See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/258056003

A method to detect and quantify Phaeomoniella chlamydospora and

Phaeoacremonium aleophilum DNA in grapevine-wood samples

Article  in  Applied Microbiology and Biotechnology · October 2013

DOI: 10.1007/s00253-013-5299-6 · Source: PubMed

CITATIONS READS

39 326

7 authors, including:

Jérôme Pouzoulet Christel Couderc

INRAE Bordeaux-Nouvelle Aquitaine École d’Ingénieurs de PURPAN
34 PUBLICATIONS   352 CITATIONS    11 PUBLICATIONS   120 CITATIONS   

SEE PROFILE SEE PROFILE

Marie Lummerzheim Alban Jacques

Institut polytechnique lasalle beauvais - Esitpa École d’Ingénieurs de PURPAN
11 PUBLICATIONS   282 CITATIONS    40 PUBLICATIONS   350 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Infrared spectroscopy and microorganisms View project

Plant host tolerance/resistance to vascular diseases View project

All content following this page was uploaded by Jérôme Pouzoulet on 06 October 2019.

The user has requested enhancement of the downloaded file.

Appl Microbiol Biotechnol
DOI 10.1007/s00253-013-5299-6
METHODS AND PROTOCOLS
A method to detect and quantify Phaeomoniella
chlamydospora and Phaeoacremonium aleophilum
DNA in grapevine-wood samples
Jérôme Pouzoulet & Nathalie Mailhac & Christel Couderc &
Xavier Besson & Jean Daydé & Marie Lummerzheim &
Alban Jacques
Received: 7 June 2013 / Revised: 26 September 2013 / Accepted: 27 September 2013
# Springer-Verlag Berlin Heidelberg 2013
Abstract Grapevines are sensitive to a wide range of fungal
pathogens, including agents such as Phaeomoniella
chlamydospora and Phaeoacremonium aleophilum that
cause tracheomycosis. In the present study, a procedure for
DNA extraction from grapevine woody tissue is first evaluat-
ed and shown to be suitable for quantitative analysis. Next, a
multiplex real-time PCR method targeting the β-tubulin gene
of the pathogens and the actin gene of plant material is
developed and its quantitative capability is verified. This
protocol was evaluated in inoculated grapevine-wood samples
and in young vines from a nursery and was found to be
reliable and highly specific. Results obtained from inoculated
cuttings show that the fungal colonization process must be
considered regardless of the wood phenotype. An analysis of
samples of young vines from the nursery shows that a high
Marie Lummerzheim and Alban Jacques contributed equally to this work.
Electronic supplementary material The online version of this article
(doi:10.1007/s00253-013-5299-6) contains supplementary material,
which is available to authorized users.
J. Pouzoulet : X. Besson
Loire Viti Vini Distribution (LVVD), Z.A du Landreau,
49610 Mozé sur Louet, France
J. Pouzoulet : N. Mailhac : C. Couderc : J. Daydé :
M. Lummerzheim : A. Jacques (*)
INP‐Ecole d’Ingénieurs de PURPAN, Laboratoire
d’Agrophysiologie, Equipe Vins Viticulture et Œnologie, Université
de Toulouse, 75 Voie du TOEC, BP 57611, 31076 Toulouse Cedex 3,
France
e-mail: alban.jacques@purpan.fr
Present Address:
J. Pouzoulet
Department of Botany and Plant Sciences, University of California,
Riverside, CA 92521, USA
rate of contamination occurs at the basis of plants and that this
contamination is associated with low quantitative values. This
finding provides evidence that in vine nurseries, these fungi
may be efficient soil-borne pathogens.
Keywords Grapevine . Esca . qPCR . Phaeomoniella
chlamydospora . Phaeoacremonium aleophilum
Introduction
By damaging grape harvests, Esca and Petri diseases are re-
sponsible for significant economic losses worldwide (Mugnai
et al. 1999). The causal agents, Phaeomoniella chlamydospora
and Phaeoacremonium spp., colonize the woody tissues of
grapes; the symptoms of infestation by these pathogens be-
come apparent on vegetative organs and cause plant decay.
Symptoms that appear in the wood include the presence of
black, gummy exudates from infected vessels, black streaking
of the xylem (in longitudinal sections), and a reddish-brown
“stripe” beneath the bark (Mugnai et al. 1999; Luque et al.
2009; Kuntzmann et al. 2010; Lecomte et al. 2012). Symptoms
of P. chlamydospora and Phaeoacremonium aleophilum in-
fection vary so widely depending on the age of the plant that
they are described as different diseases: “young vine decline”
or “Petri disease” in young plants, and “Esca” or “black mea-
sles” in mature plants (Surico 2009). The foliar symptom of
Esca disease is an interveinal necrosis of the lamina, which is
sometimes surrounded by a chlorosis (also known as “tiger
striped leaf disease”) (Mugnai et al. 1999; Lecomte et al.
2012), whereas Petri disease is characterized by a lack of vigor
and a sudden wilting of leaves (Mugnai et al. 1999). Infection
by these pathogens also affects grape quality, which leads to a
global decrease in the quality of wine produced or to visual

defects (also known as “black measles”) on berries of white
table-grape cultivars (Lorrain et al. 2012; Mugnai et al. 1999).
In some cases, Esca disease is also characterized by the pres-
ence of white rot (caused by basidiomycetes such as
Fomitiporia mediterranea) in cordon of the trunk of the dis-
eased vine (Surico 2009).
Since the ban of sodium arsenite in many grape-producing
countries (e.g., in France in 2001), no effective substitute has
been proposed to control Esca (Bertsch et al. 2009). Although
pruning wounds are thought to be the main route of infection
by P. aleophilum and P. chlamydospora, another epidemio-
logical aspect of Petri and Esca diseases is that P.
chlamydospora and P. aleophilum can propagate through
the grapevine multiplication process that occurs in nurseries.
Infection in planting material can be due to the use of canes
from infected mother vines (Aroca et al. 2010; Gramaje and
Armengol 2011) and/or to new infection during the produc-
tion process (e.g., grafting, callusing, rooting) (Gimenez-
Jaime et al. 2006; Retief et al. 2006). Gramaje and Armengol
(2011) published an extensive review of strategies to control
grapevine-trunk-disease pathogens in the nursery.
Symptoms of P. aleophilum and P. chlamydospora infec-
tion develop several years after plant contamination
(Sparapano et al. 2001; Zanzotto et al. 2007), thus the need
for efficient tools to detect early contamination in nursery
vines and in the field. Detecting and identifying P. aleophilum
and P. chlamydospora by classical microbiological methods is
fastidious and requires several weeks (Martín et al. 2012).
Moreover, due to their very slow growth rate in semi-
selective media, P. chlamydospora and Phaeoacremonium
species are often overgrown by other microorganisms, leading
to false negatives. Consequently, molecular-based detection
methods in plants are more appropriate for such fungi. Numer-
ous publications discuss PCR-based detection or identification
of P. aleophilum and P. chlamydospora (Ridgway et al. 2002;
Whiteman et al. 2002; Retief et al. 2006; Aroca and Raposo
2007; Edwards et al. 2007; Aroca et al. 2008; Romanazzi et al.
2009; Martos et al. 2011; Martín et al. 2012), and some real-
time PCR methods have been proposed (Overton et al. 2004;
Edwards et al. 2007; Aroca et al. 2008; Martín et al. 2012). The
first real-time PCR strategy, which was proposed by Overton
et al. (2004), uses SYBR-Green chemistry. Because intercalat-
ing agents are not specific fluorescent reporters, PCR reactions
cannot be used for multiplexing in real-time quantitative PCR
assays. The studies of Edwards et al. (2007) and Aroca et al.
(2008) discuss real-time PCR assays but only deal with P.
chlamydospora or Phaeoacremonium spp. These two Taqman
assays targeted P. chlamydospora rDNA and the P.
aleophilum β-tubulin gene, respectively. The most successful
method was proposed by Martín et al. (2012), who managed to
detect P. aleophilum and P. chlamydospora DNA in plant
material using a multiplex Taqman assay. Although this study
demonstrated proper linear dynamic range in each qPCR assay
Appl Microbiol Biotechnol
designed, it did not, unfortunately, attempt to quantify fungal
DNA in woody plant material. ITS regions of rDNA are the
most common targets for designing PCR assays to detect
fungi. rDNA can be present in more than 100 copies per
genome, so its use increases detection sensitivity (Tellenbach
et al. 2010). However, significant changes in the number of
rDNA repeats have been found not only among fungal species,
but also among isolates of the same species for filamentous
fungi (Herrera et al. 2009; Longo et al. 2013). This inconsis-
tency was also reported as a factor that hinders reliable quan-
tification of fungi from environmental samples (Longo et al.
2013). As already suggested by other authors, a target se-
quence that consists of a single-copy gene per haploid genome,
such as the β-tubulin gene, might provide a more reliable
quantification of fungal DNA from different samples
(Atallah et al. 2007). Additionally, an endogenous reference
targeting plant DNA should be included to verify DNA load-
ing and to compensate for variations introduced by sample-to-
sample differences (Schena et al. 2004).
In this work, we present a multiplex Plexor™ real-time
quantitative PCR method that we developed to detect and
quantify DNA of Esca-associated pathogens in grapevine-
wood samples. The use of qPCR technology to detect and
quantify DNA of fungi associated with wood decay in highly
lignified plant tissues was reported previously (Hietala et al.
2003; Bodles et al. 2006; Hietala et al. 2009). Among the
many qPCR chemistries available, the Plexor™ technology
requires only one labeled primer per pair and allows a melt
curve associated with each fluorophore to be analyzed; as a
result each pair is used in the multiplex assay (Sherrill et al.
2004). This chemistry is described as extremely sensitive in
terms of detection and only very weakly influenced by PCR
inhibition, and is also economically competitive (Gasparic
et al. 2010). We began by testing this approach for detecting
and quantifying P. aleophilum and P. chlamydospora in the
wood of inoculated vines. Next, we examined the reliability of
this approach for detecting and quantifying pathogen DNA in
wood samples from preplanting material.
Materials and methods
Fungal isolates
The fungal isolates used in this study are presented in Table 1.
Reference strains deposited in Centraalbureau voor
Schimmelcultures (CBS; Utrecht, The Netherlands) were used
for the specificity tests. For tests on strains of the same species,
isolates were provided by UMR 1065-SV (INRA Bordeaux-
Aquitaine, Villenave d'Ornon, France).
Strains were grown on potato dextrose agar (PDA; Merck,
Darmstadt, Germany) at 26 °C in the dark. Genomic DNA was
extracted from 2-week-old cultures. Fresh mycelia were
Appl Microbiol Biotechnol

Table 1 Isolates used in this study

Species Isolates Country of isolation Host GenBank accession number Bank or location

Phaeomoniella chlamydospora CBS 239.74 USA Vitis vinifera CBS

PCLR142 France Vitis vinifera INRA
PCLR01 France Vitis vinifera INRA
PCLR135 France Vitis vinifera INRA
PP1CO6 France Vitis vinifera INRA
PCLR38 France Vitis vinifera INRA
PCLR29 France Vitis vinifera INRA
PP1AL10 France Vitis vinifera INRA
PP1CO7 France Vitis vinifera INRA
Phaeoacremonium aleophilum CBS100398 Italy Vitis vinifera AF246806 CBS
PP2 CO46 France Vitis vinifera INRA
PP2 AL10 France Vitis vinifera INRA
PP2 CO43 France Vitis vinifera INRA
PP2 CO18 France Vitis vinifera INRA
PP2 F87.2 France Vitis vinifera INRA
Phaeoacremonium iranianium CBS101357 Italy Actinidia chinensis DQ173097 CBS
Phaeoacremonium viticola CBS101738 France Vitis vinifera CBS
Phaeoacremonium inflatipes CBS101585 USA Vitis vinifera CBS
Pheaoacremonium scolytii CBS113593 France Vitis vinifera AY579293 CBS
Pheaoacremonium parasiticum CBS113585 South Africa Vitis vinifera AY579307 CBS
Neofusiccocum parvum CBS110301 Portugal Vitis vinifera EU673095 CBS
Neofusicoccum luteum CBS110299 Portugal Vitis vinifera DQ458848 CBS
Diplodia seriata CBS119049 Italy Vitis vinifera DQ458857 CBS
Diplodia mutila CBS112553 Portugal Vitis vinifera DQ458850 CBS
Fusicoccum aesculi CBS110302 Portugal Vitis vinifera EU673106 CBS
Eutypa lata CBS 208.87 Switzerland Tilia sp. DQ006969 CBS

Isolates used for the specificity study were deposited at the CBS (Centraalbureau voor Schimmelculture, Institute of the Royal Netherlands Academy of
arts and sciences (KNAW), Utrecht, Netherlands). Isolates used for the ubiquity study of French strains were located at INRA UMR-SV (Villenave
d'Ornon, France). All information regarding the CBS isolates were those provided on the CBS website (http://www.cbs.knaw.nl/)

removed with a sterile scalpel and ground using tungsten
carbide beads (Qiagen, Venlo, The Netherlands) and a Retsch
MM300 grinder. By using a DNeasy plant mini Kit (Qiagen
Venlo, The Netherlands), total DNA extraction was done
according to the manufacturer's protocol adapted for fungal
genomic DNA (gDNA) extraction.
DNA concentration was determined according to the man-
ufacturer's procedures, which called for 5 μL of extract, a
Quant-it brDNA reagent (Invitrogen, Carlsbad, USA), and a
Qubit™ Fluorometer (Invitrogen). Measurements were re-
peated three times and the average was retained as the working
concentration.
Primer design and sequence alignment
Primer sets were identified on interspecific variable and
intraspecific nonvariable regions and were checked using
the software Primer3 0.4.0 (http://frodo.wi.mit.edu/
primer3/). Multiple sequences were aligned by using
Multalin (http://multalin.toulouse.inra.fr/multalin.htm). All
β-tubulin partial sequences were collected from the website
of the European Bioinformatic Institute (http://www.ebi.ac.uk).
The following isolates and β-tubulin sequences were used for
alignment of Phaeoacremonium spp.: P. aleophilum CBS
100397 (accession number AF246806), Phaeoacremonium
iranianum CBS10137 (DQ173097), Phaeoacremonium
t u s c a n u m 1 P a l ( E U 8 6 3 4 5 8 ) , P h a e o a c re m o n i u m
austroafricanum CBS112949 (DQ173099),
Phaeoacremonium angustius CBS114992 (DQ173104),
Phaeoacremonium viticola Y271-03-1d (HQ700718),
Phaeoacremonium croatiense 113Pal (EU863482),
Phaeoacremonium occidentale ICMP:17037 (EU596524),
Phaeoacremonium hungaricum 90Pal (EU863483),
Phaeoacremonium armeniacum ICMP:17421 (EU596526),
Phaeoacremonium globosum ICMP:17038 (EU596521),
Phaeoacremonium mortoniae 12RS (AF246809),
Phaeoacremonium sicilianum Psi-1 (FJ872408),
Phaeoacremonium inflatipes CBS 391.71 (AF246805),

P h a e o a c re m o n i u m c i n e re u m P m 1 ( F J 5 1 7 1 5 7 ) ,
Phaeoacremonium hispanicum Y549-09-3b (HQ700715),
Phaeoacremonium scolyti CBS 113593 (AY579293),
Phaeoacremonium griseorubrum CBS 566.97 (AF246801),
Phaeoacremonium subulatum CBS 113584 (AY579298),
Phaeoacremonium australiense CBS 113592 (AY579297),
Phaeoacremonium alvesii CBS 113590 (AY579237),
Phaeoacremonium parasiticum CBS 113585 (AY579307),
Phaeoacremonium krajdenii CBS 110361 (AY579333),
Phaeoacremonium venezuelense CBS 651.85 (AY579320),
and Phaeoacremonium rubrigenum CBS 498.94
(AF246802). Isolates and sequence accession numbers for
Phaeoacremonium chlamydospora are provided in Table 1,
except for P. chlamydospora (CBS 229.95, AF253968). The
Vitis vinifera actin gene was detected by using published
primers (Reid et al. 2006).
DNA purification from wood samples
This procedure was applied to all wood samples discussed in
this study. Samples were lyophilized for 24 h and ground at
room temperature using a Retsch MM300 grinder (90 s, 25
oscillations per second) in a 35-ml stainless-steel grinding jar
(Retsch, Haan, Germany) with 20-mm stainless steel balls
(Retsch, Haan Germany). One hundred milligrams of powder
was incubated on a rotating plate at 65 °C for 1 h in a modified
CTAB (hexadecyltrimethylammonium bromide, Sigma-
Aldrich, St. Louis, USA) extraction buffer from Doyle and
Doyle (1987). The buffer composition was 100 mM Tris–HCl
(tris(hydroxymethyl)aminomethane hydrochloride, Sigma-
A l d r i c h , S t . L o u i s , U S A ) ; 2 0 m M E D TA
(ethylenediaminetetraacetic acid, Sigma-Aldrich, St. Louis,
U S A ) ; 1 . 4 M N a C l ; 2 % C TA B ; 2 % P V P P
(polyvinylpolypyrrolidone, Sigma-Aldrich, St. Louis, USA);
0.5 %v /v β-mercapto-ethanol (Sigma-Aldrich, St. Louis,
USA); 0.4 %v /v of RNase A (Qiagen, Venlo, The Nether-
lands). After this incubation step, a half volume (500 μL) of a
chloroform/isoamyl alcohol solution (24:1, suitable for
nucleic acid purification) (Sigma-Aldrich, St. Louis, USA)
was added and the mixture was incubated 5 min on ice. The
mixture was centrifuged for 10 min (2,300×g , 4 °C) and
400 μL of supernatant was gently pipetted, transferred into a
clean tube, and mixed with 130 μL of AP2 buffer from the
DNeasy plant mini Kit (Qiagen, Venlo, The Netherlands). The
subsequent steps were performed using buffers, materials, and
the protocol supplied with the Dneasy plant mini Kit. The final
elution volume was 50 μL. Samples were stored at −20 °C.
V. vinifera cv. Cabernet Sauvignon (clone 15) canes were
cut up to obtain cuttings with two dormant buds: one at the
shoot and one at the basal end. Material exhibiting bark
injuries and wood discoloration was rejected. Cane pieces of
similar length and diameter were selected, rinsed with running
water and soaked overnight in deionized water. Cuttings were
Appl Microbiol Biotechnol
placed in moist glass wool in plastic cases covered with film
and placed under a light cycle of 16 h day, 8 h nights at 28 °C
for 2 weeks to induce bud breaking and rooting. After 2 weeks,
plants bearing the most similarities were selected and planted
in soil mixtures containing universal peat/river-sand/perlite
(1:1:1) autoclaved twice (120 °C for 20 min).
Preparation of concentration standards
Purified DNA from P. chlamydospora CBS 239.74 was am-
plified by using the primer set Bt2a/Bt2b (Glass and
Donaldson 1995), whereas DNA from P. aleophilum CBS
100398 was amplified by using the forward primer
(AATTACCCCACCATCACGATA), which was specifically
designed for this study, and the reverse primer Bt2b. PCR was
done with a 1X PCR Master Mix (Promega, Madison, USA)
and a final concentration of 0.2 μM of each primer by using
the cycling program described by Glass and Donaldson
(1995). The PCR reaction products were migrated on 2 %
LMP agarose (Promega) in Tris acetate EDTA buffer
(100 mV, 30 min) and visualized using ethidium bromide
under UV light. Strips were cut using a sterile scalpel and
purified using a Qiaquick gel extraction kit (Qiagen, Venlo,
The Netherlands) according to the manufacturer's protocol.
Purified PCR products were cloned using a pGEM-T vector
system (Promega). Recombinant colonies were cultivated ac-
cording to the manufacturer's protocol and recombinant vec-
tors were purified using the Wizard plus SV minipreps vector
purification kit (Promega). PCR was performed using primer
set pUC/M13 (Promega) and recombinant purified vectors
were used as templates. PCR products were purified by using
the MinElute PCR purification kit (Qiagen, Venlo, The Neth-
erlands), quantified as described above, and sequenced with
primer pUC/M13 to determine the lengths and authenticity of
the inserts. We determined the number of copies per microliter
of each mother solution and diluted solutions to obtain theo-
retical molarities of 109 copies per microliter. All 109 standard
solutions were mixed together in a unique solution containing
108 copies per microliter of each PCR standard. These 108
standard copies were used as a mother solution to obtain
unique standard mixtures from 105 to 101 copies.
Real-time PCR
Reactions proceeded in a final volume of 25 μl, and reaction
mixtures contained 12.5 μl of 2X Plexor™ Master Mix
(Promega). For specificity tests, primers were used at a final
concentration of 0.3 μM. In multiplex assays and without
decreasing reaction efficiencies below 90 %, we optimized
the primer concentration to between 0.2 and 0.3 μM to limit
the development of byproducts after 35 cycles. Experiments
were conducted with an ABI 7500 Real-Time PCR cycler
(Applied Biosystems, Foster City, USA) using ABI SDS
Appl Microbiol Biotechnol
software v.1.4 (Applied Biosystems, Foster City, USA) with
the default settings. The cycling program consisted of (1) an
initial denaturation step at 95 °C for 5 min, (2) 40 cycles of 5 s
at 95 °C (for denaturation) followed by 35 s at 65 °C (for both
annealing and extension), and (3) an additional melting analy-
sis of 40 min from 60 to 95 °C. Plexor™ Analysis Software
1.5.6.2 (Promega) was used for data analysis. Labeled Plexor™
primers (5′ Me-iso-dC) were synthesized by Eurogentec S.A.
(Vv ActinF: 5′-(fluka-6-carboxyfluorescein)FAM labeled;
PchQR: 5′-(6-carboxytetra-methylrhodamine)TAMRA la-
beled; PalQF: 5′-(6-carboxyl-X-rhodamine)ROX labeled;
Liege Science Park, Seraing, Belgium). Unlabeled primers
were synthesized by Invitrogen (Fisher Bioblock Scientific,
Illkirch, France).
Serial ten-fold dilutions from 2.5 ng to 25 fg of fungal
DNA template were used to determine the limit of detection
(LOD) of our system. The LOD was determined in terms of
the concentration of fungal-DNA template required to obtain
reproducible detection in three consecutive assays. Tests were
performed in one-plex conditions and in three-plex conditions
with the addition of plant DNA extracted from woody tissues
(10 ng).
Purified genomic DNA was extracted from fungal isolates
(Table 1) and quantified as previously mentioned. Five nano-
grams of DNA were used as a template in 25 μL reactions.
Assays were repeated three times for all fungi tested. Through
ANOVA tests, the statistics of quantitative values from differ-
ent isolates of the same species was analyzed.
Inoculation and sampling of wood cuttings
Before planting cuttings in glass wool, a wound was made
40 mm above the top bud with a 3-mm-diameter sterile drill.
Fungi taken from the margins were grown for 2 weeks in PDA
and then introduced into the wound, which was subsequently
covered with parafilm. The plant was then placed in rooting
and bud breaking conditions for 2 weeks as previously de-
scribed. Cuttings were then potted in jars (140×100 mm)
containing the soil mixtures described above and left to grow
for 6 weeks in a greenhouse with watering every other day.
After this period, they were uprooted and the roots were
cleaned with deionized water to remove the soil and dried
with paper towels. New cane, trunk, and root systems were
separated and weighed. The trunks were chopped downwards
into longitudinal sections using a sterile scalpel and photo-
graphs were taken of the wood phenotype. For quantitative
PCR, the trunks were then cut into three 10-mm-thick seg-
ments taken 5 mm above the inoculation sites. The photos
were analyzed using GIMP 2.0 (Free Software Foundation,
Boston, USA); based on scale patterns in the photographs of
each sample, the wood discoloration length was converted
from pixels to millimeters. The statistics of the data (discolor-
ation length and organ fresh weight) was analyzed via a
Kruskal–Wallis test. Starting 5 mm from the top of the inoc-
ulation sites, three wood sections spaced 1, 2, and 3 cm from
the site were sampled. Bark was removed from DNA extract
sampled from the remaining tissue (pith and wood).
Sampling of young plants from nursery
A bundle of 50 V. vinifera cv. Cabernet Sauvignon plants
grafted on R110 rootstocks and aged approximately one year
were provided by a vine nursery in June 2010. The plants were
individually surface-cleaned, and soil and dust were removed
by rinsing with clear water. The surface of the plants was air
dried and the bark around the graft union and the basal end of
the rootstock was removed with a sterile scalpel. Graft unions
and feet (basal ends) were sampled following anatomical
features. Wood sections were cut with clippers that were
cleaned with 70 % ethanol and flamed. The samples were
stored at −80 °C, lyophilized, and entire sections were ground
as previously described. PCR analysis was done on 10 ng of
DNA.
Results
Primer design
Primer sets were named PalQF/R and PchQF/R for P.
aleophilum and P. chlamydospora, respectively. PalQF and
PalQR were designed on introns 1 and 2 of the β-tubulin gene,
which is highly variable within the Phaeoacremonium family
(Figs. 1a and S1 in the Supplementary Material). Of the 22
partial sequences related to the P. aleophilum β-tubulin gene in
the database of the National Center for Biotechnology Infor-
mation (NCBI), three sequences (EU863470, EU863471,
EU863465) have one mismatch at the 5′ end of PalQF that
may not affect the detection of the corresponding isolates
(21Pal, 144Pal, 81Pal). P. tuscanum shares the closest se-
quence at the annealing sites and has three mismatches for
PalQF and two for PalQR (Fig. S1 in the Supplementary
Material). To the best of our knowledge, P. chlamydospora is
the only Phaeomoniella species reported for grapevine. More-
over, β-tubulin genes corresponding to other species of the
genus are not available. The results of additional research using
the BLAST approach were unsatisfactory for obtaining se-
quences from closely related species of P. chlamydospora.
Next, PchQF/R were designed on regions flanking the fourth
intron of the β-tubulin gene (Fig. 1a), which is a potential
interspecific variable region (Fig. S1 in the Supplementary
Material). Of the 11 sequences corresponding to the P.
chlamydospora β-tubulin gene (11 sequences) in the NCBI
database, no sequences have mismatches in the annealing sites
of PchQ. Both primer sets were checked by BLAST and were
confirmed to be theoretically specific to their respective target
 Appl Microbiol Biotechnol

Table 2 Specificity test

Species PchQ PalQ

Cq Tm Cq Tm

P. chlamydospora 21.7 75.8 n.d. n.d.

P. aleophilum 22.2 82.1
P. iranianium n.d. n.d.
P. viticola n.d. n.d. n.d. n.d.
P. inflatipes n.d. n.d.
P. scolytii n.d. n.d.
P. parasiticum n.d. n.d. n.d. n.d.
Fig. 1 Primers targeting β-tubulin gene of Ascomycota Phaeoacremonium
N. parvum n.d. n.d. n.d. n.d.
aleophilum and Phaeomoniella chlamydospora. a Scheme of Ascomycota
β-tubulin gene showing position of amplicons. First to sixth partial exons N. luteum n.d. n.d. n.d. n.d.
(white squares) of the β-tubulin gene of filamentous Ascomycota were D. seriata n.d. n.d. n.d. n.d.
represented according to Glass and Donaldson (1995). Gray zone repre- D. mutila n.d. n.d. n.d. n.d.
sents 5′-UTR. Black bars indicate the location and length of each amplicon.
F. aesculi n.d. n.d. n.d. n.d.
b Table presenting primer sequences amplifying amplicons. *dC means 5′-
methylisocytosin labeled with fluorochrome E. lata n.d. n.d. n.d. n.d.

Table shows Cq et Tm obtained from several species closed to those of

sequences. PalQ and PchQ primer sets produce short PCR
fragments of 96 and 72 bp (Fig. 1). The specificity of the
primer sets were tested experimentally using the species pre-
sented in Table 1. To assess the specificity of the PalQ primer
set, P. iranium is the closest species deposit in the CBS
collection, and other species associated with vine-wood micro-
flora were selected based on phylogenetic and epidemiological
studies (Mostert et al. 2006b; Rolshausen et al. 2006; Urbez-
Torres et al. 2006; Essakhi et al. 2008; Luque et al. 2009). By
using 5 ng of fungal DNA as a template, both primer sets
PalQF/R and PchQF/R (P. chlamydospora-related primer set)
were shown to be specific to their related species (Table 2).
Development of quantitative real-time PCR
To develop a competitively priced assay, we tested a three-
plex assay containing two primer sets for fungus detection and
one primer set targeting the V. vinifera actin gene as an internal
reference. With PalQF/R and PchQF/R, DNA was quantified
by real-time PCR Plexor™ chemistry (Figs. 2 and 3). Reaction
efficiencies of 90 to 105 % with an R 2 >0.985 were obtained
based on the slopes of standard curves of purified PCR prod-
ucts or total DNA from axenic culture in one-plex and three-
plex conditions (Fig. 2a, b, e). These results cover a dynamic
range from 10 to 105 copies (Figs. 2a, b). Similar results were
obtained with the VvActin set (data not shown). Additionally,
analysis of the melt curve reveals that the primer sets produced
amplicons that resulted in a single peak with standard and
fungal DNA (Fig. 2c, d). A comparison of quantitative and
melting temperature (Tm) values of several isolates of the
same species revealed that none differed significantly from
the others (Fig. 3a). In contrast, the average quantitative values
obtained for both species differed significantly (P <0.05). The
average values were approximately 25,000 and 35,000 copies/
interest (see Table 1). Results were obtained using 5 ng of genomic fungal
DNA
n.d. not detected
ng of DNA for P. aleophilum and P. chlamydospora, respec-
tively (Fig. 3b).
Woody tissues are rich in compounds that could inhibit
PCR reactions and have a very low DNA/mass ratio. Based on
results from 100 different samples, the extraction method used
gives an extraction yield of 7.6 μg of DNA per gram of wood
(±28 %). To determine if DNA extracts can be analyzed by
qPCR without quantification bias, 10 ng of purified DNA
from vine wood, which represents approximately 1 μL of
extract, were introduced into our three-plex assays in addition
to fungal DNA. Similar efficiencies and LODs were obtained
for one-plex conditions using only fungal DNA or a standard
and in three-plex conditions enriched with DNA extracted
from the wood. We therefore conclude that the performance
obtained from both DNA extraction procedures was the same
as for the use of our primer sets in three-plex conditions
(Fig. 2c–e).
Both P. aleophilum and P. chlamydospora yielded LODs
of 250 fg of fungal DNA (Fig. 2a, b, d). With 25 fg of fungal
genomic DNA as a template, valid amplifications were ob-
served in all assays except for three consecutive assays (data
not shown). Therefore, 25 fg could not be considered as a real
LOD (Bustin et al. 2009), so we retained 250 fg as the LOD
(Fig. 2a, b, d).
Inoculated cuttings
The aim of these experiments was to determine whether this
approach would allow us to quantify the presence of P.
aleophilum and P. chlamydospora DNA in woody tissue of
Appl Microbiol Biotechnol
Fig. 2 Multiplex real-time quantitative PCR setup. a, b Standard curve
of each primer set in one-plex and three-plex conditions. PchQ and PalQ
calibration curves obtained in one-plex and three-plex conditions by
using a standard with a known number of copies as a template (a) and
with total DNA extracted from fungi (tDNA) (b). Three-plex assays in b
were done by adding 10 ng of vine-wood DNA extracted under the
conditions outlined in Materials and methods section. The results pre-
sented are based on the means of three replicates. All PCR efficiencies are
between 90 and 105 % and a linear regression of standard curves gives a
coefficient of determination R 2 >0.985. c, d Melt curves obtained for a
inoculated vine plants and to assess the colonization by these
two species. Because of its use in published pathogenicity
assays, we used the mass-inoculation method using a plug of
colonized agar (Laveau et al. 2009; Luque et al. 2009). Since
the process of colonization by these pathogens in grapevine is
usually estimated by measuring lesions in woody tissue
(Sparapano et al. 2001; Laveau et al. 2009; Luque et al.
2009), we devoted particular attention to the wood phenotype.
Two months after inoculation, no leaf symptoms were
found in infected plants. In addition, no significant variation
compared with the control was detected in the fresh weight of
roots and green organs, indicating that infection by these fungi
had not affected vegetative growth under our experimental
conditions (Kruskal-Wallis test, n = 9, P >0.05, data not
shown). Observation of the longitudinal section revealed that,
in cuttings, no statistical difference occurred between the
wood discoloration generated by the P. aleophilum strain
and the coloration of the control (Kruskal–Wallis test, n =9,
P > 0.05). In contrast, the discoloration caused by P.
chlamydospora was statistically different from that of the
control (Kruskal-Wallis test, n =9, P <0.05) (Fig. 4).
Real-time PCR analysis of three wood sections taken 1, 2,
and 3 cm from the inoculation site revealed the presence of
PchQ and b PalQ products in three-plex conditions. Here, the melt curves
are associated with the results presented in Fig. 1b. Melt curves have a
single peak indicating a unique PCR product in both standard and fungal
DNA. Profiles associated with 250 fg of fungal DNA (limit of detection)
show weak, but valid, values. Very weak byproducts without expected
Tm can also be seen in negative controls for PalQ, but no traces were
observed with 250 fg of template. e Equation of linear regression curves
calculated from 1/10 dilutions series shown in c and d. Coefficients of
determination were calculated from 15 points per curve (three repetitions
per concentration). The abbreviation Eff. means PCR efficiency
pathogen DNA in all fragments (Fig. 5). The population of
both fungi decreased with increasing distance from the inocu-
lation site, which reflects a colonization process in both cases.
We also found that the number of fungal β-tubulin copies per
V. vinifera actin gene copy were higher for P. aleophilum than
for P. chlamydospora in the two sections closest to the inoc-
ulation site, but not in the third section where this ratio was
greater for P. chlamydospora than for P. aleophilum. These
results demonstrate that our approach makes it possible to
assess fungal colonization in woody tissues in a reproducible
manner, regardless of wood symptoms (Figs. 4 and 5).
Nursery stock
To determine if the proposed method can detect and quantify
the targeted fungi in naturally infected plants, we analyzed
tissue around two main wounds made during the multiplica-
tion process (at the graft union and the basal end of the
rootstock), because these are potential entry zones for these
pathogens (Fig. 6). Based on an analysis of the fusion curves,
only samples exhibiting the desired Tm profile (i.e., samples
whose fluorescence intensity exceeded the threshold) were
considered as positive (Fig. 6a–c). A positive diagnosis
 Appl Microbiol Biotechnol

Fig. 4 Wood phenotypes 2 months after inoculation with P. chlamydospora

and P. aleophilum. a Transversal (15 mm above inoculation site) and
longitudinal sections of trunks of cuttings inoculated with free culture
medium (Agar), P. aleophilum and P. chlamydospora. Black bar indicates
scale (10 mm) and black arrows indicate wound made in trunk that served as
Fig. 3 a Tm obtained and b quantitative values from different isolates of
the inoculation site. White stars indicate symptoms observed in plants
P. aleophilum and P. chlamydospora
inoculated with P. chlamydospora. b Means of size of discoloration cause
by free culture medium (Agar), P. aleophilum and P. chlamydospora.
resulted from reproducible results obtained in three indepen- Classes found using Kruskal–Wallis test are indicated by letters
dent assays (calibration and measurement). Positive samples
were classified as trace when the number of copies was less Discussion
than the lower limit of quantification (based on the dynamic
linear range of standard curves), and as quantifiable when the PCR-based detection methods are undoubtedly well adapted
number of copies exceeded this limit (Fig. 6d, e). In all positive to early diagnosis of grapevine trunk diseases (Lecomte et al.
samples (quantifiable and trace), amplifications associated
with expected melt profiles were reproduced in one-plex by
using unlabeled PalQ and PchQ sets in Sybr-Green chemistry
(data not shown). PCR products were partially sequenced and
all sequences obtained (reverse primer and amplified region)
shared 100 % identity with expected amplicons of P.
aleophilum and P. chlamydospora (data not shown).
From the 50 plants analyzed, the detection method revealed
that in the graft union, two plants were positive for PchQ and
six for PalQ (Fig. 6a, b), whereas in the basal end of the
rootstock, 11 plants were positive for PchQ and 20 for PalQ
(Fig. 6a, b). Globally, both PchQ and PalQ were detected more
frequently in the basal end but with very low quantitative
values compared with those of the graft union (Fig. 6a, b).
In some plants, similar high values were observed in the basal
end and graft union for PalQ, which might be due to the use of
Fig. 5 Quantification of fungal agent obtained from quantitative PCR
pre-infected rootstock canes. The quantitative values for PalQ assays 2 months after inoculation. a Levels analyzed by quantitative
were greater than those of PchQ, as for the experimentally PCR. Each level is 10 mm further from the inoculation site than the
infected cuttings (Fig. 5b). previous level. b Measurement using qPCR for each level presented in a
Appl Microbiol Biotechnol
R Fig. 6
2000; Fourie and Halleen 2002; Ridgway et al. 2002;
Whiteman et al. 2002; Retief et al. 2005; Romanazzi et al.
2009; Martín et al. 2012). To date, qPCR has been used
extensively in phytopathology and microbial ecology to detect
and quantify fungal DNA in plant samples grown in con-
trolled or natural conditions (Schena et al. 2004; Atallah
et al. 2007; Tellenbach et al. 2010; Yang et al. 2012). In
contrast to several other real-time PCR assays that dealt with
the detection of Esca-associated fungi (Overton et al. 2004;
Edwards et al. 2007; Aroca et al. 2008; Martín et al. 2012), the
present study successfully addresses the quantification of
these pathogen DNA in plant tissue. We thus propose herein
a verified qPCR method to detect and quantify P. aleophilum
Analysis of grafted plant from nursery. a–c Melt curves observed
from sample of basal end of young vine (viewed from Plexor™ analysis
desktop). Here, melt-curve profiles associated with DNA extracted from
50 basal ends of young vine in TAMRA filter (PchQ) (a) and in ROX
filter (PalQ) (b). Blue and red lines are from samples and yellow line is
from standard. Median temperatures (Tm) of products are indicated on
graph. Thin horizontal black line indicates melt-curve threshold. For
PalQ and PchQ, melt-curve profiles from all 50 samples are shown, with
positives in red and negatives in blue. b In negative sample and negative
control (green lines), byproducts associated with weak melt profiles and
unexpected Tm values sometimes appear. Positives samples are associ-
ated with melt curves with a unique spike reaching the fluorescent
threshold and with the expected Tm. c Example of melt curve observed
in the FAM filter (Vv Actin). Only ten samples, positives for P.
aleophilum and/or P. chlamydospora are in red and negatives are in
blue . The melt curves of the standards are in yellow. d P.
chlamydospora-contaminated plants from 50 ready-to-plant vines from
a nursery. e P. aleophilum-contaminated plants from 50 ready-to-plant
vines from a nursery. d P. chlamydospora and e P. aleophilum values in
the graft union (GU) and rootstock basal end (RBE) are represented by
white bars and black bars, respectively. Plants are classified according to
where P. chlamydospora and P. aleophilum were detected and the cu-
mulative values. Three classes are found: detection in RBE (class I), in
RBE and GU (class II), and in GU (class III). Plants for which both fungi
were detected are labeled with letters. Plants with no standard deviation
indicate that only traces were found
and P. chlamydospora in grapevine woody tissues, including
a suitable procedure to extract DNA from wood samples and a
multiplex qPCR assay.
Design of primer sets
For this study, we chose the β-tubulin for our assays because it
is known to occur as a single-copy gene in the genome of
fungi, and because this number is not likely to vary between
different isolates within a species, in contrast to ITS (Herrera
et al. 2009; Longo et al. 2013). The use of β-tubulin for the
design of P. al-specific primer sets is suitable (Mostert 2006;
Aroca et al. 2008; Martín et al. 2012) because of the high
interspecific variability of the Phaeoacremonium genus for
this gene (Mostert 2006). Of the five former primer-probe sets
developed to detect P. chlamydospora in vine material (Tegli
et al. 2000; Overton et al. 2004; Ridgway et al. 2005; Edwards
et al. 2007; Martín et al. 2012), one targets an isolate-specific
marker (moxY homologue) (Ridgway et al. 2005) and four
target ITS (Tegli et al. 2000; Overton et al. 2004; Edwards
et al. 2007; Martín et al. 2012). Thus, this study provides the
first report of a P. chlamydospora primer set targeting the β-
tubulin gene. Even if β-tubulin sequences of species closely
related to P. chlamydospora are still not available online and
the theoretical interspecific specificity of the Phaeomoniella
genus is difficult to assess, to our knowledge none of them
except P. chlamydospora have been reported for grapevine. In
contrast, epidemiological studies reported, 25 different species
of Phaeoacremonium spp. isolated from grapevine (Mostert
et al. 2006a; Essakhi et al. 2008; Gramaje et al. 2009), 21
different species of Botryosphaeriaceae (Urbez-Torres 2011),

and at least 11 species of Diatrypaceae (Rolshausen et al.
2006; Trouillas et al. 2010). In this context, even if we cannot
exclude the occurrence and subsequent detection by our assay
of other Phaeomoniella spp. on grapevine, we can expect the
probability of such an event to be very low. Assays performed
on DNA extracted from axenic culture (Table 2), melt curves
(Fig. 6a–c), and additional sequencing of PCR products ob-
tained from DNA extracts from naturally infected vine mate-
rial have shown that in practice, highly specific detection of P.
aleophilum and P. chlamydospora DNA is achieved by PalQ
and PchQ primer sets.
Limits of detection
For the multiplex qPCR Plexor™ system presented in this
study, LODs are around 250 fg of genomic DNA (Fig. 2).
These LODs are higher than some other published assays,
which are able to detect quantities as low as 1 fg of P.
chlamydospora DNA (Retief et al. 2006) or less than one
conidia (Overton et al. 2004; Edwards et al. 2007). We attri-
bute the relatively high LOD in this study to the choice of a
single-copy gene as target for our qPCR assays. The LOD
magnitude is known to vary from a hundred to a thousand
between single-copy and multi-copy PCR assays (Tellenbach
et al. 2010). With rare exceptions, Ascomycota haploid ge-
nomes generally range from 10 to 100 fg (Gregory et al.
2007). The first drafts of the sequencing of the P. aleophilum
and P. chlamydospora genome indicates that their genome
sizes are around 47.5 Mb (Blanco-Ulate et al. 2013) and
27.7 Mb (F. Peduto, personal communication), respectively.
According to Doležel et al. (2003) and these estimates of
genome size, the P. aleophilum and P. chlamydospora ge-
nome should weigh between approximately 48.5 and 28.25 fg.
In theory, for an optimal PCR system, if one copy leads to a
positive amplification, a minimum of three copies per volume
of template should lead to reproducible detection with 95 %
probability (Bustin et al. 2009). In a PCR system that targets a
single-copy sequence per haploid genome, the LOD of P.
aleophilum and P. chlamydospora assays cannot be less than
150 and 90 fg of fungal DNA, respectively. Recently, Martín
reported a lower LOD (50 fg) for a single-copy Taqman assay
targeting P. aleophilum (Martín et al. 2012). They also report-
ed that this LOD was achieved at a Cq of approximately
39 cycles. Aroca et al. (2008) also reported very low LOD
(1 fg) for their single-copy Taqman assay for P. parasiticum ,
so, as previously discussed, such results could be debatable.
One of the main problems in common qPCR systems is that,
in practice, late nonspecific amplification signals might occur,
which lead to false positives. The Plexor™ qPCR method
reported here allows us, via melt-curve analysis, to assess
the identification of synthesized products, which helps distin-
guish specific late-amplification signals from nonspecific sig-
nals. Sequencing of PCR products identified by their melt
Appl Microbiol Biotechnol
curves as those expected (Fig. 6a–c) has confirmed that this
approach leads to unequivocal detection of low amounts of P.
aleophilum and P. chlamydospora DNA in experimentally
infected samples as well as in samples grown under nursery
conditions.
Quantification of fungal DNA
Although real-time PCR methods are usually considered
quantitative, the validity of this assumption must be verified
before considering a newly developed system to be a quanti-
tative assay (Bustin et al. 2009). Here, we show that for
molarities ranging from 10 to 105 copies or from 250 fg to
2.5 ng of P. aleophilum and P. chlamydospora DNA, Cq is
linear in the logarithm of the number of copies or mass of
DNA (Fig. 2a, b). A similar result was found by Atallah et al.
(2007) for a Verticillium dahliae qPCR Plexor™ multiplex
assay. When a known amount of fungal DNA was quantified,
copy values indicate that the DNA amounts of several isolates
of the same species are not quantified differently from all
others (Table 1). We then demonstrate that, for our system,
only weak quantification biases occur among isolates of the
same species, and these isolates can be quantified as being
almost as same (Fig. 3). These results contrast with the dis-
crepancy observed among isolates of the same species when an
assay targeting rDNA is used (Herrera et al. 2009; Longo et al.
2013). In addition, we found that around 25 000 copies of P.
aleophilum and 35 000 copies of P. chlamydospora β-tubulin
were quantified per femtogram of DNA. This approach esti-
mates P. aleophilum and P. chlamydospora genome sizes of
around 40 and 28 fg, respectively. These values are in com-
plete agreement with estimates obtained by sequencing P.
aleophilum and P. chlamydospora genomes, which give
around 48 fg (Blanco-Ulate et al. 2013) and 28 fg (F. Peduto,
personal communication), respectively, as previously
discussed. These elements confirm that our system accurately
and precisely quantifies fungal DNA.
In this study, we also verified the method of extracting the
total DNA from grapevine-wood samples. The extraction
yield had to be reproducible and DNA extracts had to be
suitable for qPCR analysis, which was not obvious because
of the nature of the tissue and the host (Tegli et al. 2000;
Ridgway et al. 2002). Lyophilization of woody samples al-
lows them to be grinded into a fine and homogeneous powder
at room temperature and does not require liquid nitrogen.
Such grinding considerably facilitates sample handling and
also allows us to obtain constant extraction yields, which is
required for reliable quantification by qPCR analysis. Because
PCR was not inhibited when 10 ng of DNA extracted from
vine wood was used as a template, we conclude that our
method allows absolute quantification of P. chlamydospora
and P. aleophilum DNA within total DNA extracts from vine-
wood samples.
Appl Microbiol Biotechnol
In plants inoculated for our experiments, the proposed
method reliably quantifies the DNA of these pathogens. For
different levels of cane (i.e., ever more distant from the
inoculation site), both P. aleophilum and P. chlamydospora
DNA amounts gradually decrease, which suggests a coloni-
zation process in both cases. In contrast, significant symptoms
(i.e., streaking) appeared in P. chlamydospora inoculated
plants but not in P. aleophilum inoculated plants (Fig. 4).
The appearance of significant wood streaking was reported
for P. al-infected seedlings 2 months after inoculation (Aroca
and Raposo 2009). However, for cuttings, a lack of significant
wood symptoms was also reported for longer incubation
periods (Laveau et al. 2009; Luque et al. 2009). Mugnai
et al. (1999) reported that P. aleophilum can be isolated from
the white discolorated halo found in the trunk of some Esca-
diseased vines. Differences in the macroscopic phenotype of
wood is also known to depend on P. aleophilum isolates,
incubation times, and the cultivars used (Sparapano et al.
2001; Laveau et al. 2009; Luque et al. 2009). Here, we show
that a qPCR analysis allows us to assess P. aleophilum and P.
chlamydospora colonization patterns in plants regardless of
wood symptoms (Fig. 4a). In this context, a qPCR analysis
appears to be the most effective method to measure the spread
of these fungi in experimental assays.
Detection and quantification of P. aleophilum
and P. chlamydospora DNA in vine-planting material
Based on the qPCR method, previous analyses of commercial
plant material from nursery confirmed again that these patho-
gens occur in preplanting vines (Fourie and Halleen 2004;
Gimenez-Jaime et al. 2006; Zanzotto et al. 2007). Our quan-
titative approach indicates that a variety of routes may have led
to these infections (Fig. 6). Of the 50 vines analyzed, we
detected P. chlamydospora DNA in 26 %, P. aleophilum
DNA in 42 %, and no pathogen DNA was detected in 58 %
(Fig. 6). A larger percentage of plants were found to have
pathogen DNA at the graft union for P. chlamydospora, and
both at the graft union and basal end of same plants for P.
aleophilum (Fig. 6). These values are in the same range as
found in mass-inoculated plants (Figs. 5b and 6), so we
hypothesize that these amounts of pathogen DNA indicates
severe infections and probably also reflects the low rate of
infection coming from pre-infected material from the mother
vine, as already reported in Spain (Aroca et al. 2010). Inter-
estingly, plants were more frequently contaminated at the basal
end, but the amount of DNA associated with these contami-
nations was always small and may reflect recent infections
coming from the soil (Fig. 6). Similar levels of infection were
reported for the rootstock part of one-year-old plants from
other nurseries studied (Gimenez-Jaime et al. 2006; Zanzotto
et al. 2007). Several data obtained from experiment also
provide evidence that P. aleophilum and P. chlamydospora
may act as efficient soilborne pathogens in young vines
(Feliciano and Gubler 2001; Aroca and Raposo 2009;
Agustí-Brisach et al. 2013). Moreover, these fungi were often
found in soil and peat from the nursery (Whiteman et al. 2002;
Retief et al. 2006; Aroca et al. 2010). The qPCR approach
may prove a useful analytic method with which to evaluate
these hypotheses as well as the efficacy of any control strate-
gies implemented at the nursery that aim to reduce the inci-
dence of these pathogens in preplanting vine material.
Such a tool can also be useful in a certification scheme,
starting by the screening of mother-vine stocks. In this sce-
nario, sampling 80 units is considered to be sufficient to assess
the quality of a batch of 10,000 units and to determine if the
required quality level of 1 % is satisfied (ISO 1999). This kind
of diagnosis by qPCR is not without cost for nurseries and as a
consequence would be reflected in the price of the plant
material. However, nurseries that implement this test could
improve the quality of their plant material and advertise it to
be certified free of P. aleophilum and P. chlamydospora .
Growers, in turn, would be able to factor the costs of the plant
material into their business model. Planting clean material
from the outset of a vineyard as a preventative action would
extend the lifetime of the vineyard and thereby increase the
grower's profits.
In this study, we developed a multiplex qPCR assay to
detect and quantify P. chlamydospora and P. aleophilum
DNA in woody plant tissue and verified that the assay func-
tions satisfactorily. The proposed method was applied with
success to inoculated cuttings as well as to naturally infected
young vines and has been shown to be specific. As Schena
et al. (2004) said, “the quantification and the assessment of the
colonization rate of plant pathogens in host tissues is one of
the most attractive applications of real-time PCR”. For the
management of Petri disease and Esca-associated fungi, this
quantitative method should improve both our understanding
of the infection route and our ability to verify in plants any
existing or future solutions for controlling infections or for
testing environmental conditions.
Acknowledgments We would like to thank Pascal Lecomte,
Gwenaëlle Comont and Philippe Larignon for providing isolates, and
for their helpful informations on INRA UMR-SV collection strains. We
thank Dr. Philippe Rolshausen for his helpful assistance on the improve-
ment of this manuscript. This research was supported by Loire Vini Viti
Distribution (LVVD, Z.A du Landreau, 49610 Mozé sur Louet, France),
and “Agence Nationale de la Recherche et de la Technologie”.
References
Agustí-Brisach CD, Gramaje J, García-Jiménez J, Armengo J (2013)
Detection of black-foot and Petri disease pathogens in soils of
grapevine nurseries and vineyards using bait plants. Plant Soil
364:5–13

Aroca A, Raposo R (2007) PCR-based strategy to detect and identify
species of Phaeoacremonium causing grapevine diseases. Appl
Environ Microb 73:2911–2918
Aroca A, Raposo R (2009) Pathogenicity of Phaeoacremonium species
on grapevines. J Phytopathol 157:413–419
Aroca A, Raposo R, Lunello P (2008) A biomarker for the identification
of four Phaeoacremonium species using the β-tubulin gene as the
target sequence. Appl Microbiol Biotechnol 80:1131–1140
Aroca A, Gramaje J, Armengol J, Garcia-Jimenez J, Raposo R (2010)
Evaluation of the grapevine nursery propagation process as a source
of Phaeoacremonium spp. and Phaeomoniella chlamydospora and
occurrence of trunk disease pathogens in rootstock mother vines in
Spain. Eur J Plant Pathol 126:165–174
Atallah ZK, Bae J, Jansky SH, Rouse DL, Stevenson R (2007) Multiplex
real-time quantitative PCR to detect and quantify Verticillium
dahliae colonization in potato lines that differ in response to
verticillium wilt. Phytopathology 97:865–872
Bertsch C, Larignon P, Farine S, Clement C, Fontaine F (2009) The
spread of grapevine trunk disease. Science 324:721–721
Blanco-Ulate B, Rolshausen P, Cantu D (2013) Draft genome sequence of
the ascomycete Phaeoacremonium aleophilum strain UCR-PA7, a
causal agent of the Esca disease complex in grapevines. Genome
Announc 1(3):e00339-13
Bodles WJA, Fossdal CG, Woodward S (2006) Multiplex real-time PCR
detection of pathogen colonization in the bark and wood of Picea
sitchensis clones differing in resistance to Heterobasidion annosum.
Tree Physiol 26:775–782
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M,
Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J,
Wittwer CT (2009) The MIQE guidelines: minimum information
for publication of quantitative real-time PCR experiments. Clin
Chem 55:611–622
Doležel J, Bartoš J, Voglmayr H, Greilhuber J (2003) Nuclear DNA
content and genome size of trout and human. Cytometry 51a:
127–128
Doyle JJ, Doyle JL (1987) Rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Phytochem Bull 19:11–15
Edwards J, Constable F, Wiechel T, Salib S (2007) Comparison of the
molecular tests—single PCR, nested PCR and quantitative PCR
(SYBR® green and TaqMan®)—for detection of Phaeomoniella
chlamydospora during grapevine nursery propagation. Phytopathol
Mediterr 46:58–72
Essakhi S, Mugnai L, Crous PW, Groenewald JZ, Surico G (2008) Mo-
lecular and phenotypic characterisation of novel Phaeoacremonium
species isolated from Esca diseased grapevines. Persoonia 21:
119–134
Feliciano A, Gubler WD (2001) Histological investigations on infection
of grape roots and shoots by Phaeoacremonium spp. Phytopathol
Mediterr 40:387–393
Fourie PH, Halleen F (2002) Investigation on the occurrence of
Phaeomoniella chlamydospora in canes of rootstock mother vines.
Australas Plant Pathol 31:425–426
Fourie PH, Halleen F (2004) Occurrence of grapevine trunk disease
pathogens in rootstock mother plants in South Africa. Australas
Plant Pathol 33:313–315
Gasparic MB, Tengs T, La Paz JL, Holst-Jensen A, Pla M, Esteve T, Zel J,
Gruden K (2010) Comparison of nine different real-time PCR
chemistries for qualitative and quantitative applications in GMO
detection. Anal Bioanal Chem 396:2023–2029
Gimenez-Jaime A, Aroca A, Raposo R, Garcia-Jimenez J, Armengol J
(2006) Occurrence of fungal pathogens associated with grapevine
nurseries and the decline of young vines in Spain. J Phytopathol
154:598–602
Glass NL, Donaldson GC (1995) Development of primer sets designed
for use with the PCR to amplify conserved genes from filamentous
ascomycetes. Appl Environ Microb 61:1323–1330
Appl Microbiol Biotechnol
Gramaje D, Armengol J (2011) Fungal trunk pathogens in the grapevine
propagation process: potential inoculum sources, detection, identi-
fication, and management strategies. Plant Dis 95:1040–1055
Gramaje D, Armengol J, Mohemmadi H, Banihashemi Z, Mostert L
(2009) Novel Phaeoacremonium species associated with Petri dis-
ease and esca of grapevine in Iran and Spain. Mycol 101:920–929
Gregory TR, Nicol JA, Tamm H, Kullman B, Kullman K, Leitch IJ,
Murray BG, Kapraun DF, Greilhuber J, Bennett MD (2007) Eu-
karyotic genome size databases. Nucleic Acids Res 35:d332–d338
Herrera ML, Vallor AC, Gelfond JA, Patterson TF, Wickes BL (2009)
Strain-dependent variation in 18s ribosomal DNA copy numbers in
Aspergillus fumigatus. J Clin Microbiol 47:1325–1332
Hietala AM, Eikenes M, Kvaalen H, Solheim H, Fossdal CG (2003)
Multiplex real-time PCR for monitoring Heterobasidion annosum
colonization in Norway spruce clones that differ in disease resis-
tance. Appl Environ Microb 69:4413–4420
Hietala AM, Nagy NE, Steffenrem A, Kvaalen H, Fossdal CG, Solheim
H (2009) Spatial patterns in hyphal growth and substrate exploita-
tion within Norway spruce stems colonized by the pathogenic white-
rot fungus Heterobasidion parviporum. Appl Environ Microb 75:
4069–4078
ISO (1999) ISO 2859–1. Sampling procedures for inspection by attri-
butes. International Organization for Standardization, Geneva
Kuntzmann PS, Villaume S, Larignon P, Bertsch C (2010) Esca, BDA
and eutypiosis: foliar symptoms, trunk lesions and fungi observed in
diseased vinestocks in two vineyards in Alsace. Vitis 49:71–76
Laveau CA, Letouze A, Louvet G, Bastien S, Guerin-Dubrana L (2009)
Differential aggressiveness of fungi implicated in Esca and asso-
ciated diseases of grapevine in France. Phytopathol Mediterr 48:
32–46
Lecomte P, Peros JP, Blancard D, Bastien N, Delye C (2000) PCR assays
that identify the grapevine dieback fungus Eutypa lata. Appl Envi-
ron Microb 66:4475–4480
Lecomte P, Darrieutort G, Liminana JM, Comont G, Muruamendiaraz A,
Legorburu FJ, Choueiri E, Jreijiri F, Ei Amil R, Fermaud M (2012)
New insights into Esca of grapevine: the development of foliar
symptoms and their association with xylem discoloration. Plant
Dis 96:924–934
Longo AV, Rodriguez D, Da Silva LD, Felipe Toledo L, Mendoza
Almeralla C, Burrowes PA, Zamudio KL (2013) ITS1 copy number
varies among Batrachochytrium dendrobatidis strains: implications
for qPCR estimates of infection intensity from field-collected am-
phibian skin swabs. PLOS ONE 8(3):e59499
Lorrain B, Ky I, Pasquier G, Jourdes M, Guerin-Dubrana L, Gény L, Rey
P, Donèche B, Teissedre PL (2012) Effect of Esca disease on the
phenolic and sensory attributes of cabernet sauvignon grapes, musts
and wines. Aust J Grape Wine Res 18:64–72
Luque J, Martos S, Aroca A, Raposo R, Garcia-Figueres F (2009)
Symptoms and fungi associated with declining mature grapevine
plants in northeast Spain. J Plant Pathol 91:381–390
Martín MT, Cobos R, Martín L, López-Enríquez L (2012) Real-time PCR
detection of Phaeomoniella chlamydospora and Phaeoacremonium
aleophilum. Appl Environ Microb 78:3985–3991
Martos S, Torres E, Abdessamad El Bakali M, Raposo R, Gramaje D,
Armengol J, Luque J (2011) Co-operational PCR coupled with dot
blot hybridization for the detection of Phaeomoniella chlamydospora
on infected grapevine wood. J Phytopathol 159:247–254
Mostert L (2006) Phylogeny and taxonomy of Phaeoacremonium and its
relatives. Dissertation, Wageningen UR, Wageningen, The
Nederlands
Mostert L, Halleen F, Fourie PH, Crous PW (2006a) A review of
Phaeoacremonium species involved in Petri disease and Esca of
grapevines. Phytopathol Mediterr 45:s12–s29
Mostert L, Groenewald JZ, Summerbell RC, Gams W, Crous PW
(2006b) Taxonomy and pathology of Togninia (diaporthales) and
its Phaeoacremonium anamorphs. Stud Mycol 54:1–113
Appl Microbiol Biotechnol
Mugnai L, Graniti A, Surico G (1999) Esca (black measles) and brown
wood-streaking: two old and elusive diseases of grapevines. Plant
Dis 83:404–418
Overton BE, Stewart EL, Qu X, Wenner NG, Christ BJ (2004) Qualitative
real-time PCR SYBR® Green detection of Petri disease fungi.
Phytopathol Mediterr 43:403–410
Reid KE, Olsson N, Schlosser J, Peng F, Lund ST (2006) An optimized
grapevine RNA isolation procedure and statistical determination of
reference genes for real-time RT-PCR during berry development.
BMC Plant Biol 6:27
Retief E, Damm U, Van Niekerk M, McLeod A, Fourie PH (2005) A
protocol for molecular detection of Phaeomoniella chlamydospora
in grapevine wood sample. S Afr J Sci 101:139–142
Retief E, McLeod A, Fourie PH (2006) Potential inoculum sources of
Phaeomoniella chlamydospora in South African grapevine nurser-
ies. Eur J Plant Pathol 115:331–339
Ridgway HJ, Sleight BE, Stewart A (2002) Molecular evidence for the
presence of Phaeomoniella chlamydospora in New Zealand nurs-
eries, and its detection in rootstock mothervines using species-
specific PCR. Australas Plant Pathol 31:267–271
Ridgway HJ, Steyaert JM, Pottinger BM, Carpenter M, Nicol D, Stewart
A (2005) Development of an isolate-specific marker for tracking
Phaeomoniella chlamydospora infection in grapevines. Mycologia
97:1093–1101
Rolshausen PE, Mahoney NE, Molyneux RJ, Gubler WD (2006) Reas-
sessment of the species concept in Eutypa lata, the causal agent of
Eutypa dieback of grapevine. Phytopathology 96:369–377
Romanazzi G, Murolo S, Pizzichini L, Nardi S (2009) Esca in young and
mature vineyards, and molecular diagnosis of the associated fungi.
Eur J Plant Pathol 125:277–290
Schena L, Nigro F, Ippolito A, Gallitelli D (2004) Real-time quantitative
PCR: a new technology to detect and study phytopathogenic and
antagonistic fungi. Eur J Plant Pathol 110:893–908
View publication stats
Sherrill CB, Marshall DJ, Moser MJ, Larsen CA, Daude-Snow L, Pru-
dent JR (2004) Nucleic acid analysis using an expanded genetic
alphabet to quench fluorescence. J Am Chem Soc 126:4550–4556
Sparapano L, Bruno G, Graniti B (2001) Three-year observation of
grapevines cross-inoculated with Esca-associated fungi. Phytopathol
Mediterr 40:s376–s386
Surico G (2009) Towards a redefinition of the diseases within the Esca
complex of grapevine. Phytopathol Mediterr 48:5–10
Tegli S, Bertelli E, Surico G (2000) Sequence analysis of ITS ribosomal
DNA in five Phaeoacremonium species and development of a PCR-
based assay for the detection of P. chlamydosporum and P.
aleophilum in grapevine tissue. Phytopathol Mediterr 39:134–149
Tellenbach C, Grünig CR, Sieber TN (2010) Suitability of quantitative
real-time PCR to estimate the biomass of fungal root endophytes.
Appl Environ Microb 76:5764–5772
Trouillas FP, Urbez-Torres J, Gubler WD (2010) Diversity of
diatrypaceous fungi associated with grapevine canker diseases in
California. Mycologia 102:319–336
Urbez-Torres JR (2011) The status of Botryosphaeriaceae species
infecting grapevines. Phytopathol Mediterr 50:s5–s45
Urbez-Torres JR, Leavitt GM, Voegel TM, Gubler WD (2006) Identifi-
cation and distribution of Botryosphaeria spp. associated with
grapevine cankers in California. Plant Dis 90:1490–1503
Whiteman SA, Jaspers MV, Stewart A, Ridgway HJ (2002) Detection of
Phaeomoniella chlamydospora in soil using species-specific PCR.
N Z Plant Prot 55:139–145
Yang J, Ruegger PM, McKenry MV, Becker JO, Borneman J (2012)
Correlations between root-associated microorganisms and peach re-
plant disease symptoms in a California soil. PLOS ONE 7(10):e46420
Zanzotto A, Autiero F, Bellotto D, Dal Cortivo G, Lucchetta G, Borgo M
(2007) Occurrence of Phaeoacremonium spp. and Phaeomoniella
chlamydospora in grape propagation materials and young grape-
vines. Eur J Plant Pathol 119:183–192