Journal of Functional Foods 75 (2020) 104244

Contents lists available at ScienceDirect

Journal of Functional Foods

journal homepage: www.elsevier.com/locate/jff

Effect of paraprobiotic prepared from Kimchi-derived Lactobacillus T

plantarum K8 on skin moisturizing activity in human keratinocyte
Hoon Kima,1, Boram Jeonb,1, Woo Jung Kimc, Dae-Kyun Chungb,d,
⁎

a
Skin-biotechnology Center, Kyung Hee University, Gwanggyo-ro 147, Yeongtong-gu, Suwon 16229, Republic of Korea
b
Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Deogyeong-daero 1732, Giheung-gu, Yongin 17104, Republic of
Korea
c
Biocenter, Gyeonggido Business and Science Accelerator, Gwanggyo-ro 147, Yeongtong-gu, Suwon 16229, Republic of Korea
d
Institute of Life Science and Resources, Kyung Hee University, Deogyeong-daero 1732, Giheung-gu, Yongin 17104, Republic of Korea

ARTICLE INFO ABSTRACT

Keywords: Paraprobiotics, which are inactivated microbial cells or cell fractions that can confer beneficial effects upon uses,
Lactobacillus plantarum have garnered attention. In this study, we investigated the paraprobiotic effect of Kimchi-derived Lactobacillus
High pressurization plantarum K8 on skin moisturizing activity in human keratinocyte. Four species of lactic acid bacteria were
Moisturizing prepared into cell lysates under high pressure. L. plantarum K8 lysate induced outstanding hyaluronic acid
Hyaluronic acid
production in HaCaT cells, compared with the lysates of L. lactis, L. sakei, and Streptococcus thermophilus. L.
Hyaluronan synthase
plantarum K8 lysate prepared under high pressure of 27,000 psi with three passage times was optimized for
Aquaporin
inducing hyaluronan production. Results of real-time PCR and western blotting analyses indicated that L.
plantarum K8 lysate could enhance skin-moisturizing activity via upregulating hyaluronic acid synthase-2 and
aquaporin-3 expression in HaCaT cells. Collectively, our results present preliminary data for utilizing L. plan-
tarum K8 paraprobiotic as a functional ingredient in moisturizing products.

1. Introduction are commonly sensitive to temperature, humidity, and air conditions,

According to WHO/FAO definition, probiotics are “live micro-
organisms that can provide health benefits to the host when adminis-
tered in adequate amounts” (Bajagai, Klieve, Dart, & Bryden, 2016).
Among the diverse bacterial flora, Bifidobacterium, Lactobacillus, Strep-
tococcus, Bacillus, and Enterococcus species are commonly considered as
probiotics. In particular, lactic acid bacteria such as Lactobacillus and
Bifidobacterium are a vital part of the gut microbiota of humans and are
also widely commercialized as probiotics (Vlasova, Kandasamy,
Chattha, Rajashekara, & Saif, 2016). These probiotics are generally
considered safe and exert various health effects on humans; beyond
their functions as dietary supplements for health, it began to be re-
cognized as therapeutic drugs based on many clinical studies that
proved their effectiveness for treatment of diseases such as necrotizing
enterocolitis, acute infectious diarrhea, acute respiratory tract infec-
tions, antibiotic-associated diarrhea, and infant colic (Liu, Tran, &
Rhoads, 2018).
However, several factors affect probiotics quality. First, probiotics
such as high oxygen levels, that may severely affect their quality during
storage or delivery (Ayichew, Belete, Alebachew, Tsehaye, Berhanu, &
Minwuyelet, 2017). Second, previous studyies have raised concerns on
the safety of probiotics use in people with weak immune system, such as
pregnant women, infants, and elderly individuals. To address these
concerns, some alternatives such as prebiotics, synbiotics, and para-
probiotics have been recently suggested. Especially, paraprobiotics,
which means inactivated microbial cells or cell fractions that can confer
beneficial effects on the host have gathered attention. As similar ter-
minology with paraprobiotics, postbiotics which are focused on the
soluble factors (products or metabolic byproducts) secreted by live
bacteria or released after bacterial lysis recently emerged (Aguilar-
Toalá et al., 2018). Further, recent studies have reported that there is no
significant correlation between the viability of probiotics and their ef-
fects on human health, leading to paraprobiotics being given growing
attention (de Almada, Almada, Martinez, & Sant'Ana, 2016). Inactiva-
tion of viable cells have been reported using several mechanical
methods, such as thermal treatment, high pressure, ultraviolet

Abbreviations: AQP, aquaporin; HA, hyaluronic acid; HAS, hyaluronic acid synthase; HYAL, hyaluronidase; NC, negative control
⁎
Corresponding author at: Skin-biotechnology Center, Kyung Hee University, Gwanggyo-ro 147, Yeongtong-gu, Suwon 16229, Republic of Korea.
E-mail addresses: saphead1106@hanmail.net (H. Kim), jbr9135@khu.ac.kr (B. Jeon), wj0504@gbsa.or.kr (W.J. Kim), dkchung@khu.ac.kr (D.-K. Chung).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.jff.2020.104244
Received 7 June 2020; Received in revised form 1 October 2020; Accepted 2 October 2020
Available online 19 October 2020
1756-4646/ © 2020 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
H. Kim, et al.
irradiation, electromagnetic radiation, and sonication (de Almada,
Almada, Martinez, & Sant'Ana, 2016) among others. The biological
effects of paraprobiotics in humans have been investigated in im-
munoregulation (Miyazawa, He, Kawase, Kubota, Yoda, & Hiramatsu,
2011; Ou, Lin, Tsai, & Lin, 2011), viral infection (Kawase, He, Kubota,
Yoda, Miyazawa, & Hiramatsu, 2012), inflammation (Lopez, Li, Kataria,
Russell, & Neu, 2008), colitis (Generoso et al., 2011; Ueno et al., 2011),
cardiovascular disease (Hsieh et al., 2016; Tanaka, Hirose, Yamamoto,
Yoshikai, & Murosaki, 2020), and improvement of mental health
(Warda et al., 2019; Wei et al., 2019). Especially, several recent studies
have demonstrated that probiotic lysates have predominant effects on
the skin, such as ameliorating atopic dermatitis (Choi et al., 2016; Kim,
Kim, Kim, et al., 2015; Lee, Yoon, Kim, Jeong, Park, & Kang, 2016),
preventing wrinkle formation (Im, Lee, Kang, & Chae, 2018), and im-
proved skin-moisturizing effect (Ogawa et al., 2016). Skin health is an
important factor for psychological well-being and overall improved
quality of life. Further, it is pivotal to maintaining normal skin functions
and preventing various skin diseases induced by xerosis cutis, such as
atopic dermatitis, allergic dermatitis, and psoriasis (Szyszkowska,
Lepecka-Klusek, Kozlowicz, Jazienicka, & Krasowska, 2014).
Despite the fact that non-viable probiotics have several advantages,
few optimization methods regarding biological activity have been re-
ported in the literature, and a few in vitro studies on the molecular
mechanisms have been performed. Moreover, the effect of the para-
probiotic on the skin moisturizing has still not been elucidated in in
vitro skin models. In general, some established skin cells, such as ker-
atinocyte, fibroblast, and melanocyte have been used as the in vitro
model to investigate the effect of food as well as cosmetic ingredients
for skin health (McDaniel, Steel, & Mazur, 2013). Especially, human
keratinocytes are still widely used for evaluating skin moisturizing ef-
fects such as hyaluronic acid production. In the present study, we in-
vestigated the optimal method for preparing paraprobiotics to enhance
skin-moisturizing activity by in vitro model using HaCaT keratinocyte,
and elucidated the molecular mechanisms underlying the moisturizing
effects.
2. Materials and methods
2.1. Preparation of L. plantarum K8 cell lysates
The stock of L. plantarum K8 strain (KCTC 10887BP; Korean
Collection for Type Cultures, DaeJeon, Republic of Korea) was activated
at 37 °C for 15 h. The activated cells were inoculated in sterilized main
culture medium (modified MRS medium) and incubated at 37 °C for
10 h. The culture medium was subjected to centrifugation and the pellet
was washed with sterilized distilled water several times. After ster-
ilization by heating, the cells were disrupted using microfluidizer
(ES15-300, Micronox, Gyeonggi, Republic of Korea) depending on dif-
ferent pressures and disruption numbers. The whole cell lysates were
dried using spray drier and stored at 4 °C until use.
2.2. Keratinocyte culture and cell viability
Human keratinocyte cell line (HaCaT; Korean Cell Line Bank, Seoul,
Republic of Korea) was maintained in DMEM with 10% fetal bovine
serum (FBS; Life Technologies, Grand Island, NY, USA) and 1% peni-
cillin-streptomycin (P/S, GenDEPOT, Katy, TX, USA) at 37 °C under the
air condition of 5% CO2/95% humidity. Cells were dissociated with
trypsin-EDTA (Welgene, Daegu, Republic of Korea) and subcultured
every 2–3 days. The cells were plated in 96-well plates at a density of
1 × 105 cells/mL and incubated for 15 h. Subsequently, cells were
treated with samples for 24 h. Next, the cells were washed with phos-
phate buffered saline to remove debris, and their viabilities were ex-
amined using MTT assay. Finally, 100 μL of DMSO was added to so-
lubilize the formazan salts, and the optical density was measured at
550 nm using a microplate reader (Epoch; BioTek Instruments, Inc.,
2
Journal of Functional Foods 75 (2020) 104244
Winooski, VT, USA).
2.3. Quantification of hyaluronic acid production level in HaCaT
The cells were plated in a 96-well plate at a density of 2 × 104 cells
per well. After overnight culture, the medium was replaced by serum-
free DMEM. To eliminate the effect of FBS, cells were serum starved for
24 h and treated with samples with indicated concentrations. The cul-
ture supernatants harvested after 24 h and the level of hyaluronic acid
(HA) in the supernatants were determined by human hyaluronan ELISA
kit (R&D Systems, Minneapolis, MN, USA). The ELISA procedure was
performed in triplicate according to the manufacturer’s instructions.
The level of HA was quantified using a standard curve.
2.4. Real-time PCR
For quantitative real-time PCR, cells were collected by easy-BLUE™
(iNtRON Biotechnology, Seoul, Republic of Korea) and total RNA was
isolated from human keratinocytes using the phenol extraction method.
cDNA was synthesized using a iScript cDNA synthesis kit (BioRad,
Hercules, CA, USA). qPCR was performed using the TB Green® Premix
Ex Taq™ (Takara, Shiga, Japan) on AriaMx Real-time PCR System
(Agilent, Santa Clara, CA, USA). Hyaluronic acid synthases-2 (HAS2)
and aquaporine-3 (AQP3) mRNA expression level were calculated using
Agilent AriaMx Software and normalized to GAPDH mRNA expression.
The sequences of the primer used for qPCR are listed in Table 1.
2.5. Western blotting
The HaCaT cells were lysed with 2 × reducing buffer, and the
collected proteins were denatured for at 100 °C for 5 min. Samples were
separated by 10% SDS-polyacrylamide gel electrophoresis and blotted
onto an activated polyvinylidene fluoride membrane (Merck,
Darmstadt, Germany). Blots were blocked in 2.5% bovine serum al-
bumin solution for 2 h and incubated with primary antibodies against
HAS2 (Thermo Fisher Scientific, Waltham, MA, USA) and AQP3
(Abcam, Cambridge, UK) overnight at 4 °C in blocking buffer. After
incubation, membranes were washed twice with 1 × TBST and treated
with goat anti-mouse IgG (H + L) secondary antibody, HRP
(Invitrogen, Carlsbad, CA, USA) for 2 h. ECL substrate (BioRad) was
used for detection signals were visualized with LAS4000 mini (Fujifilm,
Tokyo, Japan). Each band size was quantified by Image J and nor-
malized to β-actin (Santa Cruz Biotechnology, Dallas, TX, USA) band.
2.6. Statistical analysis
Results are expressed as mean ± standard deviation (SD) of three
independent experiments. Statistical differences were evaluated using
one-way ANOVA, and post-hoc analysis was conducted using Tukey’s
test at a value of p < 0.05. Statistical analyses were performed using
the PASW Statistics 18 (IBM Co., Armonk, NY, USA).
Table 1
The sequences of the primers of HAS2, AQP3, and GAPDH.
Gene Primer Sequence (5′ → 3′)
HAS2 Forward ATTACCCAGTCCTGGCTTCG
Reverse CCTGTGGAAGACTCAGCAGAA
AQP3 Forward ACGGTGGTTTCCTCACCATC
Reverse GGCTGTGCCTATGAACTGGT
GAPDH Forward GTCTTCACCACCATGGAGAA
Reverse AGGAGGCATTGCTGATGAT
H. Kim, et al.
3. Results
3.1. Comparative effects of lysates prepared from various lactic acid
bacteria on HA production
To compare the moisturizing effect of various bacterial cell lysates,
four lactic acid bacterial strains L. plantarum K8, L. lactis, Streptococcus.
thermophilus, and L. sakei were used for lysate preparation by disruption
using microfluidization under the condition (27,000 pis, five passage
times). HaCaT cells were subjected to incubation with the four bacterial
lysate, and cytotoxicity and HA-promoting activity were compared at
100 and 1000 μg/mL doses. Cellular cytotoxicity was not observed in
any of the samples tested as well as N-acetylglucosamine (5000 μg/mL;
NAG) used as positive control (Fig. 1A). As shown in Fig. 1B, level of HA
significantly higher by 93.7% in the positive control treated with NAG
compared with negative control. HA secretion significantly increased in
response to the L. plantarum K8 lysate (+20.9% and +45.2%) at 10 and
100 μg/mL, respectively; however, other bacterial lysates showed no
significant differences in HA secretion compared to the control group at
all doses tested.
3.2. Preparation of L. plantarum K8 cell lysate with HA-production activity
Cell lysates from L. plantarum K8 live cells were prepared by using
microfluidizer depending on the disruption numbers up to five passage
times. HaCaT cells were treated with different lysate preparations at
100 and 1000 μg/mL doses. The viability of HaCaT cells treated with
the prepared lysates were comparable, without any visible cytotoxic
effect (103.5–111.0% and 124.0–130.9% at 100 and 1000 μg/mL, re-
spectively, Fig. 2A). As shown in Fig. 2B, HA production significantly
increased by 109.9% in NAG-treated positive control. HA secretion
increased significantly in response to the lysates prepared by disruption
with three (+21.4% and +43.7% at 100 and 1000 μg/mL, respec-
tively) and four passage times (+23.6% at 1000 μg/mL). Next, 12 types
of cell lysates were prepared depending on a combination of disruption
3
Journal of Functional Foods 75 (2020) 104244
Fig. 1. Effects of lysates prepared from
various lactic acid bacteria on (a) cell
viability and (b) hyaluronic acid pro-
duction. Each lysate was prepared under
the same condition of high pressurization
(27,000 psi, three passage times). All results
are expressed as mean ± SD of three in-
dependent tests. Different superscripts
means significant differences among groups
as analyzed by Tukey’s t-test (p < 0.05).
Small letter, 100 μg/mL; Capital letter,
1000 μg/mL. Only medium and N-acet-
ylglucosamine (5000 μg/mL) were used as
NC and positive control (PC), respectively.
K8, L. plantarum K8; lactis, L. lactis, thermo,
Streptococcus thermophilus; sakei, L. sakei.
number and pressure. We observed that HaCaT cells were unaffected in
response to treatment with all samples (100 μg/mL) and positive con-
trol, compared with that of negative control (NC) (Fig. 3A). Although
other pressurization conditions did not show statistically significant
differences, L. platarum K8 lysates prepared by disruption at 27,000 psi
induced HA production levels in HaCaT cells were significantly dif-
ferent from those of NC (Fig. 3B). Especially, the lysate disrupted at
27,000 psi with three passage times showed the best effect (+143.4%)
among all samples. Therefore, the 27,000-psi-with-3-passage-times lysis
was selected as the optimal condition for preparing L. plantarum K8
lysate with a potent HA-promoting activity.
3.3. Effect of L. plantarum K8 lysate on the gene expression of HAS2 and
AQP3
The effects of L. plantarum K8 lysate prepared under the optimal
condition on the mRNA expression levels of HAS2 and AQP3 (enzymes
responsible for HA synthesis) were investigated by qPCR. As shown in
Fig. 4A, when HaCaT cells were treated with L. plantarum K8 lysate at a
dose of 1000 μg/mL, HAS2 mRNA expression level statistically in-
creased and peaked at 3 h (2.3-fold compared with that of NC), and
then sharply decreased to basal level at > 6 h. Similarly, expression
levels of AQP3 mRNA were significant higher at 3, 6, and 12 h (6.43-,
5.33- and 1.51-fold, respectively), and returned to basal level at > 18 h,
after the lysate treatment (Fig. 4B). Next, HaCaT cells treated with L.
plantarum K8 lysate at various doses were incubated for 3 h to in-
vestigate dose-dependent effect on the levels of gene expression. The
HAS2 mRNA expression was significantly increased by the treatment of
the lysate at 500 and 1000 μg/mL doses (1.8- and 8.9-fold) compared
with that of NC (Fig. 4C). The lysate also up-regulated AQP3 mRNA
expression level in a dose-dependent manner, and the significant dif-
ferences were observed at dose ranging from 250 to 1000 μg/mL (1.4-
to 7.4-fold) (Fig. 4D).
Fig. 2. Effect of L. plantarum K8 lysates
prepared by different treated number
under high pressurization. (a) Cell viabi-
lity. (b) Hyaluronic acid production. L.
plantarum K8 lysate was prepared depending
on the disruption number (1–5 times) under
the same pressure (27,000 psi). All results
are expressed as mean ± SD of three in-
dependent tests. Different superscripts
means significant differences among groups
as analyzed by Tukey’s t-test (p < 0.05).
Small letter, 100 μg/mL; Capital letter,
1000 μg/mL. Only medium and N-acet-
ylglucosamine (5000 μg/mL) were used as
NC and positive control (PC), respectively.
H. Kim, et al.
3.4. Effect of L. plantarum K8 lysate on the protein expression levels of
HAS2 and AQP3
Protein expression of HAS2 and AQP3 in HaCaT cells was analyzed
using western blotting and blotting images are illustrated in Fig. 5A-B.
When HaCaT cells were treated with the L. plantarum K8 lysate at a dose
of 1000 μg/mL, HAS2 expression level increased within 24 h in a time-
dependent menner, and statistically significant differences were ob-
served at time points ranging from 18 to 24 h (4.5- to 12.3-fold)
compared with that of NC (Fig. 5C). AQP3 protein expression level also
increased in a time-dependent manner in response to the lysate treat-
ment and statistical differences were observed at 18 h to 24 h (1.4 to
1.7-fold) compared with that of NC (Fig. 5D). Based on these results,
HaCaT cells treated with L. plantarum K8 lysate at various doses were
incubated for 24 h to investigate dose-dependent effect on the expres-
sion levels of HAS2 and AQP3. The HAS2 expression level was sig-
nificantly increased by the treatment of the lysate (2.9- to 4.5-fold at
doses ranging from 100 to 1000 μg/mL) compared to that of NC. Si-
milarly, the lysate significantly increased AQP3 expression level at
250–500 μg/mL doses (1.6- to 1.9-fold) compared to that of NC, but
slightly decreased it at a dose of 1000 μg/mL (1.7-fold).
4
Journal of Functional Foods 75 (2020) 104244
Fig. 3. Effect of L. plantarum K8 lysates
depending on strength and treated
number under different pressures. (a)
Cell viability. (b) Hyaluronic acid produc-
tion. L. plantarum K8 lysate was prepared
depending on the disruption number (2–5
times) with pressure (20,000–27,000 psi).
All results were expressed as mean ± SD of
three independent tests. Different super-
scripts means significant differences among
groups as analyzed by Tukey’s t-test
(p < 0.05). Only medium and N-acet-
ylglucosamine (5000 μg/mL) were used as
NC and positive control (PC), respectively.
4. Discussion
According to recent evidences, lysates of probiotics are capable of
conferring health-beneficial effects in humans (de Almada, Almada,
Martinez, & Sant'Ana, 2016); however, there are concerns that specific
probiotics administered orally may be detrimental to the host (Islam,
2016). Thus, studies to overcome this limitation are warranted. In the
present study, we investigated the optimal method for preparing
paraprobiotics, aimed to enhance their skin-moisturizing effects, and
demonstrated the molecular mechanism underlying the effects. In fact,
it is true that there is several limitation to introduce the in vitro model
for elucidating action mechanism underlying the skin health induced by
oral administration. Nevertheless, it is well known that the in vitro
model for evaluating the effects and intracellular mechanisms of edible
ingredients including paraprobiotics on the skin health is actually not
very different from that of topical application such as cosmetics
(McDaniel et al., 2013). Therefore, the present study was aimed to
obtain the in vitro basic data for utilizing the paraprobiotic as both inner
(oral) and outer (topical) beauty products, and was according to “the
guideline for evaluation of functional food ingredients for skin health”
presented by Korean Ministry of Food and Drug Safety (MFDS). We
found that L. plantarum K8 lysate-mediated increase in skin-
Fig. 4. Effect of L. plantarum K8 lysate on
the mRNA expressions of HAS2 and AQP3
depending on treated time and dose.
HaCaT cells were treated with L. plantarum
K8 lysate prepared by optimal method at a
time ranging from 3 to 24 h (A and B) and at
doses ranging from 100 to 1000 μg/mL (C
and D). The expression level of each mRNA
was quantified by qPCR. All results were
expressed as mean ± SD of three in-
dependent tests. Different superscripts
means significant differences among groups
as analyzed by Tukey’s t-test (p < 0.05).
Only medium was used as NC.
H. Kim, et al.
Fig. 5. Effect of L. plantarum K8 lysate on the protein expressions of HAS2 and AQP3 depending on treated time and dose. HaCaT cells were treated with L.
plantarum K8 lysate prepared by optimal method at a time ranging from 3 to 24 h (A, C, and D) and at doses ranging from 100 to 1000 μg/mL (B, E, and F). The
expression level of each protein was determined by western blotting, and images were quantified by Image J program. All results were expressed as mean ± SD of
three independent tests. Different superscripts means significant differences among groups as analyzed by Tukey’s t-test (p < 0.05). Only medium was used as NC.
moisturizing activity was associated with upregulation of moisturizing-
related proteins, hyaluronic acid synthase-2 and aquaporin-3, in HaCaT
cells. Additionally, we showed the effect of pressurizing condition used
for preparing paraprobiotics on their skin-moisturizing activity. The
term “paraprobiotics” was recently coined to describe “inactivated
microbial cells or cell fractions prepared by several physicochemical
inactivation methods to provide a health-beneficial effect to humans”
(Adams, 2010). Heat inactivation is the conventional method to prepare
paraprobiotics and the conditions of this method have been previously
established (de Almada, Almada, Martinez, & Sant'Ana, 2016). How-
ever in the present study, we attempted to establish optimal conditions
by high pressurization using commercial microfluidizer. Compared
with other inactivation methods (mainly thermal treatment), the high-
pressure treatment exerts diverse effects on wall integrity of the pro-
biotics depending on pressure strengths to produce the various sizes of
bacterial fragments (Vlasova, Kandasamy, Chattha, Rajashekara, & Saif,
2016). We hypothesized that different sizes and compositions of bac-
terial fragments produced by high pressurization may have positive
effects on skin moisturizing. Therefore, various conditions were tested
depending on bacterial strains, disruption number, and pressure to
optimize the condition to prepare bacterial lysates with potent moist-
urizing activity. To do this, L. plantarum K8 isolated from Korean tra-
ditional kimchi was used in this study. The skin-health promoting ef-
fects of L. plantarum K8 lysate have already been demonstrated in atopic
dermatitis (Kim, Kim, Kim, et al., 2015) and improving skin moistur-
ization (Kim, Kim, Jeong, et al., 2015). Several investigators have at-
tempted to develop novel functional materials that when consumed
orally would facilitate HA synthesis for maintaining skin health and
treating diverse skin-related diseases (Papakonstantinou, Roth, &
Karakiulakis, 2012). Our results showed that the HA secretion-inducing
activity of L. plantarum K8 lysate was higher than those of the lysates
prepared from other probiotics, such as L. lactis, S thermophilus, and L.
sakei. To the best of our knowledge, only few studies have previously
compared the effect of various probiotic lysates on HA-promoting ac-
tivity in human keratinocytes.
Since application of only a high pressure process in preparing
paraprobiotics requires relatively longer duration times
(Balasubramaniam, Martinez-Monteagudo, & Gupta, 2015), we tested
various processing conditions by varying the pressure strength
(20,000–27,000 psi) as well as disruption passage number (1–5 times).
Unfortunately, we could not test the effect of pressurization exceeding
27,000 psi in this study due to the limitation of instrument capacity;
5
Journal of Functional Foods 75 (2020) 104244
however, this should be further tested in future studies. The results
showed that the lysate of L. platarum K8 prepared by pressurization at
27,000 psi with three passages (hereafter referred to as ‘optimal con-
dition’) showed the best moisturizing effect among all samples. In
contrast, HA secretion showed decreased tendency when cells were
treated with the lysates prepared by pressurization over four passage
times. It has been shown that rupture of microorganism cells by high
pressure treatment occurs by the combination of fluid-mechanical
stresses, turbulence shar and elongational stresses, and cavitation
(Donsì, Ferrari, Lenza, & Maresca, 2009). Therefore, our result could be
attributed to the difference in fragmentation depending on the strength
of pressure and disruption number, suggesting that an optimal size of
bacterial fragments is important to facilitate HA synthesis in skin cells.
Similar to our results, Kim, Kim, Kim, et al. (2015) reported that while
the mean size of bacterial lysate decreased from 2000 μm to 500 μm,
the anti-inflammatory activity of the lysate increased, depending on the
disruption number. To the best of our knowledge, this is the first study
to demonstrate the relationship between skin-moisturizing effect and
pressurizing conditions used to prepare paraprobiotics.
Next, we investigated the effects of L. plantarum K8 lysate prepared
under the optimal condition on the expression of genes and proteins
related to moisturizing effect in skin cells. HA is synthesized by trans-
membrane enzymes, called HAS, of the epidermal keratinocytes
(Verdier-Sevrain & Bonte, 2007). Among the several isoforms, HAS2 is
highly expressed and responsible for HA synthesis compared to HAS1
and HAS3 (Jokela, Karna, Makkonen, Laitinen, Tammi, & Tammi,
2014). Therefore, studying the expressinon and activity of HAS2 in
human keratinocytes is important to elucidate the moisturizing effects
of these lysates. Depending on the treated times, HAS2 mRNA expres-
sion peaked at 3 h after treatment with optimal L. plantarum K8 lysate,
suggesting that the gene was upregulated early. Similar to our results,
Nakai, Hirose, Murosaki, and Yoshikai (2019) recently reported that the
expression level of HAS2 upon heat-killed L. plantarum L-137 treatment
significantly increased at 2 h after treatment. Furthermore, HAS2 ex-
pression level increased in a dose-dependent manner following the
treatment with optimal L. plantarum K8 lysate (upto 1000 μg/mL),
suggesting that the lysate played an important role in HA production by
upresultating HAS2 gene in HaCaT keratinocytes. This observation was
confirmed at the protein level as the expression of HAS2 protein in-
creased in a time-dependent (upto 24 h) and dose-dependent manner
(100–1000 μg/mL) in response to L. plantarum K8 lysate treatment.
Taken together, our results suggest that optimal L. plantarum K8 lysate
H. Kim, et al.
may facilitate HA production by upregulating HAS2 in HaCaT kerati-
nocytes. Meanwhile, Malaisse et al. (2014) insisted that HAS1, rather
than HAS2, is the main enzyme responsible for HA production by
normal keratinocytes. For the clear elucidation, the study whether L.
plantarum K8 lysate facilitates the expression of HAS1 and HAS3 will be
also warranted in our future works. Another key molecule involved in
HA production, hyaluronidase 1 (HYAL1), is associated with the pro-
gression of damaged or aged skin by degrading HA (Colombaro et al.,
2015). Confirming whether the L. plantarum K8 lysate inhibited the
expression of HYAL1 in HaCaT cells could have further clarified the
molecular mechanism of HA-promoting activity, however, the lysate
did not affected the gene and protein expression levels of HYAL1 (data
not shown).
AQPs are moisturizing factors belonging a family of integral mem-
brane proteins that serve as water channels, and in some cases, small
solutes across the membrane (Nakahigashi, Kabashima, Ikoma,
Verkman, Miyachi, & Hara-Chikuma, 2011; Takata, Matsuzaki, &
Tajika, 2004). Among 12 types of mammalian AQPs (AQP0-12), AQP3
is the most studied and well-validated AQP and is abundantly expressed
in epidermal keratinocytes (Boury-Jamot et al., 2006). In response to
treating HaCaT cells with L. plantarum K8 lysate, the expression of
AQP3 mRNA significantly increased significantly at earlier time point,
whereas the protein synthesis started at a later time point (18 h). Col-
lectively, our results showed that the lysate of L. plantarum K8 could up-
regulate the AQP3 expression in the stratum corneum keratinocyte.
Given that the most common causes of skin barrier dysfunction are the
loss of skin water balance regulated by HA, natural moisturizing factors
(NMFs), and genes/proteins related to chemical (HBDs and LL-37) and
physical barriers (filaggrin, loricrin, AQP3, HA, and HASs) (Verdier-
Sevrain & Bonte, 2007), further studies on the effect of optimal lysate of
K8 strain for elucidating molecular mechanisms underlying skin-
moisturizing and skin-barrier function will be elucidated in near future.
In the meanwhile, the present results obtained by the in vitro skin model
may not be warranted the same levels when it administered orally,
because its mechanisms of action might be different. Although the
underlying mechanisms of action are required more investigation, re-
searchers have proposed some oral treatments exert their various effects
by triggering gut immune system modification followed by ultimately
acting the target organs, including skin (Taverniti & Guglielmetti,
2011). To elucidate more clearly its action mechanism and utilize the L.
plantarum K8 lysate as oral functional ingredients for skin moisturizing,
further in vivo studies will be warranted soon.
On the other hand, another study on the active components in re-
sponsible for expression of the moisturizing activity in HaCaT cells
should be elucidated. The high-pressure technique is known to create
nanoparticles of microbes, due to the ruptures in microbial cells caused
by increase in pressure and by shear stress (de Almada, Almada,
Martinez, & Sant'Ana, 2016). Such physical process could exert mi-
cronization or nanonization of the rigid and complex wall macro-
molecules, such as peptidoglycan, teichoic acid, lipoteichoic acid,
membrane proteins and polysaccharides, affecting expression of phy-
siological activity including skin-moisturizing effects (Chapot-Chartier
& Kulakauskas, 2014). In fact, our results suggest that NAG which is
well-known composition of constructing peptidoglycan could be a
candidate of active ingredient in expression of moisturizing activity of
L. plantarum lysate. But this possibility will be also elucidated in near
future study.
5. Conclusion
In the present study, we showed that the lysate prepared from L.
plantarum K8 strain had a higher HA-promoting activity than those of
the lysate prepared from other probiotic strains. We also revealed that
the treatment of HaCaT cells with optimal L. plantarum K8 lysate in-
creased the expression levels of moisturizing factors, including HAS2
and AQP3. To the best of our knowledge, this is first study to
6
Journal of Functional Foods 75 (2020) 104244
demonstrate that paraprobiotics prepared by high pressurization may
improve skin-moisturizing activity by upregulating moisturizing fac-
tors. Thus, paraprobiotic of L. plantarum K8 may serve as a functional
ingredient for moisturizing products.
Ethnic statements
The authors declare this research did not include any human sub-
jects and animal experiments.
CRediT authorship contribution statement
Hoon Kim: Conceptualization, Supervision, Visualization,
Supervision. Boram Jeon: Methodology, Formal analysis, Data cura-
tion, Writing - original draft. Woo Jung Kim: Writing - review &
editing, Formal analysis, Methodology, Investigation. Dae-Kyun
Chung: Funding acquisition, Project administration, Supervision.
Declaration of Competing Interest
The authors declare that there are no conflicts of interest.
Acknowledgements
We would like to thank Editage (www.editage.co.kr) for English
language editing.
Funding source
This work has supported by the National Research Foundation of
Korea (NRF) grant funded by the Korea government (MSIT) (No.
2019R1I1A1A01061083).
References
Adams, C. A. (2010). The probiotic paradox: Live and dead cells are biological response
modifiers. Nutrition Research Reviews, 23, 37–46.
Aguilar-Toalá, J. E., Garcia-Varela, R., Garcia, H. S., Mata-Haro, V., González-Córdova, A.
F., Vallejo-Cordoba, B., & Hernández-Mendoza, A. (2018). Postbiotics: An evolving
term within the functional foods field. Trends in Food Science & Technology, 75,
105–114.
Ayichew, T., Belete, A., Alebachew, T., Tsehaye, H., Berhanu, H., & Minwuyelet, A.
(2017). Bacterial probiotics their importances and limitations: A review. Journal of
Nutrition and Health Sciences, 4, 202–209.
Bajagai, Y. S., Klieve, A. V., Dart, P. J., & Bryden, W. L. (2016). Probiotics in animal
nutrition: production, impact and regulation. In H. P. S. Makkar (Ed.), FAO animal
production and health paper (Vol. 179). Rome: Food and Agriculture Organization of
the United Nations.
Balasubramaniam, V. M., Martinez-Monteagudo, S. I., & Gupta, R. (2015). Principles and
application of high pressure-based technologies in the food industry. Annual Review of
Food Science and Technology, 6, 435–462.
Boury-Jamot, M., Sougrat, R., Tailhardat, M., Le Varlet, B., Bonte, F., Dumas, M., &
Verbavatz, J.-M. (2006). Expression and function of aquaporins in human skin: Is
aquaporin-3 just a glycerol transporter? Biochimica et Biophysica Acta, 1758,
1034–1042.
Chapot-Chartier, M. P., & Kulakauskas, S. (2014). Cell wall structure and function in lactic
acid bacteria. Microbial Cell Factories, 13(Suppl 1), S9.
Choi, E.-J., Iwasa, M., Han, K.-I., Kim, W.-J., Tang, Y., Hwang, Y. J., ... Kim, E.-K. (2016).
Heat-killed Enterococcus faecalis EF-2001 ameliorates atopic dermatitis in a murine
model. Nutrients, 8, 146.
Colombaro, V., Jadot, I., Decleves, A.-E., Voisin, V., Giordano, L., Habsch, I., ... Caron, N.
(2015). Hyaluronidase 1 and hyaluronidase 2 are required for renal hyaluronan
turnover. Acta Histochemica, 117, 83–91.
de Almada, C. N., Almada, C. N., Martinez, R. C. R., & Sant'Ana, A. S. (2016).
Paraprobiotics: Evidences on their ability to modify biological responses, inactivation
methods and perspectives on their application in foods. Trends in Food Science &
Technology, 58, 96–114.
Donsì, F., Ferrari, G., Lenza, E., & Maresca, P. (2009). Main factors regulating microbial
inactivation by high-pressure homogenization: Operating parameters and scale of
operation. Chemical Engineering Science, 64, 520–532.
Generoso, S. V., Viana, M. L., Santos, R. G., Arantes, R. M., Martins, F. S., Nicoli, J. R., ...
Cardoso, V. N. (2011). Protection against increased intestinal permeability and
bacterial translocation induced by intestinal obstruction in mice treated with viable
and heat-killed Saccharomyces boulardii. European Journal of Nutrition, 50, 261–269.
Hsieh, F.-C., Lan, C.-C.-E., Huang, T.-Y., Chen, K.-W., Chai, C.-Y., Chen, W.-T., ... Wu, C.-S.
H. Kim, et al.
(2016). Heat-killed and live Lactobacillus reuteri GMNL-263 exhibit similar effects on
improving metabolic functions in high-fat diet-induced obese rats. Food & Function, 7,
2374–2388.
Im, A.-R., Lee, B., Kang, D.-J., & Chae, S. (2018). Skin moisturizing and antiphotodamage
effects of tyndallized Lactobacillus acidophilus IDCC 3302. Journal of Medicinal Food,
21, 1016–1023.
Islam, S. U. (2016). Clinical uses of probiotics. Medicine, 95, e2658–e2662.
Jokela, T. A., Karna, R., Makkonen, K. M., Laitinen, J. T., Tammi, R. H., & Tammi, M. I.
(2014). Extracellular UDP-glucose activates P2Y14 receptor and induces signal
transducer and activator of transcription 3 (STAT3) Tyr705 phosphorylation and
binding to hyaluronan synthase 2 (HAS2) promoter, stimulating hyaluronan synthesis
of keratinocytes. Journal of Biological Chemistry, 289, 18569–18581.
Kawase, M., He, F., Kubota, A., Yoda, K., Miyazawa, K., & Hiramatsu, M. (2012). Heat-
killed Lactobacillus gasseri TMC0356 protects mice against influenza virus infection
by stimulating gut and respiratory immune responses. FEMS Immunology and Medical
Microbiology, 64, 280–288.
Kim, H., Kim, H. R., Jeong, B. J., Lee, S. S., Kim, T.-R., Jeong, J. H., ... Chung, D. K.
(2015). Effects of oral intake of kimchi-derived Lactobacillus plantarum K8 lysates on
skin moisturizing. Journal of Microbiology and Biotechnology, 25, 74–80.
Kim, H., Kim, H. R., Kim, N.-R., Jeong, B. J., Lee, J. S., Jang, S., & Chung, D. K. (2015).
Oral administration of Lactobacillus plantarum lysates attenuates the development of
atopic dermatitis lesions in mouse models. Journal of Microbiology, 53, 47–52.
Lee, S. H., Yoon, J. M., Kim, Y. H., Jeong, D. G., Park, S., & Kang, D. J. (2016).
Therapeutic effect of tyndallized Lactobacillus rhamnosus IDCC 3201 on atopic
dermatitis mediated by down-regulation of immunoglobulin E in NC/Nga mice.
Microbiology and Immunology, 60, 468–476.
Liu, Y., Tran, D. Q., & Rhoads, J. M. (2018). Probiotics in disease prevention and treat-
ment. Journal of Clinical Pharmacology, 58, S164–S179.
Lopez, M., Li, N., Kataria, J., Russell, M., & Neu, J. (2008). Live and ultraviolet-in-
activated Lactobacillus rhamnosus GG decrease flagellin-induced interleukin-8 pro-
duction in Caco-2 cells. Journal of Nutrition, 138, 2264–2268.
Malaisse, J., Bourguignon, V., De Vuyst, E., Lambert de Rouvroit, C., Nikkels, A. F.,
Flamion, B., & Poumay, Y. (2014). Hyaluronan metabolism in human keratinocytes
and atopic dermatitis skin is driven by a balance of hyaluronan synthases 1 and 3.
Journal of Investigative Dermatology, 134, 2174–2182.
McDaniel, D. H., Steel, C., & Mazur, C. (2013). Cosmeceuticals and cosmetic practice. In
P. K. Farris (Ed.), Evaluating cosmeceuticals (1 ed., Vol. 1, pp. 23-36). Hoboken:
Hoboken: WILEY.
Miyazawa, K., He, F., Kawase, M., Kubota, A., Yoda, K., & Hiramatsu, M. (2011).
Enhancement of immunoregulatory effects of Lactobacillus gasseri TMC0356 by heat
treatment and culture medium. Letters in Applied Microbiology, 53, 210–216.
Nakahigashi, K., Kabashima, K., Ikoma, A., Verkman, A. S., Miyachi, Y., & Hara-Chikuma,
M. (2011). Upregulation of aquaporin-3 is involved in keratinocyte proliferation and
Journal of Functional Foods 75 (2020) 104244
epidermal hyperplasia. Journal of Investigative Dermatology, 131, 865–873.
Nakai, H., Hirose, Y., Murosaki, S., & Yoshikai, Y. (2019). Lactobacillus plantarum L-137
upregulates hyaluronic acid production in epidermal cells and fibroblasts in mice.
Microbiology and Immunology, 63, 367–378.
Ogawa, M., Saiki, A., Matsui, Y., Tsuchimoto, N., Nakakita, Y., Takata, Y., & Nakamura, T.
(2016). Effects of oral intake of heat-killed Lactobacillus brevis SBC8803 (SBL88™) on
dry skin conditions: A randomized, double-blind, placebo-controlled study.
Experimental and Therapeutic Medicine, 12, 3863–3872.
Ou, C. C., Lin, S. L., Tsai, J. J., & Lin, M. Y. (2011). Heat-killed lactic acid bacteria en-
hance immunomodulatory potential by skewing the immune response toward Th1
polarization. Journal of Food Science, 76, M260–M267.
Papakonstantinou, E., Roth, M., & Karakiulakis, G. (2012). Hyaluronic acid: A key mo-
lecule in skin aging. Dermato-Endocrinology, 4, 253–258.
Szyszkowska, B., Lepecka-Klusek, C., Kozlowicz, K., Jazienicka, I., & Krasowska, D.
(2014). The influence of selected ingredients of dietary supplements on skin condi-
tion. Postepy Dermatologii I Alergologii, 31, 174–181.
Takata, K., Matsuzaki, T., & Tajika, Y. (2004). Aquaporins: Water channel proteins of the
cell membrane. Progress in Histochemistry and Cytochemistry, 39, 1–83.
Tanaka, Y., Hirose, Y., Yamamoto, Y., Yoshikai, Y., & Murosaki, S. (2020). Daily intake of
heat-killed Lactobacillus plantarum L-137 improves inflammation and lipid metabo-
lism in overweight healthy adults: A randomized-controlled trial. European Journal of
Nutrition, 59, 2641–2649.
Taverniti, V., & Guglielmetti, S. (2011). The immunomodulatory properties of probiotic
microorganisms beyond their viability (ghost probiotics: Proposal of paraprobiotic
concept). Genes and Nutrition, 6, 261–274.
Ueno, N., Fujiya, M., Segawa, S., Nata, T., Moriichi, K., Tanabe, H., ... Kohgo, Y. (2011).
Heat-killed body of Lactobacillus brevis SBC8803 ameliorates intestinal injury in a
murine model of colitis by enhancing the intestinal barrier function. Inflammatory
Bowel Diseases, 17, 2235–2250.
Verdier-Sevrain, S., & Bonte, F. (2007). Skin hydration: A review on its molecular me-
chanisms. Journal of Cosmetic Dermatology, 6, 75–82.
Vlasova, A. N., Kandasamy, S., Chattha, K. S., Rajashekara, G., & Saif, L. J. (2016).
Comparison of probiotic lactobacilli and bifidobacteria effects, immune responses
and rotavirus vaccines and infection in different host species. Veterinary Immunology
and Immunopathology, 172, 72–84.
Warda, A. K., Rea, K., Fitzgerald, P., Hueston, C., Gonzalez-Tortuero, E., Dinan, T. G., &
Hill, C. (2019). Heat-killed lactobacilli alter both microbiota composition and be-
haviour. Behavioural Brain Research, 362, 213–223.
Wei, C.-L., Wang, S., Yen, J.-T., Cheng, Y.-F., Liao, C.-L., Hsu, C.-C., ... Tsai, Y.-C. (2019).
Antidepressant-like activities of live and heat-killed Lactobacillus paracasei PS23 in
chronic corticosterone-treated mice and possible mechanisms. Brain Research, 1711,
202–213.