Fish & Shellfish Immunology 64 (2017) 457e468

Contents lists available at ScienceDirect

Fish & Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

The hot-water extract of leaves of noni, Morinda citrifolia, promotes

the immunocompetence of giant freshwater prawn, Macrobrachium
rosenbergii
Atika Marisa Halim a, b, 1, Pai-Po Lee c, 1, Zhong-Wen Chang a, Chin-Chyuan Chang a, *
a
Department of Aquaculture, National Pingtung University of Science and Technology, Pingtung 91201, Taiwan, ROC
b
Faculty of Fisheries and Marine Science, University of Brawijaya, Malang, East Java 65145, Indonesia
c
Department of Tropical Agriculture and International Cooperation, National Pingtung University of Science and Technology, Pingtung 91201, Taiwan, ROC

a r t i c l e i n f o a b s t r a c t

Article history: The hot-water Morinda citrifolia leaf extract (HMLE) was prepared for in vitro assessment on pheno-
Received 13 February 2017 loxidase (PO) activity, respiratory bursts (RBs), and phagocytic activity (PA). Furthermore, the HMLE was
Received in revised form administrated in the diet at 0.6, 3, and 6 g (kg diet)
1 for Macrobrachium rosenbergii, and the potential
15 March 2017
effects on the immunocompetence of prawns were evaluated. PO activity, RBs, and PA in hemocytes
Accepted 26 March 2017
Available online 27 March 2017
incubated with the HMLE at 140, 20, 20, and 140 mg l
1 significantly increased. The immune parameters
of the total hemocyte count (THC), differential hemocyte count (DHC), RBs, PO activity, superoxide
dismutase (SOD) activity, PA, transglutaminase (TG) activity and hemolymph clotting time were evalu-
Keywords:
Morinda citrifolia
ated before and after 1, 3, 5, 7, and 9 weeks of the feeding trial. During 9 weeks of the feeding trial, higher
Macrobrachium rosenbergii THCs, DHCs, RBs, PO, and TG as well as accelerated clotting times were observed in prawns fed HMLE-
Feeding trial containing diets at 0.6 g kg
1. The mRNA expressions of prophenoloxidase, TG, crustin, and lysozyme
Immunity of prawns fed HMLE-containing diets at 0.6 g kg
1 for 9 weeks of the feeding trial significantly increased.
The susceptibility of prawns fed the HMLE at 0.6 g kg
1 to Lactococcus garvieae infection significantly
decreased, and the relative survival percentage was 23.1%. We therefore found that HMLE administrated
through the diet at 0.6 g kg
1 was capable of enhancing the immunity and resistance against L. garvieae
in M. rosenbergii.
© 2017 Elsevier Ltd. All rights reserved.

1. Introduction Vaccinations are used as potential treatments against disease out-

The giant freshwater prawn, Macrobrachium rosenbergii, is an
important freshwater farmed crustacean species in many countries
because of its high commercial value. However, in Taiwan, serious
economic losses have occurred due to infection by yeasts in the cool
season [1] and bacteria in the hot season [2]. To avoid economic
losses, veterinary drugs are commonly used in aquaculture to
prevent or treat disease outbreaks, and the regular administration
as additives in fish food or in baths and injections is a commonly
used strategy as prophylactics, therapeutics, or growth promoters
[3]. However, the side effects of veterinary drugs in terms of both
environmental and health safety have become a major concern.
* Corresponding author.
E-mail address: changcc@mail.npust.edu.tw (C.-C. Chang).
1 accepted that this implies the presence of immunological memory
These authors contributed equally as the first author to this work.
breaks in aquaculture; nevertheless, the cost and multivalent vac-
cine development are main issues in the spectrum of vaccine use in
aquaculture [4]. The prophylactic administration of immunosti-
mulants is considered an alternative treatment to chemotherapy
and vaccines, and is applied in aquaculture to control disease
because of their broad-spectrum activity, cost effectiveness, and
eco-friendly disease preventative effects through strengthening
defense mechanisms [5]. Immunostimulants are effective means of
increasing the immunocompetency and disease resistance by
enhancing both specific and non-specific defense mechanisms of
fish and shellfish [6,7].
Invertebrates lack an adaptive immune system and rely on their
effective cellular and humoral innate immune responses to combat
invading microbes [8]. In recent years, even though some evidence
of specific immune priming revealed the protective specificity upon
a second exposure to a pathogen in shrimp, it is still not generally

http://dx.doi.org/10.1016/j.fsi.2017.03.045
1050-4648/© 2017 Elsevier Ltd. All rights reserved.
458 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468
[9]. Plants and their byproducts, such as alkaloids, terpenoids,
tannins, saponins, glycosides, flavonoids, phenolics, steroids, and
essential oils, in plant extracts were reported to have such prop-
erties as growth-promoting ability, immune system improvement,
antimicrobial capability, and stimulating the appetite and anti-
stress characteristics in aquaculture species [7,10]. In addition, the
reduced costs of treatment, biodegradable characteristics, and less
drug resistance are advantages of using plant extracts [4]. There-
fore, plant extracts as sustainable and effective substitutes for
veterinary drugs and vaccines in aquaculture was widely reviewed
by Reverter et al. [4], Harikrishnan et al. [7], Citarasu [10], and Van
Hai [11]. As interest has grown in prawns, the enhanced immuno-
logical responses, resistance to pathogen infection, and better
growth performance were reported in Mac. rosenbergii fed diets
containing extracts of banana (Musa acuminata) peels [12], Eich-
hornia crassipes [13], Rheum officinale Bail [14], or Withania somni-
fera [15].
Morinda citrifolia, known commercially as noni, grows widely
throughout the Pacific and is the most significant source of tradi-
tional medicines among Pacific Island societies. This small ever-
green tree or shrub is native to areas from Southeastern Asia
(Indonesia) to Australia, and now has a pantropical distribution.
Extracts of various parts of the noni plant were reported to have
many significant effects, such as antibacterial, antifungal, and tu-
mor suppressive activities of the fruit [16]; antioxidative activities
of the root [17]; inhibitor of elastase and tyrosinase of seeds [18];
and treatment of ulcerations and minor infections of the leaves
[19]. In aquaculture, Kumaran et al. [20] reported that methanol
extract of Morinda tinctoria leaf enhanced the resistance to Vibrio
parahaemolyticus in the freshwater crab, Oziotelphusa senex senex
and also promoted non-specific and specific defense mechanisms.
Alcoholic and organic solvents can more highly efficiently
extract secondary bioactive metabolites (polar and non-polar) with
antimicrobial and immunostimulant activities, compared to water-
based methods [21e23]. However, during processing with orga-
nosolvent extraction, the material must be further concentrated in
a rotary evaporator under reduced pressure to remove the solvent.
Preparing plant extracts with water can be easily conducted, and
the byproducts obtained in this series of processes can readily be
directly administered as a dietary supplement. Therefore, to
develop a potential immunostimulant for Mac. rosenbergii to pro-
mote the benefits in aquaculture industry, hot water Mor. citrifolia
leaf extract (HMLE) was used to supplement diets of prawns for 9
weeks of a feeding trial, and the immunological responses,
immune-related gene expressions, and susceptibility of Mac. rose-
nbergii to Lactococcus garvieae infection were investigated in the
present study.
2. Materials and methods
2.1. Process of obtaining the HMLE
Green leaves of Mor. citrifolia were collected from Noni Farm,
Pingtung, southern Taiwan. Fresh leaves of Mor. citrifolia were
cleaned with tap water and rinsed with distilled water to remove
contaminants and debris. After the leaves were chopped into small
pieces and dried in an oven at 63  C for 12 h, the dried material was
ground into a powder with a grinder. Known weights of Mor. cit-
rifolia leaf powder of 2, 6, and 10 g were boiled in 200 ml of distilled
water (1%, 3%, and 5%) at 100 ± 4  C for 2 h, and those were
centrifuged at 3000g and 28  C for 15 min. After centrifugation,
the pellet was discarded, and the volume of collected supernatants
of hot-water mixture of Mor. citrifolia leaves from 2, 6, and 10 g leaf
powder were 170, 160, and 190 ml, respectively. Ten microliter of
the three supernatants were directly used for in vitro assessments,
and the remaining were further lyophilized using a freeze dryer to
respectively obtain 0.17, 1.13, and 2.09 g of powder, termed the
HMLE. The phenolic content of the HMLE, detected following a
modified version of the Folin-Ciocalteu method described by Hos-
sain et al. [24], was 45.36 mg of gallic acid equivalent (GAE)/g of
extract.
2.2. Macrobrachium rosenbergii
Giant freshwater prawns, Mac. rosenbergii, were obtained from a
commercial farm in Pingtung, Taiwan, reared at the Department of
Aquaculture, National Pingtung University of Science and Tech-
nology, and acclimatized at room temperature for 2 weeks before
the experiment began. Prawns were fed artificial diets at a rate of
5% body weight twice daily at 08:00 and 17:00. Fresh water, sourced
underground, was aerated for at least 2 days prior to usage. During
the accumulation and experimental period, a water temperature of
28 ± 1  C, pH of 7.0e7.5, dissolved oxygen (DO) level of 5e7 mg l
1,
and a photoperiod of 12 h of light: 12 h of dark were maintained.
Every day, 10% of the water was replaced to maintain the water
quality, and fecal matter, molted material, and uneaten food were
removed daily. Only prawns in the intermolt stage were used in the
experiments. The molt stage was determined by examining the
uropoda, where partial retraction of the epidermis could be
distinguished [25].
2.3. Experimental design
There were three tests comprising the HMLE evaluation
including in vitro and in vivo assessments of the HMLE on immune
responses, and resistance to L. garvieae infection. For the in vitro
assessment, hemocytes were collected from single prawns. For the
susceptibility, test and control groups were comprised of 10 prawns
each, and tests were conducted in triplicate. In the in vivo assess-
ment on immune responses, tests and controls were carried out on
six replicates. During the experiments, prawn were continually fed
their respective diets, and the setup of tanks and sampling pro-
cedures in each experiment followed a description by Chang et al.
[13]. No significant difference in weight was observed among
treatments in all experiments, and the experimental conditions
were maintained as described above.
2.4. In vitro assessment of the HMLE on immune responses
Hemocyte mixtures (106 cell ml
1) from Mac. rosenbergii
(weighing 30 g) were prepared with L-15 medium (Gibco-BRL,
Rockville, MD, USA) (with an osmolality of 490 mOsm kg
1) as
described by Chang et al. [26], and 10 ml of the supernatant of a hot-
water mixture of Mor. citrifolia leaves at 1%, 3%, and 5% ((gram of
dried leaf powder) (100 ml of water)
1) was separately added to
490 ml of a hemocyte mixture to obtain 0, 20, 140, and 220 mg l
1 of
the HMLE in L-15 medium. There were therefore four treatments in
total, and each treatment was conducted in triplicate. After 30 min
of incubation, the hemocyte mixture was centrifuged at 500g and
4  C for 20 min, and the hemocyte pellet was washed once with
saline. The resulting hemocyte pellet was then re-suspended in
cacodylate buffer to 300 ml of a hemocyte mixture, 100 ml for the
phenoloxidase (PO) activity assay, 100 ml for the respiratory burst
(RB) assay, and the remaining for the phagocytic activity (PA) assay.
Trypan blue was used to monitor cells after in vitro treatments, and
the percentage of live cells exceeded 85%.
2.5. Preparation of the HMLE-containing diets
Considering the level of HMLE and the results of in vitro
 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468 459

assessment, 20 mg l
1 of HMLE was chosen for the diets prepara-
tion in the feeding trial. Reddy and Reddy [27] reported that the
average value of moisture in Mac. rosenbergii was 77.14%, and
therefore, in the present study, the prawns used for feeding trial
were weighted at 30 g, and the volume of water was 23.1 ml. To
obtain the level of HMLE at 20 mg l
1 in 30 g of prawn through diet
administration, we presumed that 1.5 g of artificial diet (feeding
rate of 5% body weight) containing 0.462 mg of HMLE
(20 mg l
1  23.1 ml) for each prawn daily should be satisfied, and
therefore, the HMLE administrated into artificial diet was at
0.308 g (kg diet)
1. To avoid the potential loss of HMLE during feed
preparation, diet containing 0.6 g (kg diet)
1 of HMLE was chosen,
and its five- and ten-fold concentration were therefore conducted
for the feeding trial.
Four diets containing different concentrations of the HMLE were
prepared as described in Table 1. For the experimental diets, the
HMLE was added to the test diets at levels of 0.6, 3, and 6 g (kg
diet)
1 with a corresponding decrease in the amount of cellulose.
Ingredients were ground up in a Hammer mill until they passed
through an 80-mesh screen. The experimental diets were prepared
by mixing the dry ingredients with fish oil until a stiff dough
resulted. Each diet was then passed through a mincer with a die and
the resulting spaghetti-like strings were dried in a drying cabinet
using an air blower at 50  C until the moisture levels were <10%.
After drying the mixture, the finished pellets were stored in plastic
bins at 4  C until being used. A proximate analysis of the diets was
conducted according to the AOAC method [28], and results for
crude proteins, crude lipids, ash, and moisture are shown in Table 1.
weeks of the feeding trial. Six prawns from each treatment and
time were used for immune response determinations including
total hemocyte count (THC), differential hemocyte count (DHC), PO
activity, RBs, superoxide dismutase (SOD), transglutaminase (TG),
hemolymph clotting time, and PA activity. Immune-related gene
expressions, including prophenoloxidase (proPO), lipopolysaccha-
ride- and b-1,3-glucan-binding protein (LGBP), peroxinectin (PE),
TG, crustin, and lysozyme, were assessed at the end of the feeding
trial. Another six prawns fed the control diets were the initial
control group, and therefore, 114 prawns were sampled for the
determinations.
Hemolymph (530 ml) was withdrawn from the ventral sinus of
each prawn and divided into four parts. Fifty microliters of hemo-
lymph was placed into 1.5-ml sterile Eppendorf tubes containing
0.45 ml of anticoagulant buffer (0.8 g sodium citrate, 0.34 g EDTA,
and 10 ml Tween 80 in 100 ml of distilled water, at pH 7.45 with the
osmolality adjusted to 490 mOsm kg
1 with NaCl) and used for the
THC, DHC (granular cells (GCs), semigranular cells (SGCs), and hy-
aline cells (HCs)), and RB assay. The THC and DHC were measured in
a hemocytometer (Leica DMIL, Leica Microsystems, Wetzlar, Ger-
many). A ten-fold dilution of 100 ml of hemolymph with anticoag-
ulant buffer was used for the PO activity assay, and an additional
100 ml of hemolymph was used to prepare the hemocyte lysate
solution (HLS) for the SOD and TG activity assays. For the PA activity
and clotting time assays, 100 and 180 ml of hemolymph were
respectively used for the determinations. At the end of the feeding
trial, an additional 150 ml of hemolymph was sampled to evaluate
immune-related gene expressions.

2.6. In vivo assessment of the HMLE on immune responses 2.6.1. PO activity

Prawns (30.0 ± 2.0 g) fed HMLE-containing diets at 0, 0.6, 3,
6 g kg
1 were sampled at the beginning and after 1, 3, 5, 7, and 9
Table 1
Ingredients and composition of experimental diets containing the hot-water Mor-
inda citrifolia leaf extract (HMLE) for Macrobracium rosenbergii.
PO activity was measured spectrophotometrically by recording
the formation of dopachrome produced, following a method
modified from Mason [29] and Herna
ndez-Lo

pez et al. [30]. Details
of the measurements were described by Chang et al. [26]. The op-
tical density (OD) was measured at 490 nm using a Hitachi U-2000
spectrophotometer (Tokyo, Japan), and results are expressed as
dopachrome formation per 50 ml of hemolymph, or per 107 the sum
of granulocytes (GCs þ SGCs).

Ingredients Experimental diet (g kg
1) 2.6.2. RBs

Control (0) 0.6 3 6 RBs of hemocytes were quantified using the reduction of
nitroblue tetrazolium (NBT) to formazan as a measure of superox-
Fish meala 370 370 370 370
Wheat flour 244 244 244 244 ide anion (O
2 ) production following the procedures of previous
Soybean meal 245 245 245 245 studies [31,32]. Details of the measurements were described by
Squid liver meal 70 70 70 70 Chang et al. [26]. The OD at 630 nm was measured using a micro-
Fish oil 35 35 35 35 plate reader (Model VERSAmax, Molecular Devices, Sunnyvale, CA,
Vitamin Pre-mixb 10 10 10 10
Mineral Pre-mixc 20 20 20 20
USA). RBs are expressed as NBT reduction in 10 ml of hemolymph or
Cellulose 6 5.4 3 0 per 107 hemocytes.
HMLE 0 0.6 3 6
Proximate analysis 2.6.3. SOD and TG activity assays
Moisture (%) 5.13 ± 1.57 5.44 ± 1.45 5.26 ± 0.06 5.19 ± 0.05
The HLS was prepared as described previously [26]. SOD activity
Crude protein (%) 46.52 ± 1.05 44.58 ± 0.41 45.08 ± 2.30 43.38 ± 1.09
Crude lipid (%) 9.62 ± 0.14 10.11 ± 0.35 9.76 ± 0.18 9.99 ± 0.20 of the HLS was measured by its ability to inhibit superoxide radical-
Ash (%) 8.30 ± 0.21 8.26 ± 0.21 7.96 ± 0.17 7.84 ± 0.09 dependent reactions using a Ransod kit (Randox, Crumlin, UK).
a
Fish meal (999 LT) was supplied by Triplenine Fish Protein a.m.b.a. (Esbjerg,
Details of the measurement were described previously [26,33]. The
Denmark). OD was measured at 505 nm and at 37  C, and the rate of the re-
b
Vitamin mixture supplied the following (mg g
1 mixture): pyridoxine HCl, action was estimated from the absorbance readings at 0.5 and
3.2963; para-aminobenzoic acid, 10; retinyl acetate, 0.6222; riboflavin, 0.8333; 3 min after adding xanthine oxidase. A reference standard for SOD
nicotinic acid, 0.2667; thiamin-HCl, 0.5185; menadione, 1.4815; a-tocopheryl ace-
was supplied with the Ransod kit. One unit of SOD was defined as
tate, 10; vitamin B12, 0.0074; cholecaliferol (D3), 0.0037; folic acid, 0.0777; choline
HCl, 200; L-ascorbyl-2-monophosphate- Mg, 1.4815; d-biotin, 0.0889; Ca panto- the amount required to inhibit the rate of xanthine reduction by
thenate, 5.1481; myo-inositol, 125.9. All ingredients are diluted with a-cellulose to 50%. Specific activity was expressed as SOD units ml
1.
1 g. TG activity was measured by a colorimetric hydroxamate pro-
c
Mineral mixture supplied the following (mg g
1 mixture): K2HPO4, 100; cedure according to Folk and Cole [34] with minor modifications.
Na2HPO4, 215; Ca(H2PO4)2$H2O, 265; CaCO3, 105; Ca lactate, 165; KCl, 28; KI, 0.23;
MgSO4$7H2O, 100; ferric citrate, 10; CuCl2$2H2O, 0.15; AlCl3$6H2O, 0.24;
Details of the measurement were described previously [35]. The OD
MnSO4$H2O, 1.07; ZnSO4, 1.5; CoCl2$6H2O, 1.4. All ingredients are diluted with a- of hydroxamate was measured at 525 nm, and one unit of TG ac-
cellulose to 1 g. tivity was defined as the amount of enzyme needed to produce
460 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468

1 mmol of hydroxamate per minute. The specific activity was
expressed as TG activity units ml
1.
2.6.4. Clotting times
Measurement of hemolymph clotting times followed methods
of Tsai et al. [36] and Jussila et al. [37], and details of the mea-
surement were described previously [35]. Briefly, 180 ml of hemo-
lymph was withdrawn from the ventral sinus of Mac. rosenbergii,
then mixed with 20 ml of 20 mM CaCl2 in Eppendorf tubes, and
continually turned upside down in slow motion every 5 s. The
motion was repeated until the hemolymph had coagulated, and the
time was recorded.
2.6.5. PA
PA was calculated following a methods of Hsu et al. [38]. Details
of the measurement were described previously [26]. Hemocytes
from 100 ml of hemolymph were collected and diluted with L-15
medium (Gibco™, at an osmolality of 490 mOsm kg
1, Grand Is-
land, NY, USA) to obtain a hemocyte mixture (106 cells ml
1).
Phagocytic activity is expressed as the percentage of phagocytosing
cells quantified from the total counted adherent phagocytes (200
hemocyte cells) under a fluorescence microscope (Nikon H0.630L,
Tokyo, Japan), calculated according to the following formula: PA
(%) ¼ 100  (number of phagocytosing cells) (number of total
cells)
1.
2.6.6. Immune-related gene expressions
Total RNA was measured using total RNA isolation reagent
(Zymo Research, Quick-RNA™ MiniPrep, R1054, Irvine, California,
USA.) following the manufacturer's instructions. First-strand com-
plementary (c)DNA synthesis in reverse transcription (RT) was
performed using Tool Script MMLV RT kit (TOOLS biotechnology,
New Taipei City, Taiwan). Reaction conditions recommended by the
manufacturer were followed. Messenger (m)RNA expressions of
immune genes including proPO, LGBP, PE, TG, crustin, and lysozyme
were measured using an SYBR green I real-time RT polymerase
chain reaction (PCR) assay in the ABI PRISM 7900 Sequence
Detection System (Perkin-Elmer, Applied Biosystems, Foster City,
CA, USA), and primer pairs of detected genes are shown in Table 2.
Specific primers of immune genes and the b-actin primer were
used for the quantitative RT-(q)PCR (Table 2). Data processing and
analysis were performed using Sequence Detection Software (SDS
vers. 2.1, Applied Biosystems). The 2-DDCT method was chosen as the
calculation method [39]. The difference in the cycle threshold (CT)
value of an individual immune gene and its housekeeping gene (b-
Table 2
Primer sequences (Forward and Reverse) of target.
Gene name Source Primer Sequence (50 -30 )
actin), called DCT, was calculated. DDCT ¼ (DCT of immune gene
expression in prawn fed the HMLE-containing diets at 0.6, 3, and
6 g kg
1 after 9 weeks of feeding trial)
(DCT of those fed the
control diet).
2.7. Effect of the HMLE administrated into diets of Mac. rosenbergii
on its susceptibility to L. garvieae
A pathogenic strain of L. garvieae, isolated from diseased Mac.
rosenbergii, which displayed clinical signs as described by Chen
et al. [40] of a whitish body color, whitish muscles, and swelling,
was used for this study. Lactococcus garvieae was cultured on tryptic
soy agar (TSA, Himedia, M290-500G, Mumbai, India) for 24 h at
28  C before being transferred to 15 ml of tryptic soy broth (TSB,
Himedia, M011-500G). Subsequently, the pathogen was incubated
for 24 h at 28  C, and then centrifuged at 3000g for 15 min at 4  C.
The supernatants were removed, and the bacterial pellets were
resuspended in a saline solution at 2.5  108 colony forming units
(cfu) ml
1 as a stock bacterial suspension for the susceptibility
study. The diluted bacterial suspension was plated on TSA plates to
determine viable cell counts.
After prawns (21 ± 2 g) had been fed HMLE-containing diets at
0, 0.6, 3, or 6 g kg
1 for 3 weeks, 20 ml of a bacterial suspension was
slowly injected into the ventral sinus (located between the ventral
nerve cord/cephalothoracic ganglia associated with the fourth and
fifth periopods and striated muscle of the cephalothorax from the
first segment of abdomen) with a sterile syringe resulting in
5  106 cfu prawn
1. Prawns fed the control diet and then received
20 ml of saline served as the unchallenged control. Therefore, 150
prawns were used for the challenge test. After the injection, prawns
were continually fed their respective diets, and 25% of the water
was exchanged daily. Mortality was counted on a daily basis for the
total experimental period of 144 h. The relative percent survival
(RPS) of prawns was calculated at the end of the experiment using
the formula below described by Amend [41]: RPS ¼ [1e[(percent-
age mortality in treatment) (percentage mortality in
control)
1]]  100.
2.8. Statistical analysis
A one-way analysis of variance (ANOVA) was used to analyze the
data. When the ANOVA identified differences among groups, a
multiple-comparison (Tukey's) test was conducted to examine
significant differences among treatments using SPSS vers. 10.6
computer software (SPSS, Chicago, IL, USA). Before the analysis,
percent data were normalized by arcsine-transformation. Statisti-
cally significant differences required that p < 0.05.

LGBP GQ228481* F AGGAACCGGCGGTTTCTT

R GGTGTTGGACCAAGGCTTGT 3. Results
PE AY606270* F CAACGTTCTTGTGGATGTCGATA
R AGCCCACTGCATCACAGATG 3.1. In vitro assessment of the HMLE
Crustin JQ413342* F AACGACTTCAAGTGCTTCGGGTCT
R AAGCTTAGTGGTTTGCAGACGTGC
proPO AY947400* F ACACTGAAGGACATAAGGCGAGAT
PO activity of hemocytes incubated with the HMLE at 140 mg l
1
R AGTAGAGTTCCAAGTCGGAGATGCT significantly increased by 150.92%, and meanwhile, no significant
Lysozyme [68] F ATGGTTGTCAACTTTGCCCC difference was observed in those at 20 and 220 mg l
1, compared to
R CCAGTATCCAATGGTGTTAGGG the control (Fig. 1A). After incubating with the HMLE at 20 mg l
1,
TG [35] F GTGTTCGCTGCGGTTGTTAA
RBs of hemocytes were significantly higher by 133.45% than the
R GTGACCACTCGGGCTGGTA
b-actin [35] F CATCACCAACTGGGACGACATGGA control. However, no significant differences were observed among
R GAGCAACACGGAGTTCGTTGT treatments of the control, 140, and 220 mg l
1 HMLE (Fig. 1B). PAs of
1. proPO: prophenoloxidase; LGBP: lipopolysaccharide-and b- 1,3-glucan-binding
hemocytes incubated with the HMLE at 20 and 140 mg l
1 were
protein; PE: peroxinectin; TG: transglutaminase. significantly higher than that of the control group by 150% and
2.*:GenBank accession number. 146.6%, respectively (Fig. 1C).
 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468 461

increased PO activities of prawns fed 3 and 6 g kg
1 were not

consistent during 9 weeks of the feeding trial, significantly higher
levels were observed in prawns fed the HMLE at 3 g kg
1 after
feeding for 3 and 5 weeks, and those fed 6 g kg
1 after feeding for 5
weeks (Fig. 3A). After 9 weeks of the feeding trial, the PO activity of
prawns fed the HMLE-containing diet at 0.6 g kg
1 had significantly
increased by 190.81% compared to the control (Fig. 3A). The PO
activity per granulocyte had significantly increased after 3, 5, 7, and
9 weeks of the feeding trial. Prawns fed the control diet only
showed an obviously higher level than those fed diets at 3 and
6 g kg
1 after 1 week of the feeding trial (Fig. 3B).
RBs of prawns fed the HMLE-containing diet at 0.6 g kg
1 had
significantly increased after 1 week of the feeding trial. Slightly
increased RBs of prawns fed the HMLE-containing diet at 3 g kg
1
were only detected after 1 week of the feeding trial, and then those
declined and were significantly lower than the control after 7 and 9
weeks of the feeding trial (Fig. 4A). Significantly decreased RBs per
hemocyte were found in prawns fed the HMLE-containing diet at
0.6 g kg
1 after 1 and 3 weeks of the feeding trial. No significant
difference in RBs per hemocyte was observed among prawns fed
the diets containing the HMLE at 3 and 6 g kg
1 after 1e9 weeks of
the feeding trial, compared to the control (Fig. 4B). In addition, no
significant difference was observed in SOD activity of prawns fed
HMLE-containing diets for 1e9 weeks of the feeding trial,
compared to the control (Fig. 4C).
There was no significant difference in TG activities of prawns fed
HMLE-containing diets at 0.6, 3, and 6 g kg
1 after 1e9 weeks of the
feeding trial, compared to those of the control (Fig. 5A). Signifi-
cantly decreased clotting times of prawns fed HMLE-containing
diets were observed after 3e9 weeks of feeding trial, compared
to the control. After 9 weeks of the feeding trial, prawns fed HMLE-
containing diets at 0.6, 3, and 6 g kg
1 had accelerated clotting
times of 0.26-, 0.23-, and 0.22-fold, respectively, compared to the
control (Fig. 5B).
Obviously increased PA activities of prawns fed HMLE-
containing diets at 3 and 6 g kg
1 were observed after 1, 3, and 9
weeks of the feeding trial. Prawns fed the HMLE-containing diet at
0.6 g kg
1 had significantly increased PAs after 1, 3, 5, 7, and 9
weeks of feeding trial by 2.1-, 1.5-, 1.1-, 1.3-, and 1.7-fold, compared
to the control (Fig. 6).

3.3. Immune gene expressions of Mac. rosenbergii fed the HMLE-

containing diets after 9 weeks of the feeding trial

At the end of 9 weeks of the feeding trial, a real-time RT-PCR was

used to assess immune gene expressions. The proPO and TG
expression levels in hemocytes of prawn fed the HMLE-containing
Fig. 1. Mean (±S.E.) of phenoloxidase (PO) activity (A), respiratory bursts (B), and diet at 0.6 g kg
1 after 9 weeks of the feeding trial had significantly
phagocytic activity (C) of hemocytes incubated with different concentrations of the increased by 1.52- and 1.80-fold, respectively, compared to prawns
hot-water Morinda citrifolia leaf extract (HMLE) for 30 min. Each bar represents the fed the control diet. Even though no significant differences in LGBP,
mean value of three determinations. Bars with different letters significantly differ
PE, crustin, or lysozyme expression were found among prawns fed
(P < 0.05).
HMLE-containing diets at 0, 0.6, 3, and 6 g kg
1 after 9 weeks of the
feeding trial, yet the slightly decreased crustin and lysozyme ex-
3.2. Immune responses of Mac. rosenbergii fed the HMLE-
pressions were observed in prawns fed the HMLE-containing diets
containing diets
at 6 g kg
1, compared to those of the control (Table 3).
The THC, HCs, SGCs, and GCs of prawns fed the HMLE-containing
3.4. Susceptibility of Mac. rosenbergii fed the HMLE-containing
diet at 0.6 g kg
1 were significantly higher than those of other
diets to L. garvieae
groups after 1e9 weeks of the feeding trial. After 9 weeks of the
feeding trial, the THC, HCs, SGCs, and GCs had increased by 161.24%,
The challenge test was conducted after 3 weeks of the feeding
159.58%, 138.86%, and 169.99%, respectively, compared to those of
trial. No mortality occurred in the unchallenged controls, and
the control group (Fig. 2AeD).
mortality rates of prawns fed diets containing the HMLE at 0.6 and
PO activities of prawns fed the diet containing the HMLE at
3 g kg
1 were significantly higher than those of prawns fed the
0.6 g kg
1 were significantly higher than those of prawns fed the
6 g kg
1 HMLE-containing diet and the control diet at 24e96 h
control diet after 1e9 weeks of the feeding trial. Although obviously
post-infection. After 144 h of infection, a significantly decreased
462 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468
Fig. 2. Total hemocyte count (THC) (A), hyaline cell (B), semigranular cell (C), and granular cell (D) of Macrobrachium rosenbergii fed the hot-water Morinda citrifolia leaf extract
(HMLE)-containing diets at 0, 0.6, 3, and 6 g kg
1 for 9 weeks of the feeding trial. Each bar represents the mean value of six determinations. Data (mean ± S.E.) with different letters
are significantly different (p < 0.05) among treatment at the same sampling time.
mortality rate of 66.7% ± 5.8% was observed in prawns fed the
HMLE-containing diet at 0.6 g kg
1, and its relative percentage
survival was 23.1% (Table 4).
4. Discussion
In a review, Bulfon et al. [23] stated that the solvent used for
plant extraction can influence the spectrum of antibacterial and
immunomodulatory properties in aquaculture, and in consider-
ation of the effectiveness of extraction, a higher efficiency of
extracting secondary bioactive metabolites (polar and non-polar)
with antimicrobial and immunostimulant activities using inor-
ganic or organic solvents was mentioned compared to those
extracted with water-based methods. The same phenomenon was
also observed in the present study. Polyphenolic compounds,
containing multiple phenolic functionalities, are commonly found
in higher plants, and were found to be potential candidates for use
as drugs [42]. The total phenolic contents of dried noni leaf powder
after being extracted by hot water, ethanol, and methanol were
45.36, 92.38, and 405.05 mg GAE/g of extract, respectively (un-
published data). These results show that extracts of noni leaves
extracted with hot water possessed a lower total phenolic level
than those extracted with organic solvents. However, there has
recently been increasing interest in consuming organic and envi-
ronmentally friendly foods. Air-dried and ground noni leaves
packaged in tea bags as a commercial product are available as a
healthy drink for humans. Therefore, we used noni leaves treated
with hot water as an immunostimulant to promote the immunity of
prawns for a potential strategy in the aquaculture industry.
To evaluate the cellular immunity in shrimp, the hemogram,
radical oxygen intermediates generated during post-phagocytic
events, and PO activity are considered potential markers [43]. In
decapods, the PO activity, RBs, or PA of hemocytes were used as
indicators in several studies to evaluate the potential effects of
extracts on immunity [13,44e46]. In the present study, the PA, RBs
and PO activity of hemocytes were determined to identify the po-
tential stimulation of prawn immunity by the HMLE. Results
showed that hemocytes incubated with the HMLE had upregulated
PO activity, RBs, and PA, which reveals that the HMLE can be used to
generate free radicals and enhance PO activity and PA to eliminate
potential invading agents or to activate immunological responses in
Mac. rosenbergii.
The increased HCs, GCs and THCs, together with an increase in
mitotic cells and the mitotic index of hematopoietic tissues (HPTs)
were identified in Litopenaeus vannamei fed Gracilaria tenuistipitata
extract-containing diets, which supported the proliferation of he-
mocytes [47]. van de Braak et al. [48] claimed that the high varia-
tions in THCs were not accompanied by significant differences in
DHCs in Penaeus monodon, or by regulation of populations of
different hemocyte types in the circulation by (stored) hemocytes
from connective tissues. An increment in the THC was only detec-
ted in Mac. rosenbergii fed the HMLE-containing diet at 0.6 g kg
1
during 9 weeks of the feeding trial, and a similar pattern was
observed for HCs, GCs, and SGCs. These results suggest that the
HMLE might induce the proliferation of hemocytes in HPTs and
promote mobilization of mature granulocytes, which resulted in an
increase in the THC of prawns, and increased THC might improve
innate immunity of prawns following an increase in HCs for
 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468 463

Fig. 3. Phenoloxidase activitiy (PO) and PO per 107 granulocytes (granular and semigranular cells) of Macrobrachium rosenbergii fed the hot-water Morinda citrifolia leaf extract
(HMLE)-containing diets at 0, 0.6, 3 and 6 g kg
1 for 9 weeks of the feeding trial. Statistical descriptions are the same as those given in the legend of Fig. 2.

phagocytosis; SGCs for early recognition, melanization, encapsu-
lation, and coagulation; and GCs for melanization, antimicrobial
peptides, and cytotoxicity [49].
In the present study, prawns fed diets containing higher levels of
the HMLE revealed a minor efficiency in PO activity. Significantly
higher PO activity and PO activity per granulocyte were observed in
prawns fed the HMLE-containing diet at 0.6 g kg
1 than those at 0,
3, and 6 g kg
1. These results show that the PO activity did not
directly increase with the immunostimulant level. The same pat-
terns of PO activity were found in Fenneropenaeus chinensis fed
diets containing Sargassum fusiforme extract [50], and in
L. vannamei fed brown seaweed extract [51]. In addition, signifi-
cantly higher PO activity of hemocytes incubated with the HMLE at
140 mg l
1 than those at 0, 20, and 220 mg l
1 was observed in the
present study. This was considered to be due to the absorption,
digestion ability, and amount of HMLE uptake. It seems that after
prawns ingested the HMLE, metabolic processes and released
compounds might not have revealed the same efficiency as shown
in the in vitro assessment.
During phagocytosis in crustaceans, a series of antimicrobial
substances are generated after hemocytes engulf a microorganism,
which are essential elements for aerobic cells, but cause potential
cytotoxic problems from the generation of highly reactive oxygen
species (ROS) in the respiratory process [52e54]. The effective and
rapid elimination of ROS by antioxidant defense mechanisms
including SOD to scavenge superoxide anions is essential to
maintaining homeostasis and the survival of organisms [53].
Therefore, superoxide anions, the first product released from RBs,
are accepted as an indicator to quantify the intensity of RBs in
decapods [32,55]. In the present study, the RBs of the hemolymph
significantly increased in prawns fed the HMLE-containing diet at
0.6 g kg
1 after 1 week of the feeding trial, and they decreased in
the 3 and 6 g kg
1 groups after 3, 7, and 9 weeks of the feeding trial.
In addition, significantly decreased RBs per hemocyte were only
revealed in the 0.6 g kg
1 group after 1 and 3 weeks of the feeding
trial, and interestingly, SOD activities of prawns fed HMLE-
containing diets were consistent in the meantime. These results
indicated that the HMLE induced RBs without triggering antioxi-
dant enzymes, and the RBs accompanying the release of THC might
be regulated by non-enzyme antioxidants such as the total phenolic
acid detected in the HMLE to maintain proper variations of RBs.
Bachere et al. [52] indicated that hemocytes are involved in
phagocytosis to eliminate microbes and foreign particles in crus-
taceans. The increase in the PA might feasibly suggest an increase in
the activity of hemocytes, which was caused by an alteration in
hemocyte proliferation and may be an indirect effect of increased
464 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468

Fig. 4. Respiratory bursts (RBs) (A), RBs per 107 haemocytes (B), and superoxide dismutase activity (SOD) (C) of Macrobrachium rosenbergii fed the hot-water Morinda citrifolia leaf
extract (HMLE)-containing diets at 0, 0.6, 3 and 6 g kg
1 for 9 weeks of the feeding trial. Statistical descriptions are the same as those given in the legend of Fig. 2.

hemocyte numbers [56]. This phenomenon was further evidenced
in L. vannamei fed diets containing fucoidan [51] or carrageenan
[46], and in Mac. rosenbergii fed diets containing hot-water banana
peel extract [12,57]. In the present study, the induced PA was
observed in the in vitro and in vivo tests, and in addition, the THC
and PA revealed significantly higher levels in prawns fed the HMLE-
containing diet at 0.6 g kg
1 than the other groups. These results
indicated that the HMLE not only induced PA of hemocytes, but also
expanded its efficiency accompanied by an increased THC.
TG is a key enzyme that plays critical roles in blood coagulation,
 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468 465

Fig. 5. Transglutaminase (TG) activity (A) and clotting times (B) of Macrobrachium rosenbergii fed the hot-water Morinda citrifolia leaf extract (HMLE)-containing diets at 0, 0.6, 3 and
6 g kg
1 for 9 weeks of the feeding trial. Statistical descriptions are the same as those given in the legend of Fig. 2.

Fig. 6. Phagocytic activity of Macrobrachium rosenbergii fed the hot-water Morinda citrifolia leaf extract (HMLE)-containing diets at 0, 0.6, 3 and 6 g kg
1 for 9 weeks of the feeding
trial. Statistical descriptions are the same as those given in the legend of Fig. 2.
466 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468

Table 3
Measurement of prophenoloxidase (proPO), lipopolysaccharide-and b- 1,3-glucan-binding protein (LGBP), peroxinectin (PE), transglutaminase (TG), crustin, and lysozyme
mRNA expression in hemocytes of Macrobrachium rosenbergii fed the control diet and the hot-water Morinda citrifolia leaf extract (HMLE)-containing diets at 0.6, 3, and
6 g kg
1 for 9 weeks of the feeding trial by SYBR green real-time RT-PCR. See Fig. 3 for statistical information.

Gene name Concentration of HMLE administrated into diets (g kg
1)

0 0.6 3 6

proPO 1.006 ± 0.134b 1.536 ± 0.157a 0.726 ± 0.134bc 0.649 ± 0.104c

LGBP 1.003 ± 0.104a 1.245 ± 0.285a 1.104 ± 0.154a 0.876 ± 0.226a
PE 1.012 ± 0.186a 1.094 ± 0.167a 0.831 ± 0.101a 0.850 ± 0.259a
TG 1.006 ± 0.139b 1.809 ± 0.218a 1.118 ± 0.093b 0.877 ± 0.330b
Crustin 1.027 ± 0.1146ab 1.310 ± 0.116a 1.122 ± 0.095ab 0.820 ± 0.046b
Lysozyme 1.009 ± 0.171ab 1.422 ± 0.301a 1.358 ± 0.137a 0.609 ± 0.249b

Table 4
The mortality rate and relative percentage survival (RPS) of Macrobrachium rosenbergii fed the different hot-water Morinda citrifolia leaf extract (HMLE) containing diets after 3
weeks of feeding trial and then challenged with Lactococcus garvieae.

Bacterial dose HMLE No. of prawn Mortality (%) at each sampling time (hours)
(cfu prawn
1) (g kg
1)
6 12 24 48 72 96 120 144

saline 0 (control) 30 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0
5  106 0 30 20.0 ± 10.0a 26.7 ± 5.8a 60.0 ± 10.0a 66.7 ± 5.8a 86.7 ± 5.8a 86.7 ± 5.8a 86.7 ± 5.8a 86.7 ± 5.8a
5  106 0.6 30 6.7 ± 5.8a 6.7 ± 5.8b 16.7 ± 5.8b 20.0 ± 0.0b 40.0 ± 10.0b 46.7 ± 5.8b 63.3 ± 11.5b 66.7 ± 5.8b(23.1)P
5  106 3 30 6.7 ± 5.8a 6.7 ± 5.8b 23.3 ± 11.5b 26.7 ± 15.3b 46.7 ± 23.1b 53.3 ± 11.5b 76.7 ± 5.8ab 80.0 ± 0.0ab (7.7)P
5  106 6 30 16.7 ± 11.5a 20.0 ± 10.0ab 50.0 ± 10.0a 60.0 ± 10.0a 86.7 ± 5.8a 86.7 ± 5.8a 86.7 ± 5.8a 86.7 ± 5.8a(0)P

Data in the same column with different letters are significantly differ (p < 0.05) among different treatment. Values are mean ± S.E.
P
Values in parentheses are relative percentage survival (RPS).

TG was shown to be located in hemocytes and the lymphoid organ,
and its expression in HCs was higher than that in GCs and SGCs of
L. vannamei [58,59]. In Mac. rosenbergii, Liu et al. [35] also reported
that coagulation was mediated through clottable proteins (coa-
gulogens) present in the plasma and TG compartmentalized within
circulating hemocytes. The clotting time is measured as an indi-
cator for evaluating the potential effects of immunostimulants on
immunity in decapods. Accelerated clotting times were determined
in Mac. rosenbergii fed diets containing banana peel extract [12,57]
or water hyacinth (E. crassipes) [13], and in Fenneropenaeus indicus
fed diets containing Agathi grandiflora extract then challenged with
white spot syndrome virus [60]. In the present study, TG activity
levels of prawns fed HMLE-containing diets remained consistent
with those of the control group, and meanwhile, significantly
decreased clotting times were observed in the HMLE-treated
groups compared to the control. In addition, obviously higher HCs
were only revealed in prawns fed the HMLE-containing diet at
0.6 g kg
1. These results imply that HMLE administration might not
help reduce coagulation times via enhancing TG activity or HC
counts. Further investigations on the variation of clottable proteins
or potentially active compounds of the HMLE for activating coag-
ulation are needed to clarify this argument.
Expressions of immune genes, including proPO, LGBP, perox-
inectin, TG, crustin, and lysozyme, of prawns fed HMLE-containing
diets after 9 weeks of feeding trial were assessed to contemplate
the potential regulation in mRNA transcripts. LGBP recognizes and
responds to microbial intruders, and is involved in activation of the
proPO system [61]. PE, an associated protein of the proPO system,
has multiple functions of degranulation, encapsulation enhance-
ment, opsonification, and peroxidation [62e65], which are essen-
tial in crustacean cellular defense reactions. In the present study,
PO activity, PO activity per granulocyte, and proPO expression of
prawns fed the HMLE-containing diet at 0.6 g kg
1 significantly
increased after 9 weeks of the feeding trial. The increased PO ac-
tivity might be associated with upregulated proPO expression and
granulocyte count to increase the immunocompetence of prawns.
TG is known to play important roles in clot formation of Mac.
rosenbergii [35]. Antimicrobial peptides (AMPs) are critical in
crustaceans to fight against pathogenic invasion. In a review, Tas-
sanakajon et al. [66] reported that lysozyme caused cell lysis by
cleaving b-1,4-glycosidic linkages between N-acetylmuramic acid
and N-acetylglucosamine in peptidoglycan, and crustin, a cationic
peptide containing a cysteine-rich region and a whey acidic protein
domain, was another AMP member. Fagutao et al. [67] reported
that TG silencing caused downregulated AMP gene expressions
such as crustin and lysozyme, but did not affect proPO. Similar
patterns of significantly increased TG expression accompanied by
slight increases in crustin and lysozyme expressions as well as
significantly increased proPO expression were observed in prawns
fed the HMLE-containing diet at 0.6 g kg
1 after 9 weeks of the
feeding trial. These results imply that feeding prawns the HMLE-
containing diet at 0.6 g kg
1 triggered crustin and lysozyme ex-
pressions, which depended on the induced TG expression, and
upregulated proPO expression might be a consequence of direct
stimulation by potentially active compounds of the HMLE.
The test of the susceptibility of Mac. rosenbergii to L. garvieae
infection was conducted following findings of significantly
increased PA revealed in prawns fed HMLE-containing diets after 3
weeks of the feeding trial. The results indicated that only prawns
fed the HMLE-containing diet at 0.6 g kg
1 had significantly
decreased mortality rate after 12e144 h of infection; however,
those in the 3 and 6 g kg
1 groups after 144 h of infection showed
no significant difference compared to the control. Harikrishnan
et al. [7] reviewed effects of doses and duration on immunosti-
mulants in aquaculture, and they suggested that the effects of
immunostimulants were species specific and hence the threshold
dose to elicit the response, the optimum dose to trigger maximum
immune response, and the efficacy of high doses which may not
enhance or even inhibit the immune response should be investi-
gated for each immunostimulant. In the present study, the
enhanced immunocompetence was investigated in prawns fed the
HMLE-containing diet at 0.6 g kg
1 after 1e9 weeks of the feeding
trial, and in the meantime, the immunocompetence of prawns fed
the HMLE containing diet at 3 and 6 g kg
1 revealed similar pattern
compared to the control group. These results were in agreement
with findings of the susceptibility to infection. It was therefore
 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468
determined that an overdose of the HMLE reduced its efficacy on
immunocompetence and resistance of Mac. rosenbergii. A suitable
dose of the HMLE to obtain the desired effects needs to be further
clarified following quantification of active molecules, the estab-
lishment of adequate doses, and the evaluation of working mech-
anisms of immunity.
In conclusion, the present study demonstrated that feeding Mac.
rosenbergii the HMLE-containing diet at 0.6 g kg
1 improved non-
specific immune responses, including increases in the THC, HCs,
granulocytes, PO activity, RBs, and PA, as well as an accelerated
hemolymph clotting times; all of which contributed to enhanced
resistance to L. garvieae infection.
Acknowledgements
This research was supported by a grant from the Ministry of
Science and Technology (102-2313-B-020 -006 -MY3), Taiwan, ROC.
References
[1] J.P. Hsu, C.I. Liu, Studies on yeast infection in cultured giant freshwater prawn
(Macrobrachium rosenbergii), Fish Dis. Res. 15 (1994) 55e68.
[2] W. Cheng, J.C. Chen, Isolation and characterization of Enterococcus- like
bacterium causing muscle necrosis and mortality in Macrobrachium rose-
nbergii in Taiwan, Dis. Aquat. Organ 34 (1998) 93e101.
[3] A. Rico, T.M. Phu, K. Satapornvanit, J. Min, A.M. Shahabuddin,
P.J.G. Henriksson, F.J. Murray, D.C. Little, A. Dalsgaard, P.J. Van den Brink, Use
of veterinary medicines, feed additives and probiotics in four major interna-
tionally traded aquaculture species farmed in Asia, Aquaculture 412e413
(2013) 231e243.
[4] M. Reverter, N. Bontemps, D. Lecchini, B. Banaigs, P. Sasal, Use of plant extracts
in fish aquaculture as an alternative to chemotherapy: current status and
future perspectives, Aquaculture 433 (2014) 50e61.
[5] D.P. Anderson, Immunostimulants, adjuvants and vaccine carriers in fish:
application to aquaculture, in: M. Faisal, F.M. Hetrick (Eds.), Annual Review of
Fish Diseases, Pergamon Press, New York, 1992, pp. 281e307.
[6] A.K. Siwicki, D.P. Anderson, G. Rumsey, Dietary intake of immunostimulants
by rainbow trout affects non-specific immunity and protection against
furunculosis, Vet. Immunol. Immunopathol. 41 (1994) 125e139.
[7] R. Harikrishnan, C. Balasundaram, M.S. Heo, Review: impact of plant products
on innate and adaptive immune system of cultured finfish and shellfish,
Aquaculture 317 (2011) 1e15.
[8] E. Bachere, Y. Gueguen, M. Gonzalez, J. de Lorgeril, J. Garnier, B. Romestand,
Insights into the anti-microbial defense of marine invertebrates: the penaeid
shrimps and the oyster Crassostrea gigas, Immunol. Rev. 198 (2004) 149e168.
[9] T.H. Ng, Y.A. Chiang, Y.C. Yeh, H.C. Wang, Review of Dscam-mediated im-
munity in shrimp and other arthropods, Dev. Comp. Immunol. 46 (2014)
129e138.
[10] T. Citarasu, Herbal biomedicines: a new opportunity for aquaculture industry,
Aquac. Int. 18 (2010) 403e414.
[11] N. Van Hai, The use of medicinal plants as immunostimulants in aquaculture:
a review, Aquaculture 446 (2015) 88e96.
[12] W. Rattanavichai, W. Cheng, Dietary supplement of banana (Musa acuminata)
peels hot-water extract to enhance the growth, anti-hypothermal stress,
immunity and disease resistance of the giant freshwater prawn, Macro-
brachium rosenbergii, Fish Shellfish Immunol. 43 (2015) 415e420.
[13] C.C. Chang, H.C. Tan, W. Cheng, Effects of dietary administration of water
hyacinth (Eichhornia crassipes) extracts on the immune responses and disease
resistance of giant freshwater prawn, Macrobrachium rosenbergii, Fish Shell-
fish Immunol. 35 (2013) 92e100.
[14] B. Liu, X. Ge, Y. He, J. Xie, P. Xu, Y. He, Q. Zhou, L. Pan, R. Chen, Effects of
anthraquinones extracted from Rheum officinale Bail on the growth, non-
specific immune response of Macrobrachium rosenbergii, Aquaculture 310
(2010) 13e19.
[15] R. Harikrishnan, C. Balasundaram, S. Jawahar, M.S. Heo, Immunomodulatory
effect of Withania somnifera supplementation diet in the giant freshwater
prawn Macrobrachium rosenbergii (de Man) against Aeromonas hydrophila,
Fish Shellfish Immunol. 32 (2012) 94e100.
[16] S.K. Jayaraman, M.S. Manoharan, S. Illancheizan, Antibacterial, antifungal and
tumor cell suppression potential of Morinda citrifolia fruit extracts, Int. J.
Integr. Biol. 3 (2008) 44e49.
[17] Z.M. Zin, A.A. Hamid, A. Osman, N. Saari, Antioxidative activities of chro-
matographic fractions obtained from root, fruit and leaf of Mengkudu (Mor-
inda citrifolia L.), Food Chem. 94 (2000) 169e178.
[18] M. Masuda, K. Muraa, A. Fukuhama, S. Naruto, T. Fujita, A. Uwaya, F. Isami,
H. Matsuda, Inhibitory effects of constituents of Morinda citrifolia seeds on
elastase and tyrosinase, J. Nat. Med. 63 (2009) 267e273.
[19] R. Usha, S. Sashidharan, M. Palaniswamy, Antimicrobial activity of rarely
known species, Morinda citrifoia L, Ethnobot. Leafl. 14 (2010) 306e311.
467
[20] T. Kumaran, D. Devakumar, J. Jayanthi, M.G. Ragunathan, Stimulated immune
response by Morinda tinctoria methanol leaf extract in a Vibrio para-
haemolyticus infected fresh water crab, Oziotelphusa senex senex, Int. J. Curr.
Sci. 5 (2013) 145e152.
[21] R. Harikrishnan, C. Balasundaram, M.C. Kim, J.S. Kim, Y.J. Han, M.S. Heo, Innate
immune response and disease resistance in Carassius auratus by triherbal
solvent extracts, Fish Shellfish Immunol. 27 (2009) 508e515.
[22] M. Divyagnaneswari, D. Christybapita, R.D. Michael, Enhancement of non-
specific immunity and disease resistance in Oreochromis mossambicus by So-
lanum trilobatum leaf fractions, Fish Shellfish Immunol. 23 (2007) 249e259.
[23] C. Bulfon, D. Volpatti, M. Galeotti, Current research on the use of plant-derived
products in farmed fish, Aquac. Res. 46 (2015) 513e551.
[24] M.A. Hossain, K.A.S. Al-Raqmi, Z.H. Al-Mijizy, A.M. Weli, Q. Al-Riyami, Study of
total phenol, flavonoids contents and phytochemical screening of various
leaves crude extracts of locally grown Thymus vulgaris, Asian Pac. J. Trop.
Biomed. 3 (2013) 705e710.
[25] J.B. Peebles, A rapid technique for molt staging in live Macrobrachium rose-
nbergii, Aquaculture 12 (1977) 173e180.
[26] Z.W. Chang, Z.H. Ke, C.C. Chang, Roles of dopamine receptors in mediating
acute modulation of immunological responses in Macrobrachium rosenbergii,
Fish Shellfish Immunol. 49 (2016) 286e297.
[27] B.S. Reddy, K.V.S. Reddy, Proximate composition of the fresh water prawn
Macrobrachium rosenbergii in cultured and frozen stage from Nellore Coast,
India Int. Food Res. J. 21 (2014) 1707e1710.
[28] AOAC, Official Methods of Analyses, sixteenth ed., Association of Official
Analytical Chemists (AOAC), Washington, DC, 1997.
[29] H.S. Mason, Structures and functions of the phenolase complex, Nature 177
(1956) 79e81.
[30] J. Hern
andez-Lo
pez, T.S. Gollas-Galva
n, F. Vargas-Albores, Activation of the
prophenoloxidase system of the brown shrimp (Penaeus californiensis
Holmes), Comp. Biochem. Physiol. 113C (1996) 61e66.
[31] K.L. Bell, V.J. Smith, In vitro superoxide production by hyaline cells of the
shore crab Carcinus maenas (L.), Dev. Comp. Immunol. 17 (1993) 211e219.
[32] Y.L. Song, Y.T. Hsieh, Immunostimulation of tiger shrimp (Penaeus monodon)
hemocytes for generation of microbicidal substances: analysis of reactive
oxygen species, Dev. Comp. Immunol. 18 (1994) 201e209.
[33] G. Biagini, D. Sala, I. Zini, Diethyldithiocarbamate, a superoxide dismutase
inhibitor, counteracts the maturation of ischemic-like lesions caused by
endothelin-1 intrastriatal injection, Neurosci. Lett. 90 (1995) 212e216.
[34] J.E. Folk, P.W. Cole, Identification of a functional cysteine essential for the
activity of Guinea pig liver transglutaminase, J. Biol. Chem. 241 (1966)
3238e3240.
[35] C.H. Liu, C.C. Chang, Y.C. Chiu, W. Cheng, M.S. Yeh, Identification and cloning
of a transglutaminase from giant freshwater prawn, Macrobrachium rose-
nbergii, and its transcription during pathogen infection and moulting, Fish
Shellfish Immunol. 31 (2011) 871e880.
[36] I.H. Tsai, Y.L. Chen, P.J. Lu, Relationship between haemolymph-coagulation
and disease in shrimp: coagulation rate in vitro and the haemolymph pro-
teins of various shrimp species, COA Fish. Ser. 29 (1991) 22e30.
[37] J. Jussila, S. Mc Bride, J. Jago, L.H. Evans, Haemolymph clotting time as an
indicator of stress in western rock lobster (Panuliruscygnus George), Aqua-
culture 199 (2001) 185e193.
[38] J.P. Hsu, C. Huang, C.M. Liao, S.L. Hsuan, H.H. Hung, M.S. Chien, Engulfed
pathogen-induced apoptosis in haemocytes of giant freshwater prawn, Mac-
robrachium rosenbergii, J. Fish. Dis. 28 (2005) 729e735.
[39] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta DeltaC(T)) method, Methods 25
(2001) 402e408.
[40] S.C. Chen, Y.D. Lin, L.L. Liaw, P.C. Wang, Lactococcus garvieae infection in the
giant freshwater prawn Macrobrachium rosenbergii confirmed by polymerase
chain reaction and 16s rDNA sequencing, Dis. Aquat. Organ 45 (2001) 45e52.
[41] D.F. Amend, Potency testing of fish vaccines, International symposium on fish
Biologics: Serodiagnostics and Vaccines, Dev. Biol. Stand 49 (1981) 447e454.
[42] J.G. Handique, J.B. Baruah, Polyphenolic compounds: an overview, React.
Funct. Polym. 52 (2002) 163e188.
[43] J. Rodríguez, G. Le Moullac, State of the art of immunological tools and health
control of penaeid shrimp, Aquaculture 191 (2000) 109e119.
[44] M. Suphantharika, P. Khunrae, P. Thanardkit, C. Verduyn, Preparation of spent
brewer's yeast b-glucans with a potential application as an immunostimulant
for black tiger shrimp, Penaeus monodon, Bioresour. Tech. 88 (2003) 55e60.
[45] J.A. Xian, A.L. Wang, J.X. Tian, J.W. Huang, C.X. Ye, W.N. Wang, R.Y. Sun,
Morphologic, physiological and immunological changes of haemocytes from
Litopenaeus vannamei treated by lipopolysaccharide, Aquaculture 298 (2009)
139e145.
[46] Y.Y. Chen, J.C. Chen, Y.C. Lin, D.F. Putra, S. Kitikiew, C.C. Li, J.F. Hsieh, C.H. Liou,
S.T. Yeh, Shrimp that have received carrageenan via immersion and diet
exhibit immunocompetence in phagocytosis despite a post-plateau in im-
mune parameters, Fish Shellfish Immunol. 36 (2014) 352e366.
[47] N. Sirirustananun, J.C. Chen, Y.C. Lin, S.T. Yeh, C.H. Liou, L.L. Chen, S.S. Sim,
S.L. Chiew, Dietary administration of a Gracilaria tenuistipitata extract en-
hances the immune response and resistance against Vibrio alginolyticus and
white spot syndrome virus in the white shrimp Litopenaeus vannamei, Fish
Shellfish Immunol. 31 (2011) 848e855.
[48] C.B.T. van de Braak, M.H.A. Botterblom, W. Liu, N. Taverne, W.P.W. van der
Knaap, J.H.W.M. Rombout, The role of the haematopoietic tissue in haemocyte
468 A. Marisa Halim et al. / Fish & Shellfish Immunology 64 (2017) 457e468
production and maturation in the black tiger shrimp (Penaeus monodon), Fish
Shellfish Immunol. 12 (2002) 253e272.
[49] X. Lin, I. So€derha€ll, Crustacean hematopoiesis and the astakine cytokines,
Blood 117 (2011) 6417e6424.
[50] X.H. Huang, H. Zhou, H. Zhang, The effect of Sargassum fusiforme poly-
saccharides extracts on vibriosis resistance and immune activity of the shrimp
Fenneropenaeus chinensis, Fish Shellfish Immunol. 20 (2006) 750e757.
[51] S. Kitikiew, J.C. Chen, D.F. Putra, Y.C. Lin, S.T. Yeh, C.H. Liou, Fucoidan effec-
tively provokes the innate immunity of white shrimp Litopenaeus vannamei
and its resistance against experimental Vibrio alginolyticus infection, Fish
Shellfish Immunol. 34 (2013) 280e290.
[52] E. Bachere, E. Mialhe, D. Noel, V. Boulo, A. Morvan, J. Rodriguez, Knowledge
and research prospects in marine mollusk and crustacean immunology,
Aquaculture 132 (1995) 17e32.
[53] T. Homblad, K. So €derha €ll, Cell adhesion molecules and antioxidative enzymes
in a crustacean, possible role in immunity, Aquaculture 172 (1999) 111e123.
[54] M. de la Fuente, V.M. Victor, Anti-oxidants as modulators of immune function,
Immunol. Cell Biol. 78 (2000) 49e54.
[55] K. Sritunyalucksana, P. Sithisarn, B. Withayachumnarnkul, T.W. Flegel, Acti-
vation of prophenoloxidase, agglutinin and antibacterial activity in haemo-
lymph of the black tiger prawn, Penaeus monodon, by immunostimulants, Fish
Shellfish Immunol. 9 (1999) 21e30.
[56] R.P. Ellis, H. Parry, J.I. Spicer, T.H. Hutchinson, R.K. Pipe, S. Widdicombe,
Immunological function in marine invertebrates: responses to environmental
perturbation, Fish Shellfish Immunol. 30 (2011) 1209e1222.
[57] W. Rattanavichai, Y.N. Chen, C.C. Chang, W. Cheng, The effect of banana (Musa
acuminata) peels hot-water extract on the immunity and resistance of giant
freshwater prawn, Macrobrachium rosenbergii via dietary administration for a
long term: activity and gene transcription, Fish Shellfish Immunol. 46 (2015)
378e386.
[58] M.S. Yeh, C.H. Liu, C.W. Hung, W. Cheng, cDNA cloning, identification, tissue
localistion, and transcription profile of a transglutaminase from white shrimp,
Litopenaeus vannamei, after infection by Vibrio alginolyticus, Fish Shellfish
Immunol. 27 (2009) 748e756.
[59] M.S. Yeh, W.L. Tsai, W. Cheng, Identification and cloning of the second type
transglutaminase from Litopenaeus vannamei, and its transcription following
pathogen infection and in relation to the haemolymph coagulation, Fish
Shellfish Immunol. 35 (2013) 1613e1623.
[60] F. Bindhu, S. Velmurugan, M.B. Donio, M. Michaelbabu, T. Citarasu, Influence
of Agathi grandiflora active principles inhibit viral multiplication and stimulate
immune system in Indian white shrimp Fenneropenaeus indicus against white
spot syndrome virus infection, Fish Shellfish Immunol. 41 (2014) 482e492.
[61] S. Iwanaga, S. Kawabata, Y. Miura, N. Seki, T. Shigenaga, T. Muta, Clotting
cascade in the immune response of horseshoe crab, in: C.A. Hoffmann,
J.R. Janeway, S. Natori (Eds.), Phylogenetic Perspectives in Immunity: the In-
sect Host Defense, Landes RG, Austin, TX, 1994, pp. 79e96.
[62] M.W. Johansson, K. So €derha
€ll, Cellular immunity in crustaceans and the proPO
system, Parasitol 5 (1989) 171e176.
[63] M. Kobayashi, M.W. Johansson, K. So €derha€ll, The 76 kDa cell-adhesion factor
from crayfish haemocytes promotes encapsulation in vitro, Cell Tissue Res.
260 (1990) 113e118.
[64] P.O. Tho€rnqvist, M.W. Johansson, K. So €derha€ll, Opsonic activity of cell adhe-
sion proteins and b-1,3-glucan-binding proteins from two crustaceans, Dev.
Comp. Immunol. 18 (1994) 3e12.
[65] M.W. Johansson, M.I. Lind, T. Holmblad, P.O. Tho €rnqvist, K. So
€derha€ll, Perox-
inectin, a novel cell adhesion protein from crayfish, Biochem. Biophys. Res.
Comm. 216 (1995) 1079e1087.
[66] A. Tassanakajon, K. Somboonwiwat, S. Premruethai, T. Sureerat, Discovery of
immune molecules and their crucial functions in shrimp immunity, Fish
Shellfish Immunol. 34 (2013) 954e967.
[67] F.F. Fagutao, M.B.B. Maningas, H. Kondo, T. Aoki, I. Hirono, Transglutaminase
regulates immune-regulated genes in shrimp, Fish Shellfish Immunol. 32
(2012) 711e715.
[68] J.R. Alambra, R.R.R. Alenton, P.C.R. Gulpeo, C.L. Mecenas, A.P. Miranda,
R.C. Thomas, M.K.S. Velando, L.D. Vitug, M.B.B. Maningas, Immunomodulatory
effects of turmeric, Curcuma longa (Magnoliophyta, Zingiberaceae) on Mac-
robrachium rosenbergii (Crustacea, Palaemonidae) against Vibrio alginolyti-
cus (Proteobacteria, Vibrionaceae), AACL Bioflux 5 (2012) 13e17.