Eur J Orthop Surg Traumatol
DOI 10.1007/s00590-007-0221-5
O R I G I N A L A R T I CL E
Development of a molecular methodology to quantify
Staphylococcus epidermidis in surgical wash-out samples
from prosthetic joint replacement surgery
Fergus J. Byrne · Sinéad M. Waters · Peadar S. Waters ·
William Curtin · Michael Kerin
Received: 4 December 2006 / Accepted: 11 January 2007
© Springer-Verlag 2007
Abstract Prosthetic joint infection is a serious complica-
tion of total joint arthroplasty that causes great morbidity in
aVected individuals. The most common cause of prosthesis
associated infections are members of Staphylococcus spp.,
including Staphylococcus epidermidis. Culture has served
as the gold standard for diagnosis, despite obvious short-
comings in terms of sensitivity and time. Bacterial genomic
DNA extraction methodologies were evaluated for optimal
recovery of genomic DNA from sterilised wash-out sam-
ples, spiked with S. epidermidis. Real time Polymerase
chain reaction (PCR) assays targeting the S. epidermidis
speciWc gseA gene were designed to reliably detect and
quantify S. epidermidis. Sixty post-operative wash-out
samples from primary hip and knee arthroplasties were
taken aseptically. All were shown to be culture negative
using the culture-dependent approach. These were samples
were subjected to S. epidermidis-speciWc real time PCR.
Standard curve showed good linearity. Sensitivity limit of
the assay was <10 CFU S. epidermidis per sample. Repro-
ducibility of the assay was conWrmed. S. epidermidis was
F. J. Byrne (&) · W. Curtin
Orthopaedics Department,
Merlin Park Regional Hospital, Galway, Ireland
e-mail: fergbyrne@gmail.com
S. M. Waters
Teagasc, Animal Reproduction Research Centre,
Mellows Campus, Athenry, Co., Galway, Ireland
P. S. Waters
National University of Ireland,
Galway, Ireland
e-mail: peadarwaters@nuigalway.ie
M. Kerin
Department of Surgery, Clinical Science Institute,
University College Hospital, Galway, Ireland
not identiWed in any of these samples using the novel spe-
cies speciWc SYBR Green real time PCR technique. Results
indicated that wash-out samples were true negatives and
did not harbour S. epidermidis. To support this, patients
displayed no symptoms of infection. To illustrate the full
eVectiveness of the novel real time PCR assay, a larger
number of samples need to be tested (>1,000 patients).
Keywords Staphylococcus epidermidis · Real time PCR ·
Bacterial infection · Prosthesis · Joint replacement
Mise au point d’une méthode moléculaire pour
quantiWer le staphylocoque epidermidis dans les
produits de lavage en chirurgie prothétique
Résumé L'infection prothétique est une complication
sérieuse des arthroplasties totales et entraîne une grande
morbidité chez les patients qui en sont atteints La cause la
plus commune des infections liées aux prothèses sont dues
à diverses espèces de staphylocoques, y compris le staphy-
locoque epidermidis. La culture a servi de gold standard au
diagnostic, en dépit des imperfections évidentes en termes
de sensibilité et de temps. Des méthodologies géniquo-bac-
tériennes d'extraction d'ADN ont été évaluées pour le réta-
blissement optimal de l'ADN génique des échantillons
stérilisés de lavage, inoculés avec le staphylocoque epide-
rmidis. Des analyses en temps réel de PCR visant le gène
spéciWque du gseA du staphylocoque epidermidis ont été
conçues pour détecter de façon certaine et pour quantiWer le
staphylocoque epidermidis. Soixante échantillons de produit
de lavage pour des arthroplasties primaires de hanche et de
genou ont été prélevés aseptiquement. Toutes les cultures
ont été trouvées stériles en utilisant l'approche culture-
dépendante. Des échantillons ont été soumis à une analyse
123

en temps réel de PCR au staphylocoque epidermidis. La
courbe standard a montré de bonnes linéarités. La limite de
sensibilité de l'analyse était inférieure à CFU staphylocoque
epidermidis:prélèvement. La reproductibilité de l'analyse a
été conWrmée. Le staphylocoque epidermidis n'a pas été
retrouvé dans l'un quelconque d'entre ces échantillons en
utilisant la technique nouvelle spéciWque SYBR en temps
réel de PCR. Les résultats ont indiqué que les produits de
lavage étaient réellement négatifs et ne contenaient pas du
staphylocoque epidermidis.. Les patients n'ont d'ailleurs
montré aucun symptôme d'infection, ce qui conforte cette
aYrmation. Pour illustrer la pleine eYcacité de l'analyse en
temps réel du nouveau test PCR, un plus grand nombre
d'échantillons doit être examiné (patients >1000).
Mots clés Staphylocoque epidermidis ·
PCR en temps réel · Infection bactérienne · Prothèse ·
Arthroplastie
Introduction
Bacterial colonisation or deep infections of the prosthesis or
its site are major concerns with a potentially catastrophic
outcome [19]. The most commonly cultured microorgan-
isms associated with prosthetic joint infection are coagulase-
negative staphylococci (in 30–43% of cases) and Staphylo-
coccus aureus (12–23%), followed by mixed Xora (10–
11%), streptococci (9–10%), Gram-negative bacilli (3–6%),
enterococci (3–7%) and anaerobes (2–4%). However,
Staphylococcus epidermidis, a coagulase-negative staphylo-
cocci and ubiquitous skin commensal, has emerged as a
causative agent in prosthetic joint infection [19]. These bac-
teria are a major component of the normal skin Xora and
mucous membranes and they are among the most frequently
isolated bacteria in the clinical microbiology laboratory [15].
Cultures of periprosthetic tissue provide the most reli-
able current means of detecting these pathogens and as
such, culture has served as the gold standard for identiWca-
tion of these organisms despite obvious shortcomings in
terms of sensitivity and time. Conventional culture methods
may require several days to obtain a Wnal result and the use
of pre-operative antibiotics may render conventional cul-
tures negative. The existence of ‘culture negative’ osteomy-
elitis has been reported previously [5].
To overcome the shortcomings associated with the diag-
nosis of bacterial infections in orthopaedics by culture and
to reduce the number of infected revision arthroplasties,
molecular methodologies have been employed [14]. Molec-
ular diagnostics relies on the presence of bacterial DNA.
Polymerase chain reaction (PCR)-based methods have been
extensively applied in orthopaedics to identify bacterial
infection [14]. Bacterial presence may be detected by tar-
123
Eur J Orthop Surg Traumatol
geting the 16S rRNA gene using PCR [9]. The following
species have been identiWed using this approach, S. epide-
rmidis [1], S. aureus [2] and methicillin-resistant Staphylo-
cocci [20], to name but a few. However, the use of primers
targeting the 16S rRNA gene has been associated with a
high prevalence of false positive results [21]. The broad
sensitivity of PCR directed against the 16S rRNA detects
even trace contamination by clinically irrelevant organisms
that occur after specimen acquisition. One way to improve
the speciWcity of PCR is to use primers targeting a fragment
of gene, speciWc to the species of interest.
Another issue of concern in the development of sensitive
PCR assays for microbial detection includes the identiWca-
tion of an optimal method of DNA isolation from samples.
Optimal sample processing protocols for diagnostic bacte-
rial PCR should release DNA from an array of target organ-
isms with equal eYciencies and washout inhibitory factors
from various sample types without introducing bacterial
DNA contamination to the ampliWcation reaction. Extrac-
tion and PCR ampliWcation of DNA from synovial Xuid is
recognised to be diYcult. The complex macromolecular
composition of the synovial matrix is claimed to be respon-
sible for PCR inhibition and false negative results when
using bacterial-speciWc PCR for the diagnosis of synovial
infection [13, 16]. Indeed, recent attempts to detect bacte-
rial DNA in samples from equine patients with infectious
synovitis were overall not successful [16].
Real-time PCR is based on the detection and quantitation
of a Xuorescent reporter during PCR and is extremely sensi-
tive [12]. The Wrst and only report in the literature of real
time PCR being applied in the detection of infection in
orthopaedics was made by Kobayashi et al. [10]. This
group developed a real time PCR methodology for the
identiWcation of bacteria in culture-negative osteomyelitis,
however this assay was not species-speciWc nor fully quan-
titative. The aim of the present study was to develop a
rapid, reliable sensitive and reproducible real time PCR
method to detect S. epidermidis in surgical wash-out samples
from prosthetic joint replacement surgery.
Methods
Sample collection
Wash-out samples consisted of 0.9% saline and were sam-
ples of the Wrst wash after reduction of prosthesis. Sixty
(2 £ 40 ml2) samples of post-operative wash-out samples
from primary hip and knee arthroplasties were taken using
aseptic technique in 50 ml sterilin tubes and stored at
¡20°C. One of the duplicate samples was subjected to rou-
tine culture-based clinical microbiological analyses while
the remaining sample was tested using molecular methods.
Eur J Orthop Surg Traumatol
Optimisation of DNA isolation from Staphylococcus
epidermidis from orthopaedic surgical wash-out samples
In order to simulate S. epidermidis contaminated wash-out
samples, washout from a surgical operation was sterilised
and was subsequently spiked with known concentrations of
a pure culture of S. epidermidis. In brief, 1 l of wash-out
matrix was obtained from a patient displaying no signs of
infection and was sterilised by radiation. Sterilisation was
conWrmed by culture-based analyses. S. epidermidis ATCC
8558 was purchased from the American Type Culture Col-
lection, USA, revitalised and cultured according to manu-
facturers instructions. The identity of the strain was
conWrmed following culture by api test analysis (Bio Meri-
eux, Marcy-l’Etoile, France). This was performed to ensure
no contamination occurred during culture. Serial dilutions
of an overnight culture of S. epidermidis was carried out
and a 100
l aliquot of each dilution was plated in triplicate
on nutrient agar at 30°C under aerobic conditions for 24 h
for subsequent quantiWcation. Triplicate 100
l aliquots of
the undiluted culture were stored at ¡20°C for spiking of
sterile washout. Tripicate 1 ml samples of sterile wash-out
samples were spiked to contain 1 £ 109, 1 £ 106, 1 £ 103
and 0 CFU S. epidermidis, respectively.
Spiked wash-out samples were subjected to the Wve
DNA extraction methods listed below.
1. Standard phenol/chloroform puriWcation method fol-
lowed by an ethanol precipitation [17].
2. Protocol as described by Kuipers et al. [11].
3. Wizard Bacterial Genomic DNA isolation kit (Pro-
mega, Madison, WI, USA).
4. Qiagen DNA mini kit (Qiagen Inc., Valencia, CA,
USA)–a silica-gel column-based method.
5. Sigma Bacterial DNA isolation kit (Sigma-Aldrich Ire-
land Ltd., Dublin, Ireland).
For all protocols tested, DNA was eluted in 100
l of
Nuclease-free H2O (Promega). DNA was subsequently
assessed for optimal DNA recovery. QuantiWcation and
purity assessment of DNA was conducted using a Shima-
dzu 160-A ultraviolet (UV) spectrophotometer (Shimadzu
ScientiWc Instruments Inc., Columbia, MD, USA).
QuantiWcation of S. epidermidis in wash-out samples
using real time PCR
Staphylococcus epidermidis ATCC 8558 was cultured
overnight according to manufacturers instructions. Closely
related bacteria, S. aureus ATCC 29313, Staphylococcus
auricularis ATCC 33753, were also cultured overnight
according to manufacturer’s instructions and were applied
as negative controls. Cells were collected by centrifugation
at 6,000 rpm for 10 min using a MSE Mistral 1000 centri-
fuge (Shaw ScientiWc Ltd., Dublin, Ireland).
The extraction procedure using the Wizard Bacterial
Genomic DNA isolation kit (Promega) according to manu-
facturer’s instructions proved most eVective at extracting
the highest quality and quantity of DNA. As such, DNA
was isolated from all cultures using this technique in
molecular studies.
Oligonucleotide primers (Sigma-Genosys, Cambridge,
UK), 5⬘Staph Epi F and 3⬘Staph Epi R (Table 1) were
designed using the software programme ‘Primer3’, avail-
able online at http://www.gene3.ciat.cgiar.org/PRIMER3/
primer3_www.cgi to amplify a 193 bp region of the S. epi-
dermidis speciWc gene, which codes for the glutamic acid-
speciWc serine protease, GluSE [8]. Sequence analysis
using the Basic Local Alignment Search Tool (BLAST),
online at the National Centre for Biotechnology Informa-
tion (NCBI) homepage (http://www.ncbi.nlm.nih.gov),
conWrmed the species speciWcity of these primers.
DNA from S. epidermidis, S. aureus and S. auricularis
was subjected to S. epidermidis-speciWc PCR using the oli-
gonucleotide primers designed in this study and listed in
Table 1.
To reduce the possibility of false positive results, PCR
reagents were subjected to 5 min exposure to UV irradia-
tion prior to this work being carried out and reactions were
formulated in a laminar Xow.
Polymerase chain reaction reactions (100
l), performed
in a DNA thermal cycler (Perkin Elmer Cetus, Wellesley,
MA, USA) contained 500 ng genomic DNA, 10£
(NH4)2SO4 reaction buVer (10
l), MgCl2 (3 mM), primers
(500 ng each) and deoxynucleotide triphosphates (dNTPs)
(500
M each). Taq DNA polymerase (Bioline™, London,
UK) (2 U) was added following the initial denaturation
step.
The PCR ampliWcation programme was: 94°C for 2 min,
84°C for 5 min (to allow the addition of Taq DNA poly-
merase) and 35 cycles of 93°C for 30 s, 60°C for 30 s, 72°C
for 30 s, followed by 10 min at 72°C.
Analysis of ampliWed PCR products (10
l) was carried
out on 1% (w/v) agarose gels using 1£ Tris acetate EDTA
(TAE) running buVer, pH 8.3 in a model EC-360-M Maxi-
cell gel system (EC apparatus Corporation, St. Petersburg,
FL, USA).
Table 1 Primer sequences for Staphylococcus epidermidis-speciWc
PCR
Primer designation Sequence
5⬘Staph Epi F 5⬘GGCAAATTTGTGGGTCAAGA3⬘
3⬘Staph Epi R 5⬘TGGCTAATGGTTTGTCACCA3⬘
123
 Eur J Orthop Surg Traumatol

Positive PCR products (»200 bp on the agarose gel)
were puriWed using the High Pure PCR product puriWcation
kit (Roche, Basel, Switzerland) and DNA sequencing of
PCR products was carried out by Oswel, Southhampton,
UK. Analysis of sequence data and homology comparisons
was performed using the BLAST, online at the NCBI
homepage (http://www.ncbi.nlm.nih.gov).
To generate a standard curve for S. epidermidis quantiW-
cation, S. epidermidis ATCC 8558 was cultured overnight
and quantitated. 50 ml sterile washout was spiked with
1013–101 CFU S. epidermidis in triplicate. Contents of steri-
lin tubes from samples and standards were collected by
centrifugation. Genomic DNA was extracted from cells
using the Wizard Bacterial Genomic DNA isolation kit
(Promega). S. epidermidis-speciWc primers, 5⬘Staph Epi F
and 3⬘Staph Epi R, which were tested for species-speciWc-
ity, were used in real time PCR assays.
In SYBR Green real time PCR, the ampliWcation of the
DNA target is measured in terms of the increment in the
quantity of Xuorescence determined at the end of each
ampliWcation cycle. To determine the optimal concentration
of primers, preliminary tests were performed using equimo-
lar 300, 50, 25 and 5 nM concentrations of the 5⬘Staph Epi
F and 3⬘Staph Epi R forward and reverse primers. Opti-
mised ampliWcation reactions were performed in a total vol-
ume of 50
l with an ABI prism 7500 sequence detector
(Applied Biosystems, Foster City, CA, USA) with 96 well
microwell plates (MicroAmp; Applied Biosystems).
In each well, the following were added: 5
l of puriWed
genomic DNA, 25
l of SYBR Green I PCR Master Mix
(Applied Biosystems), a 50 nM concentration of each S.
epidermidis-speciWc primers 5⬘Staph Epi F and 3⬘Staph Epi
R, in a Wnal volume of 50
l with Nuclease-free H2O (Pro-
mega). Genomic DNA from non-spiked sterile wash-out
samples was applied as a negative control. The reaction
mixture was run online at 50°C for 2 min and 95°C for
10 min (to activate ampli Taq Gold), followed by 35 cycles
at 95°C for 30 s, 60°C for 30 s and 72°C for 30 s, with an
extension phase of 1 cycle at 95°C for 1 min, 60°C for
1 min and 95°C (ramp time, 19.59 min).
The results were visualised using the software Sequence
Detector 1.7 provided with the ABI Prism 7500 system
(Applied Biosystems) and Cell number values were log10
transformed and plotted against their respective cycle
threshold (CT) values to generate a standard curve for quan-
tiWcation of S. epidermidis in wash-out samples. The stan-
dard curve was conWrmed by using Microsoft Excel 2000.
The melting curve was visualised with the software Disso-
ciation Curve 1.0 provided with the ABI Prism 7500 sys-
tem (Applied Biosystems). The reproducibility of the assay
was assessed by spiking sterile washout and measuring S.
epidermidis using the entire methodology described in this
study on three separate occasions.
Results
Sixty surgical wash-out samples from prosthetic joint
replacement surgery were subjected to routine culture-
based microbiological analysis and all samples displayed
no bacterial growth under both aerobic and anaerobic con-
ditions.
To determine the optimal method of DNA isolation from
sterile wash-out samples spiked to contain 1 £ 109,
1 £ 106, 1 £ 103 and 0 CFU S. epidermidis, a number of
DNA extraction methodologies reported in the literature
[11] including commercial kits [10] were assessed for opti-
mal genomic DNA recovery. Table 2 illustrates results
from this evaluation. All DNA isolation generated A260/
A280 ratios in region of 1.6–1–8, indicating that the resul-
tant DNA was of suitable purity to be used in PCR reac-
tions. The Wizard bacterial DNA isolation kit achieved the
greatest recovery of DNA from all dilutions of S. epidermi-
dis, while the method employed by Kuipers et al. [11] to
isolate DNA from synovial Xuid yielded slightly lower
recovery rates. The Qiagen commercial kit has previously
been used to isolate S. epidermidis from bone and soft tis-
sue [10] and to detect bacterial DNA in synovial Xuid form
horses with infectious synovitis [16], however when this kit
was applied in the extraction of S. epidermidis DNA from
wash-out samples, it yielded poor results in comparison to
other procedures. The Sigma bacterial DNA isolation kit
proved least eVective at recovering high levels of bacterial
DNA from surgical wash-out samples. These results dem-

Table 2 QuantiWcation of
Method of DNA Weight of DNA recovered
genomic DNA (mean and
isolation
standard deviation) 1 £ 109 CFU 1 £ 106 CFU 1 £ 103 CFU 0 CFU
(ng
l¡1) (ng
l¡1)

Phenol/chloroform 852 § 0.06 ng
l¡1 521 § 0.04 22 § 0.04 0

Kuipers 1.24 § 0.07
g
l¡1 654 § 0.07 34 § 0.06 0
Wizard 1.56 § 0.08
g
l ¡1
833 § 0.06 50 § 0.04 0
Results presented as a mean of Qiagen 431 § 0.09
g
l¡1 266 § 0.04 27 § 0.04 0
three replicates Sigma 381 § 0.10
g
l¡1 184 § 0.03 9 § 0.05 0

123
Eur J Orthop Surg Traumatol

onstrated that the Wizard kit protocol was most suitable to

be used in further PCR-based studies in this project.
Staphylococus epidermidis-speciWc primers were designed
using the software programme ‘Primer3’ and conWrmed
to be species-speciWc using the bioinformatic analysis
tool, BLAST. DNA, isolated from S. epidermidis, S. aureus
and S. auricularis was subjected to S. epidermidis-speciWc
PCR using the oligonucleotide primers designed in this
study. Following agarose gel electrophoresis the gel was vis-
ualised (Fig. 1). PCR product of the correct size (194 bp)
was generated from S. epidermidis while no ampliWcation
was evident from the negative controls, indicating that the
primers designed in this study were indeed S. epidermidis- Fig. 2 Melting peak analysis of S. epidermidis-speciWc real time PCR
speciWc. To further conWrm the species speciWcity of the assay
primers, the positive PCR product was puriWed and sub-
jected to sequence analysis. BLAST analysis of resultant To produce a standard curve for real time PCR studies,
sequence conWrmed that this product was indeed speciWc to sterile washout was spiked with 1013–101 CFU S. epidermi-
S. epidermidis (data not shown). This result in addition to dis in triplicate and subjected to this technique. The stan-
the inability of the primers to amplify any product from neg- dard curve constructed using mean CT generated for
ative controls compounds the speciWcity of the primers standard concentrations of S. epidermidis (1013–101 CFU
designed and as such, were applied in real time PCR studies. per 50 ml) (Table 3) showed a good linearity of response
During the optimisation of real time PCR conditions, the (R2 = 0.9827) (Fig. 3).
optimal concentration of primers chosen for the experiments
was determined as 50 nM. This concentration was chosen Table 3 Mean and standard deviation CT values for real time PCR
because it provided the lowest CT and because the CT values analysis of Staphylococcus epidermidis standards
obtained at lower primer concentrations (5 and 25 nM) were Log10 copy Mean CT value Standard
signiWcantly higher (P < 0.05; data not shown). number deviation CT
The mean peak Tm obtained for all standards speciWc for
1 39.73 0.021
S. epidermidis was 84°C (range 81.5–86.5°C). It can be
2 39.06 0.046
observed in Fig. 2 that all amplicons are extremely speciWc
3 38.19 0.038
and there are no primer dimers present in reactions indicat-
ing that the real time PCR reactions are highly eYcient. The 4 36.07 0.136
negative controls did not generate any peaks when they 5 33.64 0.151
were subjected to 35 cycles of ampliWcation, further dem- 6 30.43 0.190
onstrating the speciWcity of this assay. 7 27.17 0.053
8 24.55 0.290
9 21.81 0.078
10 18.28 0.076
11 15.63 0.097
12 11.99 0.059
13 8.23 0.128
Results presented as a mean of three replicates

15
Log10 cell number

y = -0.3595x + 16.534
10 R2 = 0.9827

0
Fig. 1 The 1% agarose gel electrophoresis of Staphylococcus epide- 0 10 20 30 40 50
rmidis-speciWc PCR products. Lane 1; 100 bp ladder, Genomic DNA Cycle threshold
from: lane 2; Staphylococcus epidermidis ATCC 8558, lane 3; Staph-
ylococcus aureus ATCC 29313 and lane 4; Staphylococcus auricularis Fig. 3 Standard curve for S. epidermidis quantiWcation in wash-out
ATCC 33753 samples

123

The sensitivity limit of the reaction was <10 CFU per
50 ml (Fig. 3).
The reproducibility of the assay was assessed. When S.
epidermidis was measured in standards employing the
entire real time PCR procedure on three separate occasions,
results were identical, ensuring the reproducibility of the
technique.
To recall, the sixty wash-out samples taken from opera-
tions were shown to be culture negative using microbiolog-
ical culture-dependent techniques. S. epidermidis was also
not identiWed in any of these samples using our novel spe-
cies speciWc SYBR Green real time PCR assay, indicating
that these samples are indeed true negatives and do not har-
bour this species. To support this result, none of these
patients have displayed any symptoms of infection (data
not shown).
Discussion
A novel, rapid sensitive and reproducible real time PCR
methodology has been developed for the speciWc detection
and quantiWcation of S. epidermidis in surgical wash-out
samples from prosthetic joint replacement procedures. This
is the Wrst report of a molecular procedure, which optimally
isolates bacterial genomic DNA from orthopaedic wash-out
samples and speciWcally quantiWes this species using real
time PCR technology. The methodology is culture-indepen-
dent and extremely sensitive, capable of detecting S. epide-
rmidis at levels as low as 10 CFU per reaction.
At present, S. epidermidis is routinely quantiWed in hos-
pital laboratories by culture. The main disadvantage associ-
ated with culturing is the turnabout time that may extend to
several days. The use of real time however can circumvent
this problem. The DNA isolation is completed in <2 h and
the subsequent real time PCR step only takes 2 h, a low
turnabout time compared to days with culture. In addition,
the present of Staphylococcus spp. has been detected in cul-
ture negative osteomyelitis clinical samples using real time
PCR [10], indicating its lack of sensitivity.
It has been reported in previous studies that the method
of DNA preparation in PCR-based bacterial detection and
quantiWcation methodologies is of crucial importance in
improving the sensitivity of the procedure [4, 22]. Kuipers
et al. [11], in a study describing the optimisation of sample
preparation of synovial Xuid for detection of Chlamydia
trachomatis DNA by PCR, concluded that the method of
sample preparation signiWcantly inXuences the sensitivity
of subsequent PCR. Daly et al. [4], noted appreciable diVer-
ences in the sensitivity of a PCR-ELISA method to detect
Escherichia coli depending on the DNA extraction tech-
nique employed. Other groups found that in using certain
DNA isolation methods, PCR inhibitors co-puriWed with
123
Eur J Orthop Surg Traumatol
the target DNA, thereby requiring extensive sample prepa-
ration to remove, dilute or inactivate inhibitors prior to
PCR ampliWcation [6, 7, 11]. As a consequence of these
reports, a variety of DNA extraction methods were evalu-
ated in this study. It was established that diVerent DNA
isolation procedures yielded varying recovery of DNA from
S. epidermidis spiked washout and that the Wizard bacterial
genomic DNA preparation kit (Promega) isolated optimal
concentrations of DNA in the most pure form from sam-
ples. This method of DNA preparation was thus utilised in
all real time PCR quantiWcation procedures.
The most common target gene for bacterial identiWcation
is the 16S rRNA gene that is conserved in nearly all species
of bacteria. For example, Tunney et al. [21] used PCR to
test for evidence of bacteria in Xuids obtained by sonication
of 120 hip implants retrieved at revision arthroplasty. With
the use of primers targeting the 16S rRNA gene, this group
found that this technique was related to a high prevalence
of false positive results. The broad sensitivity of PCR
directed against the 16S rRNA detects even trace contami-
nation by clinically irrelevant organisms that occur after
specimen acquisition. One way to improve the speciWcity of
PCR is to use primers targeting a speciWc organism, or
groups of organisms most likely to be involved in clinically
important orthopaedic infections, as was performed in the
current study.
Other investigators have used this approach. Sakai et al.
developed a PCR assay for staphylococci, in which post-
ampliWcation melting curve analysis allows distinction
between S. aureus and coagulase negative staphylococci
[18]. Kobayashi et al. used a combination of a modiWed
universal PCR and sequencing technology to identify bac-
teria on the basis of DNA sequences that determine Gram-
positive versus Gram-negative staining [9]. Thus, combina-
tions of speciWc PCR assays may ultimately prove to be
more useful than broad-spectrum, so-called ‘universal’ bac-
terial assays. While there is a report in the literature of the
detection of S. epidermidis in orthopaedic clinical samples
using real time PCR, this method was not quantitative [10].
The problem of false positivity in PCR-based studies has
frustrated researchers and clinicians due to unreliable inter-
pretation of positive molecular results. To eliminate these
problems, some precautions were taken in this study. First,
PCR reagents were treated with UV irradiation and sec-
ondly to avoid contamination from DNA in the air the PCR
reactions were formulated carefully in a laminar Xow hood.
In addition, intra-operative sampling by the surgeon is of
utmost importance to avoid contamination of wash-out
samples. Care was taken to employ aseptic technique at all
stages of sampling.
In order to overcome the likely limitation of this meth-
odology of DNA ampliWcation from dead cells, it may be
possible in some instances to incorporate a reverse
Eur J Orthop Surg Traumatol
transcription step in conjunction with real time PCR to
distinguish between viable and non-viable cells. Other new
techniques, which may have a role in the diagnosis of via-
ble infecting bacteria in orthopaedic clinical samples
include the use of microarray technology [3]. A microarray
allows the isolation and evaluation of numerous mRNA
genes with a single test. The premise of this technique is to
identify organism-speciWc genes and as mRNA is targeted,
only live bacteria are detected.
To conclude, a novel, rapid sensitive and reproducible
real time PCR methodology has been developed for the
speciWc detection and quantiWcation of S. epidermidis in
surgical wash-out samples from prosthetic joint replace-
ment procedures. However, to illustrate the full eVective-
ness of this real time PCR assay a larger number of samples
need to be tested (>1,000 patients).
References
1. Arciola CR, Campoccia D, Gamberini S, Donati ME, Montanaro
L (2004) Presence of Wbrinogen-binding adhesin gene in Staphy-
lococcus epidermidis isolates from central venous catheters-asso-
ciated and orthopaedic implant-associated infections. Biomaterials
25(19):4825–4829
2. Arciola CR, Alvi FI, An YH, Campoccia D, Montanaro L (2005)
Implant infection and infection resistant materials: a mini review.
Int J Artif Organs 28(11):1119–1125
3. Bauer TW, Parvizi J, Kobayashi N, Krebs V (2006) Diagnosis of
periprosthetic infection. J Bone Joint Surg 88(4):869–882
4. Daly P, Collier T, Doyle S (2002) PCR-ELISA detection of Esc-
herichia coli in milk. Lett Appl Microbiol 34:222–226
5. Floyed RL, Steele RW (2003) Culture-negative osteomyelitis. Pe-
diatr Infect Dis J 8:731
6. Fratamico PM, Bagi LK, Pepe T (2000) A multiplex polymerase
chain assay for rapid detection and identiWcation of Escherichia
coli 0157:H7 in foods and bovine feces. J Food Prot 63:1032–1037
7. González I, Garcia T, Fernandez A, Sanz B, Hernandez PE, Martin
R (1999) Rapid enumeration of Escherichia coli in oysters by a
quantitative PCR-ELISA. J Appl Microbiol 86:231–236
8. Ikeda Y, Ohara-Nemoto Y, Kimura S, Ishibashi K, Kikuchi K
(2004) PCR-based identiWcation of Staphylococcus epidermidis
targeting gseA endocing the glutamic-acid speciWc protease. Can J
Microbiol 50(7):493–498
9. Kobayashi N, Bauer TW, Togawa D, Lieberman IH, Sakai H, Fu-
jishiro T, Tuohy MJ, Procop GW (2005) A molecular gram stain
using broad range PCR and pyrosequencing technology: a poten-
tially useful tool for diagnosing orthopaedic infections. Diagn Mol
Pathol 14(2):83–89
10. Kobayashi N, Bauer TW, Tuohy MJ, Lieberman IH, Krebs V,
Togawa D, Fujishiro T, Procop GW (2006) The comparison of py-
rosequencing molecular Gram stain, culture, and conventional
Gram stain for diagnosing orthopaedic infections. J Orthop Res
24(8):1641–1649
11. Kuipers JG, Nietfeld L, Dreses-Werringloer U, Koehler L, Wol-
lenhaupt J, Zeidler H, Hammer M (1999) Optimised sample prep-
aration of synovial Xuid for detection of Chlamydia trachomatis
DNA by polymerase chain reaction. Ann Rheum Dis 58(2):103–
108
12. Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K (1995) Oligo-
nucleotides with Xuorescent dyes at opposite ends provide a
quenched probe system useful for detecting PCR product and nu-
cleic acid hybridization. PCR Methods Appl 4(6):357–362
13. Mariani BD, Levine MJ, Booth RE Jr, Tuan RS (1995) Develop-
ment of a novel, rapid processing protocol for polymerase chain
reaction-based detection of bacterial infections in synovial Xuids.
Mol Biotechnol 4(3):227–237
14. Mariani BD, Tuan RS (1998) Advances in the diagnosis of infec-
tion in prosthetic joint implants. Mol Med Today 4(5):207–213
15. Martineau F, Picard FJ, Roy PH, Ouellette M, Bergeron MG
(1996) Species-speciWc and ubiquitous DNA-based assays for rap-
id identiWcation of Staphylococcus epidermidis. J Clin Microbiol
34(12):2888–2893
16. Pille F, Martens A, Schouls LM, Peelman L, Gasthuys F, Schot
CS, De Baere C, Desmet P, Vandenberghe F (2005) Detection of
bacterial DNA in synovial Xuid from horses with infectious syno-
vitis. Res Vet Sci 77:198–195
17. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a
laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York
18. Sakai H, Procop GW, Kobayashi N, Togawa D, Wilson DA, Bor-
den L, Krebs V, Bauer TW (2004) Simultaneous detection of
Staphylococcus aureus and coagulase-negative staphylococci in
positive blood cultures by real-time PCR with two Xuorescence
resonance energy transfer probe sets. J Clin Microbiol 42(12):5739–
5744
19. Steckelberg JM, Osmon DR (2000) Prosthetic joint infections.
American Society for Microbiology, Washington DC, pp 173–209
20. Tarkin IS, Henry TJ, Fey PI, Iwen PC, Hinrichs SH, Garvin KL
(2003) PCR rapidly detects methicillin-resistant staphylococci
periprosthetic infection. Clin Orthop Relat Res 414:89–94
21. Tunney MM, Patrick S, Curran MD, Ramage G, Hanna D, Nixon
JR, Gorman SP, Davis RI, Anderson N (1999) Detection of pros-
thetic hip infection at revision arthroplasty by immunoXuores-
cence microscopy and PCR ampliWcation of the bacterial 16S
rRNA gene. J Clin Microbiol 37(10):3281–3290
22. Waters SM, Doyle S, Murphy RA, Power RF (2005) Development
of solution phase hybridisation PCR-ELISA for the detection and
quantiWcation of Enterococcus faecalis and Pediococcus pento-
saceus in Nurmi-type cultures. J Microbiol Methods 63(3):264–
275
123