation in Alzheimer’s
disease (AD) and in age-related macular degeneration (AMD). Int J Biochem
Mol Biol 2012;3:105–16.
[33] Chen X, Yang F, Zhang T, Wang W, Xi W, Li Y, et al. MiR-9 promotes
tumorigenesis and angiogenesis and is activated by MYC and OCT4 in human
glioma. J Exp Clin Cancer Res 2019;38:99.
[34] Ghosh S, Karin M. Missing pieces in the NF-kappaB puzzle. Cell 2002;109
(Suppl):S81–96.
[35] Gasparini C, Foxwell BM, Feldmann M. RelB/p50 regulates CCL19 production,
but fails to promote human DC maturation. Eur J Immunol 2009;39:2215–23.
[36] Gonzalez-Granado LI, Ruiz-Garcia R, Blas-Espada J, Moreno-Villares JM,
German-Diaz M, Lopez-Nevado M, et al. Acquired and innate immunity
impairment and severe disseminated Mycobacterium genavense infection in a
patient with a NF-kappaB1 deficiency. Front Immunol 2018;9:3148.
[37] Guo LM, Pu Y, Han Z, Liu T, Li YX, Liu M, et al. MicroRNA-9 inhibits ovarian
cancer cell growth through regulation of NF-kappaB1. FEBS J
2009;276:5537–46.
[38] Qian D, Wei G, Xu C, He Z, Hua J, Li J, et al. Bone marrow-derived mesenchymal
stem cells (BMSCs) repair acute necrotized pancreatitis by secreting
microRNA-9 to target the NF-kappaB1/p50 gene in rats. Sci Rep 2017;7:581.