Article

p63 and SOX2 Dictate Glucose Reliance and

Metabolic Vulnerabilities in Squamous Cell
Carcinomas
Graphical Abstract Authors
Meng-Hsiung Hsieh, Joshua H. Choe,
Ketogenic Diet Jashkaran Gadhvi, ...,
SGLT2 Inhibition
Ralph J. DeBerardinis, Tae Hoon Kim,
Insulin Glucose
Jung-whan Kim

Correspondence
jay.kim@utdallas.edu

PI3K/AKT G6P In Brief

NADPH
ROS
GSH Hsieh et al. show that p63 and SOX2
G3P
Survival
cooperate to induce enhanced GLUT1
Proliferation
Pyruvate expression, driving a critical reliance on
GLUT1
glucose, in squamous cell carcinomas.
Systemic glucose restriction by
SLC2A1
p63 SOX2 ketogenic diet or SGLT2 inhibition
Intronic attenuates squamous tumor progression
Enhancer
by disrupting redox homeostasis and
TP63
SOX2
insulin/AKT pathways in vivo.
PIK3CA
chromosome 3
3q Amplification

Highlights
d p63 and SOX2 drive elevated GLUT1 expression by SLC2A1
intronic enhancer transactivation

d Enhanced GLUT1-mediated glucose influx fuels antioxidant

production to promote survival

d Systemic glucose restriction concurrently targets vital

metabolic and oncogenic pathways

d High random blood glucose is associated with poorer

outcomes in squamous cancer patients

Hsieh et al., 2019, Cell Reports 28, 1860–1878

August 13, 2019 ª 2019 The Authors.
https://doi.org/10.1016/j.celrep.2019.07.027
 Cell Reports

Article

p63 and SOX2 Dictate Glucose Reliance

and Metabolic Vulnerabilities
in Squamous Cell Carcinomas
Meng-Hsiung Hsieh,1 Joshua H. Choe,2 Jashkaran Gadhvi,1 Yoon Jung Kim,1 Marcus A. Arguez,1 Madison Palmer,1
Haleigh Gerold,1 Chance Nowak,1 Hung Do,1 Simbarashe Mazambani,1 Jordan K. Knighton,1 Matthew Cha,1
Justin Goodwin,4 Min Kyu Kang,5 Ji Yun Jeong,6 Shin Yup Lee,7 Brandon Faubert,8 Zhenyu Xuan,1,9 E. Dale Abel,10
Claudio Scafoglio,11 David B. Shackelford,11 John D. Minna,12 Pankaj K. Singh,13 Vladimir Shulaev,14 Leonidas Bleris,3
Kenneth Hoyt,3 James Kim,15 Masahiro Inoue,16 Ralph J. DeBerardinis,8,17 Tae Hoon Kim,1 and Jung-whan Kim1,18,*
1Department of Biological Sciences, The University of Texas at Dallas, Richardson, TX, USA
2Department of Biological Sciences, Columbia University, New York, NY, USA
3Department of Bioengineering, The University of Texas at Dallas, Richardson, TX, USA
4Graduate School of Art and Sciences and School of Medicine, Yale University, New Haven, CT, USA
5Department of Radiation Oncology, School of Medicine, Kyungpook National University, Daegu, Korea
6Department of Pathology, School of Medicine, Kyungpook National University, Daegu, Korea
7Department of Internal Medicine, School of Medicine, Kyungpook National University, Daegu, Korea
8Children’s Medical Center Research Institute, University of Texas Southwestern Medical Center, Dallas, TX, USA
9Center for Systems Biology, The University of Texas at Dallas, Richardson, TX, USA
10Division of Endocrinology and Metabolism and the Fraternal Order of Eagles Diabetes Research Center, Roy J. and Lucille A. Carver

College of Medicine, University of Iowa, Iowa City, IA, USA

11Department of Pulmonary and Critical Care Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA, USA
12Hamon Center for Therapeutic Oncology Research, Simmons Comprehensive Cancer Center, Departments of

Medicine and Pharmacology, University of Texas Southwestern Medical Center, Dallas, TX, USA
13Eppley Institute for Cancer Research, University of Nebraska Medical Center, Omaha, NE, USA
14Department of Biological Sciences, College of Science, Advanced Environmental Research Institute, University of North Texas, Denton,

TX, USA
15Department of Internal Medicine, Hamon Center for Therapeutic Oncology Research, and Simmons Comprehensive Cancer Center,

University of Texas Southwestern Medical Center, Dallas, TX, USA

16Department of Clinical Bio-resource Research and Development, Graduate School of Medicine, Kyoto University, Kyoto, Japan
17Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, TX, USA
18Lead Author

*Correspondence: jay.kim@utdallas.edu
https://doi.org/10.1016/j.celrep.2019.07.027

SUMMARY SCC patients. Collectively, this study identifies the

Squamous cell carcinoma (SCC), a malignancy
arising across multiple anatomical sites, is respon-
sible for significant cancer mortality due to insuffi-
cient therapeutic options. Here, we identify excep-
tional glucose reliance among SCCs dictated by
hyperactive GLUT1-mediated glucose influx. Mecha-
nistically, squamous lineage transcription factors
p63 and SOX2 transactivate the intronic enhancer
cluster of SLC2A1. Elevated glucose influx fuels gen-
eration of NADPH and GSH, thereby heightening the
anti-oxidative capacity in SCC tumors. Systemic
glucose restriction by ketogenic diet and inhibiting
renal glucose reabsorption with SGLT2 inhibitor pre-
cipitate intratumoral oxidative stress and tumor
growth inhibition. Furthermore, reduction of blood
glucose lowers blood insulin levels, which sup-
presses PI3K/AKT signaling in SCC cells. Clinically,
we demonstrate a robust correlation between blood
glucose concentration and worse survival among
exceptional glucose reliance of SCC and suggests
its candidacy as a highly vulnerable cancer type to
be targeted by systemic glucose restriction.
INTRODUCTION
Squamous cell carcinoma (SCC) is a major class of malignancy
arising from squamous cells of the epithelia and is responsible
for more than one million cancer deaths annually worldwide
(Dotto and Rustgi, 2016; Yan et al., 2011). Despite the trend to-
ward molecularly targeted therapy for certain cancers, SCC pa-
tients have benefited very little from the application of such
therapeutic options due to a lack of identified vulnerabilities.
Rather, decades old platinum-based chemotherapy or radiation
regimens still remain the first-line treatment options and, thus,
retain limited specificity to the unique characteristics of SCC
(Dotto and Rustgi, 2016). SCCs originate from stratified
epithelial layers of various anatomical sites (Yan et al., 2011).
Despite the unique microenvironmental cues of the tissues
where SCCs arise, the majority of SCCs share common onco-
genic abnormalities, such as the amplification of chromosome

1860 Cell Reports 28, 1860–1878, August 13, 2019 ª 2019 The Authors.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
3q, which contains important transcriptional regulators p63 and
SOX2 (Cancer Genome Atlas, 2015; Cancer Genome Atlas
Research Network, 2012; Cancer Genome Atlas Research
Network et al., 2017a; Cancer Genome Atlas Research
Network et al., 2017b).
p63, part of the p53 protein family, is a master transcription
factor of stem cell pluripotency and remains crucial in basal
epithelial development, differentiation, and prevention of
senescence (Crum and McKeon, 2010; Su et al., 2013).
Recent studies have established the oncogenicity of amplified
DNp63, an isoform that lacks the N-terminal transactivation
(TA) domains as a result of an alternative transcriptional start
site, in squamous cancer development and progression.
Amplified DNp63 may cooperate with various oncogenic
events, including activation of oncogenic Ras and b-catenin
as well as repression of tumor suppressors p53 and p73, to
endow an increased proliferative effect (Hibi et al., 2000;
Keyes et al., 2011; Patturajan et al., 2002; Rocco et al.,
2006; Yang et al., 1998). Analogous to DNp63, SOX2, a key
transcriptional regulator that is crucial for embryonic stem
cell pluripotency maintenance and cell fate determination
(Gubbay et al., 1990; Sinclair et al., 1990), is frequently ampli-
fied and drives oncogenic growth in various SCCs (Bass et al.,
2009). Ectopic SOX2 expression in autochthonous mouse
models of lung cancer resulted in squamous lineage restric-
tion (Ferone et al., 2016). Intriguingly, p63 and SOX2 have
been reported to jointly occupy multiple genomic loci in
esophageal and lung SCC cell lines (Watanabe et al., 2014).
Collectively, these studies indicate that p63 and SOX2 may
cooperate to generate a squamous lineage-specific transcrip-
tional program that promotes the oncogenic progression of
SCC and the reliance on which may present a targetable
vulnerability. Here, we seek to further uncover the precise
mechanism through which p63 and SOX2 cooperatively exert
a SCC-specific oncogenic phenotype.
In addition to oncogene reliance, a deregulated metabolism,
in order to support the unique bioenergetic as well as anabolic
needs of rapidly proliferating cells, represents another
defining malignant abnormality of cancer (Vander Heiden
and DeBerardinis, 2017). Constitutively augmented glycolysis
even in the presence of adequate oxygen, known as the War-
burg effect (Warburg, 1956a, 1956b), is thought to support
cancer progression by helping cancer cells meet their
enhanced needs for energy, macromolecular biosynthesis,
and redox homeostasis. Although these pivotal functions of
glycolysis were considered a universal feature of cancer
metabolism, an increasing body of evidence argues for sub-
stantial heterogeneity in glucose metabolism among diverse
cancer types and regional metabolic heterogeneity even
within the same tumor (Gentric et al., 2017; Hensley et al.,
2016). For example, our recent study demonstrated a distinct
metabolic heterogeneity between two subtype tumors of non-
small-cell lung cancer (NSCLC), lung squamous cell carci-
noma (LSCC), and lung adenocarcinoma (LADC) (Goodwin
et al., 2017). LSCC exhibits distinctively elevated glucose
transporter 1 (GLUT1) expression resulting in a high reliance
on glucose, whereas LADC is significantly less dependent
on glucose for survival and tumor growth.
In light of this distinct metabolic heterogeneity, we sought to
expand our analysis to other major SCC and non-SCC tumors.
Our results reveal that hyper-activation of GLUT1-mediated glyco-
lytic influx is phenotypically embedded in all major SCCs and not
only LSCC, suggesting a previously unrecognized unifying meta-
bolic signature among SCCs. Here, our study uncovers that
GLUT1 is a direct transcriptional target of p63 and SOX2, by which
the p63 and SOX2 complex binds to and transactivates the intronic
enhancer cluster of the SLC2A1 gene that encodes GLUT1, result-
ing in markedly elevated GLUT1 expression. GLUT1-mediated
glucose influx fuels generation of nicotinamide adenine dinucleo-
tide phosphate (NADPH) from the pentose phosphate pathway
(PPP), which provides a sustaining anti-oxidative capacity that is
required for the survival and tumor growth of SCCs. Moreover,
glucose restriction by ketogenic diet, inhibition of renal glucose re-
absorption with US Food and Drug Administration (FDA)-approved
SGLT2 inhibitor canagliflozin, and genetic ablation of the SLC2A1
gene effectively and specifically suppressed the tumor growth of
SCC xenografts as well as autochthonous transgenic mouse
models. Together, these results not only provide mechanistic
insight into squamous lineage-specific metabolic regulation
through an enhancer region of SLC2A1 but also define metabolic
vulnerabilities imposed by the exquisite glucose reliance of SCC.
This study further presents a viable treatment paradigm in target-
ing squamous cancers metabolically by modulating organismal
level blood glucose levels and canonical insulin/phosphatidylinosi-
tol 3-kinase (PI3K)/AKT signaling by dietary as well as pharmaco-
logical glucose restriction.
RESULTS
Robust GLUT1 Expression Defines a Unifying Metabolic
Feature of SCCs
We recently reported that GLUT1 is distinctively overexpressed
in the SCC subtype of NSCLC, resulting in a strict reliance on
glucose and a high susceptibility to glycolytic inhibition (Good-
win et al., 2017). However, SCC arises from multiple anatomical
sites in addition to the lung (Yan et al., 2011). Thus, we sought to
determine if GLUT1 overexpression is phenotypically associated
with squamous lineage malignancy. The Cancer Genome Atlas
(TCGA) analysis of mRNA sequencing gene expression profiles
revealed that all four annotated head and neck (HN), lung, esoph-
ageal, and cervical SCCs are the highest GLUT1-expressing
cancers (Figure 1A). Notably, a significant proportion of the
bladder urothelial carcinoma (BLCA) cohort, which is the fifth-
highest GLUT1-expressing tumor type, exhibits a squamous
gene expression pattern, yet, squamous patients have not
been annotated (Cancer Genome Atlas Research Network,
2014). Analysis of other glucose transporters validates that
GLUT1 is the predominant glucose transporter in SCCs (Fig-
ure S1A). Experimentally validating TCGA results, immunohisto-
chemical (IHC) analysis of human SCC tissue microarrays
demonstrates that GLUT1 is remarkably and specifically overex-
pressed in all SCCs tested as compared to non-squamous sub-
types (Figures 1B and S1B). Moreover, we observed exclusive
GLUT1 overexpression in squamous tumor areas within lung
and cervical mixed adenosquamous carcinoma tumor tissues
(Li and Lu, 2018) (Figures 1C and S1C). GLUT1 mRNA and
Cell Reports 28, 1860–1878, August 13, 2019 1861
 A B

D E

(legend on next page)

1862 Cell Reports 28, 1860–1878, August 13, 2019

protein expression is also highly elevated in a panel of SCC cell
lines as compared to non-SCC cell lines (Figures 1D and 1E).
GLUT1 expression levels are strongly correlated with the expres-
sion of SCC-specific markers, DNp63, cytokeratin 5 (CK5,
KRT5), and cytokeratin 6A (CK6A, KRT6A) (Figures 1E and
S1D). Next, we performed a differential gene expression analysis
by comparing the combined TCGA cohort of all four SCCs
(n = 1,372) to all non-SCC tumors (n = 7,752). The analysis iden-
tified GLUT1 (SLC2A1) among the most significantly upregulated
genes in the combined SCC cohort, along with genes associated
with squamous differentiation and carcinogenesis (TP63, KRTs,
GPR87, and KLF5) and oxidative detoxification (AKRs,
ALDH3A1, GPX2, and CYP2S1) (Dotto and Rustgi, 2016) (Fig-
ures 1F and S2A). The BLCA cohort (n = 408) was analyzed as
a separate group due to the lack of subtype annotation but ex-
hibited a correspondingly SCC-like expression pattern (Cancer
Genome Atlas Research Network, 2014). Collectively, these re-
sults uncovered remarkably heightened GLUT1 upregulation as
a potent and unique metabolic characteristic embedded in squa-
mous lineage cancers.
p63 Regulates GLUT1 Expression
We next sought to identify the mechanisms underlying universal
GLUT1 upregulation in SCCs. Previous studies and our TCGA
copy number variation (CNV) analysis have shown that transcrip-
tion factor p63 is highly expressed in major SCCs mainly through
genomic amplification of chromosome 3q26 and functions as a
squamous lineage-specific oncogene (Figure S3A) (Hibi et al.,
2000; Ramsey et al., 2013). Moreover, we identified a robust cor-
relation between GLUT1 and p63 mRNA expression in individual
as well as combined SCC TCGA cohorts (Figures S3B and S3C).
We validated the p63/GLUT1 correlation in human SCC tumor
tissues by co-immunofluorescent (IF) staining for p63 and
GLUT1 (Figure 2A). To assess the potential link between p63
and GLUT1, we performed short hairpin RNA (shRNA)-mediated
knockdown of p63 in lung (HCC95 and HCC2814), esophageal
(KYSE70), and HN (JHU-029) SCC cell lines and observed that
p63 knockdown remarkably decreased GLUT1 mRNA and pro-
tein expression (Figures 2B and S3D). Immunocytochemistry
(ICC) staining confirmed the attenuation of GLUT1 levels at the
plasma membrane in p63 knockdown SCC cell lines (Figures
2C and S3E).
The p63 gene (TP63) expresses two major isoforms, TAp63
and amino terminally truncated DNp63 (Crum and McKeon,
2010; Su et al., 2013). As DNp63 is generally the predominant
isoform expressed in squamous cancer cells (Rocco and Ellisen,
2006), we validated that DNp63 is indeed predominantly ex-
pressed in a panel of SCC cell lines (Figure S4A), whereas
TAp63 was undetectable by immunoblot assays. To confirm
that DNp63 is responsible for GLUT1 expression, we employed
isoform-specific shRNAs to knock down DNp63 or TAp63.
DNp63-specific knockdown consistently suppressed GLUT1
mRNA and protein expression in SCC cell lines (Figure 2D),
whereas TAp63 knockdown showed no effect on GLUT1 expres-
sion or glucose uptake (Figures S4B and S4C). Conversely, we
ectopically introduced DNp63 or TAp63 and observed that only
ectopically expressed DNp63 further increased GLUT1 mRNA,
protein levels, and glucose uptake in SCC cell lines (Figures
2E, 2F, S4D, and S4E). These results indicate that DNp63 but
not TAp63 isoforms transcriptionally activate GLUT1 expression
in SCCs.
We next investigated whether GLUT1 is a direct target of p63.
Global DNA binding of p63 across the genome has been well
characterized (Bao et al., 2015; Kouwenhoven et al., 2015). Anal-
ysis of the publically available dataset of the HN SCC cell line
JHU-029 identified strong p63 chromatin immunoprecipitation
sequencing (ChIP-seq) signal clusters within the second intron
of the GLUT1 gene (SLC2A1) (Saladi et al., 2017) (Figure 2G).
Intriguingly, an epigenetic mark of potential enhancer elements,
H3K27ac, is co-localized with p63 binding regions (Kundaje
et al., 2015; Zhang et al., 2016) (Figure 2G). Corroborating the
ChIP-seq dataset, our ChIP assays identified strong p63 and
H3K27ac binding signals in all three individual potential enhancer
elements (E1–E3) on the second intronic region of SLC2A1 but
not on the first intronic region of SLC2A1 or the gene desert region
(NC, negative control) (Figures 2H). Furthermore, we observed a
significant induction of luciferase expression in the potential
enhancer-containing reporter construct, whereas DNp63 knock-
down reduced luciferase reporter activity, thus validating the
specificity of p63-mediated transcriptional activation of GLUT1
(Figures 2D and 2I). To further validate p63 binding to the potential
SLC2A1 enhancer in physiologically relevant conditions, we dis-
rupted the p63-binding site in E2 by CRISPR-Cas9-mediated
genome editing. Notably, GLUT1 expression was significantly
reduced in edited clones containing the deletion (Figure 2J).
Collectively, these data suggest that p63-dependent transactiva-
tion of SLC2A1 enhancer clusters is the mechanistic basis for
GLUT1 overexpression across all SCCs.

Figure 1. Enhanced GLUT1 Expression and Glycolytic Metabolism in SCC

(A) RNA sequencing (RNA-seq) analysis of GLUT1 mRNA expression among 35 tumor types. Each box represents the lower quartile, median, and upper quartile.
Whiskers represent the 10th and 90th percentile of the data. Kruskal-Wallis nonparametric ANOVA. TPM, transcripts per million.
(B) Representative IHC images (top) and quantification (bottom) of GLUT1 expression in human lung (n = 237), skin (n = 50), oral cavity (n = 43), cervix (n = 198), and
esophagus (n = 54) SCC and non-SCC tumor tissue microarray (top). Scale bars, 1 mm. Each box represents the lower quartile, median, and upper quartile.
Whiskers represent the 10th and 90th percentile of the data. Mann-Whitney U-test or one-way ANOVA. BCC, basal cell carcinoma; MEL, melanoma; MuCC,
mucoepidermoid carcinoma of salivary gland; EnADC, endometrioid ADC; mSCC, metastatic SCC, HSE, hyperplasia of squamous epithelium; SCOC, small cell
esophageal carcinoma.
(C) H&E staining and IHC images of GLUT1 expression in human lung adenosquamous carcinoma tumor samples. Scale bar, 300 mm.
(D) qRT-PCR analysis of GLUT1 mRNA expression in SCC and non-SCC cell lines (n = 3 for each cell line).
(E) Immunoblot analysis of DNp63 and GLUT1 expression in SCC and non-SCC cell lines.
(F) Representative heatmap depicting differential gene expression between the combined TCGA cohorts of NH, lung, cervical, and esophageal SCC (n = 1,372),
bladder urothelial carcinoma (BLCA; n = 408), and all non-SCC (n = 7,752) tumors. Extended gene heatmap with clustering information is provided in Figure S2A.
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

Cell Reports 28, 1860–1878, August 13, 2019 1863

 A B
1.0 1.0

GLUT1 / 18S
GLUT1 p63 DAPI

p63 / 18S
0.5 0.5
**** p63
Lung H&N Esophagus
H&N **** ***
**** GLUT1
0.0 0.0

β-actin

C
p63 GLUT1 DAPI
Cervix Skin

GLUT1 (RFU/cell)
1.5 1.5

p63 (RFU/cell)
shScr
1.0 1.0

0.5
* 0.5 **

shp63
0.0 0.0

D HCC2814 E F
1.5 1.5
HCC2814 KYSE70
GLUT1 / 18S
∆Np63 / 18S

3 5 2.0
1.0 1.0 ***

Glucose Uptake
*** **** *** *** 4 **

GLUT1 / 18S
0.5 0.5 1.5
2 ***

Relative
3 ∆Np63
0.0 0.0 1.0
2
1
∆Np63 1 0.5
GLUT1
KYSE70 0 0 0.0
1.5 1.5 GLUT1
GLUT1 / 18S

β-actin
∆Np63 / 18S

1.0 1.0 β-actin

**** * *
0.5 **** 0.5

0.0 0.0

G I shScr
SLC2A1 (GLUT1) HCC2814 sh∆Np63 #1 KYSE70

Exon2 Exon1 5 **** 5 **

**** *** ** ** **
Relative Luciferase

Relative Luciferase

p63 4 *** ** 4
H3K27ac 3 3
** **
*
2 2
p63 1 1
E3 E2 E1 Intron 1 Promoter
0 0

H J
p63
SLC2A1 (E2) p63 SOX2
HCC2814 H3K27ac KYSE70
Expression Fold Changes

8 IgG 10 WT GGACCCACTGCCCAGGGCAGACGTGATCAGACTTGCATTGTAGGGAAATGACTCAGGCGTCT
** *
*** Mutant GGACC- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - GTCT
8 ***
(Input-ChIP)

6 * *** Deletion
*** ***
*** 6
*** ***
4
** 1.5 1.5
4 **
GLUT3 / 18S
GLUT1 / 18S

***
2
2 1.0 1.0

**
0 0
0.5 0.5

0.0 0.0
WT Mutant WT Mutant
SLC2A1 (GLUT1) SLC2A1 (GLUT1)

(legend on next page)

1864 Cell Reports 28, 1860–1878, August 13, 2019

p63/GLUT1-Mediated Glucose Influx Provides Anti-
oxidative Capacity in SCCs
Cancer cells can exploit enhanced glucose influx to promote
cellular proliferation and survival. The glucose-fueled generation
of NADPH from the oxidative PPP and glutathione (GSH) by de
novo serine biosynthesis provides sustaining anti-oxidative ca-
pacity in cancer cells (Figure 3A) (Locasale and Cantley, 2011).
Metabolic tracing analysis using [U-13C] glucose indicates that
SCC cells exhibit significantly higher glucose consumption and
synthesis of ribose-5-phosphate (R5-P) and serine from glucose
as compared to non-SCC cells (Figures 3B, S5A, and S5B).
These data suggest that p63/GLUT1-mediated increased
glucose influx fuels anabolic pathways to generate NADPH
and GSH in SCC. This enhanced redox potential renders SCC
cells more resistant to high concentrations of vitamin C and bu-
thionine sulfoximine (BSO), which have been shown to act as
pro-oxidants by depleting cellular GSH (Yun et al., 2015) (Figures
3D and S6A). Accordingly, SCC cells produced considerably
less reactive oxygen species (ROS) than non-SCC cells in
response to vitamin C (1 mM) treatment (Figure 3E), suggesting
augmented anti-oxidative capacities in SCCs.
We next sought to investigate whether p63/GLUT1-mediated
glucose influx maintains cellular redox homeostasis in SCC.
p63 knockdown markedly suppressed glucose influx into
R5-P, serine, and lactate in SCC cells (Figures 3C, S5C, S6B,
and S6C). Accordingly, reduced glucose influx into anabolic
pathways by p63 or GLUT1 knockdown resulted in increases
in cellular ROS measured by a universal oxidative indicator,
20 -7’-dichlorodihydrofluorescein (H2DCFDA) (Figure 3F), a small
molecule probe for superoxide radicals, dihydroethidium (DHE)
(Figure 3G), and a lipid peroxidation sensor, C11-BODIPY (Fig-
ure S6D). Importantly, increased ROS upon p63 or GLUT1
knockdown is associated with significant reduction in intracel-
lular NADPH/NADP+ and GSH/GSSG ratios (Figures 3H, 3I,
and S6E), in vitro cell proliferation (Figures 3J and S6F), and
transformation capacity (Figure 3K). Restoring cellular oxidative
capacity by supplementing with an anti-oxidant, N-acetylcys-
teine (NAC), markedly rescued the cellular proliferation and
viability of p63-deficient SCC cells, thereby implicating elevated
ROS upon GLUT1 decrease as the cause of cellular death (Fig-
ures 3L, 3M, S6G, and S6H). It should be noted that p63
shRNA-induced cell death and GLUT1 attenuation were rescued
by ectopic introduction of shRNA-resistant DNp63 but not
TAp63, validating the predominant role the DNp63 isoform plays
in modulating SCC GLUT1 expression and maintaining viability
(Figure S6I). Of note, pyruvate supplementation in SCC cells
failed to rescue GLUT1-knockdown-induced cell death, thereby
arguing for the primacy of glucose influx for maintaining antiox-
idant potential over merely fueling cellular energetic needs
(Figure S6J).
In vivo tumor growth of lung SCC HCC2814 was also signifi-
cantly impaired by doxycycline-inducible DNp63 knockdown
(Figures 3N, S6K, and S6L). DNp63 knockdown tumors exhibited
markedly decreased GLUT1 expression and elevated intratu-
moral oxidative stress as indicated by a significant increase in
phosphorylation of DNA damage marker p-H2AX and lipid per-
oxidation marker 4-hydroxynonenal (4-HNE) staining (Figure 3O).
GLUT1 is expressed only in a small population of cells that retain
p63 expression in Tet-shDNp63 tumors, further supporting the
dependency of GLUT1 expression on DNp63 (Figure S6M).
Importantly, NAC supplementation effectively restored tumor
growth of DNp63-deficient tumors and markedly reduced intra-
tumoral oxidative stress (Figures 3N and 3O). Collectively, these
results suggest that p63 essentially contributes to cellular prolif-
eration and survival of SCC by transcriptionally activating
GLUT1, thus promoting subsequent glucose influx into NADPH
and GSH-generating anabolic pathways to sustain anti-oxidative
capacity in SCC.
GLUT1 Rescues Oxidative Stress and Cell Death
Induced by p63 Deficiency
We next sought to qualify GLUT1-mediated glucose influx as an
essential pro-tumorigenic and/or survival cue driven by onco-
genic p63 function. Ectopic overexpression of GLUT1 in p63-
deficient SCC cells markedly restored cellular proliferation and
viability upon p63 knockdown in lung (HCC2814) and skin
(A431) SCC cell lines (Figures 4A, 4B, S7A, and S7B). GLUT1
reconstitution increased glucose uptake, implicating GLUT1 as
primarily responsible for glucose influx (Figure 4C), and reduced
oxidative stress (Figure 4D) by restoring NADPH and GSH pro-
duction (Figures 4E and 4F) in p63-deficient SCC cells. Notably,
GLUT1 overexpression dramatically restored tumorigenic as

Figure 2. p63 Regulates GLUT1 Expression in SCC

(A) IF staining for GLUT1 (green) and p63 (red) in human SCC tissue samples. Scale bars, 300 mm.
(B) qRT-PCR (left) and immunoblot analyses (right) of p63 and GLUT1 expression in shScr and shp63 lung SCC HCC2814 cells (n = 4).
(C) Representative ICC images (left) and quantification (right) of p63 and GLUT1 expression in shScr or shp63 HCC2814 cells. (n = 3, 5–10 images were captured
per group and normalized to nuclei for quantification). Scale bars, 100 mm.
(D) qRT-PCR (left) and immunoblot analyses (right) of DNp63 and GLUT1 expression in shScr and shDNp63 HCC2814 and KYSE70 (n = 4).
(E) qRT-PCR (left) and immunoblot analyses (right) of DNp63 and GLUT1 expression in HCC2814 cells overexpressing EGFP or DNp63a (n = 3).
(F) Quantification of 2-NBDG uptake in HCC2814 cells overexpressing EGFP or DNp63a (n = 3, 8–12 images were captured in each group for quantification).
(G) Publicly available ChIP-seq alignment of p63 binding and H3K27ac on the SLC2A1 locus. p63 ChIP-seq was performed in HN SCC JHU-029 (GEO:
GSE88859) and ENCODE histone mark ChIP-seq was performed in HeLa-S3 (GEO: GSM733684). Homer analysis (Heinz et al., 2010) identifies enriched p63
binding motifs in peak regions (E1–E3) of the SLC2A1 locus.
(H) ChIP-PCR analysis for endogenous p63 and H3K27ac on the potential p63 binding regions in the intronic enhancer cluster of the SLC2A1 in HCC2814 and
KYSE70. Values represent the average of triplicates ± SEM in a representative experiment. Data represent a minimum of two independent experiments.
(I) Luciferase reporter assay measuring the transcriptional activity of individual enhancers E1, E2, and E3 in shScr or shDNp63 HCC2814 and KYSE70 cells (n = 3).
Luciferase signal is normalized to b-galactosidase activity.
(J) GLUT1 and GLUT3 mRNA expression in CRISPR-Cas9-medated genome editing of the E2 p63-binding enhancer region (n = 3).
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

Cell Reports 28, 1860–1878, August 13, 2019 1865

 A B
Glucose (M+6) Lactate (M+3) G6-P (M+6) R5-P (M+5) Serine (M+3)

Relative Abundance

Relative Abundance

Relative Abundance
Relative Abundance

Relative Abundance
[U-13C] Glucose 100 6 12
** 4
P=0.053
3
***
**
75
9 3 * 2
4

***
6 2

**
50
2 3
* 1
1
25

*
0 0 0
0 0
0 2 4 6 8 0 2 4 6 8
Time (Hours) Time (Hours)

C
G6-P (M+6) R5-P (M+5) Serine (M+3)

Relative Abundance

Relative Abundance

Relative Abundance
1.5 1.5 1.5

1.0 1.0 1.0

shScr

* *
0.5 0.5 * 0.5

Lactate
0.0 0.0 0.0

D E F G
**** HCC95 KYSE70 HCC95 KYSE70
**

H2DCFDA (RFU/cell)
H2DCFDA (RFU/cell)

1.0 8 14 3 3

DHE (RFU/cell)
DHE (RFU/cell)
***
% ROS Increase

500 **** **** ***

**** ** 8
% Viable Cell

400 6 4 **** **
**** **** 2
*** ** 2
HCC2814
HCC15
300 **** 4 **** 3 * ***
0.5 HCC1588
SCC ** **
HCC95 200 2 ** 1 1
****

A431
KYSE70 2 ***
H522
100 1
H1299
FLO.1 Non-SCC 0 0 0 0 0
A375
0.0
0.1 0.2 0.5 1
Vitamin C (mM)
SCC ADC

H I J
Relative NADPH / NADP+
Relative NADPH / NADP+

Relative GSH / GSSG

Relative GSH / GSSG

1.5 HCC2814 1.5 KYSE70 1.5 HCC2814 1.5 KYSE70 HCC2814 KYSE70
shScr shScr

Cell Count (x104)

30
Cell Count (x104)

1.0 1.0 1.0 1.0 20

****
**** **** * **
****
20
**** ****
0.5
**** 0.5 **** 0.5 ** ** 0.5 *** 10
10
**
0.0 0.0 0.0 0.0
0 0
72 120 168 72 120 168
Time (hours) Time (hours)

K L M
HCC2814 KYSE70 HCC2814 KYSE70 HCC2814 KYSE70
No. of Colony / cm2

No. of Colony / cm2

200 400
H2DCFDA (RFU/cell)
H2DCFDA (RFU/cell)

shScr shScr 4 4
20 30
*** *
Cell Count (x104)

Cell Count (x104)

150 300
shScr shScr * ** 3 3 *** **
****

15
100 200
****
****

* 20
2 2
** 10
****

50 100
10
5 1 1
0 0

0 0 0 0
72 120 168 72 120 168
Time (hours) Time (hours)

N O
Tet-shScr 1.8 p63 GLUT1 Ki67 CC3 p-H2A.X 4-HNE
Tumor Weight (g)
Tumor Volume (mm3)

500
shScr

**
1.2 **
ns

400
****

300 Dox 0.6

200
0.0
100
+ NAC

0
4 8 12 16 20 24 28 32
Days

(legend on next page)

1866 Cell Reports 28, 1860–1878, August 13, 2019

well as anti-oxidative capacities of DNp63-deficient tumors (Fig-
ures 4G and 4H). These results suggest that it is the DNp63-
knockdown-dependent decrease in GLUT1 that chiefly affects
cellular viability.
SOX2 Cooperates with p63 to Transactivate GLUT1
in SCC
TCGA CNV analysis indicates that SOX2 is co-amplified with p63
in up to 40% of human SCCs (Figure S8A). Moreover, a recent
study has demonstrated that SOX2 interacts with p63 and jointly
occupies genomic loci to promote squamous cancer progres-
sion (Watanabe et al., 2014). These findings prompted us to hy-
pothesize that p63 and SOX2 may cooperatively act to induce
GLUT1 expression. Indeed, SOX2 knockdown attenuates
GLUT1 mRNA and protein expression (Figures 5A, 5B, S8B,
and S8C) as well as cellular glucose uptake and lactate produc-
tion in SCC cell lines (Figures 5C and S8D). Consistent with a pre-
vious study, co-immunoprecipitation (coIP) indicates that p63
does indeed interact with SOX2 (Watanabe et al., 2014) (Fig-
ure 5D). Notably, our ChIP analysis identified robust SOX2 bind-
ing in one of the SLC2A1 intronic p63 binding enhancer clusters
(E2) (Figures 5E, 2G, and S8E). Furthermore, our analysis on
global SOX2 occupancy from the publicly available ChIP-seq da-
taset revealed a strong SOX2 binding signal within E2 where ca-
nonical SOX2 and p63 binding sites are co-localized (Perez et al.,
2007; Reményi et al., 2003) (Figure 5F). As these results suggest
that p63 and SOX2 may form a transcriptional complex in trans-
activating SLC2A1, we sought to determine whether the
enhancer binding capacity of one factor is dependent on the
other. Intriguingly, SOX2 enhancer binding is markedly attenu-
ated when p63 is knocked down (Figure 5G), whereas p63 sus-
tains its binding capacity regardless of SOX2 levels (Figure S8F)
suggesting p63 may play a dominant role in transactivating
SLC2A1 jointly with SOX2. Although further study is required to
elucidate the biological implications of this functional interplay,
our data argue for crucial cooperation between p63 and SOX2
in promoting GLUT1 expression.
Analogous to p63 inhibition, SOX2 knockdown significantly
attenuated NADPH/NADP+ and GSH/GSSG ratios (Figures 5H,
5I, S8G, and S8H), which is associated with an increase in
ROS (Figures 5J, S8I, and S8J) and marked decreases in
in vitro proliferation (Figures 5K and S8K) and cellular transfor-
mation capacity (Figure 5L). Ectopic GLUT1 reconstitution
upon SOX2 ablation effectively restored cellular proliferation
(Figures 5M and 5N), glucose uptake (Figure 5O), and cellular
anti-oxidative capacity (Figure 5P), thus implicating SOX2-medi-
ated regulation of GLUT1 specifically in maintaining viability.
Collectively, these results suggest that SOX2 regulates GLUT1
expression by transactivating the SLC2A1 enhancer coopera-
tively with p63.
Dietary Glucose Restriction Suppresses Human SCC
Xenograft Tumor Growth
Given the strict reliance of SCC on glucose for sustaining anti-
oxidative capacity and survival, we reasoned that SCC might
be highly susceptible to glucose restriction. Thus, we investi-
gated the therapeutic effects of dietary glucose restriction by
feeding mice bearing xenograft tumors with a ketogenic diet
(0.1% carbohydrate). Xenograft tumor growth of lung SCC
(HCC2814 and HCC95) and esophageal SCC (KYSE70) was
significantly inhibited upon ketogenic diet as compared to
normal chow-fed groups (Figures 6A, S9A, S9B, and S9G). In-
hibited tumor growth is associated with a significant reduction
in cellular proliferation and increase in apoptosis (Figures 6C,
S9D, and S9E). In sharp contrast, ketogenic diet had no effect
on the tumor growth of lung ADC, A549, and esophageal ADC,
FLO-1 (Figures 6B, 6C, S9C, S9F, and S9G). Importantly, keto-
genic diet effectively reduced blood glucose levels, but exerted
no adverse effects including hypoglycemia or weight loss (Fig-
ures 6A, 6B, S9H, and S9I). Corroborating the in vitro results,
glucose restriction by ketogenic diet induced oxidative stress
in lung SCC xenograft tumors as indicated by a significant in-
crease in p-H2AX and 4-HNE staining (Figures 6C). We also
observed increased oxidative stress in SCC tumors treated
with glycolytic inhibitor, 2-deoxyglucose (2-DG), or GLUT1 inhib-
itor, WZB117, as well as shRNA-mediated GLUT1 knockdown,
which is associated with significant tumor growth inhibition as
we previously reported (Goodwin et al., 2017) (Figure S10A–
S10C). Collectively, these results suggest that SCC tumors
crucially rely on glucose to maintain anti-oxidative power.
In addition to the restriction of glucose available for SCC cells,
reduction of blood glucose can lower blood insulin levels, which

Figure 3. p63/GLUT1 Enhances Anti-oxidative Power in SCC

(A) Schematic representation of uniformly labeled glucose-derived carbons in glucose metabolic pathways.
(B and C) Fates of [U-13C] glucose-derived carbons in glycolysis, PPP, and de novo serine biosynthesis in lung SCC HCC95 and HCC2814 and lung ADC A549 (B)
and shScr and shDNp63 HCC2814 (C) cells. Relative 13C abundance of glucose and lactate in the culture media or intracellular glucose-6-phosphage (G6-P),
ribose-5-phosphate (R5-P), and serine after 4 h of incubation with [U-13C] glucose were determined by gas chromatography-mass spectrometry (GC/MS). Values
represent the average of triplicates ± SEM. Data represent a minimum of two independent experiments.
(D) Cell viability of SCC and non-SCC cell lines cultured in increasing vitamin C concentration for 48 h (n = 4). Two-way ANOVA.
(E) Increase in intracellular ROS levels measured by H2DCFDA staining in SCC and non-SCC cell lines treated with 1 mM vitamin C for 48 h (n = 3).
(F and G) Relative intracellular ROS level by H2DCFDA (F) and DHE (G) staining in shScr, shp63, shDNp63, and shGLUT1 HCC95 and KYSE70 cells (n = 4).
(H and I) Relative intracellular NADPH/NADP+ ratio (H) and GSH/GSSG ratio (I) in shScr, shp63, shDNp63, and shGLUT1 HCC2814 and KYSE70 cells (n = 3).
(J) In vitro proliferation of shScr and shDNp63 HCC2814 and KYSE70 cells (n = 4). Two-way ANOVA.
(K) Soft agar colony formation assays of shScr and shDNp63 HCC2814 and KYSE70 cells. Images are representative of three independent experiments. Number
of colonies was analyzed after 21 days (n = 3).
(L and M) In vitro proliferation (L) of shScr, shDNp63, and shDNp63 treated with NAC and intracellular ROS levels (M) measured by H2DCFDA staining in HCC2814
and KYSE70 cells (n = 3). Two-way ANOVA.
(N and O) Tumor growth (left) and tumor weight (right) (N) and IHC analysis (O) of p63, GLUT1, Ki67, CC3, p-H2A.X, 4-HNE in Tet-inducible shScr (n = 5), shDNp63
(n = 4), and shDNp63 treated with NAC (10 g/L) (n = 4) HCC2814 xenograft tumors. Two-way ANOVA. Scale bars, 100 mm. ns, not significant.
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

Cell Reports 28, 1860–1878, August 13, 2019 1867

 A

C D

E F

G H

(legend on next page)

1868 Cell Reports 28, 1860–1878, August 13, 2019

may attenuate PI3K/AKT signaling activity in cancer cells and
thereby confer synergistic anti-cancer effects. Our recent study
and other groups have demonstrated that SCCs exhibit highly
activated PI3K/AKT signaling due to the frequent amplification
of chromosome 3q26 that contains PIK3CA, a catalytic subunit
of the PI3K complex (Goodwin et al., 2017; Yamamoto et al.,
2008). Indeed, ketogenic diet resulted in a significant reduction
of blood insulin levels (Figures 6A, 6B, and S9H), which is asso-
ciated with a significant attenuation of AKT signaling in high
PIK3CA copy number lung SCC HCC2814 and HCC95 xenograft
tumors (Figures 6C and S10D) (Yamamoto et al., 2008). Insulin
effectively promoted in vitro proliferation and AKT signaling ac-
tivity of SCC cells indicating that SCC cells respond to insulin
(Figure 6D). These results suggest that ketogenic-diet-mediated
glucose restriction effectively suppresses in vivo tumor growth of
SCC by not only perturbing glucose-fueled anti-oxidative de-
fense machinery but also by reducing blood insulin which then
suppresses PI3K/AKT signaling in SCC tumors.
Despite significant tumor growth inhibition, there was no tu-
mor regression by ketogenic diet alone. Hence, we sought to
determine if a therapeutic combination of ketogenic diet and
cisplatin, an alkylating agent and standard chemotherapeutic
treatment for SCCs (Dotto and Rustgi, 2016), might achieve
more potent therapeutic outcomes by enhancing the cytotoxic
effect of cisplatin-mediated ROS burst. Combination of keto-
genic diet with cisplatin (5 mg/kg/week) was evidently more
effective than a single treatment of either ketogenic diet or
cisplatin alone without any noticeable adverse effects (Figures
6E, S11A, and S11D). Accordingly, we detected a marked reduc-
tion of proliferation with an increase in apoptosis and intratu-
moral oxidative stress (Figure S11B). Notably, cisplatin
treatment neither affected blood glucose levels nor attenuated
PI3K/AKT pathway signaling, thus arguing for the ketogenic-
diet-dependent insulin and PI3K/AKT attenuation in SCC tumors
(Figures S11B and S11C). Consistent with in vivo results, SCC
cells cultured in low glucose (1 mM glucose), which mimics keto-
genic-diet-mediated glucose restriction, were more susceptible
to cisplatin treatment (Figure S11E).
Glucose Restriction Specifically Suppresses SCC in
LSL-KrasG12DLkb1flox/flox LSL-Luc (KLLuc) Genetically
Engineered Murine Model (GEMM)
We next sought to evaluate the effects of ketogenic diet in the
KLLuc mouse model, which develops a full spectrum of NSCLC
tumor types including SCC, ADC, and mixed adenosquamous
tumors (Ji et al., 2007; Li et al., 2015), envisioning selective sensi-
tivity in SCC tumors. Indeed, KLLuc mice fed with a ketogenic diet
exhibited dramatically less SCC tumor development (Figures 7A
and 7B), whereas total tumor burden or overall survival was not
affected (Figures 7C, 7D, and S12A), indicating that a ketogenic
diet pointedly inhibited the development of KLLuc SCC tumors
but not ADC tumors. Substantiating the xenograft tumor results,
ketogenic diet effectively reduced blood glucose and insulin
levels in KLLuc mice (Figures 7E and 7F), which consequently
increased oxidative stress and suppressed PI3K/AKT signaling
in SCC tumors (Figure 7G), whereas in ADC tumors, oxidative
stress or PI3K/AKT signaling was not affected by a ketogenic
diet (Figure S12B).
Next, we sought to pharmacologically restrict blood glucose
by inhibiting host sodium-glucose co-transporter 2 (SGLT2),
which is primarily expressed in the proximal tubules of the kidney
and responsible for 90% of renal glucose reabsorption (Wright
et al., 2007). Analogous to dietary glucose restriction, treatment
with a FDA-approved anti-diabetic SGLT2 inhibitor, canagliflozin
(CAG), effectively suppressed SCC tumor development in KLLuc
mice (Figures 7A and 7B) and was associated with elevated
oxidative stress and suppressed insulin/PI3K/AKT signaling (Fig-
ures 7E–7G). Yet, total tumor burden or overall survival was not
affected (Figures 7C, 7D, and S12A). Recent studies reported
that SGLT2 inhibition exerted anti-cancer effects on pancreatic
ductal adenocarcinoma, prostate cancer, astrocytoma, and
early stage lung ADC by SGLT2-mediated glucose uptake as
SGLT2 appears to be functionally expressed in these cancers
(Kepe et al., 2018; Scafoglio et al., 2015; Scafoglio et al.,
2018). However, direct SGLT2 inhibition of tumors may not be
the cause of cell death in SCC as SGLT2 is not expressed in
SCC cell lines (Figures S13A), human SCC tumors (Figure S13B),
and KLLuc tumors (Figures S13C–S13E). Consistent with a previ-
ous study, we were able to detect SGLT2 expression in prema-
lignant, early stage ADC, but not in advanced ADC tumors in
KLLuc mice (Figure S13C) (Scafoglio et al., 2018). It should be
noted that CAG was administered when a majority of the tumors
were in advanced stages (5-weeks post-adenoviral-cre inhala-
tion), which ensured the effects of CAG on KLLuc tumors were
due to inhibition of host SGLT2 primarily in the kidney. Accord-
ingly, in vitro SGLT2 inhibition neither affected viability nor
glucose uptake in SCC cells (Figures S13F–S13H). Rather, these
results suggest that the anti-SCC effects of SGLT2 inhibition are
likely due to glucose restriction by systemic modulation and an
associated suppression of insulin/PI3K/AKT signaling in cancer
cells.
To further validate the necessity of glucose in SCC survival
and tumor growth, we genetically ablated Slc2a1 in KLLuc
mice (LSL-KrasG12DLkb1flox/floxGlut1flox/flox, KL GLUT1-knockout
[KO]) (Young et al., 2011). Slc2a1 deletion dramatically
decreased SCC tumors (Figures 7H and 7I), yet total tumor
burden was not affected (Figure 7J), again indicating that
GLUT1 plays pivotal roles in SCC tumorigenesis but remains

Figure 4. GLUT1 Rescues Oxidative Stress and Cell Death Induced by p63 Inhibition
(A and B) In vitro proliferation, qRT-PCR, and immunoblot analysis of DNp63, GLUT1 and V5-tag expression of shScr and shp63 lung SCC HCC2814 (A) and skin
SCC A431 (B) cells ectopically overexpressing EGFP or GLUT1 (n = 3). Two-way ANOVA.
(C–F) Relative glucose uptake (C), intracellular ROS (D), intracellular NADPH (E), and GSH/GSSG ratio (F) in shScr and shp63 HCC2814 (left) and A431 (right)
ectopically overexpressing EGFP or GLUT1 (n = 3).
(G and H) Tumor growth (left) and tumor weight (right) (G) and IHC analysis (H)of p63, GLUT1, Ki67, CC3, p-H2AX, 4-HNE in Tet-inducible shScr (n = 3), shDNp63
(n = 4), and shDNp63 overexpressing GLUT1 (n = 4) HCC2814 xenograft tumors. Two-way ANOVA. Scale bars, 100 mm.
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

Cell Reports 28, 1860–1878, August 13, 2019 1869

 A B C D

E F G

H I J K L

M N O P

(legend on next page)

1870 Cell Reports 28, 1860–1878, August 13, 2019

dispensable for ADC tumors. It should be noted that a small
number of SCC tumors identified in KL GLUT1-KO mice do
express GLUT1 (Figures 7K and S14A) presumably due to
incomplete Cre recombination of the floxed Slc2a1 gene in those
tumors, further corroborating the essentiality of GLUT1 in SCC
tumorigenesis. Collectively, these results support our model
that glucose restriction can be an effective therapeutic strategy
for SCC tumors.
High Blood Glucose Correlates with Poor Prognosis in
SCC Patients
To verify the clinical relevance of SCC glucose reliance, we per-
formed Kaplan-Meier survival analysis with a cohort of lung and
esophageal cancer patients to examine the prognostic value of
random blood glucose (RBG) levels in SCC patients (Ziemer
et al., 2008). We identified a robust correlation between high
random blood glucose (>120 mg/dL) and poor survival rate in
lung and esophageal SCC patients (Figures 7L and 7M), but no
such correlation was found among lung ADC patients (Figure 7N).
The 120-mg/dL cutoff of random blood glucose has proven to
provide over 90% specificity for detection of glucose intolerance
in humans (Ziemer et al., 2008) and recently has shown to be
associated with poor prognosis in breast cancer patients (Mon-
zavi-Karbassi et al., 2016). Notably, none of these patients have
been diagnosed with diabetes, indicating that they have not
been exposed to any anti-diabetic agents. These results are
accordant with a previous epidemiological study demonstrating
a higher glycemic index among lung SCC patients (Melkonian
et al., 2016), thus highlighting the potential prognostic feasibility
of circulating blood glucose concentrations in SCC patients.
DISCUSSION
Targeting altered glucose metabolism in cancer cells has resulted
in varied and unsatisfactory outcomes (Luengo et al., 2017).
Among multiple factors preventing effective therapeutic re-
sponses, a poorly understood tumor-intrinsic metabolic heteroge-
neity across different cancers may preclude effective therapeutic
strategies to target cancer metabolism. Here, we uncover a previ-
ously unrecognized metabolic reliance and vulnerability distinc-
tively embedded across all SCCs, in which the major glucose
transporter GLUT1 is exceptionally overexpressed through the
squamous lineage-specific transcriptional network, p63 and
SOX2. Enhanced GLUT1 expression is linked to an exquisite reli-
ance on glucose for survival and tumor growth in SCC. This
strongly argues that hyperactive GLUT1 activity and dramatically
enhanced glucose influx is not a uniform metabolic hallmark of
all cancers but rather a potent and unique characteristic of SCC,
thereby rendering SCC the most susceptible tumor type to glucose
restriction and may present an actionable therapeutic window.
Although recent studies have shown that SCC exhibits height-
ened cellular anti-oxidative capacity through p63- and NRF2-
mediated transcriptional control of genes involved in the PPP,
de novo serine biosynthesis, and GSH metabolism (DeNicola
et al., 2015; Mitsuishi et al., 2012; Wang et al., 2017), robust
glucose influx is equally crucial to metabolically fuel these path-
ways to generate redox power. Our study establishes a model in
which DNp63 in cooperation with SOX2 metabolically couples
high glucose influx and anti-oxidative pathways by transcrip-
tional upregulation of GLUT1. Accordingly, inhibition of DNp63
or SOX2 expression deprived cellular NADPH and GSH pools
and impaired cellular proliferation and viability of SCC (Figure 3).
Importantly, overexpression of GLUT1 successfully restored
glucose uptake, anti-oxidative capacity, and viability of p63-defi-
cient SCC cells (Figure 4), supporting the essential contribution
of DNp63/SOX2-GLUT1-mediated glucose influx to redox ho-
meostasis within SCC. Recently, hexokinase 2 (HK2) has been
identified as a direct DNp63 target gene in human keratinocytes
and has been shown to regulate mitochondrial ROS generation
(Viticchiè et al., 2015). As HK2 catalyzes the first step of glycol-
ysis producing glucose-6-phosphate, which is diverted into the
PPP, the biological significance of DNp63 in directing glucose
utilization into maintaining redox pools is further emphasized.
Strong co-occupancy of p63 and H3K27ac in the second
intron region of the SLC2A1 gene is corroborated with a recent
study demonstrating that more than half of all genomic p63

Figure 5. SOX2 Regulates GLUT1 Expression

(A and B) qRT-PCR (A) and immunoblot (B) analyses of SOX2 and GLUT1 expression in shScr and shSOX2 HCC2814 and KYSE70 cells (n = 3).
(C) Quantification of 2-NBDG uptake (left) and extracellular lactate (right) in shScr and shSOX2 HCC2814 and KYSE70 cells (n = 3, 8–12 images were captured in
each group for quantification).
(D) CoIP analysis of the interaction between endogenous SOX2 and p63 in HCC2814 and KYSE70 cells. Immunoglobulin G (IgG) was used as a negative control.
(E) ChIP-PCR analysis for endogenous SOX2 on potential p63 binding regions in the intronic enhancer cluster of the SLC2A1 gene in HCC2814 cells. Values
represent the average of triplicates ± SEM in a representative experiment. Data represent a minimum of two independent experiments.
(F) Analysis on publicly available ChIP-seq of SOX2 (red bars) and p63 (blue bars) occupancy in the SLC2A1 intronic enhancer cluster in esophageal SCC lines
KYSE70 and TT (Watanabe et al., 2014) and lung SCC line HCC95 (GEO: GSE46837).
(G) ChIP-PCR analysis for endogenous SOX2 on potential p63 binding regions in the intronic enhancer cluster of the SLC2A1 gene in shScr, shDNp63, and
shSOX2 HCC2814 cells. Values represent the average of triplicates ± SEM in a representative experiment. Data represent a minimum of two independent
experiments.
(H–J) Relative intracellular NADPH/NADP+ ratio (H), GSH/GSSH ratio (I), and intracellular ROS (J) in shScr and shSOX2 HCC2814 and KYSE70 cells (n = 3).
(K) In vitro proliferation of shScr and shSOX2 HCC2814 and KYSE70 cells (n = 3). Two-way ANOVA.
(L) Soft agar colony formation assays of shScr and shSOX2 HCC2814 and KYSE70 cells. Images are representative of three independent experiments. Number of
colonies was analyzed after 21 days (n = 3).
(M) In vitro proliferation of shScr and shSOX2 HCC2814 cells ectopically overexpressing EGFP or GLUT1 (n = 3). Two-way ANOVA.
(N) qRT-PCR (left) and immunoblot (right) analysis of SOX2, GLUT1 and V5-tag expression in shScr and shSOX2 HCC2814 cells ectopically overexpressing EGFP
or GLUT1 (n = 3).
(O and P) Relative 2-NBDG uptake (O), intracellular ROS levels (P) in shScr, and shSOX2 HCC2814 cells ectopically overexpressing EGFP or GLUT1 (n = 3).
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

Cell Reports 28, 1860–1878, August 13, 2019 1871

 A HCC2814
Tumor Volume (mm3)
** 0.9 P=0.058
2500 1.2 160

Tumor Weight (g)

Plasma Insulin
Blood Glucose
2000 NC 0.9 0.6

(ng/mL)
(mg/dL)
KD

****
120

*
1500
0.6
1000
80 NC 0.3
500 0.3 KD
0 0.0 40 0.0
8 16 24 32 40 2 3 4
Days NC KD Weeks NC KD

B
Tumor Volume (mm3)

A549 0.9
500 0.4 160

Tumor Weight (g)

Blood Glucose
**

Plasma Insulin
400 NC 0.3 0.6

(ng/mL)
(mg/dL)
120
300 KD

*
0.2
200
80 NC 0.3
100 0.1
KD
0 0.0 40 0.0
16 24 32 40 2 3 4
Days NC KD Weeks NC KD

C
H&E Ki67 CC3 p-H2A.X 4-HNE p-IR p-AKT p-S6 p-4EBP
NC
HCC2814
KD NC
A549
KD

p-H2A.X % Area

p-4EBP % Area
4-HNE % Area

p-AKT % Area
CC3 % Area

p-S6 % Area
Ki67 % Area

p-IR % Area

15 **** 0.8 * 0.5

* 6
* 8
***
8 P=0.12 15 8 **
0.6 0.4 6 6
** 6
NC 10
0.4
0.3
4
4 4
10
4
KD 5
0.2
0.2
0.1
2
2 2
5
2

0 0.0 0.0 0 0 0 0 0

D HCC2814 E
Cell Count (X104)

50
0 ng/ml HCC2814 KYSE70 NC
40 1 ng/ml (min) 0 15 30 60 120 0 15 30 60 120 KD
1200
Tumor Volume (mm3)

10 ng/ml 0.8
NC + cisplatin
****

*
30 p-IR
*
Tumor Weight (g)

20
IR
KD + cisplatin
0.6 *
10 800
0 p-AKT
0 2 4 6
0.4
*

Days
AKT 400
KYSE70
0.2
Cell Count (X104)

80 0 ng/ml
1 ng/ml
p-S6
60
10 ng/ml S6 0 0.0
16 24 32 40 48 56 64
****

40

20 p-4EBP Days Post Diet Change

0 4EBP
0 2 4 6
Days

Figure 6. Ketogenic Diet Suppresses SCC Growth In Vivo

(A and B) Xenograft tumor growth, tumor weight, and blood glucose and plasma insulin levels of lung SCC HCC2814 (NC, n = 6; KD, n = 8) (A) and lung ADC A549
(NC, n = 4; KD, n = 5) (B) fed with normal chow (NC) as control or ketogenic diet (KD). Two-way ANOVA.
(C) IHC analysis (top) and quantification (bottom) of Ki67, CC3, p-H2AX, 4-HNE, p-IR, p-AKT, p-S6, and p-4EBP in NC (HCC2814, n = 6; A549, n = 4)- and KD
(HCC2814, n = 8; A549, n = 5)-fed xenograft tumors. A total of 5–0 images in each tumor were captured and analyzed for quantification. Scale bars, 100 mm.
(D) In vitro proliferation (left) and immunoblot analysis (right) of p-IR, IR, p-AKT, AKT, p-S6, S6, p-4EBP, and 4-EBP expression of HCC2814 cells treated with
insulin (0–10 ng/mL) (n = 3). Two-way ANOVA.
(E) Tumor growth (left) and tumor weight (right) of HCC2814 xenograft tumors treated with NC alone (NC, n = 5) as control, NC with cisplatin (NC+cisplatin, n = 7),
KD alone (KD, n = 6), and KD with cisplatin (KD+cisplatin, n = 8). Two-way ANOVA.
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

1872 Cell Reports 28, 1860–1878, August 13, 2019

 A B C D

E G

H I J K

L M N

Figure 7. Dietary, Pharmacological, and Genetic Glucose Restriction Suppresses KLLuc SCC Tumor Development
(A and B) Representative thyroid transcription factor-1 (TTF-1; ADC marker) and CK5 (SCC marker) IF images (A) and quantification of SCC, adenosquamous, and
ADC tumor types determined by histopathological as well as IHC evaluation of TTF-1/CK5 (B) in KLLuc mice fed with normal chow (NC, n = 11), ketogenic diet
(KD, n = 7), or canagliflozin (CAG, n = 6). Chi-square test. Scale bar, 2.5 mm.
(C) Total tumor burden of KLLuc mice analyzed by in vivo bioluminescence analysis at 11 weeks post intratracheal injection of adenovirus-Cre (NC, n = 11; KD,
n = 7; CAG, n = 6).
(D) Survival analysis of KLLuc mice fed with NC (n = 11), KD (n = 7), or CAG (n = 6).
(E) Blood glucose levels in KLLuc mice fed with NC (n = 11), KD (n = 7), or CAG (n = 6). Two-way ANOVA.
(F) Plasma insulin concentration in KLLuc mice fed with NC (n = 11), KD (n = 7), or CAG (n = 6).
(legend continued on next page)

Cell Reports 28, 1860–1878, August 13, 2019 1873

binding regions are epigenetically marked by an active enhancer
marker, H3K27ac, and p63/H3K27ac co-occupied sites were
identified as transcriptionally active sites (Kouwenhoven et al.,
2015). Given that functional implications of enhancers within in-
trons remain poorly understood, investigating 3D chromatin
folding and physical association of the potential p63 binding
enhancer cluster with the promoter of the SLC2A1 gene will be
critical to validate the p63 binding enhancer function (Rao
et al., 2014). Intriguingly, our study further identified that SOX2
regulates GLUT1 expression. Although the precise molecular
mechanism by which p63 and SOX2 may interact to transacti-
vate GLUT1 remains to be fully elucidated, our results indicate
that SOX2 transactivates one of the p63 binding enhancers
(E2) in the SLC2A1 gene suggesting the bona fide cooperative
regulatory relationships between p63 and SOX2. Co-occupancy
of p63 and SOX2 in the SLC2A1 intronic enhancer cluster was
confirmed by analysis on a recent genome-wide p63 and
SOX2 ChIP-seq study (Saladi et al., 2017; Watanabe et al.,
2014). Moreover, these studies indicated that genomic SOX2
binding in SCC cell lines significantly differs from that in embry-
onic stem cells suggesting that its oncogenic functions in SCC
are defined by tissue-specific transcriptional binding partners
such as p63, especially considering our finding that SOX2 may
only bind SLC2A1 in the presence of p63 (Figures 5G and S8F)
(Watanabe et al., 2014).
Strict reliance of SCC on glucose influx for redox homeostasis
and survival provides the rationale to evaluate glucose restriction
as a potential therapeutic strategy for SCCs (Allen et al., 2014).
Notably, tumor growth inhibition by ketogenic diet or host
SGLT2 inhibition was only evident in SCC tumors, whereas
glucose restriction neither affected tumor growth nor intratu-
moral ROS levels of non-SCC tumors (Figures 6, 7, and S9).
These findings are in accordance with previous studies revealing
that a ketogenic diet enhanced anti-cancer effects when com-
bined with chemotherapy or radiation, yet ketogenic diet alone
did not show any growth inhibitory effects on H292 and A549
lung cancer xenograft tumors, which are both of non-squamous
origin (Allen et al., 2013). These results highlight the necessity of
better understanding intrinsic heterogeneity in glucose reliance
across cancer types, which can be exploited for more precise
targeted metabolic therapy. Our results, however, cannot
completely exclude the possibility that a ketogenic diet or
SGLT2 inhibitors may affect SCC metabolism and tumor growth
independent of glucose- and/or insulin-mediated effects (Shukla
et al., 2014). For instance, recent studies have shown that CAG
may target mitochondrial complex I and glutamate dehydroge-
nase, thereby activating adenosine monophosphate-activated
protein kinase (AMPK) and altering amino acid metabolism
(Hawley et al., 2016; Secker et al., 2018; Villani et al., 2016).
Moreover, ketone bodies have been determined to promote,
rather than attenuate, tumor progression of BRAF V600E mela-
noma and leukemia cells by enhancing the ability of BRAF
V600E to activate MEK1-ERK signaling (Kang et al., 2015).
Thus, further studies are needed to elucidate the functional impli-
cations of CAG and ketone bodies in intrinsic SCC-associated
metabolic or oncogenic signaling pathways.
In addition to restriction of available glucose for cancer cells,
decreased blood glucose subsequently reduces blood insulin
levels. Because PI3K/AKT is a downstream target of canonical
insulin signaling, reduced blood glucose levels can attenuate in-
sulin-activated PI3K/AKT signaling in SCC. Importantly, SCC is
among cancer types exhibiting highly activated PI3K/AKT
signaling due to amplified PIK3CA by genomic amplification of
chromosome 3q26 that also contains p63 and SOX2 (Yamamoto
et al., 2008). Indeed, our data demonstrate a significant reduc-
tion of AKT signaling in ketogenic-diet-fed or CAG-treated
SCC tumors but not in A549 ADC or KL ADC tumors, which
have considerably less PI3K/AKT activity (Figures 6C, 7G, and
S12B). Intriguingly, recent evidence has shown that ketogenic
diet and SGLT2 inhibition enhanced the efficacy of PI3K inhibi-
tors by blocking glucose-insulin feedback that is caused by
compensatory insulin elevation in response to systemic PI3K in-
hibition (Hopkins et al., 2018). These results support our model
that glucose restriction suppresses intrinsic PI3K/AKT signaling
in SCC by reducing blood insulin levels. Our earlier study and
others have demonstrated that PI3K/AKT signaling enhances
glucose uptake and retention by promoting GLUT1 expression
and translocation to the plasma membrane as well as increasing
HK2 activity (Rathmell et al., 2003). Therefore, inhibition of insu-
lin/PI3K/AKT signaling in ketogenic-diet-fed or CAG-treated
mice may reduce GLUT1 transmembrane localization and HK2
activity in SCC tumors that further restricts glucose uptake and
utilization.
A strong correlation between high random blood glucose and
worse survival of SCC patients highlights the clinical relevance of
SCC-specific strict glucose reliance and further implicates the
potential efficacy of glucose restriction in attenuating SCC tumor
growth. These results imply that hyperglycemia per se may pro-
mote tumorigenic progression and survival of SCC tumors and
impede effective therapeutic action resulting in poor prognosis.
In light of these findings, it will be critical to determine whether
diabetic patients have an increased risk of SCC.
This study presents a viable and potentially rapidly translat-
able treatment paradigm in targeting squamous cancers pre-
cisely not by direct inhibition but modulating metabolism at a
systemic level. Cancer cells depend on growth factor availability

(G) Representative IHC images (top) and quantification of % area (right) of Ki67, CC3, p-H2AX, 4-HNE, p-IR, p-AKT, p-S6, and p-4EBP in KLLuc SCC tumors fed
with NC (n = 11), KD (n = 7), or CAG (n = 6). A total of 5–10 images in each tumor were captured and analyzed for quantification. Scale bars, 100 mm.
(H–J) Representative TTF-1 and CK5 IF images (H), quantification of individual tumor types (I), and total tumor burden determined by histological analysis of H&E-
stained tumor tissues (J) in wild type (LSL-KrasG12D; Lkb1flox/flox; LSL-Luc, WT, n = 7) and GLUT1 knockout (LSL-KrasG12D; Lkb1flox/flox; LSL-Luc; GLUT1flox/flox,
GLUT1-KO, n = 4) KLLuc mice. Chi-square test. Scale bar, 2.5 mm.
(K) Comparison of individual SCC tumor size of WT (n = 7) and GLUT1-KO (n = 4) KLLuc mice.
(L–N) Kaplan-Meier survival analysis comparing high and low random blood glucose (RGB) levels in the esophageal SCC (n = 65) (L), lung SCC (n = 127) (M), and
lung ADC (n = 120) (N) patient cohorts. High and low RGB groups were separated by 120 mg/dL. Significance was determined with the log-rank test.
All error bars represent the mean ± SEM. ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. Two-tailed t test was used unless noted otherwise.

1874 Cell Reports 28, 1860–1878, August 13, 2019

and proliferative signaling pathways such as PI3K/AKT to acti-
vate nutrient uptake and subsequent metabolic processes to
drive growth (Palm and Thompson, 2017). Thus, metabolic pro-
cesses and growth signaling fundamentally converge to drive
proliferation. In light of our study demonstrating the strict
glucose reliance of SCC driven by the squamous lineage-spe-
cific p63 and SOX2 transcriptional complex, we envision that
p63/SOX2-GLUT1 and PI3K/AKT signaling, among other path-
ways, remain central in an oncogenic network driving antioxidant
defense and proliferation that is deeply linked to SCC etiology
and identity. By restricting glucose not only is nutrient acquisition
affected but also a profound synergistic effect suppressing
metabolic, antioxidant, and tumor-intrinsic growth signaling
pathways essential for squamous oncogenicity may be exerted
and chemotherapeutic resistance potentially precluded. Given
that SGLT2 inhibition has been well tolerated without clinical hy-
poglycemia in non-diabetic humans and mice treated with CAG
(Devineni et al., 2015) (Figures 7E and S13I), repurposing FDA-
approved anti-diabetic SGLT2 inhibitors may be tractable and
rapidly translatable as a safe and effective therapeutic strategy
in combination with existing treatments for squamous cancers
and may hold significant promise in improving therapeutic out-
comes for SCC patients.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d LEAD CONTACT AND MATERIALS AVAILABILITY
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Human Tumor Samples and Survival Analyses
B Mice
B Cell Line
d METHOD DETAILS
B In Vivo Tumor Xenograft Experiments
B In Vivo KLLuc Mice Experiments
B Ketogenic Diet and Canagliflozin Treatment
B Blood Glucose and Insulin Measurement
B Immunoblot Analysis
B mRNA Quantification
B In Vitro Metabolic Analysis
B In vitro ROS Measurement
13
B U- C Glucose Tracing and GC-MS Metabolomics
B Immunoprecipitation (IP)
B Chromatin Immunoprecipitation (ChIP)
B CRISPR-Cas9 Genome Editing
B shRNA Knockdown
B Luciferase Assays
B Stable Cell Lines
B Immunocytochemistry
B Immunohistochemistry and Immunofluorescence
Analysis
B Soft Agar Colony Formation Analysis
B TCGA Analyses
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND CODE AVAILABLITY
SUPPLEMENTAL INFORMATION
Supplemental Information can be found online at https://doi.org/10.1016/j.
celrep.2019.07.027.
ACKNOWLEDGMENTS
We thank An Hong Nguyen for technical assistance. We thank David Sidransky
(Johns Hopkins University), Vlad Sandulache (Baylor College of Medicine),
Ralph Weichselbaum (University of Chicago), Jeffrey Meyers (MD Anderson
Cancer Center), John Minna, Richard Wang, David Wang, and Wei Zhang (Uni-
versity of Texas Southwestern Medical Center), and Zui Pan (University of
Texas at Arlington) for providing cell lines. This work was supported by Amer-
ican Lung Association, United States, LCD-400239, DOD, United States,
W81XWH-18-1-0439, CPRIT, United States, RP180670, and NIH, United
States, 5R21CA208746 and P50CA70907 to J.K.; CPRIT RP160089 and NIH
R35CA220449 to R.J.D.; Japan Agency for Medical Research and Develop-
ment Grants-in Aid, P-CREATE, AMED, Japan, to M.I.; NIH K25EB017222
and R01EB025841 and CPRIT RP180670 to K.H.; NIH R01CA210439,
R01CA216853, P50CA127297, and P01CA217798 to P.K.S.; NIH
P50CA70907 to J.D.M.; American Cancer Society, United States, RSG-16-
234-01-TBG to D.B.S.; NIH/NCATS UCLA Clinical & Translational Science
Institute KL2 Translational Science Award, United States, UL1TR001881,
American Cancer Society RSG-17-003-01-CCE, Tobacco-Related Disease
Research Program, United States, 2016TRDRP0IR00000143977, and STOP
Cancer Foundation Seed Grant, United States, to C.S.; National Research
Foundation of Korea, South Korea, NRF-2016R1A1A1A-05005315 to S.Y.L.;
and NSF, United States, CAREER 1351354 and NSF 1361355 to L.B. and C.N.
AUTHOR CONTRIBUTIONS
Conception and design, M.H. and J.K.; Development of methodology,
M.-H.H., Y.J.K, C.N., J.G., S.Y.L., V.S., P.K.S., L.B., K.H., Z.X., and M.I.; Inves-
tigation and data acquisition, M.-H.H., J.G., Y.J.K., J.H.C., M.A.A., M.P., H.G.,
C.N., H.D., S.M., J.K.K., M.C., M.K.K., J.Y.J., S.Y.L., B.F., and Z.X.; Data anal-
ysis and interpretation, M.-H.H., J.G., Y.J.K., J.H.C., C.N., M.C., M.K.K.,
J.Y.J., S.Y.L., V.S., Z.X., K.H., C.S., D.B.S., L.B., J.K., R.J.D., T.H.K., and
J.K.; Technical and material support, B.F., E.D.A., J.D.M., P.K.S., J.K., M.I.,
R.J.D., and T.H.K.; Writing and revision of the manuscript, M.H., J.H.C.,
J.G., and J.K.; Study supervision, J.K.
DECLARATION OF INTERESTS
R.J.D. is an advisor for Agios Pharmaceuticals. J.D.M. receives licensing fees
for lung cancer cell lines from the NCI and University of Texas Southwestern
Medical Center.
Received: February 22, 2019
Revised: June 17, 2019
Accepted: July 11, 2019
Published: August 13, 2019
REFERENCES
Allen, B.G., Bhatia, S.K., Buatti, J.M., Brandt, K.E., Lindholm, K.E., Button,
A.M., Szweda, L.I., Smith, B.J., Spitz, D.R., and Fath, M.A. (2013). Ketogenic
diets enhance oxidative stress and radio-chemo-therapy responses in lung
cancer xenografts. Clin. Cancer Res. 19, 3905–3913.
Allen, B.G., Bhatia, S.K., Anderson, C.M., Eichenberger-Gilmore, J.M., Sibe-
naller, Z.A., Mapuskar, K.A., Schoenfeld, J.D., Buatti, J.M., Spitz, D.R., and
Fath, M.A. (2014). Ketogenic diets as an adjuvant cancer therapy: History
and potential mechanism. Redox Biol. 2, 963–970.
Bao, X., Rubin, A.J., Qu, K., Zhang, J., Giresi, P.G., Chang, H.Y., and Khavari,
P.A. (2015). A novel ATAC-seq approach reveals lineage-specific reinforce-
ment of the open chromatin landscape via cooperation between BAF and
p63. Genome Biol. 16, 284.
Cell Reports 28, 1860–1878, August 13, 2019 1875
Bardeesy, N., Sinha, M., Hezel, A.F., Signoretti, S., Hathaway, N.A., Sharpless,
N.E., Loda, M., Carrasco, D.R., and DePinho, R.A. (2002). Loss of the Lkb1
tumour suppressor provokes intestinal polyposis but resistance to transforma-
tion. Nature 419, 162–167.
Bass, A.J., Watanabe, H., Mermel, C.H., Yu, S., Perner, S., Verhaak, R.G., Kim,
S.Y., Wardwell, L., Tamayo, P., Gat-Viks, I., et al. (2009). SOX2 is an amplified
lineage-survival oncogene in lung and esophageal squamous cell carcinomas.
Nat. Genet. 41, 1238–1242.
Cancer Genome Atlas Research Network (2012). Comprehensive genomic
characterization of squamous cell lung cancers. Nature 489, 519–525.
Cancer Genome Atlas Research Network (2014). Comprehensive molecular
characterization of urothelial bladder carcinoma. Nature 507, 315–322.
Cancer Genome Atlas; Research Network. (2015). Comprehensive genomic
characterization of head and neck squamous cell carcinomas. Nature 517,
576–582.
Cancer Genome Atlas Research Network; Albert Einstein College of Medicine;
Analytical Biological Services; Barretos Cancer Hospital; Baylor College of
Medicine; Beckman Research Institute of City of Hope; Buck Institute for
Research on Aging; Canada’s Michael Smith Genome Sciences Centre; Har-
vard Medical School; Helen F. Graham Cancer Center &Research Institute at
Christiana Care Health Services; HudsonAlpha Institute for Biotechnology;
ILSbio, LLC; Indiana University School of Medicine; Institute of Human
Virology; Institute for Systems Biology; International Genomics Consortium;
Leidos Biomedical; Massachusetts General Hospital; McDonnell Genome
Institute at Washington University; Medical College of Wisconsin; Medical Uni-
versity of South Carolina; Memorial Sloan Kettering Cancer Center; Montefiore
Medical Center; NantOmics; National Cancer Institute; National Hospital,
Abuja, Nigeria; National Human Genome Research Institute; National Institute
of Environmental Health Sciences; National Institute on Deafness &Other
Communication Disorders; Ontario Tumour Bank, London Health Sciences
Centre; Ontario Tumour Bank, Ontario Institute for Cancer Research; Ontario
Tumour Bank, The Ottawa Hospital; Oregon Health &Science University;
Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Cen-
ter; SRA International; St Joseph’s Candler Health System; Eli &Edythe L.
Broad Institute of Massachusetts Institute of Technology &Harvard University;
Research Institute at Nationwide Children’s Hospital; Sidney Kimmel Compre-
hensive Cancer Center at Johns Hopkins University; University of Bergen; Uni-
versity of Texas MD Anderson Cancer Center; University of Abuja
Teaching Hospital; University of Alabama at Birmingham; University of Califor-
nia, Irvine; University of California Santa Cruz; University of Kansas Medical
Center; University of Lausanne; University of New Mexico Health Sciences
Center; University of North Carolina at Chapel Hill; University of Oklahoma
Health Sciences Center; University of Pittsburgh; University of Sa ~o Paulo,
Ribeir a~o Preto Medical School; University of Southern California; University
of Washington; University of Wisconsin School of Medicine &Public Health;
Van Andel Research Institute; Washington University in St Louis (2017a). Inte-
grated genomic and molecular characterization of cervical cancer. Nature 543,
378–384.
Cancer Genome Atlas Research Network; Analysis Working Group: Asan Uni-
versity; BC Cancer Agency; Brigham and Women’s Hospital; Broad Institute;
Brown University; Case Western Reserve University; Dana-Farber Cancer
Institute; Duke University; Greater Poland Cancer Centre; Harvard Medical
School; Institute for Systems Biology; KU Leuven; Mayo Clinic; Memorial
Sloan Kettering Cancer Center; National Cancer Institute; Nationwide
Children’s Hospital; Stanford University; University of Alabama; University of
Michigan; University of North Carolina; University of Pittsburgh; University of
Rochester; University of Southern California; University of Texas MD Anderson
Cancer Center; University of Washington; Van Andel Research Institute; Van-
derbilt University; Washington University; Genome Sequencing Center: Broad
Institute; Washington University in St. Louis; Genome Characterization Cen-
ters: BC Cancer Agency; Broad Institute; Harvard Medical School; Sidney
Kimmel Comprehensive Cancer Center at Johns Hopkins University; Univer-
sity of North Carolina; University of Southern California Epigenome Center;
University of Texas MD Anderson Cancer Center; Van Andel Research Insti-
tute; Genome Data Analysis Centers: Broad Institute; Brown University; Har-
1876 Cell Reports 28, 1860–1878, August 13, 2019
vard Medical School; Institute for Systems Biology; Memorial Sloan Kettering
Cancer Center; University of California Santa Cruz; University of Texas MD
Anderson Cancer Center; Biospecimen Core Resource: International Geno-
mics Consortium; Research Institute at Nationwide Children’s Hospital; Tissue
Source Sites: Analytic Biologic Services; Asan Medical Center; Asterand
Bioscience; Barretos Cancer Hospital; BioreclamationIVT; Botkin Municipal
Clinic; Chonnam National University Medical School; Christiana Care Health
System; Cureline; Duke University; Emory University; Erasmus University; In-
diana University School of Medicine; Institute of Oncology of Moldova; Interna-
tional Genomics Consortium; Invidumed; Israelitisches Krankenhaus
Hamburg; Keimyung University School of Medicine; Memorial Sloan Kettering
Cancer Center; National Cancer Center Goyang; Ontario Tumour Bank; Peter
MacCallum Cancer Centre; Pusan National University Medical School;
Ribeira~o Preto Medical School; St. Joseph’s Hospital &Medical Center; St.
Petersburg Academic University; Tayside Tissue Bank; University of Dundee;
University of Kansas Medical Center; University of Michigan; University of
North Carolina at Chapel Hill; University of Pittsburgh School of Medicine; Uni-
versity of Texas MD Anderson Cancer Center; Disease Working Group: Duke
University; Memorial Sloan Kettering Cancer Center; National Cancer Institute;
University of Texas MD Anderson Cancer Center; Yonsei University College of
Medicine; Data Coordination Center: CSRA Inc.; Project Team: National Insti-
tutes of Health (2017b). Integrated genomic characterization of oesophageal
carcinoma. Nature 541, 169–175.
Crum, C.P., and McKeon, F.D. (2010). p63 in epithelial survival, germ cell sur-
veillance, and neoplasia. Annu. Rev. Pathol. 5, 349–371.
DeNicola, G.M., Chen, P.H., Mullarky, E., Sudderth, J.A., Hu, Z., Wu, D., Tang,
H., Xie, Y., Asara, J.M., Huffman, K.E., et al. (2015). NRF2 regulates serine
biosynthesis in non-small cell lung cancer. Nat. Genet. 47, 1475–1481.
Devineni, D., Polidori, D., Curtin, C.R., Murphy, J., Wang, S.S., Stieltjes, H., and
Wajs, E. (2015). Pharmacokinetics and pharmacodynamics of once- and
twice-daily multiple-doses of canagliflozin, a selective inhibitor of sodium
glucose co-transporter 2, in healthy participants. Int. J. Clin. Pharmacol.
Ther. 53, 438–446.
Dotto, G.P., and Rustgi, A.K. (2016). Squamous Cell Cancers: A Unified
Perspective on Biology and Genetics. Cancer Cell 29, 622–637.
Ferone, G., Song, J.Y., Sutherland, K.D., Bhaskaran, R., Monkhorst, K., Lam-
booij, J.P., Proost, N., Gargiulo, G., and Berns, A. (2016). SOX2 Is the Deter-
mining Oncogenic Switch in Promoting Lung Squamous Cell Carcinoma
from Different Cells of Origin. Cancer Cell 30, 519–532.
Gazdar, A.F., Girard, L., Lockwood, W.W., Lam, W.L., and Minna, J.D. (2010).
Lung cancer cell lines as tools for biomedical discovery and research. J. Natl.
Cancer Inst. 102, 1310–1321.
Gentric, G., Mieulet, V., and Mechta-Grigoriou, F. (2017). Heterogeneity in
Cancer Metabolism: New Concepts in an Old Field. Antioxid. Redox Signal.
26, 462–485.
Goodwin, J., Neugent, M.L., Lee, S.Y., Choe, J.H., Choi, H., Jenkins, D.M.R.,
Ruthenborg, R.J., Robinson, M.W., Jeong, J.Y., Wake, M., et al. (2017). The
distinct metabolic phenotype of lung squamous cell carcinoma defines selec-
tive vulnerability to glycolytic inhibition. Nat. Commun. 8, 15503.
Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A.,
Mu€nsterberg, A., Vivian, N., Goodfellow, P., and Lovell-Badge, R. (1990). A
gene mapping to the sex-determining region of the mouse Y chromosome is
a member of a novel family of embryonically expressed genes. Nature 346,
245–250.
Hawley, S.A., Ford, R.J., Smith, B.K., Gowans, G.J., Mancini, S.J., Pitt, R.D.,
Day, E.A., Salt, I.P., Steinberg, G.R., and Hardie, D.G. (2016). The
Na+/Glucose Cotransporter Inhibitor Canagliflozin Activates AMPK by Inhibit-
ing Mitochondrial Function and Increasing Cellular AMP Levels. Diabetes 65,
2784–2794.
Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y.C., Laslo, P., Cheng, J.X.,
Murre, C., Singh, H., and Glass, C.K. (2010). Simple combinations of lineage-
determining transcription actors prime cis-regulatory elements required for
macrophage and B cell identities. Mol. Cell 38, 576–589.
Hensley, C.T., Faubert, B., Yuan, Q., Lev-Cohain, N., Jin, E., Kim, J., Jiang, L.,
Ko, B., Skelton, R., Loudat, L., et al. (2016). Metabolic Heterogeneity in Human
Lung Tumors. Cell 164, 681–694.
Hibi, K., Trink, B., Patturajan, M., Westra, W.H., Caballero, O.L., Hill, D.E., Ra-
tovitski, E.A., Jen, J., and Sidransky, D. (2000). AIS is an oncogene amplified in
squamous cell carcinoma. Proc. Natl. Acad. Sci. USA 97, 5462–5467.
Hopkins, B.D., Pauli, C., Du, X., Wang, D.G., Li, X., Wu, D., Amadiume, S.C.,
Goncalves, M.D., Hodakoski, C., Lundquist, M.R., et al. (2018). Suppression
of insulin feedback enhances the efficacy of PI3K inhibitors. Nature 560,
499–503.
Jackson, E.L., Willis, N., Mercer, K., Bronson, R.T., Crowley, D., Montoya, R.,
Jacks, T., and Tuveson, D.A. (2001). Analysis of lung tumor initiation and pro-
gression using conditional expression of oncogenic K-ras. Genes Dev. 15,
3243–3248.
Ji, H., Ramsey, M.R., Hayes, D.N., Fan, C., McNamara, K., Kozlowski, P., Tor-
rice, C., Wu, M.C., Shimamura, T., Perera, S.A., et al. (2007). LKB1 modulates
lung cancer differentiation and metastasis. Nature 448, 807–810.
Kang, H.B., Fan, J., Lin, R., Elf, S., Ji, Q., Zhao, L., Jin, L., Seo, J.H., Shan, C.,
Arbiser, J.L., et al. (2015). Metabolic Rewiring by Oncogenic BRAF V600E
Links Ketogenesis Pathway to BRAF-MEK1 Signaling. Mol. Cell 59, 345–358.
Kepe, V., Scafoglio, C., Liu, J., Yong, W.H., Bergsneider, M., Huang, S.C., Bar-
rio, J.R., and Wright, E.M. (2018). Positron emission tomography of sodium
glucose cotransport activity in high grade astrocytomas. J. Neurooncol. 138,
557–569.
Keyes, W.M., Pecoraro, M., Aranda, V., Vernersson-Lindahl, E., Li, W., Vogel,
H., Guo, X., Garcia, E.L., Michurina, T.V., Enikolopov, G., et al. (2011). DNp63a
is an oncogene that targets chromatin remodeler Lsh to drive skin stem cell
proliferation and tumorigenesis. Cell Stem Cell 8, 164–176.
Kouwenhoven, E.N., Oti, M., Niehues, H., van Heeringen, S.J., Schalkwijk, J.,
Stunnenberg, H.G., van Bokhoven, H., and Zhou, H. (2015). Transcription fac-
tor p63 bookmarks and regulates dynamic enhancers during epidermal differ-
entiation. EMBO Rep. 16, 863–878.
Kundaje, A., Meuleman, W., Ernst, J., Bilenky, M., Yen, A., Heravi-Moussavi,
A., Kheradpour, P., Zhang, Z., Wang, J., Ziller, M.J., et al.; Roadmap Epige-
nomics Consortium (2015). Integrative analysis of 111 reference human epige-
nomes. Nature 518, 317–330.
Li, C., and Lu, H. (2018). Adenosquamous carcinoma of the lung. OncoTargets
Ther. 11, 4829–4835.
Li, F., Han, X., Li, F., Wang, R., Wang, H., Gao, Y., Wang, X., Fang, Z., Zhang,
W., Yao, S., et al. (2015). LKB1 Inactivation Elicits a Redox Imbalance to Modu-
late Non-small Cell Lung Cancer Plasticity and Therapeutic Response. Cancer
Cell 27, 698–711.
Locasale, J.W., and Cantley, L.C. (2011). Metabolic flux and the regulation of
mammalian cell growth. Cell Metab. 14, 443–451.
Luengo, A., Gui, D.Y., and Vander Heiden, M.G. (2017). Targeting Metabolism
for Cancer Therapy. Cell Chem. Biol. 24, 1161–1180.
Melkonian, S.C., Daniel, C.R., Ye, Y., Pierzynski, J.A., Roth, J.A., and Wu, X.
(2016). Glycemic Index, Glycemic Load, and Lung Cancer Risk in Non-
Hispanic Whites. Cancer Epidemiol. Biomarkers Prev. 25, 532–539.
Mitsuishi, Y., Taguchi, K., Kawatani, Y., Shibata, T., Nukiwa, T., Aburatani, H.,
Yamamoto, M., and Motohashi, H. (2012). Nrf2 redirects glucose and gluta-
mine into anabolic pathways in metabolic reprogramming. Cancer Cell 22,
66–79.
Monzavi-Karbassi, B., Gentry, R., Kaur, V., Siegel, E.R., Jousheghany, F.,
Medarametla, S., Fuhrman, B.J., Safar, A.M., Hutchins, L.F., and Kieber-Em-
mons, T. (2016). Pre-diagnosis blood glucose and prognosis in women with
breast cancer. Cancer Metab. 4, 7.
Palm, W., and Thompson, C.B. (2017). Nutrient acquisition strategies of
mammalian cells. Nature 546, 234–242.
Patturajan, M., Nomoto, S., Sommer, M., Fomenkov, A., Hibi, K., Zangen, R.,
Poliak, N., Califano, J., Trink, B., Ratovitski, E., and Sidransky, D. (2002). Del-
taNp63 induces beta-catenin nuclear accumulation and signaling. Cancer Cell
1, 369–379.
Perez, C.A., Ott, J., Mays, D.J., and Pietenpol, J.A. (2007). p63 consensus
DNA-binding site: identification, analysis and application into a p63MH algo-
rithm. Oncogene 26, 7363–7370.
Ramsey, M.R., Wilson, C., Ory, B., Rothenberg, S.M., Faquin, W., Mills, A.A.,
and Ellisen, L.W. (2013). FGFR2 signaling underlies p63 oncogenic function
in squamous cell carcinoma. J. Clin. Invest. 123, 3525–3538.
Rao, S.S., Huntley, M.H., Durand, N.C., Stamenova, E.K., Bochkov, I.D., Rob-
inson, J.T., Sanborn, A.L., Machol, I., Omer, A.D., Lander, E.S., and Aiden, E.L.
(2014). A 3D map of the human genome at kilobase resolution reveals princi-
ples of chromatin looping. Cell 159, 1665–1680.
Rathmell, J.C., Fox, C.J., Plas, D.R., Hammerman, P.S., Cinalli, R.M., and
Thompson, C.B. (2003). Akt-directed glucose metabolism can prevent Bax
conformation change and promote growth factor-independent survival. Mol.
Cell. Biol. 23, 7315–7328.
Reményi, A., Lins, K., Nissen, L.J., Reinbold, R., Schöler, H.R., and Wilmanns,
M. (2003). Crystal structure of a POU/HMG/DNA ternary complex suggests dif-
ferential assembly of Oct4 and Sox2 on two enhancers. Genes Dev. 17, 2048–
2059.
Rocco, J.W., and Ellisen, L.W. (2006). p63 and p73: life and death in squamous
cell carcinoma. Cell Cycle 5, 936–940.
Rocco, J.W., Leong, C.O., Kuperwasser, N., DeYoung, M.P., and Ellisen, L.W.
(2006). p63 mediates survival in squamous cell carcinoma by suppression of
p73-dependent apoptosis. Cancer Cell 9, 45–56.
Safran, M., Kim, W.Y., Kung, A.L., Horner, J.W., DePinho, R.A., and Kaelin,
W.G., Jr. (2003). Mouse reporter strain for noninvasive bioluminescent imaging
of cells that have undergone Cre-mediated recombination. Mol. Imaging 2,
297–302.
Saladi, S.V., Ross, K., Karaayvaz, M., Tata, P.R., Mou, H., Rajagopal, J., Ram-
aswamy, S., and Ellisen, L.W. (2017). ACTL6A Is Co-Amplified with p63 in
Squamous Cell Carcinoma to Drive YAP Activation, Regenerative Proliferation,
and Poor Prognosis. Cancer Cell 31, 35–49.
Scafoglio, C., Hirayama, B.A., Kepe, V., Liu, J., Ghezzi, C., Satyamurthy, N.,
Moatamed, N.A., Huang, J., Koepsell, H., Barrio, J.R., and Wright, E.M.
(2015). Functional expression of sodium-glucose transporters in cancer.
Proc. Natl. Acad. Sci. USA 112, E4111–E4119.
Scafoglio, C.R., Villegas, B., Abdelhady, G., Bailey, S.T., Liu, J., Shirali, A.S.,
Wallace, W.D., Magyar, C.E., Grogan, T.R., Elashoff, D., et al. (2018). So-
dium-glucose transporter 2 is a diagnostic and therapeutic target for early-
stage lung adenocarcinoma. Sci. Transl. Med. 10, eaat5933.
Secker, P.F., Beneke, S., Schlichenmaier, N., Delp, J., Gutbier, S., Leist, M.,
and Dietrich, D.R. (2018). Canagliflozin mediated dual inhibition of mitochon-
drial glutamate dehydrogenase and complex I: an off-target adverse effect.
Cell Death Dis. 9, 226.
Shukla, S.K., Gebregiworgis, T., Purohit, V., Chaika, N.V., Gunda, V., Radhak-
rishnan, P., Mehla, K., Pipinos, I.I., Powers, R., Yu, F., and Singh, P.K. (2014).
Metabolic reprogramming induced by ketone bodies diminishes pancreatic
cancer cachexia. Cancer Metab. 2, 18.
Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Smith,
M.J., Foster, J.W., Frischauf, A.M., Lovell-Badge, R., and Goodfellow, P.N.
(1990). A gene from the human sex-determining region encodes a protein
with homology to a conserved DNA-binding motif. Nature 346, 240–244.
Su, X., Chakravarti, D., and Flores, E.R. (2013). p63 steps into the limelight:
crucial roles in the suppression of tumorigenesis and metastasis. Nat. Rev.
Cancer 13, 136–143.
Vander Heiden, M.G., and DeBerardinis, R.J. (2017). Understanding the Inter-
sections between Metabolism and Cancer Biology. Cell 168, 657–669.
Villani, L.A., Smith, B.K., Marcinko, K., Ford, R.J., Broadfield, L.A., Green, A.E.,
Houde, V.P., Muti, P., Tsakiridis, T., and Steinberg, G.R. (2016). The diabetes
medication Canagliflozin reduces cancer cell proliferation by inhibiting mito-
chondrial complex-I supported respiration. Mol. Metab. 5, 1048–1056.
Viticchiè, G., Agostini, M., Lena, A.M., Mancini, M., Zhou, H., Zolla, L., Dins-
dale, D., Saintigny, G., Melino, G., and Candi, E. (2015). p63 supports aerobic
Cell Reports 28, 1860–1878, August 13, 2019 1877
respiration through hexokinase II. Proc. Natl. Acad. Sci. USA 112, 11577–
11582.
Wang, G.X., Tu, H.C., Dong, Y., Skanderup, A.J., Wang, Y., Takeda, S., Gane-
san, Y.T., Han, S., Liu, H., Hsieh, J.J., and Cheng, E.H. (2017). DNp63 Inhibits
Oxidative Stress-Induced Cell Death, Including Ferroptosis, and Cooperates
with the BCL-2 Family to Promote Clonogenic Survival. Cell Rep. 21, 2926–
2939.
Warburg, O. (1956a). On respiratory impairment in cancer cells. Science 124,
269–270.
Warburg, O. (1956b). On the origin of cancer cells. Science 123, 309–314.
Watanabe, H., Ma, Q., Peng, S., Adelmant, G., Swain, D., Song, W., Fox, C.,
Francis, J.M., Pedamallu, C.S., DeLuca, D.S., et al. (2014). SOX2 and p63
colocalize at genetic loci in squamous cell carcinomas. J. Clin. Invest. 124,
1636–1645.
Wright, E.M., Hirayama, B.A., and Loo, D.F. (2007). Active sugar transport in
health and disease. J. Intern. Med. 261, 32–43.
Yamamoto, H., Shigematsu, H., Nomura, M., Lockwood, W.W., Sato, M., Oku-
mura, N., Soh, J., Suzuki, M., Wistuba, I.I., Fong, K.M., et al. (2008). PIK3CA
mutations and copy number gains in human lung cancers. Cancer Res. 68,
6913–6921.
Yan, W., Wistuba, I.I., Emmert-Buck, M.R., and Erickson, H.S. (2011). Squa-
mous Cell Carcinoma - Similarities and Differences among Anatomical Sites.
Am. J. Cancer Res. 1, 275–300.
1878 Cell Reports 28, 1860–1878, August 13, 2019
Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M.D., Dötsch, V., An-
drews, N.C., Caput, D., and McKeon, F. (1998). p63, a p53 homolog at
3q27-29, encodes multiple products with transactivating, death-inducing,
and dominant-negative activities. Mol. Cell 2, 305–316.
Young, C.D., Lewis, A.S., Rudolph, M.C., Ruehle, M.D., Jackman, M.R., Yun,
U.J., Ilkun, O., Pereira, R., Abel, E.D., and Anderson, S.M. (2011). Modulation
of glucose transporter 1 (GLUT1) expression levels alters mouse mammary tu-
mor cell growth in vitro and in vivo. PLoS One 6, e23205.
Yun, J., Mullarky, E., Lu, C., Bosch, K.N., Kavalier, A., Rivera, K., Roper, J.,
Chio, I.I., Giannopoulou, E.G., Rago, C., et al. (2015). Vitamin C selectively kills
KRAS and BRAF mutant colorectal cancer cells by targeting GAPDH. Science
350, 1391–1396.
Zhang, X., Choi, P.S., Francis, J.M., Imielinski, M., Watanabe, H., Cherniack,
A.D., and Meyerson, M. (2016). Identification of focally amplified lineage-spe-
cific super-enhancers in human epithelial cancers. Nat. Genet. 48, 176–182.
Ziemer, D.C., Kolm, P., Foster, J.K., Weintraub, W.S., Vaccarino, V., Rhee,
M.K., Varughese, R.M., Tsui, C.W., Koch, D.D., Twombly, J.G., et al. (2008).
Random plasma glucose in serendipitous screening for glucose intolerance:
screening for impaired glucose tolerance study 2. J. Gen. Intern. Med. 23,
528–535.
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse monoclonal anti-p63 Biocare Medical Cat# CM163A; Clone 4A4;
RRID: AB_10582730
Goat polyclonal anti-p63/TP73L R&D Systems Cat# AF1916; RRID: AB_2207174
Rabbit polyclonal anti-p63 Active Motif Cat# 39739
Rabbit polyclonal anti-Glut-1 Alpha Diagnostic International Cat# GT11-A; RRID: AB_2190596
Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat# 3579; Clone D6D9;
RRID: AB_2195767
Rabbit monoclonal anti-Sox2 ChIP Formulated Cell Signaling Technology Cat# 5024; Clone D6D9;
RRID: AB_1904142
Rabbit monoclonal anti-V5-Tag Cell Signaling Technology Cat# 13202; Clone D3H8Q;
RRID: AB_2687461
Rabbit polyclonal anti-SGLT2 Abcam Cat# ab85626; RRID: AB_10674183
Mouse monoclonal anti-b-actin Sigma-Aldrich Cat# A5441; Clone AC-15;
RRID: AB_476744
Rabbit polyclonal anti-Phospho-INSR(Tyr1361) ThermoFisher Scientific Cat# PA5 38283; RRID: AB_2554884
Mouse monoclonal anti-INSR ThermoFisher Scientific Cat# AHR0271; Clone CT-3;
RRID: AB_2536351
Rabbit monoclonal anti-Phospho-AKT(Ser473) Cell Signaling Technology Cat# 4058; Clone 193H12;
RRID: AB_331168
Rabbit polyclonal anti-AKT Cell Signaling Technology Cat# 9272; RRID: AB_329827
Rabbit monoclonal anti-Phospho-S6(Ser235/236) Cell Signaling Technology Cat# 4858; Clone D57.2.2E;
RRID: AB_916156
Rabbit monoclonal anti-S6 Ribosomal Protein Cell Signaling Technology Cat# 2217; Clone 5G10;
RRID: AB_331355
Rabbit monoclonal anti-Phospho-4E-BP1(Thr37/46) Cell Signaling Technology Cat# 2855; Clone 236B4;
RRID: AB_560835
Rabbit monoclonal anti-4E-BP1 Cell Signaling Technology Cat# 9644; Clone 53H11;
RRID: AB_2097841
Mouse monoclonal anti-TTF-1 Dako Cat# M3575; Clone 8G7G3/7;
RRID: AB_531460
Rabbit monoclonal anti-Ki67 Cell Signaling Technology Cat# 12202; Clone D3B5;
RRID: AB_2620142
Rabbit monoclonal anti-CC3(Asp175) Cell Signaling Technology Cat# 9664; Clone 5A1E;
RRID: AB_2070042
Rabbit polyclonal anti-4-Hydroxynonenal Abcam Cat# ab46545; RRID: AB_722490
Rabbit monoclonal anti-Phospho-H2A.X(Ser139) Cell Signaling Technology Cat# 9718; Clone 20E3;
RRID: AB_2118009
Rabbit monoclonal anti-CK5 Abcam Cat# ab52635; Clone EP1601Y;
RRID: AB_869890
Rabbit monoclonal anti-Acetly-Histone-H3(Lys27) Cell Signaling Technology Cat# 8173; Clone D5E4;
RRID: AB_10949503
Mouse monoclonal anti-PCNA Cell Signaling Technology Cat# 2586; Clone PC10;
RRID: AB_2160343
Bacterial and Virus Strains
Adenoviral Cre (Ad5-CMV-Cre) Baylor Vector Development Laboratory N/A
(Continued on next page)

Cell Reports 28, 1860–1878.e1–e9, August 13, 2019 e1

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Biological Samples
Human lung cancer IHC slides National Biobank of Korea-Kyungpook N/A
National University Hospital
Human esophageal cancer IHC slides National Biobank of Korea-Kyungpook N/A
National University Hospital
Human cervical cancer IHC slides National Biobank of Korea-Kyungpook N/A
National University Hospital
Human head and neck cancer IHC slides National Biobank of Korea-Kyungpook N/A
National University Hospital
Human skin cancer IHC slides National Biobank of Korea-Kyungpook N/A
National University Hospital
Human lung cancer tissue microarrays National Biobank of Korea-Kyungpook N/A
National University Hospital
Human lung cancer tissue microarrays US Biomax Cat# LC806, LC2085a, LC2081
Human esophageal cancer tissue microarrays US Biomax Cat# ES2081
Human cervical cancer tissue microarrays US Biomax Cat# CR2089
Human head and neck cancer tissue microarrays US Biomax Cat# OR802
Human skin cancer tissue microarrays US Biomax Cat# SK2081
Chemicals, Peptides, and Recombinant Proteins
WZB117 Calbiochem Cat# 400036
2-DG Santa Cruz Biotechnology Cat# 154-17-6
N-acetyl-cysteine Sigma-Aldrich Cat# A9165
[U-13C] Glucose Cambridge Isotope Labs Cat# CLM-1396
Insulin Sigma-Aldrich Cat# I1884
Matrigel basement membrane Corning Life Sciences Cat# 354234
Cisplatin Sigma-Aldrich Cat# P4394
Luciferin PerkinElmer Cat# 122799
Canagliflozin SelleckChem Cat# S2760
Critical Commercial Assays
NADP/NADPH-Glo assay kit Promega Cat# G9081
GSH/GSSG-Glo assay kit Promega Cat# V6611
Glucose uptake cell-based kit Cayman Cat# 600470
DHE assay kit Cayman Cat# 601290
C11-BOIDPY assay kit Invitrogen Cat# D3861
H2DCFDA assay kit Cayman Cat# 601520
L-Lactate assay kit Eton Cat# 1200014002
Luciferase assay system Promega Cat# E4030
Insulin ELISA Kit Crystal Chem Cat# 90080
Deposited Data
p63 ChIP-seq dataset Saladi et al., 2017 GEO: GSE88859
SOX2 ChIP-seq dataset Watanabe et al., 2014 GEO: GSE46837
H3K27ac ChIP-seq dataset Kundaje et al., 2015 GEO: GSM733684
Primary tumors expression data TCGA http://www.cbioportal.org
Squamous carcinomas expression data TCGA http://www.cbioportal.org
Non-squamous carcinomas expression data TCGA http://www.cbioportal.org
Experimental Models: Cell Lines
HCC2814 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
HCC95 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
(Continued on next page)

e2 Cell Reports 28, 1860–1878.e1–e9, August 13, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
HCC1588 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
A549 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
H522 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
H1299 Gazdar et al., 2010 (University of Texas N/A
Southwestern Medical Center)
KYSE70 David Wang Lab (University of Texas N/A
Southwestern Medical Center)
KYSE30 David Wang Lab (University of Texas N/A
Southwestern Medical Center)
KYSE510 David Wang Lab (University of Texas N/A
Southwestern Medical Center)
OE33 Wei Zhang Lab (University of Texas N/A
Southwestern Medical Center)
FLO-1 Zui Pan Lab (University of Texas Arlington) N/A
A431 Richard Wang Lab (University of Texas N/A
Southwestern Medical Center)
A375 Richard Wang Lab (University of Texas N/A
Southwestern Medical Center)
SkMel28 Richard Wang Lab (University of Texas N/A
Southwestern Medical Center)
JHU-029 David Sidransky Lab (Johns Hopkins N/A
University)
OSC19 Vlad Sandulache Lab (Baylor College N/A
of Medicine)
NH31 Ralph Weichselbaum Lab (University N/A
of Chicago)
SCC61 David Wang Lab (University of Texas N/A
Southwestern Medical Center)
Experimental Models: Organisms/Strains
Mouse strain: NSG; NOD.Cg-PrkdcscidIL2rgtm1Wjl/ Szj The Jackson Laboratory Cat# 005557
Mouse strain: NOD/SCID; NOD.CB17-Prkdcscid/J The Jackson Laboratory Cat# 001303
Mouse strain: NU/J; FOXN1nu The Jackson Laboratory Cat# 002019
tm4Tyj
Mouse strain: B6.129S4-Kras /J The Jackson Laboratory Cat# 008179
Mouse strain: STOCK Stk11tm1.1Sjm/J The Jackson Laboratory Cat# 014143
Mouse strain: FVB.129S6(B6)- The Jackson Laboratory Cat# 005125
Gt(ROSA)26Sortm1(Luc)Kael/J
Mouse strain: FVB; GLUT1flox/flox E. Dale Abel Lab (University of Iowa) N/A
Oligonucleotides
Primers for RT-PCR: see Table S1 This paper N/A
Primers for CHIP-PCR: see Table S1 This paper N/A
Primers for Cloning: see Table S1 This paper N/A
shRNA targeting sequence: see Table S2 This paper N/A
Recombinant DNA
lenti-CRISPRv2 Addgene Cat# 52961
pMD2-VSVG Addgene Cat# 12259
psPAX2 Addgene Cat# 12260
pLKO.1-shp63#1 Sigma-Aldrich Cat# TRCN0000006560
pLKO.1-shp63#2 Sigma-Aldrich Cat# TRCN0000006502
(Continued on next page)

Cell Reports 28, 1860–1878.e1–e9, August 13, 2019 e3

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
pLKO.1-shGLUT1 Sigma-Aldrich Cat# TRCN0000043583
pLKO.1-shSOX2#1 Sigma-Aldrich Cat# TRCN0000231643
pLKO.1-shSOX2#2 Sigma-Aldrich Cat# TRCN0000355637
pLKO.1-puro Addgene Cat# 10878
Tet-pLKO.1-puro Addgene Cat# 21915
pGL3 vector Promega Cat# E1741
pCMV-b-galactosidase Addgene Cat# 20702
Software and Algorithms
IVIS Lumina III Imager PerkinElmer Cat# CLS136334
Living Image 4.5V PerkinElmer N/A
GC/MS Shulaev Vladimir Lab (University of N/A
North Texas)
CFX-96 Real-time PCR System BioRad Cat# 1855196
Fiji NIH N/A
Nikon Eclipse Ni-U microscope Nikon N/A
NIS Elements imaging Nikon N/A
ChemiDoc BioRad Cat# 12003153
Homer Software Heinz et al., 2010 http://homer.ucsd.edu/homer/ngs/
peakMotifs.html
Other
Normal Chow Research Diet Cat# D16062901
Ketogenic Diet Research Diet Cat# D16062902
Doxycycline Diet Research Diet Cat# D18042704

LEAD CONTACT AND MATERIALS AVAILABILITY

This study did not generate new unique reagents. However, further information, requests for resources and reagents, and
questions relating to experimental protocols should be directed to and will be fulfilled by the Lead Contact, Jung-whan Kim (jay.
kim@utdallas.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Human Tumor Samples and Survival Analyses

Human lung SCC (77 and 74 year-old males), head and neck SCC (60 and 48 year-old males and 47 year-old female), esophageal
SCC (77 and 51 year-old males), cervical SCC (78 and 58 year-old females), skin CC (64 and 59 year-old males) tumor tissue spec-
imens and patient clinical information were provided by the National Biobank of Korea-Kyungpook National University Hospital (NBK-
KNUH). Human lung tumor tissue microarrays established from a cohort of 237 lung cancer patients (161 males and 76 females) with
an average age of 65.1 (range 35 – 87) were provided by the NBK-KNUH. Lung (LC806, LC2085a, LC2081), head and neck (OR802),
esophageal (ES2081), cervical (CR2089), and skin (SK2081) tumor tissue microarrays were purchased from US Biomax (Derwood,
MD, USA), and patient clinical information is available on the website (https://biomax.us). To evaluate if high blood glucose levels in
lung SCC patients correlate with overall survival (OS), we analyzed a cohort of 127 non-diabetic lung SCC patients (118 males and 9
females) with an average age of 63.6 (range 42 – 82) and 120 non-diabetic lung ADC patients (64 males and 56 females) with an
average age of 60.7 (range 35 – 79) who underwent surgical resection. We also analyzed 65 non-diabetic esophageal SCC patients
(56 males and 9 females) with an average age of 65.4 (range 44 – 81) who underwent concurrent chemo-radiation for curative intents.
For the blood glucose level, fasting glucose level was not on the list of the routine laboratory tests at the time of cancer diagnosis of
each patient. Instead, all the patients were initially tested for random blood glucose (RBG) level, which is a commonly used oppor-
tunistic screen for dysglycemia (Ziemer et al., 2008). We adopted RBG R 120 mg/dL to be an indication of disorders in glucose
metabolism because RBG R 120 mg/dL have been shown to have 92% specificity for detection of any glucose intolerance
(Monzavi-Karbassi et al., 2016; Ziemer et al., 2008). OS was measured from the day of surgery or start of chemo-radiation until
the date of cancer-specific death or to the date of the last follow-up. The survival estimates were calculated using the Kaplan-Meier
method and the differences in OS between high and low glucose were compared using the log-rank test. All materials derived from

e4 Cell Reports 28, 1860–1878.e1–e9, August 13, 2019

the NBK-KNUH were obtained from patients under institutional review board-approved protocols. Informed written consent was ob-
tained from all patients, and the study protocol was approved by the institutional review boards of KNUH and University of Texas at
Dallas.

Mice
LSL-KrasG12D mice (Jackson et al., 2001), Lkb1flox/flox mice (Bardeesy et al., 2002) and LSL-Luciferase (LSL-Luc) mice (Safran et al.,
2003) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and backcrossed more than fifteen generations into the
FVB/N inbred mouse strain. Glut1flox/flox mice were described previously (Young et al., 2011). All mice were maintained in the path-
ogen-free Animal Resource Center at the University of Texas at Dallas. Both male and female mice were used. All animal experiments
were conducted using age and gender-matched littermate controls. All care and experimental procedures involving mice were
approved by the University of Texas at Dallas Institutional Animal Care and Use Committee.

Cell Line
Lung SCC lines HCC2814, HCC95, HCC1588 and lung ADC lines A549, H522, H1299 were obtained from the Hamon Cancer Center
Collection (University of Texas Southwestern Medical Center) (Gazdar et al., 2010). Esophageal SCC lines KYSE70, KYSE30,
KYSE510 and esophageal ADC lines OE33, FLO-1 were provided by Drs. David Wang and Wei Zhang (University of Texas South-
western Medical Center). Skin SCC line A431 and melanoma lines A375 and SkMel28 were provided by Dr. Richard Wang (University
of Texas Southwestern Medical Center). HN SCC line, JHU-029 was provided by Dr. David Sidransky (Johns Hopkins University). HN
SCC lines OSC19, NH31, SCC61 were provided by Drs. Vlad Sandulache (Baylor College of Medicine), Ralph Weichselbaum
(University of Chicago), and Jeffrey Myers (MD Anderson Cancer Center). Cells were cultured in 10 mM glucose DMEM (Sigma)
supplemented with 5% fetal bovine serum (Sigma), 1% penicillin/streptomycin (Sigma) and 1% non-essential amino acids (Sigma)
at 37 C in a humidified 5% CO2 environment. All cell lines were mycoplasma tested with e-Myco Kit (Boca Scientific).

METHOD DETAILS

In Vivo Tumor Xenograft Experiments

5 3 106 cells suspended in 50% matrigel (Corning Life Sciences) and 50% Hank’s Balanced Salt Solution (HBSS, Sigma) were sub-
cutaneously implanted into the flank of nu/nu (Foxn1nu) mice or NOD/SCID mice (Jackson Laboratory) between 4 and 6 weeks old.
Cisplatin (Sigma) was administered intraperitoneally (i.p.) at 3.5 mg kg-1 in PBS (Sigma) twice weekly. 2-Deoxyglucose (2-DG, Santa
Cruz Biotechnology) 500 mg kg-1 or WZB117 (Calbiochem) 10 mg kg-1 was administered i.p. once daily. Tumor volume was
measured at indicated times using electronic calipers and estimated by the modified ellipsoid formula: tumor volume = (length x
width2) / 2.

In Vivo KLLuc Mice Experiments

Lung cancer was induced by intratracheal injection of adenovirus-Cre (Baylor Vector Development Laboratory) into 8 weeks-old
LSL-KrasG12D; Lkb1flox/flox; LSL-Luc (KLLuc) at 5 3 106 PFU per mouse. Lung cancer progression was monitored via bioluminescence
imaging. Luciferin (Sigma-Aldrich) was administered at 150 mg/kg through subcutaneous injection in the neck. Bioluminescence
imaging was performed via IVIS Lumina III imager (PerkinElmer). Bioluminoscore was quantified via Living Image 4.5V.

Ketogenic Diet and Canagliflozin Treatment

Mice were fed a control, normal chow (Research Diet, D16062901; 55% carbohydrate, 25% fat, and 20% protein), a ketogenic diet
(Research Diet, D16062902; 0.1% carbohydrate, 89.9% fat, and 10% protein) or Doxycycline containing diet (625 mg/kg, Research
Diet, D18042704) ad libitum. The ketogenic diet was prepared as a paste on a ceramic dish and placed upside down in the food hop-
per. Ketogenic diet was started when xenograft tumors were approximately 100 mm3 or 5 weeks after intratracheal inhalation of
adenovirus-Cre in KLLuc mice and continued until the mice were euthanized for tissue collection. The doxycycline diet was started
when xenograft tumors were approximately 200 mm3. Canagliflozin (SelleckChem) was dissolved in 0.5% hydroxypropyl methylcel-
lulose (Sigma) and administrated 20 mg/kg via oral gavage daily. Canagliflozin was started 5 weeks after intratracheal inhalation of
adenovirus-Cre in KLLuc mice and continued until the mice were euthanized for tissue collection.

Blood Glucose and Insulin Measurement

Blood collected from the tail of mice fasted for six hours prior was utilized to measure blood glucose via glucometer (ONETOUCH
Ultra2). Up to 200 mL of blood was collected from the tail into EDTA coated microfuge tube and centrifuged to isolate plasma for
insulin measurement. Insulin levels were determined via Mouse Insulin ELISA Assay Kit (Crystal Chem) according to the
manufacturer’s instruction.

Immunoblot Analysis
Cells were lysed by RIPA lysis buffer supplemented with cOmplete Protease Inhibitor (Roche) and subsequent 20% amplitude
sonication for 5 s, and lysates were cleared by 14,000 rpm centrifugation at 4 C for 15 min. Equivalent lysates were separated by

Cell Reports 28, 1860–1878.e1–e9, August 13, 2019 e5

SDS-PAGE and electrotransferred onto polyvinylidene difluoride membranes (Fisher Scientific). Membranes following blocking in 5%
non-fat dry milk dissolved in TBST for 30 min were incubated in primary antibody diluted in 5% BSA overnight. Horseradish-perox-
idase conjugated secondary antibodies diluted 1:5000 in 5% non-fat milk were used and visualized with SuperSignal West Pico or
Femto substrate kits (ThermoFisher). The following commercial primary antibodies supplemented with 0.02% sodium azide were
used for immunoblot analysis: p63 (1:1,000; Biocare Medical CM163A), GLUT1 (1:1,000; Alpha Diagnostics GT11-A), SOX2
(1:1,000; Cell Signaling Technology #3579), V5-tag (1:1,000; Cell Signaling Technology #13202), SLGT2 (1:1,000; abcam
ab85626), Tyr1361-p-INSR (1:1,000; ThermoFisher Scientific PA5-38283), INSR (1:1,000; ThermoFisher Scientifc AHR0271),
Ser473-p-AKT (1:1000; Cell Signaling Technology #4058), p-AKT (1:1,000; Cell Signaling Technology #9272), Ser235/236-p-S6
(1:1,000; Cell Signaling Technology #4858), S6 Ribosomal Protein (1:1,000; Cell Signaling Technology #2217), Thr37/46-p-4EBP1
(1:1,000; Cell Signaling Technology #2855), 4E-BP1 (1:1,000; Cell Signaling Technology #9644), PCNA (1:1,000; Cell Signaling Tech-
nology #13110), Cleaved Caspase-3 (1:1,000; Cell Signaling Technology #9664), and b-actin (1:5,000; Sigma A5441). Unprocessed
immunoblot images are provided in Data S1.

mRNA Quantification
RNA was isolated using the Direct-zol RNA MiniPrep kit (Zymo Research) from cells lysed with TRI reagent (Sigma) according to man-
ufacturer’s protocol. For two-step quantitative RT-PCR, cDNA was synthesized from template RNA by mixing with 5X All-In-One RT
MasterMix (abm) then combined with PowerUp SYBR Green Master Mix (Thermo Fisher) as per each manufacturer’s instruction.
Quantitative PCR was performed using the CFX-96 real-time PCR System (BioRad). Primer sequences used are provided in Table S1.

In Vitro Metabolic Analysis

Glucose uptake was measured using the Glucose Uptake Cell-Based Assay Kit (Cayman) according to the manufacturer’s protocol.
Following incubation with fluorescent glucose analog 2-NBDG in glucose-free DMEM (GIBCO) at 37 C for 1 hour and cell preparation
according to the manufacturer’s instruction, emission at 535 nm was measured using a fluorescent confocal microscope (Nikon
Eclipse Ni-U) and fluorescent intensity quantified in Fiji (NIH). Conditioned media was collected from cells following 48h proliferation
in pyruvate-free, 10mM glucose DMEM in order to quantify extracellular lactate normalized to cell count using the L-Lactate Assay Kit
I (Eton). Cellular NADPH and NADP+ levels of cells seeded on white 96-well plates in pyruvate-free 10 mM glucose DMEM and lysed
in 1% dodecyltrimethylammonium bromide were assayed using the NADP/NADPH-Glo Assay Kit (Promega) according to manufac-
turer instruction and raw luminescence normalized to cell count measured by the TC-20 automated cell counter (BioRad). GSH/
GSSG ratios were measured in cells seeded in pyruvate-free 10mM glucose DMEM using the GSH/GSSG-Glo Assay (Promega)
as specified by manufacturer protocol and normalized to cell count.

In vitro ROS Measurement

ROS levels were detected via H2DCFDA (Cayman), DHE (Cayman), and C11-BODIPY (Invitrogen). Following seeding on 24-well
plates in pyruvate-free, 10 mM glucose DMEM, cells were stained with H2DCFDA for 1 hour. H2O2-treated cells were used as positive
control. For ROS measurement by DHE staining, cells were seeded on black 96-well plates in pyruvate-free, 10 mM glucose DMEM,
and stained with DHE for 1 hour, and emission measured at 585 nm according to manufacturer’s protocol. TBHP or antimycin A was
used as positive controls for ROS generation for each assay, and relative fluorescent intensity as a proxy for ROS was normalized to
cell count. For lipid peroxidation analysis, cells were seeded on chamber slide (Thermo Fisher) in pyruvate-free, 10 mM glucose
DMEM, and stained with C11-BODIPY for 30 minutes. H2O2-treated cells were used as positive control. Reduced and oxidized
probes were measured respectively at 590 nm and 535 nm. Up to 6 images were taken for quantification.

U-13C Glucose Tracing and GC-MS Metabolomics

Following 24h culturing in pyruvate-free DMEM containing 10mM [U-13C] glucose (Cambridge Isotope Labs), cells were quenched
with cold 80% methanol. Polar metabolites were then extracted in 80% methanol containing 0.3 mg/mL myristic-d27 acid (Sigma) and
dried via vacuum centrifugation and lyophilization. Dried polar metabolite extracts were derivatized for GC-MS analysis by methox-
yamination using 30mL of methoxyamine HCl dissolved in 20mg/mL pyridine for 60 minutes at 60 C and by silyation with 30mL of
MSTFA (Sigma) for 60 minutes at room temperature. Derivatized extracts were analyzed on an Agilent 7890 GC / 5975 MDS with
a splitless 1mL injection and 10 C/min ramp rate from 70 C – 320 C. Electron impact ionization was utilized for mass spectrum collec-
tion, and peak identification and deconvolution were performed using the Agilent ChemStation software with an in-house mass spec-
trum library. Peaks were integrated and normalized to the myristic-d27 acid standard and further normalized to protein concentration.

Immunoprecipitation (IP)
Following cell lysis with CST lysis buffer (Cell Signaling Technology) supplemented with cOmplete Protease Inhibitor Cocktail
(Roche), lysates were cleared by centrifugation at 12,000xg for 15 minutes at 4 C. Dynabeads Protein G (ThermoFisher) were blocked
with BSA and incubated with 10 mL of 1 mg/mL antibody overnight at 4 C. Equivalent amounts of cleared cell lysate (200 mg) were
then subjected to immunoprecipitation with antibody bound to protein G beads, lysate removed using magnet, and target proteins
eluted by adding protein sample buffer and incubating at 90 C for 5 minutes. Immunoblotting was then performed as indicated
above. The following antibodies were used: p63 (1 mg/mL; Active Motif #39739), SOX2 (1:100; Cell Signaling Technology #5024).

e6 Cell Reports 28, 1860–1878.e1–e9, August 13, 2019

Chromatin Immunoprecipitation (ChIP)
Cells were cross-linked with 1% formaldehyde (16% methanol free formaldehyde solution (w/v), Thermo Fisher Scientific) in culture
medium for 10 min at room temperature with rocking and quenched for 5 min with 1/20 volume of a 2.5 M glycine solution. The cells
were washed twice with PBS and harvested by centrifugation at 2,000 g for 10 min at 4 C. The cell pellets were snap frozen in liquid
nitrogen and stored at 80 C until use. The frozen cell pellets were resuspended in lysis buffer 1 (0.05 M HEPES pH7.5, 140 mM NaCl,
1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton 100, and protease inhibitors) for 10 min at 4 C with rocking. After centrifuga-
tion, the cell pellets were resuspended in lysis buffer 2 (10 mM Tris pH 8, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, and protease
inhibitors) at room temperature for 10 min with rocking. After pelleting nuclei by centrifugation, chromatin was sheared by Covaris
Sonicator (s220) with the following condition; 10%–20% dury cycle, 175-peak intensity power, 200 cycles per burst, 500 s. The chro-
matin solution was the spun for 10 min at 10,000 g to remove cell debris and stored at 80 C until use. To immunoprecipitated chro-
matin, Dynabeads Protein G (Thermo Fisher Scientific) was blocked with BSA and incubated overnight with the primary antibody: p63
(1 mg/mL; Active Motif #39739), SOX2 (1:100; Cell Signaling Technology #5024), Acetyl-Histone H3-Lys27 (D5E4, 1:100; Cell Signaling
Technology #8173). Pre-coupled Dynabeads were resuspended in ChIP buffer (1% Triton X-100, 100mM NaCl, 0.1% sodium deox-
ycholate, 0.5% N-lauroylsarcosine, and 0.5 mM EGTA) and mixed with 250 – 500 mg of soluble chromatin. The mixture was incubated
at 4 C overnight with rotating, followed by washing with RIPA buffer (50 mM HEPES pH 7.5, 500 mM LiCl, 1 mM EDTA, 1% NP-40,
and 0.7% sodium deoxycholate) for a total of eight times. ChIP DNA was eluted from the beads by incubating with 50 mL elution butter
(TE with 1% SDS) at 65 C for 15 min with constant agitation, then centrifuged for 1 min at 10,000 g. Supernatant (up to 50 ml) was
taken out and mixed with 120 mL of elution buffer and incubated at 65 C overnight to reverse the crosslinks. Protein was removed
by incubation with 120 mL of proteinase K solution (2% glycogen, 5% proteinase K solution, 20 mg/ml in TE buffer for 2 hours at
37 C. The sample was then extracted with phenol and chloroform and precipitated with 100% EtOH. The DNA was then treated
with 30 mL of TE buffer containing 10 mg of DNase-free RNase A (Sigma, 6513) followed by PCR cleanup to purify DNA. Quantitative
real-time PCR was undertaken as described previously. The following antibodies were used. Primer sequences are provided in Table
S1.

CRISPR-Cas9 Genome Editing

To generate lentiviral vectors, sgRNAs were created by annealing complementary oligonucleotides with the forward oligonucleotide
designed as 50 -CACCG-(20 nt sgRNA target sequence)-30 and the second oligonucleotide designed as 50 -AAAC-(20 nt reverse com-
plement of the sgRNA target sequence)-C-30 . The sgRNA used to target the p63-binding site in E2 was made by annealing forward
primer 50 -caccgCGTGATCAGACTTGCATTGT-30 and reverse primer 50 -aaacACAATGCAAGTCTGATCACGc-30 . For annealing the
oligo pairs, 2 mL of each of the reconstituted oligo solutions (100nM) was mixed with 2 mL of 10X T4 DNA Ligase Buffer (New England
Biolabs) and 16 mL dH2O. The mixtures were heated at 95 C for 4 minutes, then left at room temperature for 60 minutes. The annealed
oligos were then diluted 1:200. Next, 1 mg of the lentiCRISPRv2 plasmid (Addgene) was digested with 1 mL Esp3I (Thermo Fisher Sci-
entific) at 37 C for 1 hour and run out on an 1% agarose gel. The 12 kb band was extracted using the QIAquick Gel Extraction Kit
(QIAGEN). 1 mL of the oligo mixture was ligated with Esp3I-digested lentiCRISPRv2 using T4 DNA Ligase. 2.5 mL of the resulting liga-
tion mixture was transformed into XL10-Gold Ultracompetent cells (Agilent). Individual colonies were picked, plasmid DNA isolated
and sgRNA regions were sequenced with primer 50 -GGGCCTATTTCCCATGATTCCTTCA-30 . To generate the lentiviral particles,
HEK293T cells were grown to 50%–70% confluence and then transfected with 3.3 mg of the lentiCRISPRv2 plasmid with the p63-
binding site in E2 targeting sgRNA, 3.3 mg of the pMD2-VSVG plasmid, and 3.3 mg of the psPAX2 plasmid using 20 mL of JetPRIME
(Polyplus). 24 h later, the medium was removed and replenished with 5 mL of complete growth medium. In the next 3 days, the growth
medium containing lentiviral vectors was harvested, and 5 mL of fresh complete growth medium was replenished. The final pooled
15 mL growth medium was centrifuged at 3,000 rpm for 15 min at 4 C to remove cell debris. The supernatant was filtered through a
0.45 mm filter, dispensed into 1–2 mL aliquots and stored at 80 C. Viral titers were determined using qPCR Lentivirus Titration Kit
(ABMGood) following manufacturer’s instructions. 2.5 million KYSE70 cells were seeded onto a 10 cm Petri dish. 24 hours later, cells
were transduced using the lentiviral vectors at a multiplicity of infection (MOI) of 1.0. 48 hours post-transduction, cells were treated
with 1.0 mg/mL of puromycin. Polyclonal stable cell line libraries were established after 2 weeks of drug selection. The p63-binding
site in E2 disruption site was sequenced by extracting genomic DNA, amplifying the target region with forward primer 50 -CTGC
TCCTTCTTCAAACCACACATCACC-30 and reverse primer 50 -GACAGAAAGCCTGGCATTCAGTAAAGCG-30 , and sequenced with
the primer 50 - GTTTAGTGTGTCACTAGAGTGAACA-30 .

shRNA Knockdown
The following pLKO.1 shRNA were used: shp63 #1 (Mission TRC shRNA, TRCN0000006560, Sigma), shp63 #2 (Mission TRC shRNA,
TRCN0000006502, Sigma), shGLUT1 (Mission TRC shRNA, TRCN0000043583, Sigma), shSOX2 #1 (Mission TRC shRNA,
TRCN0000231643, Sigma), shSOX2 #2 (Mission TRC shRNA, TRCN0000355637, Sigma). To construct Tet-pLKO.1-shDNp63,
pLKO.1-shDNp63 #1, pLKO.1-shDNp63 #2, and pLKO.1-shTAp63, targeting oligonucleotides (Eurofins Genomics) were annealed
and cloned into the pLKO.1-puro lentiviral backbone (Addgene #10878) or Tet-pLKO-puro (Addgene #21915) as described in the
protocol on the Addgene website. For lentivirus production, HEK293T cells were transfected with viral packaging plasmids psPAX2

Cell Reports 28, 1860–1878.e1–e9, August 13, 2019 e7

(Addgene #12260) and pMD2.G (Addgene #12259), and pLKO.1 shRNA using Lipofectamine 3000 (Invitrogen). Cells were incubated
with viral supernatant containing polybrene (8 mg/mL). pLKO.1-shScr was used as a control vector. Targeting sequences for all
shRNAs are provided in Table S1.

Luciferase Assays
To construct the SLC2A1 enhancer luciferase reporter vectors, genomic fragments containing E1, E2 or E3 were PCR amplified using
the following primers: E1, 50 -GTAGGCTAGCGAGATTCTAGAATTCTGCCACCCT-30 (forward) and 50 -GTAGCTCGA-GGCTGGT
TCCTGGGCCTCC-30 (reverse); E2, 50 -GTAGGCTAGCCTGTGTCACCCCA-CGCCTC-30 (forward) and 50 -GTAGCTCGAGTTTTCCA
GAAACAGAACAGGGT-30 (reverse); E3, 50 GTAGGCTAGCCAGCAGAAACATCACAGTGCC-30 (forward) and 50 -GTAGCTCGAGTTC
TAGTCCTCTCTCCCT-30 (reverse). Amplified inserts were ligated into the pGL3 vector (Promega), and cloned reporter plasmids
were verified by restriction digestion as well as DNA sequencing (Eurofins Genomics). Cells were co-transfected with a mixture con-
taining pGL3-E1, E2, or E3 and pCMV-b-galactosidase (Addgene #20702) using Lipofectamine 3000 (Invitrogen). Luciferase and
b-galactosidase activities were measured using a luciferase assay kit (Promega) and a b-gal assay kit (Promega) following the
manufacturer’s instructions.

Stable Cell Lines

The pLV lentiviral vectors expressing GLUT1, DNp63a, Tap63a were constructed using VectorBuilder. To construct stable cell lines,
cells were incubated with viral supernatant containing polybrene (8 mg/mL), and the transduced cells were selected with 6 mg/ml blas-
ticidin (Invitrogen) or 2 mg/ml puromycin (Thermo Fisher Scientific) for at least 2 weeks. For monoclonal selection, 1,000 cells were
seeded on 150 mm dish with relative puromycin or blasticidin containing media. Up to 10 colonies were picked via cloning cylinder
(Corning) and plated in 12-well plate for further amplification.

Immunocytochemistry
Cells seeded on coverslips and allowed to adhere overnight were fixed in 4% paraformaldehyde and permeabilized with 0.5% Triton
X-100. Primary antibodies diluted in 3% BSA were applied overnight at 4 C, and fluorophore-conjugated secondary antibodies were
then applied to visualize primary antibody staining. Fixed cells were counterstained with 4,6-diamidino-2-phenylindole (DAPI),
mounted with Vectashield Mounting Medium (Vector Labs), and observed under a fluorescent microscope (Nikon Eclipse Ni-U).
The following primary antibodies were used: GLUT1 (1:250; Alpha Diagnostic GT11-A), p63 (1:200; Biocare Medical CM163A).

Immunohistochemistry and Immunofluorescence Analysis

KL and xenograft mice were perfused with 10 mM EDTA in PBS followed by 4% PFA. Both lung and xenograft tumors were extracted
and fixed in 4% PFA for 12 hours and were followed by paraffin embedding. Tissue blocks were then sectioned (5 um) and subjected
to heat-mediated antigen retrieval (citrate buffer, pH 6). Goat serum (Sigma) or donkey serum (Sigma) was used to block for 1 hour,
and primary antibodies diluted were applied at 4 C overnight. Vectastain ABC (Vector Labs) with DAB substrate (Vector Labs) was
used to optimize staining according to the manufacture’s protocol. The following primary antibodies were used: p63 (1:200; Biocare
Medical; CM163A), p63 (1:100; R&D Systems AF-1916), GLUT1 (1:250; Alpha Diagnostic GT11-A), SGLT2 (1:1000; Abcam ab85626),
TTF1 (1:1,000; Dako M3575), Ki67 (1:500; Cell Signaling Technology #12202), Cleaved Caspase-3 (1:200; Cell Signaling Technology
#9664), Ser473-p-AKT (1:500; Cell signaling Technology #4058), Ser235/236-p-S6 (1:200; Cell Signaling Technology #4858) and
Thr37/46-p-4EBP1 (1:200; Cell Signaling Technology #2855), Ser139-p-Histone H2A.X (1:1,000; Cell Signaling Technology
#9718), 4-Hydroxynonenal (1:500; Abcam ab46545), CK5 (1:200; Abcam ab52635). Images were taken via Nikon Eclipse Ni-U micro-
scope with NIS Elements imaging software (Nikon) and quantified using Fiji (NIH).

Soft Agar Colony Formation Analysis

48 hours post viral transduction, 1,000 cells were suspended in DMEM containing 0.3% noble agar (Fisher Scientific) and 5% fetal
bovine serum, and layered on DMEM containing 0.5% noble agar and 10% fetal bovine serum in 6-well plate. 200 mL of DMEM was
supplemented every two days to replenish evaporated media. Colonies were stained with crystal violet and photographed at day 21.
All experiments were performed in triplicate. Images were taken via ChemiDoc (Bio-Rad) and quantified using Fiji (NIH).

TCGA Analyses
Publically available mRNA-sequencing gene expression data were obtained from The Cancer Genome Atlas (TCGA) through the
Broad Institute’s FireBrowse data portal for all TCGA primary tumors (n = 9,532), the TCGA SCC cohort (n = 1,372), the TCGA
BLCA cohort (n = 408), and the TCGA non-SCC cohort (n = 7,752). TCGA gene expression profiles were pre-processed to determine
gene expression in terms of transcripts per million mappable reads using the RSEM software package and were further quartile-
normalized for comparability between datasets. Log2-transformed TPM expression values were compared among SCC, BLCA,
and non-SCC cohorts with t test and multiple testing adjustments. Pearson parametric and Spearman nonparametric correlation
analyses of GLUT1 and SCC marker mRNA expression from TCGA combined SCC cohorts were performed in GraphPad Prism.

e8 Cell Reports 28, 1860–1878.e1–e9, August 13, 2019

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analyses were performed using StatPlus, Version v5 (AnalystSoft Inc.) and GraphPad Prism 7.0 (GraphPad Software Inc.).
All data are expressed as mean ± s.e.m or median ± the interquartile range unless noted otherwise. Two-tailed Student’s t test, one-
way ANOVA with multiple comparison post hoc test, Kruskal-Wallis nonparametric ANOVA, Chi-Square test and Mann-Whitney
U test were used for hypothesis testing, and p values of 0.05 were considered significant. ****p < 0.0001, ***p < 0.001, **p < 0.01,
*p < 0.05.

DATA AND CODE AVAILABLITY

All TCGA data used in the study were obtained through the FireBrowse data portal (http://firebrowse.org). All data supporting the
findings of this study are available within the article and its supplementary information files and from the lead contact upon request.

Cell Reports 28, 1860–1878.e1–e9, August 13, 2019 e9