Microbiological Research 169 (2014) 453–462

Contents lists available at ScienceDirect

Microbiological Research
journal homepage: www.elsevier.com/locate/micres

Cloning, expression and phylogenetic analysis of a divergent laccase

multigene family in Auricularia auricula-judae
XiuZhi Fan a,b , Yan Zhou a,b , Yang Xiao a,b , ZhangYi Xu a,b , YinBing Bian a,b,∗
a
Institute of Applied Mycology, Huazhong Agricultural University, No. 1 Shizishan Rd., Wuhan 430070, Hubei, China
b
Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, China

a r t i c l e i n f o a b s t r a c t

Article history: Laccases (p-diphenol: oxygen oxidoreductase; EC 1.10.3.2) are multi-copper oxidases encoded by gene
Received 24 May 2013 family in white rot fungi. Auricularia auricula-judae is one kind of white rot fungi with a soft, jelly-like tex-
Received in revised form 17 August 2013 ture and an ear-like shape. In the present study, seven laccase genes containing the signature sequences
Accepted 24 August 2013
L1–L4 were isolated from A. auricula-judae strain Au916 on the basis of the mycelium-derived transcrip-
Available online 19 September 2013
tome. In the basidiomycetes, the predicted substrate binding loops of the A. auricula-judae laccases were
found to be uncommon. Phylogenetic analysis showed that the laccases of the Auricularia were nested
Keywords:
into the ascomycete laccases, indicating that the laccase genes from Auricularia are distinctly different
Auricularia auricula-judae
Laccase
in function from other basidiomycetes. Among the seven laccases, the intron positions and cluster dis-
Transcriptome tributions in the NJ tree varied from each other and the expression patterns of seven genes estimated by
Quantitative reverse transcription PCR qRT-PCR were also discrepant. The lcc3 gene was highly expressed not only in the free-living mycelium
Phylogenetic analysis but also in substrate mycelium, furthermore, the lcc5 gene was mostly expressed during the fruiting body
formation and maturation indicating that lcc5 might play a major role during the sexual reproduction
stage.
© 2013 Elsevier GmbH. All rights reserved.

1. Introduction
Laccase (p-diphenol: oxygen oxidoreductase; EC 1.10.3.2) is a
blue multi-copper oxidase that catalyzes the oxidation of phenols,
aromatic amines, and other aromatic compounds concomitantly
with the reduction of molecular oxygen to water (Thurston, 1994).
Laccases contain two copper centers which are responsible for the
electron transfer during redox reactions. The copper centers are
usually differentiated as mononuclear center (T1) with one type-1
Cu being responsible for the blue color, and the trinuclear clus-
ter (T2/T3) consisting of one type-2 Cu and two coupled type-3
Cu (Messerschmidt and Huber, 1990; Hoegger et al., 2004). In all
laccases, the copper-binding residues, ten histidines and one cys-
teine, are conserved as copper ligands, among which two histidines
and one cysteine serve as ligands for type-1 Cu and the rest eight
histidines for type-2 and type-3 Cu. These conserved residues are
spread over four conserved amino acid regions, which are desig-
nated as signature sequences L1–L4 that can be used to identify the
laccases (Kumar et al., 2003).
∗ Corresponding author at: Institute of Applied Mycology, Huazhong Agricultural
University, No. 1 Shizishan Rd., Wuhan 430070, Hubei, China.
Tel.: +86 02787282221.
E-mail address: bianyinbinghzaucn@yahoo.com (YB. Bian).
The laccase was first identified in the varnish tree Rhus verni-
cifera in 1883 (Yoshida, 1883), and since then, it has been detected
in higher plants, some insects, a few bacteria, and fungi (Mayer and
Staples, 2002). Most of the known laccases are of fungal origin, in
particular from the lignin-degrading white rot fungi (Saito et al.,
2003). In the white rot fungi, the laccases are usually encoded by a
gene family, as described in Trametes villosa (Yaver and Golightly,
1996; Yaver et al., 1996), Agaricus bisporus (Perry et al., 1993;
Billette et al., 2011), Pleurotus sajor-caju (Soden and Dobson, 2001),
Polyporus brumalis (Ryu et al., 2008), Pleurotus ostreatus (Castanera
et al., 2012) and Laccaria bicolor (Courty et al., 2009). The largest
laccase family is from Coprinopsis cinerea that comprises up to 17
non-allelic laccase genes (Kilaru et al., 2006).
Besides lignin degradation, the fungal laccases have been linked
to vegetative growth (Ohga et al., 1999; Ohga and Royse, 2001),
fruiting body formation (Kües and Liu, 2000; Chen et al., 2004),
sporulation (Mayer and Staples, 2002), and pigment production
(Langfelder et al., 2003; Nagai et al., 2003). It is noteworthy that
the members of the laccase gene family showed differential expres-
sion patterns, suggesting that they play different roles during the
life cycle of fungi (Hoegger et al., 2006). For instance, in L. bicolor,
among the 11 laccase genes, lcc3 and lcc8 are very abundant in
ectomycorrhiza, lcc7 in fruiting bodies, and lcc9 and lcc10 in the
free-living mycelium growth (Courty et al., 2009). In P. ostrea-
tus, among the produced laccases, lacc10 plays a major role in

0944-5013/$ – see front matter © 2013 Elsevier GmbH. All rights reserved.
http://dx.doi.org/10.1016/j.micres.2013.08.004
454 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462
vegetative growth and lacc2, an additional physiological role during
fructification (Pezzella et al., 2013).
Laccase genes are usually cloned from a cDNA or genomic library
using degenerate primers designed according to the highly con-
served laccase copper-binding regions (Soden and Dobson, 2001;
Hoegger et al., 2004). In recent years, the newly sequenced genomes
of fungi have rapidly increased the number of laccases, such as
in C. cinerea, L. bicolor and P. ostreatus. Lately, transcriptome, the
complete set of transcripts from a sample in a specific develop-
mental stage or physiological condition provided by RNA-Seq, has
been used to reveal the molecular constituents and the expression
levels of each transcript (Wang et al., 2009). Consequently, one or
more laccase genes of a target organism could be predicted by the
transcriptome.
Although the phylogeny of laccase genes does not strictly follow
the species phylogeny, the fungal laccases can be divided into basid-
iomycetous and ascomycetous clades in phylogenetic analyses
(Hoegger et al., 2006). Nevertheless, Auricularia delicata, one kind
of basidiomycetes, is classified into the ascomycetous clade for its
laccase genes were nested within the ascomycete laccases (Floudas
et al., 2012). Auricularia auricula-judae [(Bull.) Quél.], together with
A. delicata, belongs to genus Auricularia of Incertae sedis under
Agaricomycetes (Kirk et al., 2008). It is one of the most cultivated
mushrooms in China due to its high nutritive, economic and medic-
inal values. To the best of our knowledge, no report has been
published about laccases in A. auricula-judae.
The aims of the current study were to (i) isolate laccase genes
from A. auricula-judae based on the transcriptome of mycelium, (ii)
unravel the expression patterns of different isoenzymes by quan-
titative reverse transcription PCR, and (iii) infer the phylogenetic
relationship between the laccases of A. auricula-judae and other
fungi.
2. Materials and methods
2.1. Organisms and culture conditions
The strain used in this study was a commercially cultivated
strain of A. auricula-judae, Au916 (preserved in our laboratory),
together with two types of monokaryotic strains PI and PII, which
were isolated by protoplast monokaryogenesis from dikaryotic
Au916. Both dikaryotic and monokaryotic strains were maintained
on solid CYM medium (complete yeast medium: 2 g peptone, 2 g
yeast extract, 20 g glucose, 1 g K2 HPO4 , 0.5 g MgSO4 ·7H2 O, 0.46 g
KH2 PO4 and 15 g agar per liter of distilled water) as described by
Horgen et al., (1989). Escherichia coli, strain DH5␣, was used for
transformation and subcloning. E. coli strains were grown at 37 ◦ C
in LB medium for plasmid propagation.
2.2. Sampling
The strain Au916 was incubated at 25 ◦ C in liquid CYM for one
week, and then the mycelia were filtered and collected. After 7 days
of growth on CYM at 25 ◦ C, the mycelial plugs were inoculated in
sterile polypropylene plastic bags (30 cm × 15 cm) containing 360 g
sawdust substrate (78% sawdust, 20% wheat bran, 1% CaCO3 and 1%
sugar) and 60% water. The inoculated bags were incubated at 25 ◦ C
in the dark for 30 days, and then the mycelia with substrate were
gathered from three bags and mixed. Subsequently, the substrate
with mycelia in the other bags was used as spawns and inoculated
in wood-log to obtain primordia and fruiting bodies. Primordia with
a diameter of 1–3 mm were selected and blended (pinhead, stage I).
Immature fruiting bodies with a diameter of 5–10 mm (stage II), and
10–20 mm (stage III) and the mature fruiting bodies with a diameter
of above 20 mm (stage IV) were plucked on the 2nd, 5th, and 15th
days after primordia budding, respectively. All the aforementioned
samples were immediately frozen by liquid nitrogen and stored at
−80 ◦ C.
2.3. Nucleic acids isolation and cDNA preparation
Genomic DNA was extracted from the mycelia using the cetyl
trimethylammonium bromide (CTAB) method (Sambrook and
Russell, 2001). RNase A (100 mg/mL) was used to degrade the
residual RNA. Total RNAs from the samples described above were
isolated with TRIzol Reagent (Invitrogen, USA) according to the
instruction manual. The integrity of the obtained genomic DNA
and total RNA were evaluated via 1.0% (w/v) agarose gel elec-
trophoresis. Nanodrop 2000 (Thermo Scientific, USA) was used to
determine the concentration. Total RNA was treated to remove the
genomic DNA according to the protocol of Recombinant DNase I
(TaKaRa). After DNase I treatment, quality was checked again with
the Nanodrop. 1 ␮g of treated total RNA was used to synthesize the
first-strand complementary DNA (cDNA) by M-MLV reverse trans-
criptase (TaKaRa, Japan) with 1 ␮M oligo (dT)18 primer in a 20 ␮L
reaction system. Genomic DNA and cDNA were stored at −20 ◦ C,
and the total RNA was stored at −80 ◦ C.
2.4. Cloning and analysis of laccase genes
According to the annotation in the transcriptome of A. auricula-
judae Au916 mycelium, 11 putative laccase genes (plcc1 to plcc11)
were obtained. The length of the unknown 5 and 3 ends
for the putative laccase coding regions were speculated using
BLASTX on the National Center for Biotechnology Information
(NCBI, http://www.ncbi.nlm.nih.gov). Subsequently, the primers
for amplifying cDNA fragment and 5 and 3 ends were designed by
using Primer Premier 5.0 software (see supplementary Table S1).
Using the first-strand cDNA from dikaryotic mycelia as the tem-
plate, the 5 -Full RACE Core set, 3 -Full RACE Core Set (TaKaRa) and
SMARTerTM RACE (Clontech) cDNA Amplification Kits were used
to obtain the complete full-length cDNA according to the man-
ufacturer’s instruction. According to the 5 and 3 untranslation
regions (UTR) of cDNA, primers for DNA sequence amplification
were designed. The final concentration of the genomic DNA from
dikaryotic mycelia was 50 ng in the 20 ␮L polymerase chain reac-
tion (PCR) system.
Supplementary material related to this article can be
found, in the online version, at http://dx.doi.org/10.1016/
j.micres.2013.08.004.
The putative alleles were identified by PCR, for which the specific
primers were designed and the genomic DNA from two types of
parental monokaryons were separately used as templates (Table
S1). After PCR, the products were sequenced and compared with
the DNA sequences of the putative genes to verify the reliability of
amplification.
All the PCR products were subjected to the agarose gel elec-
trophoresis. The target PCR fragments were excised from the
gel and purified with Gel Purification Kit (BioTeke, Beijing). The
purified products were then cloned using the pMD® 18-T Vector
(TaKaRa, Japan) into E. coli DH5␣. Finally, 3–5 positive clones of tar-
get fragments were sequenced by GenScript Corporation (Nanjing,
China).
DNAMAN version 5.2.2 software was used for
sequences analysis and assembly. The SoftBerry program
(http://linux1.softberry.com) was used to predict the amino
acid sequence. The deduced amino acid sequences were aligned
with Clustal X 1.83 (Thompson et al., 1997) and then manually
adjusted in GeneDoc 2.6 (Nicholas and Nicholas, 1997). Introns
were analyzed by aligning the obtained cDNA and DNA sequences
and confirmed by identifying the consensus exon/intron splice
 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462 455

Table 1
Oligonucleotide primer sequences used for quantitative RT-PCR.

Gene Primer name Primer sequence (5 –3 ) Product length (bp)

lcc1qF CGGCAATAGCACCTGGAA
lcc1 112
lcc1qR CAAATGAATCGGGTGAGC
lcc2qF GCTATCCTTGCGGCTGTC
lcc2 152
lcc2qR TTGGTGGAGATGTCGTATGTG
lcc3qF TGGACCTGCGGATGTAACGA
lcc3 182
lcc3qR CGACGATGCTGCCATTCTTG
lcc4qF ATTGTGATCCTGCTCGTTGC
lcc4 172
lcc4qR CCCTGATGAAGAAAGCGTGT
lcc5qF TTGAGCGTGCAGCTTATTG
lcc5 140
lcc5qR CAGATACCCGAGTCGTCCTT’
lcc6qF CGCCTGGGCAGACTTTTAC
lcc6 (lcc6a /lcc6b ) 140
lcc6qR AGCTTCGGGAATGTTGTGA
lcc7qF GTACGGAGACGGCGTTTGGG
lcc7 (lcc7a /lcc7b ) 161
lcc7qR AGTTCTGTGGGCGAGGAGGA
18S qF TTAGTTGGTGGAGTGATTTG
18S rRNA 201
18S qR GCTGGCTCTGTCAGTGTAG

junction sequences. Intron positions were compared as described
by Fedorov et al. (2002). The signal peptide for mature laccase pro-
tein was predicted by SignalP 4.1 program (Petersen et al., 2011).
Sequences obtained in this study were submitted to GenBank in
NCBI.
tree bisection-reconnection (TBR) as branch-swapping algorithm.
Gaps were treated as missing data. Bootstrapping was carried out
with 1000 replications.
2.6. Quantitative reverse transcription PCR (qRT-PCR)

2.5. Phylogenetic analysis
For phylogenetic analysis, the amino acid sequences of other
basidiomycete and ascomycete laccase were selected from the NCBI
referring to the phylogeny studies of laccase proteins in basid-
iomycetes and ascomycetes (Hoegger et al., 2006; Tamayo Ramos
et al., 2011; Floudas et al., 2012), and the sequences from insects
were used as outgroups. All sequences were aligned by Clustal X
1.83. The phylogenetic trees were constructed using the neighbor
joining (NJ) method in MEGA 5.1 (Tamura et al., 2011) based on
Poisson, Dayhoff and Jones–Taylor–Thornton (JTT) substrate mod-
els. Branch robustness was evaluated by bootstrap phylogeny test
with 1000 replications. For further evaluation of the tree, a clado-
gram was constructed by the maximum parsimony (MP) method
using heuristic searches with 100 replicates of random addition and
The transcriptional levels of laccase genes in free-living mycelia,
substrate mycelia and developmental stages I–IV on wood-log
were detected by qRT-PCR. Gene-specific primers were designed
by Primer Premier 5.0 software (Table 1). After synthesis, the first-
strand cDNA was diluted 10 times with ddH2 O, and then was used
as template for qRT-PCR. The PCR was carried out in CFX96 (BIO-
RAD, USA) in a total volume of 20 ␮L with 1 ␮L of diluted cDNA,
10 ␮L Bestar Real time PCR Master Mix (SYBR Green, DBI, Germany),
0.5 ␮L forward and reverse primer (10 ␮M), respectively. The PCR
program was 95 ◦ C for 2 min, 40 cycles (95 ◦ C for 10 s, 60 ◦ C for
30 s, 72 ◦ C for 30 s with a single fluorescence measurement), and
melting curve program (65–95 ◦ C, +0.5 ◦ C/cycle, 0.05 s/cycle with
fluorescence measurement). All the experiments were performed
in triplicate and the reactions with ddH2 O as template were run in
the same conditions as negative control.

Fig. 1. The samples used in this study. (A) The free-living mycelium in the glucose-rich liquid CYM medium. (B) The substrate mycelium in the plastic bag containing sawdust.
C–F, four developmental stages on the wood-log. (C) Primordium (Stage I). (D) Immature fruiting body (Stage II). (E) Immature fruiting body (Stage III). (F) Mature fruiting
body (Stage IV). Red bar, 10 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
456 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462
Fig. 2. PCR identification of putative alleles plcc7/plcc8 and plcc10/plcc11. 916,
dikaryotic strain Au916; PI and PII, two types of parental monokaryons; M is the
DL2000 marker (TaKaRa).
After amplification, the relative expression quantification was
evaluated by the algorithm of 2−CT method (Pfaffl, 2001). The
results of each sample were normalized to the 18S rRNA (reference
gene) run on the same plate (CT = CTlcc − CT18S ), and the rela-
tive quantification of target genes was quantified according to the
control (CT = CTtarget − CTcontrol ). One-way ANOVA test was
performed to determine the significance level. Mean values were
compared by the least significant difference (LSD) test at p ≤ 0.05
and p ≤ 0.01.
3. Results
3.1. Identification laccase genes in A. auricula-judae
The materials used in this study were shown in Fig. 1. The trans-
criptome data of A. auricula-judae mycelium (Fig. 1A) surveyed
using RNA-Seq were deposited in the NCBI database under the
accession number SRX318366. After assembly, the eleven putative
laccase sequences were aligned to detect the similarity, indicat-
ing that plcc2 and plcc6, and plcc4 and plcc9 matched each other
perfectly, suggesting that they were from the same gene, respec-
tively. Instead, 15 and 20 single nucleotide polymorphisms (SNPs)
were separately found between plcc7 and plcc8, and plcc10 and
plcc11; meanwhile, six and five nucleotide length discrepancies
were detected in each pair at introns, respectively. The PCR per-
formed with the specific primers containing the SNP sties (Table
S1) showed that plcc7 and plcc8, along with plcc10 and plcc11, were
present in different parental monokaryons (Fig. 2), suggesting that
the variant sequences in the two pairs were alleles, respectively.
Hence, the cloned putative laccase genes were renamed as
lcc1, lcc2, lcc3, lcc4, lcc5, lcc6a , lcc6b , lcc7a and lcc7b , according
to the nomenclature of alleles (http://www.informatics.jax.org/
mgihome/nomen/gene.shtml#nas). The sequence information
about these genes is presented in Table 2. The accession numbers
in NCBI are KC991150 to KC991158.
3.2. Predicted laccase proteins
Alignment of the deduced amino acid sequences of the A.
auricula-judae laccase genes showed that all proteins contained
the typical conserved ten histidine and one cysteine residues,
which were ligands for the two laccase copper-binding centers, T1
and T2/T3, and located in the laccase signature sequences L1–L4
(Fig. 3A).
The deduced protein sequences of the seven genes encoded
laccases sensu stricto with the length varying from 575 to 620 aa
(Table 2), and the sequence identity ranging from 25 to 93%, among
which lcc2 and lcc7a (lcc7b ) showed the highest similarity. Compar-
ison of the deduced amino acid sequences of the alleles showed
no sequence difference between allelic lcc7a and lcc7b , because
all of the SNP variation sites were at the 3rd position of synony-
mous codons. However, the 48th (threonine/serine) and the198th
(valine/alanine) amino acids were varied in the allelic lcc6a and
lcc6b , resulting from substitution at the 2nd base of codons.
The signal peptides for mature proteins were predicted to be
of a length of 16–20 amino acids except for Lcc4, suggesting that
Lcc4 was extracellular. The postulated substrate binding loops
of A. auricula-judae and A. delicata were identified by compari-
son with the protein 3D-structures of Melanocarpus albomyces, T.
versicolor and C. cinerea (Larrondo et al., 2003), and Lentinus Tigri-
nus (Ferraroni et al., 2007). Besides, the predicted structural loop
regions were mapped based on the deduced amino acid sequences,
indicating that all the laccase proteins of A. auricula-judae and A.
delicata contained the substrate-binding loops I–IV. However, the
amino acid sequences exhibited a relatively low degree of homol-
ogy to the reference fungi (Fig. 3B).
In fungal laccases, an additional residue located 10 amino acids
downstream of the conserved cysteine has an important effect on
the redox potential of the cupric ion. Based on the known residues
on this position, the laccases were classified into three classes: class
1 (methionine, M), class 2 (leucine, L), and class 3 (phenylalanine, F)
in the order of postulated increasing redox potential (Eggert et al.,
1998). In A. auricula-judae, except that Lcc3 (M) could be catego-
rized in class 1, the others harboring leucine residues at the critical
position were supposed to have a medium redox potential (Fig. 3A).
3.3. Intron features
Within the laccase genes of A. auricula-judae, the coding regions
were interrupted by 10, 13, 16 or 18 introns (Table 2), with their
length varying from 44 to 63 nucleotides, but all of the intron splice
junctions corresponded to the 5 GT–AG3 rule. For the insertion
sites of introns, statistics demonstrated that there was no prefer-
ence for intron insertion after the 1st, 2nd or 3rd position of codons
in the nine genes.
Between ascomycetes and basidiomycetes, the intron pos-
itions of laccase genes exhibited low consistency (Fig. 4). Only
2% of the introns of basidiomycetes matched the positions of the
ascomycetes, and nearly 90% of the introns of basidiomycetes were
at a unique position. Among all the positions, the most conserved
one was located after the 70th amino acid (marked with a black
triangle in Fig. 4). Among basidiomycetes, the Auricularia laccase
genes were divided into five groups (Fig. 4a–e); however, in each
group, the positions of A. auricula-judae laccase genes showed 100%
identify to those from A. polytricha and A. delicata except for lcc4 and
lcc5. Within A. auricula-judae, lcc2 and lcc7a (lcc7b ) were grouped
together with identical intron positions, and lcc1 and lcc5 were also
gathered in one group, but between them, four introns were gained
and lost, respectively. The first intron was located around the 20th
amino acid in other laccase genes, and was absent in lcc3, lcc4 and
lcc6 of A. auricula-judae.
 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462 457

Table 2
Accession numbers, nucleotide and amino acid sequence lengths of laccases from A. auricula-judae.

Gene GenBank accseeion no. cDNA length (bp) Amino acid length (aa) DNA length (bp) Number of introns Corresponding to

lcc1 KC991150 1755 584 2408 13 plcc1

lcc2 KC991151 1731 576 2233 10 plcc2/plcc6
lcc3 KC991152 1788 595 2723 18 plcc3
lcc4 KC991153 1788 595 2689 16 plcc4/plcc9
lcc5 KC991154 1770 589 2450 13 plcc5
lcc6a KC991155 1863 620 2518 13 plcc7
lcc6b KC991156 1863 620 2524 13 plcc8
lcc7a KC991157 1728 575 2247 10 plcc10
lcc7b KC991158 1728 575 2242 10 plcc11

3.4. Phylogenetic analysis
In the NJ tree, the clustering of the amino acid sequences
in the phylogenetic tree did not strictly follow the species phy-
logeny. The tree was divided into three clades: basidiomycete,
ascomycete-basidiomycete and insect (Fig. 5). The basidiomycete
clade contained all the analyzed species from Agaricomycetes (Fig.
S1), except the laccases from genus Auricularia, and Rhizoctonia
solani (Cantharellales) and Tremellomycetes Cryptococcus neofor-
mans, which were all nested within ascomycete laccases with a high
bootstrap value (Fig. 5). The seven laccases isolated from A. auricula-
judae Au916 had high homology with the previously deposited
laccases of A. auricula-judae, A. delicate and A. polytricha in NCBI (iso-
lated by other researchers), among which three and one laccase of A.
auricula-judae exhibited more than 90% identity with Lcc3 and Lcc4,
respectively. Within the ascomycete-basidiomycete clade, the lac-
cases from genus Auricularia were clustered together with different
ascomycetes, such as Lcc1, Lcc5, Lcc2, Lcc7a (Lcc7b ) and the laccases
from A. delicata were formed a sister group to Colletotrichum lage-
narium, Cryphonectria parasitica, Magnaporthe oryzae, M. albomyces
and Neurospora crassa from Ascomycete. Lcc3 and laccases of R.
solani were in the sister group to the cluster of Aspergillus oryzae, A.
niger and Fusarium oxysporum laccases.
Supplementary material related to this article can be
found, in the online version, at http://dx.doi.org/10.1016/
j.micres.2013.08.004.
Using the three models of NJ method, similar groups were iden-
tified, and clusters similar to the NJ trees were generated by the MP
method (data not shown). In this paper, only the tree constructed
by the Poisson model is shown due to their high similarities to each
other.
3.5. Expression patterns
In the present work, due to the high sequence identity between
allelic lcc6a and lcc6b , lcc7a and lcc7b , the transcript levels of variant

Fig. 3. The signature sequences and the postulated substrate binding loops of A. auricula-judae laccases Lcc1 to Lcc7. (A) The laccase signature sequences L1–L4. The histidine
and cysteine residues for copper binding are indicated according to the copper type, with T1, T2, and T3 above the residues representing type-1, type-2 and type-3 coppers,
respectively. The amino acid sequences of A. delicata laccases downloaded from NCBI are named by the abbreviation of the species name and the GenBank accession number.
(B) The sequences of the potential substrate binding loops of A. auricula-judae laccase enzymes identified according to structural alignment with loops I–IV of Trametes
versicolor laccase I (PDB code 1GYC), T. versicolor laccase III (PDB code 1KYA), Lentinus tigrinus (PDB code 2QT6), Coprinopsis cinerea laccase (PDB code 1A65) and Melanocarpus
albomyces (PDB code 1GW0). The protein regions are shown on the left of each sequence.
458 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462

Fig. 4. Comparison of intron positions in laccase genes. Horizontal lines indicate the laccase genes, vertical bars indicate intron positions, gray dotted lines mark introns that
interrupt the coding regions at exactly the same codon position in different genes, and black triangle shows the most conserved position. Sequence names consist of the
abbreviation of the species name and GenBank accession number. The full names (from top to bottom) are Auricularia delicata, Auricularia polytricha, Rhizoctonia solani,
Cryptococcus neoformans, Botryotinia fuckeliana, Fusarium oxysporum, Cryphonectria parasitica; Melanocarpus albomyces; Neurospora crassa; Colletotrichum lagenarium.

allelic genes were considered as a sum; hence, they were collec-
tively called lcc6 and lcc7, respectively. The expressions of the seven
laccase genes were analyzed by qRT-PCR and the levels were com-
pared under two conditions: (i) the transcripts of different genes
under the same condition (the free-living mycelia on glucose-rich
medium or substrate mycelia in sawdust medium) and (ii) the
expression profiles of the same laccase gene at different devel-
opmental stages on wood-log (Fig. 1). The expression levels were
normalized with the 18S rRNA gene, and the relative expression
levels were evaluated against the normalized expression of lcc1 in
the first condition and the primordium in the second one.
Gene expression analysis indicated that in the free-living
mycelia and substrate mycelia, the expression level of lcc3 was
significantly higher than that of any other gene at the 0.01 level.
Besides lcc3, the lcc2, lcc6 and lcc7 also showed high transcript lev-
els (Fig. 6A). During the production of fruiting bodies on the log,
 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462 459

Fig. 5. Neighbor joining tree of laccase amino acid sequences and details of the ascomycete-basidiomycete clade. Taxonomy names consist of the species name and GenBank
accession number. The laccases from A. auricula-judae are marked with black triangles, and the bold branches indicate basidiomycetous laccases. Bootstrap values are from
1000 replications. The scale bar indicates a distance equivalent to 0.2 amino acid substitutions per site.

lcc5 maintained the highest transcription level, and lcc3 also had a
higher expression level than the others in the four developmental
stages (Fig. 6B).
During the fructification from the pinhead stage to sporulation
on log, all the lcc1 to lcc7 genes were most expressed in stage II,
the immature fruiting body with a diameter of 5–10 mm (Fig. 6C),
but in stage III, the expressions of all the seven genes were signif-
icantly decreased. Along with the development of fruiting bodies,
transcripts for the lcc2 and lcc4 genes maintained a decrease trend,
but the expression of lcc1, lcc3, lcc5, lcc6 and lcc7 were dramati-
cally increased in mature fruiting body, and for lcc1 and lcc5, the
expression showed no significant difference from those in stage II.
4. Discussion
In the transcriptome of A. auricula-judae, 11 putative laccase
genes were annotated. After cloning, assembling and aligning
sequences of the putative genes, nine genes containing the whole
coding regions were isolated. Sequence alignment showed that
all the deduced amino acid sequences contained four ungapped
signature sequences L1–L4, which can be used to identify and
distinguish the laccases within the broader class of multicopper
oxidases (Kumar et al., 2003). Therefore, the nine sequences can
be confirmed to be laccase genes. On the basis of the amplifica-
tion in two parental monokaryons, two pairs of variant alleles were
identified (Fig. 2), which can be attributed to the use of the dikary-
otic strains to sequence the transcriptome and isolate genes as
described by Wahleithner et al. (1996). Thus, seven laccase genes
were obtained in total. In this study, sequencing more than three
clones for each target gene guaranteed the authenticity of the
alleles containing variant sequences. Among the 11 putative genes
from the mycelium-derived transcriptome, different parts of the
same genes were present with gaps, which can be speculated to
be caused by the insufficient sequencing depth, because a greater
coverage of transcriptome requires more sequencing depth (Wang
et al., 2009).
Although both the signature sequences L1–L4 and substrate
binding loops are identified in the deduced amino acid sequences
of the seven genes, the domains are not exactly identical to those
of other basidiomycetes (Kumar et al., 2003; Courty et al., 2009;
460 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462

Fig. 6. Relative expression ratios of laccase genes from A. auricula-judae. The bars represent the standard errors of the means (SEM) of three replicates for samples. (A)
Differentially expressed patterns of seven genes under the same culture conditions, free-living mycelium on glucose-rich medium or substrate mycelium on sawdust. The
relative quantification (RQ) of each gene was evaluated against the lcc1. (B) Differential expression patterns of the seven genes in four developmental stages. The RQ of each
gene was evaluated against lcc1. (C) The expression profiles of the seven genes in four developmental stages. The RQ of each gene was evaluated against Stage I, primordium.
**p ≤ 0.01, significant differences between lcc3 and the rest genes in each culture condition (A), between lcc5 and all the other genes in each stage (B), and between Stage II
and the other three stages for each gene (C). primordium.

Lettera et al., 2010; Giardina et al., 2010). In the signature regions,
only the copper ligands are highly conserved, but the other con-
served residues are not preserved, for example, QCPI residues in L1
region and QYC in L2 (Fig. 3A). More differences are found to exist in
the substrate binding loops (Fig. 3B). To the beset of our knowledge,
no report about the signature sequences and the putative substrate
binding loops of A. auricula-judae has been published, and thus the
laccases of A. delicata were analyzed simultaneously to ensure the
reliability of the predication. The results show that these regions
in A. delicata are very similar to those in A. auricula-judae, suggest-
ing that the laccases from A. auricula-judae, even genus Auricularia
might be unique in Agaricomycetes.
In the NJ tree, besides the A. delicata laccases (Floudas et al.,
2012), all the other laccases detected from genus Auricularia,
together with the laccases of species R. solani and C. neoformans,
are nested within the ascomycete laccases rather than the basid-
iomycetes. Within the ascomycete-basidiomycete clade, these
laccases group with various paralogous genes from ascomycetes
of C. lagenarium, N. crassa, F. oxysporum, A. niger, A. oryzae or others
(Fig. 5). It is reported that the clustering of the amino acid sequences
in the NJ tree is at least partly in accord with the function of the
respective enzymes; the presence of multiple paralogous laccase
genes within the same species stems from the demands of variable
oxidative functions (Hoegger et al., 2006). Therefore, the laccases of
genus Auricularia presumably could assume different functions in
other basidiomycetes, but similar to those in the aforementioned
ascomycetes. This functional conjecture also indicates the speci-
ficity of the Auricularia laccases under Agaricomycetes. Moreover,
based on the NJ tree, the phylogeny indicates that the laccases of A.
auricula-judae might be polyphyletic.
Ten to eighteen introns are present in the laccase genes of A.
auricula-judae Au916 (Fig. 4), and the seven genes are divided into
five groups on the basis of the intron positions, which show lower
similarity than those among the laccase family of L. bicolor (Courty
et al., 2009), C. cinerea (Hoegger et al., 2004). In the NJ trees, dif-
ferent laccases from A. auricula-judae, together with A. delicata and
A. polytricha, are clustered into different groups (Fig. 5). From the
dendrogram constructed by NJ method and intron positions, it can
 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462
be seen that the clustering of laccase genes from A. auricula-judae
is congruent with the intron positions homology, suggesting the
diversity of the seven laccases from A. auricula-judae.
It is known that the fungal laccases are associated with fruit-
ing body formation (Chen et al., 2004), sporulation (Mayer and
Staples, 2002), tissue and spore pigmentation (Clutterbuck, 1972;
Vnenchak and Schwalb, 1989). In A. auricula-judae, the seven
laccase genes are differentially expressed in different culture con-
ditions and developmental stages (Fig. 6). During the development
process on the wood-log, the highest expression level of all the
detected genes occurred in stage II following the primordium (stage
I). The primordium of A. auricula-judae Au916 is a sandy or light
tawny pinhead tissue, while the color of the immature fruiting body
in stage II is tan or brown, which is maintained till the mature stage
(Fig. 1). In Lentinula edodes, the research of laccase and pigment
production shows that a marked increase in laccase is correlated
with rapid growth of pigmentation (Leatham and Stahmann, 1981).
Hence, these seven laccase genes can be assumed to be involved in
the pigment production during the fruiting body formation of A.
auricula-judae. Comparison of the transcript levels of different lac-
case genes in the developmental stages on wood-log demonstrated
that the lcc5 gene was highly expressed in all the four stages. The
expression levels of lcc1, lcc3, lcc5, lcc6 and lcc7 recovered in stage
IV after an obvious decrease in stage III, and the expression levels
of lcc1 and lcc5 were close to the highest value in stage II. From
the expression features in the four stages, it could be postulated
that lcc1, lcc3, lcc5, lcc6 and lcc7 participate in the maturation of the
fruiting body and sporulation, and lcc5 might play a major role in
this process. To gain more information about the biological roles of
the laccase genes in the life cycle of A. auricula-judae, more studies
need to be conducted in the future, for instance, using the knock
out or overexpression of target genes to predict their detailed func-
tions. Furthermore, the drastic decline of expression in stage III also
remains to be elucidated in further work.
Besides lignin degradation, the laccases have been reported to be
widely applied in textile industry, food industry, paper pulp bleach-
ing, bioremediation and other similar sectors (Kües and Rühl, 2011;
Parenti and Muguerza, 2013). In the mycelia tested, the seven genes
varied in their expression levels, with lcc3 exhibiting an expression
level of more than 400-fold that of any others, both in the free-
living mycelium and substrate mycelium (Fig. 6A), suggesting the
potential industrial significance of lcc3 in enzyme production by
submerged fermentation (SmF) or solid-state fermentation (SSF)
with different culture media.
Since the transcriptome is a set of real transcripts from a target
sample, the transcripts are all functional (Wang et al., 2009); conse-
quently, this research indicates that it is a fast and reliable method
to obtain family genes based on the high quality transcriptome.
Acknowledgments
This work is supported by the Industry (Agriculture), Science
and Technology Plans of China (Grant No. nyhyzx07-008) and
the key program from the Natural Science Foundation of Hubei
Province.
References
Billette C, Gibard T, Foulongne-Oriol M, Savoie JM. Origin of laccase gene structural
diversity in edible mushrooms. In: ICMBMP7-Physiology and Development;
2011. p. 212–23.
Castanera R, Pérez G, Omarini A, Alfaro M, Pisabarro AG, Faraco V, et al. Trans-
criptional and enzymatic profiling of Pleurotus ostreatus laccase genes in
submerged and solid-state fermentation cultures. Appl Environ Microbiol
2012;78(11):4037–45.
Chen S, Ge W, Buswell JA. Molecular cloning of a new laccase from the edible straw
mushroom Volvariella volvacea: possible involvement in fruit body develop-
ment. FEMS Microbiol Lett 2004;30:171–6.
461
Clutterbuck AJ. Absence of laccase from yellow spored mutants of Aspergillus nidu-
lans. J Gen Microbiol 1972;70:423–35.
Courty PE, Hoegger PJ, Kilaru S, Kohler A, Buée M, GarbayeJ. Martin F, et al. Phyloge-
netic analysis, genomic organization, and expression analysis of multi-copper
oxidases in the ectomycorrhizal basidiomycete Laccaria bicolor. New Phytol
2009;182:736–50.
Eggert C, La Fayette PR, Temp U, Eriksson KEL, Dean JFD. Molecular analysis of a
laccase gene from the white rot fungus Pycnoporus cinnabarinus. Appl Environ
Microbiol 1998;64:1766–72.
Fedorov A, Merican AF, Gilbert W. Large-scale comparison of intron positions among
animal, plant, and fungal genes. PNAS 2002;99(25):16128–33.
Ferraroni M, Myasoedova NM, Schmatchenko V, Leontievsky AA, Golovleva LA, Scoz-
zafava A, et al. Crystal structure of a blue laccase from Lentinus tigrinus: evidences
for intermediates in the molecular oxygen reductive splitting by multicopper
oxidases. BMC Struct Biol 2007;7:60.
Floudas D, Binder M, Riley R, Barry K, Blanchette RA, Henrissat B, et al. The paleo-
zoic origin of enzymatic lignin decomposition reconstructed from 31 fungal
genomes. Science 2012;336:1715–9.
Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G. Laccases: a never-
ending story. Cell Mol Life Sci 2010;67:369–85.
Hoegger PJ, Navarro-González M, Kilaru S, Hoffmann M, Westbrook ED, Kües U.
The laccase gene family in Coprinopsis cinerea (Coprinus cinereus). Curr Genet
2004;45:9–18.
Hoegger PJ, Kilaru S, James TY, Thacker JR, Kües U. Phylogenetic comparison and
classification of laccase and related multicopper oxidase protein sequences. FEBS
J 2006;273:2308–26.
Horgen PA, Kokurewicz KF, Anderson JB. The germination of basidiospores from-
commercial and wild collected isolates of Agaricus bisporus (=A. brunnescens).
Can J Microbiol 1989;35:492–8.
Kilaru S, Hoegger PJ, Kües U. The laccase multi-gene family in Coprinopsis cinerea
has seventeen different members that divide into two distinct subfamilies. Curr
Genet 2006;50:45–60.
Kirk, et al. , Kirk PM, Cannon PF, Minter DW, Stalpers JA. Dictionary of the fungi. 10th
ed. Wallingford, UK: CABI; 2008. p. p68.
Kües U, Liu Y. Fruiting body production in basidiomycetes. Appl Microbiol Biotechnol
2000;54:141–52.
Kües U, Rühl M. Mutliple multi-copper oxidase gene families in
basidiomycetes—what for. Curr Genomics 2011;12:72–94.
Kumar SVS, Phale PS, Durani S, Wangikar PP. Combined sequence and structure
analysis of the fungal laccase family. Biotechnol Bioeng 2003;83:386–94.
Langfelder K, Streibel M, Jahn B, Haase G, Brakhage AA. Biosynthesis of fungal
melanins and their importance for human pathogenic fungi. Fungal Genet Biol
2003;38:143–58.
Larrondo LF, Salas L, Melo F, Vicuna R, Cullen D. A novel extracellular multicop-
per oxidase from Phanerochaete chrysosporium with ferroxidase activity. Appl
Environ Microbiol 2003;69:6257–63.
Leatham GF, Stahmann MA. Studies on the laccase of Lentinus edodes: specificity,
localization and association with the development of fruiting bodies. J Gen
Microbiol 1981;125:147–57.
Lettera V, Piscitelli A, Leo G, Birolo L, Pezzella C, Sannia G. Identification of a new
member of Pleurotus ostreatus laccase family from mature fruiting body. Fungal
Biol 2010;114:724–30.
Mayer AM, Staples RC. Laccase: new functions for an old enzyme. Phytochemistry
2002;60:551–65.
Messerschmidt A, Huber R. The blue oxidases, ascorbate oxidase, laccase
and ceruloplasmin. Modelling and structural relationships. Eur J Biochem
1990;187:341–52.
Nagai M, Kawata M, Watanabe H, Ogawa M, Saito K, Takesawa T, et al. Important role
of fungal intracellular laccase for melanin synthesis: purification and characteri-
zation of an intracellular laccase from Lentinula edodes fruit bodies. Microbiology
2003;149:2455–62.
Nicholas KB, Nicholas HB. Genedoc: a tool for editing and annotating multiple
sequence alignments; 1997, http://www.psc.edu/biomed/genedoc
Ohga S, Smith M, Thurston CF, Wood DA. Transcriptional regulation of laccase and
cellulase genes in the mycelium of Agaricus bisporus during fruit body develop-
ment on a solid substrate. Mycol Res 1999;103:1557–60.
Ohga S, Royse DJ. Transcriptional regulation of laccase and cellulose genes dur-
ing growth and fruiting of Lentinula edodes on supplemented sawdust. FEMS
Microbiol Lett 2001;201:111–5.
Parenti A, Muguerza E, Redin Iroz A, Omarini A, Conde E, Alfaro M, et al. Induction of
laccase activity in the white rot fungus Pleurotus ostreatus using water polluted
with wheat straw extracts. Bioresour Technol 2013;133:142–9.
Pezzella C, Lettera V, Piscitelli A, Giardina P, Sannia G. Transcriptional analysis of
Pleurotus ostreatus laccase genes. Appl Microbiol Biotechnol 2013;97:705–17.
Perry CR, Smith M, Britnell CH, Wood DA, Thurston CF. Identification of two lac-
case genes in the cultivated mushroom Agaricus bisporus. J Gen Microbiol
1993;139:1209–18.
Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal
peptides from transmembrane regions. Nat Methods 2011;8:785–6.
Pfaffl MW. A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res 2001;29(9):2002–7.
Ryu SH, Lee AY, Kim M. Molecular characteristics of two laccase from the basid-
iomycete fungus Polyporus brumalis. J Microbiol 2008;46(1):62–9.
Saito T, Hong P, Kato K, Okazaki M, Inagaki H, Maeda S, et al. Purification and charac-
terization of an extracellular laccase of a fungus (family Chaetomiaceae) isolated
from soil. Enzyme Microb Technol 2003;33:520–6.
462 XZ. Fan et al. / Microbiological Research 169 (2014) 453–462
Sambrook J, Russell DW. Rapid isolation of yeast DNA. In: Sambrook J, Russell DW,
editors. Molecular cloning, a laboratory manual. New York: Cold Spring Harbor
Laboratory Press; 2001. p. 631–2.
Soden DM, Dobson ADW. Differential regulation of laccase gene expression in Pleu-
rotus sajor-caju. Microbiology 2001;147:1755–63.
Tamayo Ramos JA, Barends S, Verhaert RMD, de Graaff LH. The Aspergillus niger mul-
ticopper oxidase family: analysis and overexpression of laccase-like encoding
genes. Microb Cell Fact 2011;10:78.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evo-
lutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol Biol Evol 2011;28:2731–9.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX win-
dows interface: flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic Acids Res 1997;25:4876–82.
Thurston CF. The structure and function of fungal laccases. Microbiology
1994;140:19–26.
Vnenchak P, Schwalb MN. Phenol oxidase activity during development of Coprinus
cinereus. Mycol Res 1989;93:546–8.
Wahleithner JA, Xu F, Brown KM, Brown SH, Golightly EJ, Halkier T,
et al. The identification and characterization of four laccases from
the plant pathogenic fungus Rhizoctonia solani. Curr Genet 1996;29:
395–403.
Wang Z, Gerstein M, Snyder M. RNA-Seq: a revolutionary tool for transcriptomics.
Nat Rev Genet 2009;10:57–63.
Yaver DS, Golightly EJ. Cloning and characterization of three laccase genes from the
white-rot basidiomycete Trametes villosa: genomic organization of the laccase
gene family. Gene 1996;181:95–102.
Yaver DS, Xu F, Golightly EJ, Brown KM, Brown SH, Rey MW, et al. Purifica-
tion, characterization, molecular cloning, and expression of two laccase genes
from the white rot basidiomycete Trametes villosa. Appl Environ Microbiol
1996;62:834–41.
Yoshida H. Chemistry of lacquer (Urushi) part 1. J Chem Soc 1883;43:472–86.