British Journal of Haematology, 2000, 111, 549±551

SHORT REPORT

Factor IX gene sequencing by a simple and sensitive 15-hour

procedure for haemophilia B diagnosis: identification of two
novel mutations

Francisco Vidal, 1 Elisenda Farssac, 1 Carme Altisent, 2 LluõÂs Puig 2 and Dominique Gallardo 1
1
Unitat de Recerca del Centre de Transfusio i Banc de Teixits de Barcelona, and 2 Unitat d'HemofõÂlia de l'Hospital General
Vall d'Hebron, Barcelona, Spain

Received 14 July 2000; accepted for publication 17 July 2000

Summary. We have developed a simple, sensitive and cost-
effective direct DNA sequencing procedure for the molecular
diagnosis of haemophilia B. All factor IX gene essential
regions were amplified under identical thermocycling
parameters allowing mutation identification in less than
15 h from blood sample collection. Identical results in terms
of accuracy and speed were obtained when using a single
hair as the source of DNA. Using this approach, we have
found mutations in 10 out of 10 haemophilia B patients,
two of which are novel (P287T and S123C). Very suitable
for individual studies, this procedure can be easily scaled up
for higher throughput.
Keywords: F9, haemophilia B, mutations, automated DNA
sequencing, diagnosis.

Many methods have been described to identify mutations in PATIENTS AND METHODS
the coagulation factor IX (F IX) gene that result in the
Patients. The 10 patients studied were from unrelated
haemophilia B disorder. As none of the 650 mutations
families of Spanish origin and suffered from severe,
described along the F IX gene are predominant, proper
moderate or mild haemophilia B.
molecular diagnosis must involve nucleotide reading.
DNA extraction from peripheral blood. Genomic DNA was
Nevertheless, linkage analysis and mutation screening
isolated from 2 ml of peripheral blood by the standard
techniques are still in common use, as DNA sequencing
salting-out procedure (Olerup & Zetterquist, 1992).
technology has been traditionally seen as an expensive,
DNA extraction from a hair root. Single plucked hairs were
tedious and time-consuming alternative (Figueiredo et al,
incubated in 100 ml of 500 mg/ml proteinase K for 45 min
1994; Goodeve, 1998).
at 558C and 10 min at 1008C.
We describe here the usefulness of direct DNA sequencing
DNA amplification. Fourteen primers (Table I) were
for haemophilia B molecular diagnosis in terms of sensitiv-
designed to amplify all exons, flanking intronic regions
ity, rapidity and simplicity. By optimizing several parameters,
and the promoter. The polymerase chain reaction (PCR)
including primer sequences and thermocycling conditions,
solution contained 50 mmol/l KCl, 20 mmol/l Tris-HCl
we were able to perform all procedure steps from blood
(pH 8´4), 1´5 mmol/l MgCl2, 200 mmol/l dNTPs, 2 U of
sample collection to F IX gene mutation identification in
platinum Taq DNA polymerase (Life Technologies),
slightly less than 15 h. Moreover, identical results were
400 nmol/l each primer and 200±300 ng of genomic
obtained when using a single plucked hair as the starting
DNA from blood (or 10 ml of hair root DNA solution) in a
material. With this powerful technique, we have character-
total volume of 50 ml. After initial denaturation at 948C for
ized the genetic defect in 10 haemophilia B patients, two of
3 min, 34 cycles of 948C for 20 s, 548C for 30 s and 728C
which corresponded to novel mutations.
for 1 min were performed.
DNA sequencing. PCR products were purified using the
Concert Rapid PCR purification system (Life Technologies),
and nine sequencing reactions were performed using the
Correspondence: Dominique Gallardo, Unitat de Recerca del Centre BigDye Terminator cycle sequencing kit (PE Biosystems) in
de Transfusio i Banc de Teixits, Passeig Vall d'Hebron 119±129, a final volume of 5 ml. After capillary electrophoresis in
08035-Barcelona. Spain. E-mail: gallardo@hg.vhebron.es an ABI Prism 310 genetic analyser (PE Biosystems) with

q 2000 Blackwell Science Ltd 549

550 Short Report
Table I. Primers designed for amplification and sequencing of factor IX gene.

Primer Sequence 5 0 to 3 0 Product size (bp) Gene region Sequencing primer and running times

F9E1-1 CACGTATCTATGAAAGGATTC Pro 1 exon 1 F9E1-2 (36 min)

F9E1-2 CAGCATCAGATATTTCTATATC 624
F9E2-1 CAAAGACTTTCTTAAGAGATGT Exon 2 1 3 F9E2-1 (22 min)
F9E3-2 GACAAAGTTTAATATATTATCTATT 557 F9E3-2 (15 min)
F9E4-1 ATCCCAATGAGTATCTACAGG Exon 4 F9E4-1 (20 min)
F9E4-2 CACCAATATTGCATTTTCCAG 275
F9E5-1 ATACATGAGTCAGTAGTTCCA Exon 5 F9E5-1 (22 min)
F9E5-2 AGGAAGCAGATTCAAGTAGG 309
F9E6-1 TCTCAGAAGTGACAAGGATG Exon 6 F9E6-2 (30 min)
F9E6-2 ACATCCCAATAGGTCTGTCT 407
F9E7-1 CTATTCCTGTAACCAGCACA Exon 7 F9E7-1 (25 min)
F9E7-2 CTTCTGCCTTTAGCCCAATT 318
F9E8-1 AATTAGGTCAGTGGTCCCAA Exon 8 F9E8-1 (36 min)
F9E8-2 TCTAATCAATTTGCTCAGGTAA 807 F9E8-2 (36 min)

running times specifically adjusted for each reaction
(Table I), sequences were aligned with the corresponding
wild-type sequences using the macvector program (Oxford
Molecular).
RESULTS
Seven PCR products comprising the F IX gene essential
regions were amplified from blood-isolated genomic DNA
under identical MgCl2 and primer concentrations (kept at
2208C in a premixed format) and thermocycling para-
meters. After column purification, PCR products were
directly sequenced with nine of the primers previously
used in the amplification (Table I). Sequence alignment to
the wild-type sequences included the putative promoter
(Heit et al, 1999), all coding regions and the 20 intronic
basepairs (bp) flanking both sides of each exon. The whole
procedure from tissue sample collection to mutation
identification was completed in less than 15 h. Mutations
were always validated by sequencing a second independent
PCR product. All the regions considered relevant for F IX
expression were sequenced; however, the presence of a
second mutation elsewhere cannot be ruled out.
The F IX gene defect was found in all 10 patients and
involved nine single bp substitutions and one short deletion.
Two of the single substitutions were novel, corresponding to
missense mutations causing a mild phenotype (P287T and
S123C), whereas the remaining substitutions had already
been reported in the haemophilia B mutation database
(Giannelli et al, 1998) (Table II). Analysis of patient HB003,
the only one previously characterized (Montejo et al, 1999),
confirmed the R29X nonsense mutation.
In order to test the sensitivity of our direct sequencing
approach, we used a single plucked hair from a healthy
individual as a source of genomic DNA. After very simple
DNA isolation (see Patients and methods), the required
amounts of PCR products gave rise to clear sequencing
reactions. As with blood, the total time for the procedure
was slightly less than 15 h. When a single plucked hair
from patient HB018 was used, the presence of mutation
S123C was confirmed with the same accuracy and speed.
DISCUSSION
Haemophilia B molecular diagnosis is still performed in
several laboratories with indirect techniques in spite of

Table II. Summary of clinical and molecular data in haemophilia B patients.

Patient ID Severity Factor:C (%) Exon/intron no. Codon no. Nucleotide change Amino acid change Novel mutation

HB002 Severe ,1 Exon 6 145 CGT!TGT Arg!Cys No

HB003 Severe ,1 Exon 2 29 CGA!TGA Arg!Stop No
HB004 Severe ,1 Exon 8 252 CGA!TGA Arg!Stop No
HB006 Mild 14 Exon 8 287 CCT!ACT Pro!Thr Yes
HB008 Moderate 4 Exon 8 248 CGA!CAA Arg!Gln No
HB010 Severe ,1 Exon 8 331 del(TTG) del(Val) No
HB016 Severe ,1 Intron 3 ± aag/AT!gag/AT ± No
HB017 Severe ,1 Exon 1 217 GTT!ATT Val!Ile No
HB018 Mild 15 Exon 5 123 TCC!TGC Ser!Cys Yes
HB026 Mild 8 Exon 8 402 TCC!TTC Ser!Phe No

q 2000 Blackwell Science Ltd, British Journal of Haematology 111: 549±551


limitations such as uninformative families, sporadic cases
without prior family history [approximately one-third of
haemophilia patients (Kaufman, 1999)] and the require-
ment of a large number of polymorphic markers to increase
the chance of heterozygosity. Identification of the causative
mutation may improve prediction of the dysfunction
mechanism (Weinmann et al, 1998), development of
recombinant factor IX analogues and gene therapy proto-
cols (Giannelli & Green, 1996; Warrier et al, 1997; Warrier
& Lusher, 1998). Several screening techniques have been
reported (Goodeve, 1998) to detect and characterize
mutations in the factor IX gene, most of which are single
nucleotide changes. These procedures generally require the
use of radioactive or highly toxic chemicals, dedicated
equipment and intensive training of personnel.
We have designed a simple procedure that makes
mutation screening techniques more labour intensive than
direct sequencing itself. As all essential regions are system-
atically sequenced, the undesirable masking effect observed
with some screening techniques owing to polymorphic
variations is avoided, resulting in a higher mutation detec-
tion efficiency. All primers have been designed to work
under the same salt conditions and thermocycling para-
meters. Predispensed primers and MgCl2 in a ready-to-use
microplate format, as well as automated loading of sequ-
encing reactions, greatly facilitate high sample throughput.
No hazardous materials or toxic chemicals are required.
Furthermore, reduced amounts of sequencing reagents, the
overall time reduction (hands-on time of about 4 h) and the
fact that a dedicated technician is not needed to run
the machine make this a cost-effective procedure.
Identification of the mutation starting from a single
plucked hair as the source of genomic DNA demonstrated
the sensitivity of the technique. To the best of our
knowledge, this is the first report in which diagnosis of a
genetic disease is established by sequencing the promoter, all
exons and intronic flanking regions of a gene starting from
a single hair root.
In summary, we present here a simple, fast and sensitive
procedure for direct sequencing of the entire F IX gene
essential regions. As lengthy set-up in the laboratory is not
required, the protocol is versatile and the method can be
applied conveniently to individual studies or to large
population screening programmes. Once the mutation has
been identified, precise genetic counselling for unambiguous
q 2000 Blackwell Science Ltd, British Journal of Haematology 111: 549±551
Short Report 551
carrier assignment and accurate prenatal diagnosis can
easily be performed.
ACKNOWLEDGMENTS
We are grateful to the Associacio Catalana de l'HemofõÂlia for
financial support for this project.
REFERENCES
Figueiredo, M.S., Bowen, D.J., Silva Junior, W.A. & Zago, M.A.
(1994) Factor IX gene haplotypes in Brazilian blacks and charac-
terization of unusual DdeI alleles. British Journal of Haematology,
87, 789±796.
Giannelli, F. & Green, P.M. (1996) The molecular basis of
haemophilia A and B. Baillieres Clinical Haematology, 9, 211±228.
Giannelli, F., Green, P.M., Sommer, S.S., Poon, M., Ludwig, M.,
Schwaab, R., Reitsma, P.H., Goossens, M., Yoshioka, A., Figueiredo,
M.S. & Brownlee, G.G. (1998) Haemophilia B: database of point
mutations and short additions and deletions ± eighth edition.
Nucleic Acids Research, 26, 265±268.
Goodeve, A.C. (1998) Laboratory methods for the genetic diagnosis of
bleeding disorders. Clinical and Laboratory Haematology, 20, 3±19.
Heit, J.A., Ketterling, R.P., Zapata, R.E., Ordonez, S.M., Kasper, C.K.
& Sommer, S.S. (1999) Haemophilia B Brandenburg-type
promoter mutation. Haemophilia, 5, 73±75.
Kaufman, R.J. (1999) Advances toward gene therapy for hemo-
philia at the millennium. Human Gene Therapy, 10, 2091±2107.
Montejo, J.M., MagalloÂn, M., Tizzano, E. & Solera, J. (1999) Identifi-
cation of twenty-one new mutations in the factor IX gene by
SSCP analysis. Human Mutation, 13, 160±165.
Olerup, O. & Zetterquist, H. (1992) HLA-DR typing by PCR amplifi-
cation with sequence-specific primers (PCR±SSP) in 2 hours: an
alternative to serological DR typing in clinical practice including
donor-recipient matching in cadaveric transplantation. Tissue
Antigens, 39, 225±235.
Warrier, I. & Lusher, J.M. (1998) Development of anaphylactic
shock in haemophilia B patients with inhibitors. Blood Coagulation
and Fibrinolysis, 9, S125±S128.
Warrier, I., Ewenstein, B.M., Koerper, M.A., Shapiro, A., Key, N.,
DiMichele, D., Miller, R.T., Pasi, J., Rivard, G.E., Sommer, S.S.,
Katz, J., Bergmann, F., Ljung, R., Petrini, P. & Lusher, J.M. (1997)
Factor IX inhibitors and anaphylaxis in hemophilia B. Journal of
Pediatric Hematology/Oncology, 19, 23±27.
Weinmann, A.F., Murphy, M.E. & Thompson, A.R. (1998) Conse-
quences of factor IX mutations in 26 families with haemophilia B.
British Journal of Haematology, 100, 58±61.