Food Chemistry 295 (2019) 395–402

Contents lists available at ScienceDirect

Food Chemistry
journal homepage: www.elsevier.com/locate/foodchem

A rapid and reliable multiplex PCR assay for simultaneous detection of T

fourteen animal species in two tubes
Jinchun Lia,b, Jiapeng Lia,b, , Suigen Xua,b, Suyue Xionga,b, Junna Yanga,b, Xi Chena,b,
⁎

Shouwei Wanga,b, Xiaoling Qiaoa,b, Tong Zhoua,b

a
China Meat Research Center, 100068 Beijing, China
b
Beijing Key Laboratory of Meat Processing Technology, 100068 Beijing, China

ARTICLE INFO ABSTRACT

Keywords: A simple and rapid method for animal species identification to prevent food adulteration based on mitochondrial
Meat adulteration DNA using two independent multiplex polymerase chain reactions (PCRs) and microchip electrophoresis was
Mitochondrial DNA developed. This method was designed to identify fourteen domestic animals (Group I: cattle, donkey, dog, fox,
Degenerate primer raccoon-dog, deer and horse; Group II: pig, sheep, goat, chicken, duck, cat and mouse) simultaneously using ten
Multiplex PCR
pairs of primers and three of which were degenerate primers. Sequences for species-specific primers were
Microchip electrophoresis
generated based on mitochondrial genes, including 12S rRNA, 16S rRNA, ND2 and CO I. This method was
Species identification
validated in terms of the specificity, sensitivity and practicability, and the developed multiplex PCR method was
able to correctly identify animal species of raw meats and processed meat products. The detection limits of two
multiplex PCRs were 0.02 ng DNA for animal species in Group I and 0.2 ng DNA for Group II, respectively.

1. Introduction
Meat adulteration has been a quality issue in entire meat supply
chain, including processing, circulation and catering in recent years.
Due to the temptation of economic benefit caused by price variance
among different meats (Economically Motivated Adulteration, EMA),
illegal meat producers may try to substitute beef, mutton and other
high-priced meats with pork, duck, chicken and other low-priced meats,
and even inedible meats (e.g. mouse meat and fox meat). The incidents
of meat adulteration in raw meats and meat products frequently hap-
pened globally, such as “duck counterfeited mutton”, “horsemeat
counterfeited donkey meat”, “horse meat adulteration scandal”, and so
on (Burns, Wiseman, & Knight, 2016; Fajardo, González, & Rojas,
2010). Meat adulteration, like other food fraud, plays a harmful role in
directly threatening consumers’ health, weakening processing en-
terprises’ reputation and destroying trade order and fair competition;
furthermore, it can also lead to religious issues in Islamic countries
(Amqizal, Kahtani, & Ismail, 2017; Shabani, Mehdizadeh, & Mousavi,
2015). In view of serious meat adulteration situation, a rapid and re-
liable detection method is urgently needed. In quick inspection field of
food safety, rapidness and reliability are the two most important in-
dicators. The more reliable and rapider the detection method is, the
easier the method is applied to actual tests. The rapidness of detection
method is mainly reflected in the shorter testing time, less testing steps
and more simple analysis of results. The reliability of detection method
is mainly reflected in the lower detection limit, higher stability and
more accurate verification of actual samples.
Animal species identification methods are usually developed based
on the variation analysis of structure, sequence, composition and
spectral characteristic among protein or DNA separately. Numerous
methods at different levels have been applied for meat adulteration
detection, such as genomics (Amaral, Santos, & Melo, 2014;
Karabasanavar, Singh, & Kumar, 2014), proteomics (Giuseppe,
Giarretta, & Lippert, 2015; Gobert, Sayd, & Gatellier, 2014), im-
munology (Mandli, Fatimi, & Seddaoui, 2018; Perestam, Fujisaki, &
Nava, 2017), spectroscopy (Kumar & Karne, 2017; Pieszczek, Czarnik-
Matusewicz, & Daszykowski, 2018), and so on. Nowadays, although
many methods based on peptide fragments were developed using mass
spectrometry technology with good results (Flaudrops, Armstrong, &
Raoult, 2015; Li, Zhang, & Li, 2018; Sarah, Faradalila, & Salwani,
2016), the use of expensive and precise instruments, such as Liquid
Chromatography/Ion Trap Mass Spectrometry (HPLC/ITMS) and Liquid
Chromatography/Time of Flight-Mass Spectrometry (HPLC/TOF-MS)
generated significant limitations on application. At present, the method
based on DNA molecular is still the research focus which is also the
appointed standard detection method in many countries for its lower

⁎
Corresponding author at: China Meat Research Center, 100068 Beijing, China.
E-mail address: ljp7915@126.com (J. Li).

https://doi.org/10.1016/j.foodchem.2019.05.112
Received 22 November 2018; Received in revised form 30 April 2019; Accepted 15 May 2019
Available online 16 May 2019
0308-8146/ © 2019 Elsevier Ltd. All rights reserved.
J. Li, et al.
cost, higher efficiency and user-friendly control (Lo & Shaw, 2018).
DNA is a macromolecule that contains all genetic information of an
organism which makes it an excellent target for species analysis, and
the polymerase chain reaction (PCR) approach is always dominant
detection means based on DNA with several sub classes including PCR-
RFLP (Mahajan, Gadekar, & Dighe, 2011; Sivaraman, Jeyasekaran, &
Shakila, 2018), PCR-RAPD (Fraga, Rodriguez, & Fuentes, 2005;
Spychaj, Mozdziak, & Pospiech, 2009), PCR-SSCP (Schiefenhovel &
Rehbein, 2013; Tisza, Csikós, & Simon, 2016), PCR-Sequencing (Ribani,
Schiavo, & Utzeri, 2018), and so on. Compared with protein, DNA has
higher thermal stability in addition to the advantages of high con-
servative and inter-species specificity, which is used for not only fresh
meats but hot processed meat products (Karabasanavar, Singh, &
Umapathi, 2011).
Compared with simplex PCR, multiplex PCR has gradually become
the hotspot because of its advantages such as higher detection effi-
ciency, low cost and time saving in a single reaction hole. Safdar pre-
sented a quadruplex PCR to identify bovine, ovine, caprine and fish
species in feedstuffs simultaneously with detection limit of 0.01% DNA
for each species in 2015 (Safdar & Junejo, 2015). Then, in 2016 he
presented a sextuple-conventional PCR to identify the origins of five
meat and one plant species in foodstuffs (Safdar & Junejo, 2016). Hou
described a triplex PCR to simultaneously detect chicken, duck and
goose DNA in meat products with detection limit of 0.05 ng DNA (Hou,
Meng, & Zhang, 2015). In terms of conventional PCR, agarose gel
electrophoresis is the most commonly used to detect amplicons in spite
of its complicated processes. Nowadays, microchip electrophoresis is a
newer, faster and less-cost detecting method, which is applied to sci-
entific research increasingly (Ali, Ahamad, & Asing, 2018; Ali, Razzak,
& Hamid, 2015; Hossain, Ali, & Hamid, 2017; Li, Hong, & Kim, 2015).
Although, many multiplex PCR assays have been reported for the
identification of various animal species, none of them has been aimed at
identifying more than ten common animal species simultaneously and
using degenerate primers. There are still lack of accurate, low-cost and
high-throughput detection methods, especially for enterprises and su-
pervision departments.
In this paper, we described a simple and rapid method for fourteen
animal species identification simultaneously based on mitochondrial
DNA, using two independent multiplex PCRs and chip electrophoresis.
Each multiplex PCR contains degenerate primers which can detect 7
animal species (Group I: cattle, donkey, dog, fox, raccoon-dog, deer and
horse; Group II: pig, sheep, goat, chicken, duck, cat and mouse). The
choice of species was fully considered of actual adulteration case with a
higher practicability and the use of degenerate primers could increase
the detection number of species without increasing reaction multi-
plicity. The aim of this paper was to provide reliable adulteration de-
tection means and law enforcement basis for the food regulators, meat
product processing enterprises, supermarkets and individuals, and it
was also of great significance to protect interests of consumers and
companies.
2. Materials and methods
2.1. Samples collection
All the authentic fresh meat samples were obtained in different
ways. Chicken, duck and aristichthys nobilis were purchased from local
market; pork, beef, sheep meat and goat meat were obtained from
butcheries; horsemeat, fox meat, racoon dog meat and mink meat were
obtained from farms; donkey meat and venison were purchased from
food processing enterprises; rat meat was obtained from food safety
monitoring center; cat meat and dog meat were obtained from pet
hospital; and commercial meat products were bought from local
market, restaurant and import supermarket. All meat products were
transported under ice-chilled condition (4 °C) and stored frozen at
−20 °C until use to extract DNA.
396
Food Chemistry 295 (2019) 395–402
2.2. DNA extraction
In order to obtain better extraction efficiency, the samples should be
homogenized, especially for the processed meat products. It was also
necessary that processed meat products especially for containing a mass
of salts and spices should be washed by ultrapure water to reduce the
impact on efficiency of DNA extraction. The samples and sterile water
were accurately weighed together with the proportion of 1/4 (m/m)
and homogenized with the speed of 13,500 rpm for 10 min, and then
100 μL homogenate was absorbed for DNA extraction. DNA was ex-
tracted with a DNeasy® Blood and Tissue Kit (Qiagen, Hilden, Germany)
as per its manual. DNA concentration was measured with a spectro-
photometer (NanoDrop™ One, Thermo Fisher Scientific, USA).
2.3. Primer design
Primers were newly designed based on characteristic of poly-
morphism and homogeneity existing simultaneously in mitochondria
DNA using the Oligo Primer Analysis Software (Oligo7.0, DBA Oligo,
Inc., USA). The mitochondria gene sequences were obtained from the
National Center for Biotechnology Information (http://www.ncbi.nlm.
nih.gov). The nucleotide sequences were submitted to BLAST using
MEGA 5.10 software (Tamura K., USA). Three pairs of degenerate pri-
mers named CMRC-Ovis, CMRC-Canidae and CMRC-Poultry were de-
signed based on the characteristic of subspecies (sheep, goat), or similar
genera (dog, fox, raccoon-dog; chicken, duck), and the rest of seven
pairs of specific primers were designed based on the conserved region
of mitochondria DNA from single species. Primers were listed in
Table 1, and all primers used in this study were synthesized by the
Invitrogen Company (Thermo Fisher Scientific Inc., USA). For PCR re-
action, 5 μM of each primer was used.
2.4. Simplex PCR
Primers specificity was verified among 16 species (pig, cattle, sheep,
goat, chicken, duck, dog, fox, raccoon-dog, deer, aristichthys nobilis,
donkey, mink, cat, mouse and horse) using simplex PCR, which was
accomplished in a 25 μL total volume containing 12.5 μL premix (0.6 U/
12.5 μL DNA polymerase, 0.4 mM each of dNTP, 2 mM MgCl2, TAKARA
Bio Inc., Japan), 1.5 μL primer (5 μM) and 2 μL (5 ng/μL) of total DNA.
Amplification was performed in a 96 well thermal cycler (Bio-Rad
Laboratories, Inc., USA) with the following conditions, after an initial
heat denaturation step at 95 °C for 3 min, 30 cycles were programmed
as follows, 95 °C for 10 s, 60 °C for 25 s, with annealing and extension
steps merging one step. PCR amplified products were analyzed by mi-
crochip electrophoresis (Shimadzu Corporation, Japan).
2.5. Multiplex PCR
For simultaneous detecting fourteen species, two multiplex PCR
assays were performed in a final volume of 25 μL (Group I: premix
12.5 μL, five pairs of primers (5 μM) 0.4–1.0 μL, template (5 ng/μL)
2 μL; Group II: premix 12.5 μL, five pairs of primers (5 μM) 0.2–1.0 μL,
template (5 ng/μL, 2 μL) with each component listed in Table S1 using
the same premix, cycling programs and detection method in simplex
PCR. Considering adulteration situations and practical application at
present, high-price meats were easily to be adulterated with cheap or
inedible ones, and adulterated components were usually more than one
species. So kinds of different template combinations were investigated
for each group, and all these combinations were isometric mixing of
different species templates. We carried out the research in ten duplex
templates for cattle and horse (fox); donkey and horse (fox); deer and
horse (fox); sheep and pig (duck/chicken/mouse); four triplex tem-
plates for cattle (donkey/deer), horse, fox; and sheep, pig, duck; one
quadruple template was carried out for sheep, pig, duck and mouse; and
two quintuple templates for Group I (cattle, donkey, fox, deer and
J. Li, et al. Food Chemistry 295 (2019) 395–402

Table 1
Oligonucleotide primers used in this study.
Group Primers Species Mitochondrial Genes Oligonucleotides primers (5′-3′) Amplicon (bp)

I CMRC-Cattle Bos taurus CO I GTTCTTCACGACACATACTACGTT 68

GCAAATACAGCTCCTATTGATAAA
CMRC-Donkey Equus asinus ND2 ATTCTCCCCACCCTAATGGCT 125
ACTAACCTATTCCACCTCCCTAACT
CMRC-Canidae Canis lupus familiaris, Vulpes vulpes, Nyctereutes procyonoides 16S rRNA AAGGGAATGATGAAAGACAT 161
GAGTTGATCCTTTTAGATTGTT
CMRC-Deer Cervus nippon hortulorum 12S rRNA GCTCACGACACCTTGCACAG 175
GCTTTAACACACTTTACGCCGTATG
CMRC-Horse Equus caballus 16S rRNA CAACCCAAACTAACTCCT 207
ATAGATGCATGCCTGTGTT

II CMRC-Cat Felis catus CO I TCATGTTAATAGTTTTCATAGTG 74

TGTGGTTAGTTCTACTATGGC
CMRC-Pig Sus scrofa domesticus CO I TACTTCTACTATCCCTGCCAGTTC 115
TGATAAAGGATAGGGTCTCCACCA
CMRC-Mouse Mus musculus 16S rRNA GACATCCCAATGGTGTAGAAGCTATT 132
GTCCTTTCGTACTGGGAGAAATCGTA
CMRC-Ovis Ovis aries, Capra hircus 12S rRNA AAAATAAATGACGAAAGTAACCCTAC 164
GCCAAGTCCTTTGAGTTTCGG
CMRC-Poultry Gallus gallus, Anas platyrhynchos 12S rRNA GAGAACTACGAGCACAAACGCTT 218
CCCATAGGCTATACCTTGACCTGT

horse) and Group II (cat, pig, mouse, sheep and duck). Table 2
Commercial products collected for verifying the method in this paper.

2.6. Specificity and detection limit Sample Labelled Product type Marker type
number species

In order to examine two multiplex PCRs specificity, 16 kinds of DNA 1 sheep mutton kebab local super market
templates from 15 animals and 1 fish were added into two multiplex 2 sheep mutton kebab
PCR systems for cross amplification. To test detection limit, serial 10- 3 sheep mutton kebab

fold dilutions (2 ng, 0.2 ng, 0.02 ng, 0.002 ng) of target premixed DNA 4 sheep mutton kebab local restaurant
templates of two groups were added into the respective reactions. 5 sheep mutton kebab
6 sheep mutton kebab

7 donkey spiced donkey meat local super market

2.7. Commercial samples 8 donkey spiced donkey meat
9 donkey spiced donkey meat
Fourteen local commercial meat products (6 kinds of kebabs, 6 10 cattle spiced beef
11 cattle spiced beef
kinds of cooked meat products, and 2 kinds of leisure meat products) 12 cattle spiced beef
were purchased from local supermarkets, restaurants and retail markets
13 cattle leisure meat food (beef local retail market
in Beijing City, PR China to verify this method. In addition, five western
jerky)
commercial meat products (2 kinds of ham, 2 kinds of sausage, and 1 14 cattle leisure meat food (beef
kind of bacon) were purchased from import supermarket in Beijing granules)
City, PR China. The details of samples were listed in Table 2. 15 pig dried ham import supermarket
16 pig American style sliced
ham
3. Results 17 pig dry sausage, pepperoni
18 cattle & pig dry sausage, salami
3.1. DNA extraction 19 pig bacon

The purity of the DNA carried out by detecting optical density (OD)
readings at 280 nm and 260 nm was important for PCR amplification.
The OD260:OD280 ratios of extracted DNA were between 1.7 and 2.0
which indicated a high quality of DNA. The results also showed that the
extracted DNA was suitable for PCR amplification.
3.2. Simplex PCR and primer specificity
All ten pairs of primers’ specificity were verified among 16 species
using simplex PCRs. Seven pairs of primers (CMRC-Cattle, CMRC-
Donkey, CMRC-Deer, CMRC-Horse, CMRC-Cat, CMRC-Pig, and CMRC-
Mouse) were able to amplify DNA fragments for only one target species
respectively, and the rest three pairs of degenerated primers (CMRC-
Ovis, CMRC-Canidae and CMRC-Poultry) corresponded to two or three
similar species with the same length of DNA fragments, respectively.
Each set of primers was tested in simplex PCR, and there were no cross
amplification (data not shown).
3.3. Multiplex PCR amplification
In an elementary phase of this paper, multiplex PCR were carried
out by using DNA extracted from raw meats. Then multiplex PCR
products in two groups amplified from different kinds of template
combinations were run on chip electrophoresis to visualize the pre-
dicted size, as shown in Fig. 1a and c. Among which specific primers of
Group I amplified 79 bp, 134 bp, 164 bp, 183 bp and 208 bp fragments
from cattle, donkey, fox (dog or raccoon-dog), deer and horse, respec-
tively, as shown in Fig. 1b and primers of Group II amplified 84 bp,
120 bp, 138 bp, 171 bp and 222 bp fragments from pig, sheep (or goat),
chicken (or duck), cat and mouse, respectively, as shown in Fig. 1d. The
fragments from both of the two groups were longer than their theore-
tical length because of the deviation brought by microchip electro-
phoresis apparatus.

397
J. Li, et al. Food Chemistry 295 (2019) 395–402

Fig. 1. The gel image (a, c) and electropherograms (b, d) of two multiplex PCRs products amplified from different kinds of template combinations. In the gel image
(a), lane 1 represents DNA ladder; lanes 2–11 PCR products from duplex PCR of cattle and horse (lane 2), cattle and fox (lane 3), donkey and horse (lane 4), donkey
and fox (lane 5), deer and horse (lane 6), deer and fox (lane 7); triplex PCR of cattle and horse and fox (lane 8), donkey and horse and fox (lane 9), deer and horse and
fox (lane 10); quintuple PCR of cattle and donkey and fox and deer and horse (lane 11); lane 12 represents negative template control. The corresponding elec-
tropherograms of lane 11 is represented with image (b). In the gel image (c), lane 1 represents DNA ladder; lanes 2–8 PCR products from duplex PCR of sheep and
chicken (lane 2), sheep and duck (lane 3), sheep and pig (lane 4), sheep and mouse (lane 5); triplex PCR of sheep and pig and duck (lane 6); quadruplex PCR of sheep
and pig and duck and mouse (lane 7); quintuple PCR of cat and pig and mouse and sheep and duck (lane 8); lane 9 represents negative template control. The
corresponding electropherograms of lane 8 is represented with image (d).

3.4. Multiplex PCR specificity
The two multiplex PCRs specificity were also tested with the DNA of
the sixteen species described above. The multiplex PCR specificity of
Group I was analyzed on microchip electrophoresis as shown in Fig. 2a,
and the result showed that a single band of targeted PCR product from
cattle, donkey, dog, fox, raccoon-dog, deer and horse meat species,
respectively (lane 2–8), without producing any fragments of non-spe-
cific amplification, indicating high species specificity of multiplex PCR.
Similar to the Group I, the specificity of Group II was shown in Fig. 2b
showing that a single band of targeted PCR products from pig, sheep,
goat, chicken, duck, cat and mouse meat species, respectively (lane
2–8).
3.5. Detection limit
To determine the detection limit of the multiplex PCR, we tested the
performance of the multiplex PCR method under serial 10-fold dilutions
of target premixed DNA templates (2 ng, 0.2 ng, 0.02 ng, 0.002 ng) of
two groups. The result showed that amplicons of Group I were detect-
able at template amounts as low as 0.02 ng DNA (Fig. 3a and b), and the
electropherograms clearly represented five peaks corresponding to the
five different bands displayed in the gel image. The detection limit of
Group II was 0.2 ng DNA (Fig. 3c and d).
3.6. Assessment of commercially meat products
The applicability of the assay to nineteen commercial products (6
kinds of kebabs, 6 kinds of cooked meat products, 2 kinds of leisure
meat products, and 5 western commercial meat products) had been
demonstrated. Results indicated that one of 6 mutton kebabs was
adulterated with duck and pig meats simultaneously which collected
from restaurant. One spiced donkey meat product purchased from local
supermarket and a leisure meat food (beef granules) purchased from
retail market were both determined as containing horse ingredient. The
rest of sixteen meat products were determined as containing the target
species marked on ingredient list only.
4. Discussions
In this paper, we developed a simple and rapid method for animal
species identification to prevent food adulteration that based on mi-
tochondrial DNA using two independent multiplex PCRs and microchip
electrophoresis. Multiple PCR technology can simultaneously amplify
several templates in a single reaction tube, which is developed for the
first time to study the absence of mutations associating with Duchenne
muscular dystrophy (Chamberlain, Gibbs, & Ranierl, 1988). This
method not only retains the advantages of strong specificity and high
sensitivity of the simplex PCR, but benefits to simplify the operation
steps, shorten the test cycles, and reduce the personnel and material
cost.
Although animal species identification method based on peptide
fragments developed quickly these years, peptide preparations in-
cluding sample heat treatment, protein extraction and trypsin digestion
were still time-consuming steps, and the protein was usually digested
overnight with trypsin (Li et al., 2018). Compared with proteomics
method, the time of DNA template preparations including sample
homogenization and DNA extraction in this method was controlled
within 4 h which was far less than 12 h. The method based on spectrum
had its application limitations. This kind of method was mainly applied

398
J. Li, et al. Food Chemistry 295 (2019) 395–402

Fig. 2. Specificity analysis of two multiplex PCRs.

In the gel image (a), lane 1 represents DNA ladder;
lanes 2–16 represents PCR products from cattle,
donkey, dog, fox, raccoon-dog, deer, horse, pig,
sheep, goat, chicken, duck, cat, mouse, aristichthys
nobilis and mink of Group I; lane 17 represents
negative template control. In the gel image (b), lane
1 represents DNA ladder; lanes 2–16 represents
PCR products from cat, pig, mouse, sheep, goat,
chicken, duck, cattle, dog, fox, raccoon-dog, deer,
aristichthys nobilis, donkey, mink and horse of
Group II; lane 17 represents negative template
control.

to fresh meat (Pieszczek et al., 2018). It would result in inaccurate was widely used among different kinds of samples such as raw meat,
results caused by changes of meat color and structure when we detected processed meat products and mixed meat products, which indicated
processed meat products However, the method based on DNA molecule more reliable during meat adulteration detection than spectrum

Fig. 3. Detection limit of two multiplex PCRs. In the gel image (b), lane 1 is DNA ladder, lane 2–5 are the PCR products of 2, 0.2, 0.02 and 0.002 ng of premixed DNA
templates of Group I; The electropherograms of Group I is presented with (a). And in the gel image (c), lane 1 is DNA ladder, lane 2–5 are the PCR products of 2, 0.2,
0.02 and 0.002 ng of target premixed DNA templates of Group II; The electropherograms of Group II is presented with (d).

399
J. Li, et al.
method.
Fourteen species in this paper were divided into two groups de-
pending on the actual adulteration situation. We assigned cattle,
donkey and horse into Group I, because horse meat was frequently
adulterated into beef or donkey meat in European countries or some
Chinese cities. Group II was also classified according to this strategy,
since pork and poultry were easily pretended to be mutton, and it was
difficult to distinguish only by tasting for consumers. Therefore we
assigned pig, chicken and duck into Group II. Besides, some inedible
meat with healthy risk such as mouse meat and other kinds of meat
from species mainly for fur such as fox and racoon dog were also in-
cluded in two groups. Considering adulteration situations and practical
application at present, a great deal of actual adulteration cases had
been simulated by mixing DNA template of different species. And the
result showed that the target species could be accurately detected by
this method indicating good reliability in actual application. A two-tube
multiplex PCR assay for simultaneous detection of ten meat species was
reported lately (Prusakova, Glukhova, & Afanas'eva, 2018). We find
that both the two methods used a two-tube multiplex PCR assay to
achieve simultaneous identification of multiple species. In contrast to
this method, our strategy contained more species by using degenerated
primers and was more efficient by using microchip electrophoresis,
which was much more suitable for adulteration detection in actual
adulteration event. Although 14 species can be detected in two tubes
conveniently and efficiently, it was not good enough in actual detec-
tion. Two PCR assays should be taken together when suspect species
were located in two groups. Therefore, we are developing a septuple
PCR in a single tube which can distinguish more than 10 species si-
multaneously.
Ten pairs of species-specific primers in this paper were designed to
amplify ten short fragments varying from 68 bp to 218 bp, which basing
on four mitochondrial genes including 12S rRNA, 16S rRNA, ND2 and
CO I. Since the genome of processed meat products especially suffering
fry, barbecue or mechanical damage was easy to be fractured (Ali,
Hashim, & Mustafa, 2012; Lin & Hwang, 2008), short fragments were
chosen to improve the probability of detection. Short fragments of not
more than 220 bp were chosen in this article indicating a less PCR
amplification time. Annealing and extension steps of PCR were merged
into one single step with a total time of 30 s, while only one extension
step needed 30 s in most PCR assays (Amaral et al., 2014;
Karabasanavar et al., 2014). In addition, cycle numbers were decreased
from 35 to 30, and the final extension step was removed, the amplifi-
cation time was further reduced. Along with more primers and multi-
plicity of PCR in a tube, competitions among primer, template, poly-
merase and other materials became more complex, which resulted in
lower efficiency and even the failure of reaction directly. In view of this,
three pairs of degenerate primers were designed upon the similarity of
species (Ovis represents sheep and goat; Canidae represents dog, fox
and raccoon-dog; Poultry represents chicken and duck), which in-
creased the detection flux, raised the efficiency and reduced the cost
without increasing the number of reactions.
Primers specificity is the core indicator for the species identification
method. Thus, the primer design and verification are very significant
steps in multiplex PCR development. In order to ensure the specificity
of the primers, inter-species polymorphism regions in mitochondrial
genes alignment must be selected, especially for 3′ end of primers. As
for the degenerate primer, it must not only satisfy the primer design
principle above, but ensure that the target sequences are conservative
in intra species. For example, the primer “CMRC-Canidae” can amplify
dog, fox and raccoon-dog separately, but cannot amplify other species.
This is why the degenerate primers are difficult to design and rare to
report. In our work, all ten pairs of primers’ specificity was verified
using simplex PCR, and results showed that there was no cross con-
tamination among 16 species for each primer. The specificity of two
quintuple PCRs was also tested with the DNA of the sixteen species
described above in the complicated PCR system, and the result
400
Food Chemistry 295 (2019) 395–402
indicated high species specificity of the primers towards the target
species (Fig. 2).
The length of amplification products are between 68 bp and 218 bp
in this paper and the difference between some species was only about
10–20 bp, which was difficult to distinguish by agarose gel electro-
phoresis considering its resolution ratio of 40–50 bp (Bottero &
Dalmasso, 2011). Compared with agarose gel electrophoresis, micro-
chip electrophoresis system used in this paper could distinguish as low
as 5% difference of two sequences, indicating more reliable and a better
application prospect (Ali et al., 2015). Since the length difference of
amplicon between pig and mouse was 17 bp, and between fox and deer
was only 14 bp, we used Shimadzu microchip electrophoresis system to
analyze PCR products which automatically provided banding patterns
(Fig. 1a) along with the electropherograms (Fig. 1c) for all of the five
targets amplified in this multiplex system. PCR products were analyzed
by agarose gel electrophoresis system in conventional test method in-
cluding agarose gel preparation, electrophoretic analysis and gel ima-
ging which cost more than 2 h. Compared with conventional method,
electrophoresis and data analysis of PCR products were carried out si-
multaneously using microchip electrophoresis system which cost not
more than half an hour.
The detection limit of the multiplex PCR was tested using serial 10-
fold dilutions of target premixed DNA, and the result showed that
amplicons of Group I were detectable when template amounts was as
low as 0.02 ng DNA (Fig. 3a), and the detection limit of Group II was
0.2 ng DNA (Fig. 3d). Literatures reported the distribution of detection
limits within the scope of 0.001–0.1 ng, as shown in Table 3 (Hanapi
et al., 2015; Song, Hwang, & Kim, 2017; Sultana, Hossain, & Zaidul,
2018), and the detection limit in this paper was at the same level which
could satisfy the needs of the daily detection work. At the beginning of
the study, the detection limit of the multiplex PCR was tested using
serial 10-fold dilutions of target premixed DNA with equal proportion
of each species. However, the proportion of each species in mixed meat
was different in actual adulteration. Therefore, template that contains
different proportion of DNA should be validated in the future.
Along with the development of detection techniques, the detection
number of meat species has already shown an increasing trend in recent
years. Parts of published multiplex PCR assays for meat species iden-
tification using gel or chip electrophoresis last decade were listed in
Table S2. The lengths of most fragments reported recently were among
100–500 bp from 3 to 6 kinds of common species such as pig, cattle,
sheep and poultry. In this paper, a method for fourteen animal species
identification simultaneously was developed, not only containing spe-
cies introduced above, but also containing other common species such
as dog, fox, donkey, cat, mouse, which indicated that it would be widely
used in species identification.
The application of this method about detecting nineteen commercial
meat products had been demonstrated. The multiplex PCR method we
built was possible to identify animal species from not only fresh meats,
but also processed products, indicating a wide application prospect.
Five of these nineteen samples were traditional western meat products
purchased from import supermarket, and the rest were local meat
products. The results showed that the multiplex PCR method was able
to detect both domestic and western commercial meat products. The
results also showed that this method was able to identify more than one
animal species simultaneously along with lower cost and higher effi-
ciency indicating a reliable application prospect.
In establishment of this method, we took shorter target sequences,
more suitable species, degenerated primers and microchip electro-
phoresis into consideration in order to improve the efficiency and
practicability. In case of detecting meat products adulterated with more
than one species, this method can highlight its advantages better.
5. Conclusions
In summary, the developed multiplex PCR assay has been proved to
J. Li, et al. Food Chemistry 295 (2019) 395–402

Table 3
Published multiplex PCR assays for meat species identification.
Multiplex type Species and target length Target gene(s) Detection Limit Detection methoda Reference

Two quintuple cattle (68 bp) CO I 0.02 ng DNA chip This paper
donkey (125 bp) ND2
dog, fox, raccoon dog (161 bp) 16S rRNA
horse (207 bp)
deer (175 bp) 12S rRNA
cat (74 bp) CO I 0.2 ng DNA
pig (115 bp)
mouse (132 bp) 16S rRNA
sheep, goat (164 bp) 12S rRNA
duck, chicken (218 bp)

Quadruplex pig (267 bp) ND4 0.1 ng DNA Gel Hanapi et al. (2015)
ruminant (370 bp)
avian (504 bp)
rabbit (548 bp)

Quadruplex turkey (217 bp) Cytb 0.005–0.05 ng DNA Chip and Gel Li et al. (2015)
ostrich (330 bp)
chicken (516 bp)
duck (820 bp)

Quintuple cat (172 bp) Cytb 0.01–0.02 ng DNA Chip Ali et al. (2015)
dog (163 bp) ATPase 6
pig (141 bp) ND5
monkey (129 bp)
rat (108 bp) ATPase 6

Triplex beef (274 bp) Cytb 0.001 ng DNA Gel Song et al. (2017)
lamp (340 bp)
pork (418 bp)

Quadruplex pig (87 bp) Cytb 0.001–0.1 ng DNA Gel Sultana et al. (2018)
cattle (120 bp)
fish (295 bp) CO I
eukaryotic DNA (141 bp) 18S rRNA

a
Chip, microchip electrophoresis; Gel, agarose gel electrophoresis.

be a simple and rapid method for animal species identification. This
method was designed to identify fourteen common animal species si-
multaneously using two independent multiplex PCRs and chip elec-
trophoresis with detection limit of 0.02–0.2 ng DNA. Instead of de-
tecting single species in a PCR assay, the detection of seven different
species of each multiplex PCR assay would clearly improve the effi-
ciency and reduce the analysis cost. Short amplicons lengths
(68–218 bp) and successful amplification of targets species from raw
meat and processed products suggested that this method could be used
in screening the target species, which provided reliable adulteration
detection means and law enforcement basis for the food regulators,
meat product processing enterprises, supermarkets and individuals, and
it is also of great significance to protect interests of consumers and
companies.
Acknowledgments
This report was supported by National Key R&D Program of China
(Grant number 2017YFC1601701) and “Increase overall transparency
of processed agri-food products” (H2020-SFS-45-2016) funded by the
European Commission within the Horizon 2020 programme (2014-
2020). The authors would like to thank Dr. J. Wu for her excellent
assistance.
Declaration of Competing Interest
All authors declare that we do not have any commercial or asso-
ciative interest with other people or organizations that represent a
conflict of interest in connection with the manuscript submitted; there
is no professional or other personal interest of any nature or kind in any
product, service and/or company.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.foodchem.2019.05.112.
References
Ali, M. E., Razzak, M. A., Hamid, S. B. A., et al. (2015). Multiplex PCR assay for the
detection of five meat species forbidden in Islamic foods. Food Chemistry, 117,
214–224.
Ali, M. E., Hashim, U., Mustafa, S., et al. (2012). Analysis of pork adulteration in com-
mercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by
TaqMan probe real-time polymerase chain reaction. Meat Science, 91(4), 147–153.
Ali, M. E., Ahamad, M. N. U., Asing, et al. (2018). Multiplex polymerase chain reaction-
restriction fragment length polymorphism assay discriminates of rabbit, rat and
squirrel meat in frankfurter products. Food Control, 84, 148–158.
Amaral, J. S., Santos, C. G., Melo, V. S., et al. (2014). Authentication of a traditional game
meat sausage (Alheira) by species-specific PCR assays to detect hare, rabbit, red deer,
pork and cow meats. Food Research International, 60, 140–145.
Amqizal, H. I. A., Kahtani, H. A. A., Ismail, E. A., et al. (2017). Identification and ver-
ification of porcine DNA in commercial gelatin and gelatin containing processed
foods. Food Control, 78, 297–303.
Bottero, M. T., & Dalmasso, A. (2011). Animal species identification in food products:
Evolution of biomolecular methods. The Veterinary Journal, 190, 34–38.
Burns, M., Wiseman, G., Knight, A., et al. (2016). Measurement issues associated with
quantitative molecular biology analysis of complex food matrices for the detection of
food fraud. The Analyst, 141(1), 45–61.
Chamberlain, J. S., Gibbs, R. A., Ranierl, J. E., et al. (1988). Deletion screening of the
Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids
Research, 16(23), 11141–11156.
Giuseppe, A. M. A. D., Giarretta, N., Lippert, M., et al. (2015). An improved UPLC method
for the detection of undeclared horse meat addition by using myoglobin as molecular
marker. Food Chemistry, 169, 241–245.
Fajardo, V., González, I., Rojas, M., et al. (2010). A review of current PCR-based meth-
odologies for the authentication of meats from game animal species. Trends in Food
Science and Technology, 21(8), 408–421.
Flaudrops, C., Armstrong, N., Raoult, D., et al. (2015). Determination of the animal origin
of meat and gelatin by MALDI-TOF-MS. Journal of Food Composition and Analysis, 41,
104–112.
Fraga, J., Rodriguez, J., Fuentes, O., et al. (2005). Optimization of random amplified

401
J. Li, et al.
polymorphic DNA protocol for molecular identification of Lophius gastrophysus. Food
Science and Technology (Campinas), 25, 733–735.
Gobert, M., Sayd, T., Gatellier, P., et al. (2014). Application to proteomics to understand
and modify meat quality. Meat Science, 101, 539–543.
Hanapi, U. K., Desa, M. N., Ismail, A., et al. (2015). A higher sensitivity and efficiency of
common primer multiplex PCR assay in identification of meat origin using NADH
dehydrogenase subunit 4 gene. Journal of Food Science and Technology, 52(7),
4166–4175.
Hossain, M. A., Ali, M. E., Hamid, S. B. A., et al. (2017). Targeting double genes in
multiplex PCR for discriminating bovine, buffalo and porcine materials in food chain.
Food Control, 73, 175–184.
Hou, B., Meng, X., Zhang, L., et al. (2015). Development of a sensitive and specific
multiplex PCR method for the simultaneous detection of chicken, duck and goose
DNA in meat products. Meat Science, 101, 90–94.
Karabasanavar, N. S., Singh, S. P., Kumar, D., et al. (2014). Detection of pork adulteration
by highly-specific PCR assay of mitochondrial D-loop. Food Chemistry, 145, 530–534.
Karabasanavar, N. S., Singh, S. P., Umapathi, V., et al. (2011). A highly specific PCR assay
for identification of raw and heat treated mutton (Ovis aries). Small Ruminant
Research, 100(2–3), 153–158.
Kumar, Y., & Karne, S. C. (2017). Spectral analysis: A rapid tool for species detection in
meat products. Trends in Food Science and Technology, 62, 59–67.
Li, J., Hong, Y., Kim, J. H., et al. (2015). Multiplex PCR for simultaneous identification of
turkey, ostrich, chicken, and duck. Journal of the Korean Society for Applied Biological
Chemistry, 58(6), 887–893.
Li, Y., Zhang, Y., Li, H., et al. (2018). Simultaneous determination of heat stable peptides
for eight animal and plant species in meat products using UPLC-MS/MS method. Food
Chemistry, 245, 125–131.
Lin, W. F., & Hwang, D. F. (2008). A multiplex PCR assay for species identification of raw
and cooked bonito. Food Control, 19(9), 879–885.
Lo, Y. T., & Shaw, P. C. (2018). DNA-based techniques for authentication of processed
food and food supplements. Food Chemistry, 240, 767–774.
Mahajan, M. V., Gadekar, Y. P., Dighe, V. D., et al. (2011). Molecular detection of meat
animal species targeting MT 12S rRNA gene. Meat Science, 88, 23–27.
Mandli, J., Fatimi, I. E., Seddaoui, N., et al. (2018). Enzyme immunoassay (ELISA/im-
munosensor) for a sensitive detection of pork adulteration in meat. Food Chemistry,
255, 380–389.
Perestam, A. T., Fujisaki, K. K., Nava, O., et al. (2017). Comparison of real-time PCR and
ELISA-based methods for the detection of beef and pork in processed meat products.
Food Control, 71, 346–352.
Pieszczek, L., Czarnik-Matusewicz, H., Daszykowski, M., et al. (2018). Identification of
402
Food Chemistry 295 (2019) 395–402
ground meat species using near-infrared spectroscopy and class modeling techniques
– Aspects of optimization and validation using a one-class classification model. Meat
Science, 139, 15–24.
Prusakova, O. V., Glukhova, X. A., Afanas'eva, G. V., et al. (2018). A simple and sensitive
two-tube multiplex PCR assay for simultaneous detection of ten meat species. Meat
Science, 137, 34–40.
Ribani, A., Schiavo, G., Utzeri, V. J., et al. (2018). Application of next generation semi-
conductor based sequencing for species identification in dairy products. Food
Chemistry, 246, 90–98.
Sarah, S. A., Faradalila, W. N., Salwani, M. S., et al. (2016). LC-QTOF-MS identification of
porcine-specific peptide in heat treated pork identifies candidate markers for meat
species determination. Food Chemistry, 199, 157–164.
Safdar, M., & Junejo, Y. (2015). A multiplex-conventional PCR assay for bovine, ovine,
caprine and fish species identification in feedstuffs: Highly sensitive and specific.
Food Control, 50, 190–194.
Safdar, M., & Junejo, Y. (2016). The development of a hexaplex-conventional PCR for
identification of six animal and plant species in foodstuffs. Food Chemistry, 192,
745–749.
Schiefenhovel, K., & Rehbein, H. (2013). Differentiation of Sparidae species by DNA se-
quence analysis, PCR-SSCP and IEF of sarcoplasmic proteins. Food Chemistry, 138,
154–160.
Shabani, H., Mehdizadeh, M., Mousavi, S. M., et al. (2015). Halal authenticity of gelatin
using species-specific PCR. Food Chemistry, 184, 203–206.
Sivaraman, B., Jeyasekaran, G., Shakila, R. J., et al. (2018). PCR-RFLP for authentication
of different species of processed snappers using mitochondrial D-loop region by single
enzyme. Food Control, 90, 58–65.
Song, K. Y., Hwang, H. J., Kim, J. H., et al. (2017). Ultra-fast DNA-based multiplex
convection PCR method for meat species identification with possible on-site appli-
cations. Food Chemistry, 229, 341–346.
Spychaj, A., Mozdziak, P. E., & Pospiech, E. (2009). PCR methods in meat species iden-
tification as a tool for the verification of regional and traditional meat products. Acta
Scientiarum Polonorum Technologia Alimentaria, 8(2), 5–20.
Sultana, S., Hossain, M. A. M., Zaidul, I. S. M., et al. (2018). Multiplex PCR to discriminate
bovine, porcine, and fish DNA in gelatin and confectionery products. LWT – Food
Science and Technology, 92, 169–176.
Tisza, Á., Csikós, Á., Simon, Á., et al. (2016). Identification of poultry species using
polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP)
and capillary electrophoresis-single strand conformation polymorphism (CE-SSCP)
methods. Food Control, 59, 430–438.