Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Viral and bacterial contamination in recreational waters: a

case study in the Lisbon bay area
A.M. Silva1, H. Vieira2, N. Martins1, A.T.S. Granja1, M.J. Vale1 and F.F. Vale1
1 Faculty of Engineering, Catholic University of Portugal, Estrada Octávio Pato, Rio de Mouro, Portugal
2 BIOALVO SA, Edifı́cio ICAT, Campus da FCUL, Lisbon, Portugal

Keywords
bacterial indicators, bathing water quality,
hepatitis A virus, norovirus, RT-PCR.
Correspondence
Filipa F. Vale, Faculty of Engineering, Catholic
University of Portugal, Estrada Octávio Pato,
2635-631 Rio de Mouro, Portugal.
E-mail: filipavale@fe.ucp.pt
2009 ⁄ 1004: received 5 June 2009, revised 7
July 2009 and accepted 22 July 2009
doi:10.1111/j.1365-2672.2009.04503.x
Abstract
Aims: To assess the presence of viral pathogens in bathing water samples and to
evaluate the interdependency of bacterial indicator counts and viral detection.
Methods and Results: Bathing water samples of 16 beaches collected along a
Portuguese Coastal area were screened for the hepatitis A virus (HAV) and
norovirus genogroup I (NVGI) using RT-PCR technique. Bacteriological water
quality was also assessed, according to European regulations. HAV and NVGI
were detected in 95% and 27% of the water samples, respectively, whereas
bacteriological quality was good in all but one sample, according to current
water quality regulations.
Conclusions: All water samples would be considered of excellent quality
according to the most recent European regulations. No relationship between
viral detection and regulatory-based bacterial indicators was found.
Significance and Impact of the Study: The current results reinforce the
importance of increased surveillance for pathogenic viruses in bathing waters.

recreational waters, the mandatory indicators are E. coli and

Introduction
The quality of both drinking and recreational waters is a
growing concern within national and international regula-
tory bodies. The World Health Organization (WHO)
states that almost one-tenth of the global disease burden
could be prevented by improving water supply, sanitation,
hygiene and water resources management. The same orga-
nization estimates that around 1Æ5 million deaths per year
could be avoided if these measures were implemented
(Prüss-Üstün et al. 2008).
Applying bacterial indicators is still the most widely used
procedure to assess the microbiological quality of water.
This is based on the principle that their presence in water
may indicate faecal pollution and possible association with
enteric pathogens. According to EU and national regula-
tions, current legally enforced indicator micro-organisms
for drinking water are total coliform bacteria, Escherichia
coli, enterococci and Clostridium perfringens (Diário da
República Decree no. 306 ⁄ 2007, which acknowledges
European Council Directive 98 ⁄ 83 ⁄ CE). In Europe, for
faecal enterococci (European Council Directive 2006 ⁄ 7 ⁄ EC)
or, for countries such as Portugal, where adoption of the
European Directive is still pending, are the total and faecal
coliforms (Diário da República Decree no. 236 ⁄ 1998, which
acknowledges European Council Directive 76 ⁄ 160 ⁄ EC).
However, the European Council Directive 2006 ⁄ 7 ⁄ EC,
concerning the management of bathing water quality, and
the repealing Directive 76 ⁄ 160 ⁄ EEC appear to lack a firm
epidemiological foundation (Bartram and Fewtrell 2001).
The main difference between these directives concerning
indicator bacteria is the substitution of coliform bacteria for
E. coli. This change is due because one of the prerequisites of
suitable indicator bacteria is that they should be identified to
the species level.
Viruses have long been known to be important aetio-
logical agents of waterborne diseases. The capacity of
indicator bacteria to reflect the occurrence, concentration
and potential risks to human health from pathogenic
human viruses started to be questioned about 30 years
ago (Gerba et al. 1979) because of the apparent lack of a

ª 2009 The Authors

Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031 1023
Viral detection in bathing waters
relationship between virus and indicator bacteria present
(Gerba et al. 1979; Noble and Fuhrman 2001; Rose et al.
2006). This lack of relationship could be because of their
morphological and physicochemical differences, which
may allow viruses to remain viable for longer periods of
time in water, under a wider range of physicochemical
conditions, including wastewater treatments that eliminate
bacteria (Metcalf et al. 1995; Fong and Lipp 2005).
Common pathogenic viruses found in recreational
waters include hepatitis A virus (HAV), rotaviruses, noro-
viruses, adenoviruses and enteroviruses. These can cause
illness when ingested or contacted with, including gastro-
enteritis, diarrhoea and eye infections, to more severe
conditions such as hepatitis, paralysis, meningitis, respira-
tory tract infections and myocarditis (Fong and Lipp
2005). In addition to causing acute diseases, they are of
public health concern because of their low infectious
dose. Moreover, there have been several virus-related out-
breaks (confirmed or suspected) linked to the ingestion
of and contact with waters that meet faecal coliform stan-
dards (Fong and Lipp 2005).
Despite their relevance as possible aetiological agents,
the detection of viruses in water samples has been limited
by two main constraints: (i) the generally low concentra-
tion of target viruses in aquatic samples, which requires
sample concentration and purification to obtain sufficient
target sequences and limit carryover of assay inhibitors
(metal ions, humic and fulvic acids and phenolic com-
pounds); (ii) the need for culturing in human ⁄ mamma-
lian cell lines, leading to long processing times, lower
sensitivity and lack of cell lines for many viruses of
concern (Fong and Lipp 2005; Jiang 2006).
The detection of viruses using molecular biology tools
has been extensively used since 1990, either directly from
concentrated samples or following cell culture. Polymer-
ase chain reaction (PCR) and several of its variations such
as multiplexed PCR, nested PCR or real-time PCR are
faster, more sensitive and more specific than traditional
cell culture methods. However, increased false positive
rates may occur because of cross-contamination. Likewise,
false negative results, because of the inhibition of the
assay by compounds in the concentrated sample and the
inability to determine viability are also limits of this
approach (Fong and Lipp 2005; Jiang 2006). These facts,
together with the traditional high cost of equipment and
consumables have delayed the implementation of molecu-
lar tools as standard methods for viral detection and
monitoring.
Many coastal recreational and bathing water areas
across the developed world are located near urban areas,
and thus, are subject to contamination, which can lead to
public health problems. The study area selection followed
this assumption. The Lisbon bay area (Portugal, Europe)
1024 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
A.M. Silva et al.
is a densely populated region, with more than one million
inhabitants. Several recreational and bathing areas are
present along the coastline in the Tagus estuary and
Atlantic coast; some of them are in close proximity to
important urban centres (Lisbon, Oeiras and Cascais,
among others). Three main effluents of wastewater treat-
ment plants (WWTP) drain either to the Tagus River or to
the Atlantic Ocean. The WWTP have an average daily out-
put of approximately 50 000 m3 day)1, corresponding to
the treatment of 280 000 m3 day)1 of wastewater. Two of
them discharge directly into the estuary (22 000 m3 day)1),
upstream of the recreational areas. The third, which serves
the populations of the municipalities directly associated
with the recreational areas, has a single submarine point of
discharge, 45 m deep and 2Æ7 km offshore.
The detection of enteroviruses is only to be determined
in case of suspected outbreaks (Diário da República
Decree no. 236 ⁄ 1998), and no published information was
found regarding the assessment of viral contamination in
Portuguese waters intended for human use, either by
molecular or by cell culture methods.
The present study assessed the presence of viral patho-
gens in bathing water samples of the Lisbon coastal area,
namely HAV and norovirus genogroup I (NVGI), using
reverse transcription PCR (RT-PCR). Standard bacterio-
logical indicators of water quality were also determined to
evaluate whether currently used microbiological indicators
reflect viral contamination.
Material and methods
Sampling sites
In a first round of collection, two 1-l bathing water sam-
ples were collected in 16 beaches from the Lisbon coastal
area from May to July 2008 (Fig. 1 and Table 1). One of
the 1-l samples was used for viral detection, and the sec-
ond for bacteriological water quality assessment. From
these 16 beaches, three of them were randomly chosen
within the study area, for a second and a third round of
collection in September 2008 (Table 1) to confirm the
results obtained in the first round.
RNA extraction of positive viral controls
Positive controls of HAV and NVGI were considered. The
HAV strain HM175 was obtained from the National Insti-
tute for Biological Standards and Control (South Mimms,
UK); NVGI-positive stool samples were generously
donated by the Centre for Environment, Fisheries and
Aquaculture Science (Weymouth, UK). Viral RNA was
extracted using the QIAamp viral RNA mini kit (Qiagen,
Hilsen, Germany), according to the manufacturer’s
ª 2009 The Authors
A.M. Silva et al. Viral detection in bathing waters

(a)
(b)

USBOA
CASCAIS OEIRAS

(c)

(a)

Figure 1 The coastal Lisbon Metropolitan

Area reference map: (a) located within the
European context; (b) located within the
Lisbon Metropolitan Area; (c) detailed view of
the study area, at a local level, showing an
extract of the exact sample locations, at
Oeiras and Lisbon municipalities, within the
Tagus estuary. Basis imaging and cartography
information: Portuguese Geographical
Institute; Lanstat 5 TM – 30 m (September
1998); colour composition: band 5 – band
4 – band 3; ortophotos – August 2007;
pixel: 50 cm; three RGB bands; original scale:
1 : 5000.

instructions, eluted in 60 ll of RNase-free water and stored
at )80C until further use.
Virus concentration from bathing water samples
For viral detection, water samples were passed through
sterile membranes of 0Æ45 lm pore for bacteria removal,
and pH was adjusted to 7Æ0. Water samples were concen-
trated using a positively charged membrane Sartobind
Q75 (Sartorius, Goettingen, Germany). Membranes were
initially rinsed with TE buffer (10 mmol l)1 Tris adjusted
to pH 7Æ0 with HCl, spiked with 1 mmol l)1 EDTA).
Samples were pumped through the membranes using a
peristaltic pump (Braun, Melsungen, Germany) at a flow
rate of 10 ml min)1. Membranes were then washed with
10 ml of TE buffer. The bound viral particles were eluted
using 10 ml 0Æ5 mmol l)1 NaCl solution (Specht et al.
2004). Afterwards, a second concentration step was per-
formed using Amicon Ultra-15 Centrifugal Filter Devices
(Millipore, Carrigtwohill, Ireland). Besides concentration,
this second step allows to wash the sample, by removing
inhibitors of DNA polymerase. Samples obtained in the
first concentration step were added to these filter units
and centrifuged at 4000 g for 15 min. After a wash step,
concentrated samples were recovered in 140 ll of RNase-
free water and stored at )80C. Viral RNA was extracted
from concentrated samples as described in the previous
subsection.
RT-PCR
Viral RNA was used in the cDNA synthesis with the First
Strand cDNA synthesis kit (Fermentas, Canada), accord-
ing to the manufacturer’s instructions, using oligo(dT)18
primers.
In a total volume of 50 ll, the cDNA was mixed with 1 ·
(NH4)2SO4 buffer [75 mmol l)1 Tris–HCl, 20 mmol l)1
(NH4)2SO4 and 0Æ01% (v ⁄ v) Tween 20], 3 mmol l)1
MgCl2, 0Æ2 mmol l)1 dNTPs, 1 lmol l)1 of primers spe-
cific for each viral group (Invitrogen, USA) and 1U Taq

ª 2009 The Authors

Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031 1025
Viral detection in bathing waters A.M. Silva et al.

Table 1 Water quality assessment of the 16 bathing water samples from the Lisbon geographic area. Coordinates of the sampling sites,
collection dates, bacteriologic water quality parameters and results of the PCR for the detection of hepatitis A virus (HAV) and norovirus geno-
group I (NVGI) are shown

Geographical Bacteriologic Bacteriologic

Coordinates Water Water
Site (ETRS89)* Date TC FC quality§ EC– FE** quality HAV NVGI

Belém 3841¢30¢’N 29 May 2008 120 100 Good 10 83 Excellent + )

912¢55¢’W
Torre 3840¢33¢’N 2 June 2008 50 30 Good 30 3 Excellent + )
919¢16¢’W
Carcavelos 3840¢35¢’N 2 June 2008 51 51 Good 10 14 Excellent + )
919¢44¢’W 3 September 2008 15 8 Good 7 2 Excellent + )
5 September 2008 22 10 Good 8 4 Excellent ) +
Parede 3841¢7¢’N 4 June 2008 180 180 Acceptable 10 16 Excellent + )
921¢11¢’W
Avencas 3841¢15¢’N 4 June 2008 80 80 Good 10 14 Excellent + +
921¢35¢’W
Bafureira 3841¢30¢’N 6 June 2008 20 1 Good 1 4 Excellent + )
921¢56¢’W 3 September 2008 3 2 Good 2 0 Excellent + +
5 September 2008 4 2 Good 2 1 Excellent + )
S. Pedro Estoril 3841¢33¢’N 6 June 2008 58 58 Good 0 2 Excellent + )
922¢5¢’W
Azarujinha 3842¢2¢’N 13 June 2008 100 10 Good 0 0 Excellent + )
923¢21¢’W
Poça 3842¢5¢’N 13 June 2008 70 10 Good 10 0 Excellent + )
923¢27¢’W
Tamariz 3842¢7¢’N 20 June 2008 20 3 Good 1 10 Excellent + )
923¢55¢’W
Moitas 3842¢6¢’N 20 June 2008 1 1 Good 0 2 Excellent + )
924¢31¢’W
Conceição ⁄ Duquesa 3842¢3¢’N 25 June 2008 100 100 Good 100 50 Excellent + )
924¢51¢’W
Rainha 3841¢57¢’N 25 June 2008 230 100 Good 100 48 Excellent + )
925¢4¢’W
Cresmina 3843¢25¢’N 2 July 2008 0 0 Good 0 0 Excellent + +
928¢39¢’W
Guincho 3843¢48¢’N 2 July 2008 1 0 Good 0 2 Excellent + +
928¢30¢’W 3 September 2008 3 0 Good 0 1 Excellent + )
5 September 2008 1 1 Good 0 6 Excellent + +
Abano 3844¢29¢’N 2 July 2008 10 1 Good 1 0 Excellent + )
928¢24¢’W

*European Terrestrial Reference System 89; (Ihde, J., Luthardt, J., Boucer, C., Dunkley, P., Farrell, B., Gubler, E. and Torres, J., personal communi-
cation) European Spatial Reference Systems – Frames for Geoinformation Systems; http://www.crsgeo.eu/crseu/EN/References/Elemente/pub01
EuropeanSpatialRefernceSystems,templateId=raw,property=publicationFile.pdf/pub01EuropeanSpatialRefernceSystems.pdf
TC, total coliforms in 100 ml: good: £500; acceptable: 500 < TC £ 10 000; poor: >10 000.
FC, faecal coliforms in 100 ml: good: £100; acceptable: 100 < FC £ 2000; poor: >2000.
§According to Diário da República Decree no. 236 ⁄ 1998.
–EC, Escherichia coli in 100 ml: excellent: £250; good ⁄ sufficient: 250 < EC £ 500; poor: >500.
**FE, faecal enterococci in 100 ml: good: £100; good ⁄ sufficient: 100 < FE £ 185; poor: >185.
According to European Council Directive 2006 ⁄ 7 ⁄ EC.

Polymerase (Fermentas). After the initial denaturation at
94C, PCR amplification was performed for 35 cycles, with
each cycle consisting of 94C for 1 min, 60C (NVGI) or
66Æ5C (HAV) for 1 min and 72C for 1 min. The final
extension was performed at 72C for 5 min. The PCR
products were analysed by electrophoresis in a 2% agarose
gel stained with ethidium bromide (Sigma-Aldrich, USA),
visualized under UV light (UVIvue SXT-20M; Uvitec,
Cambridge, UK) and documented using a Kodak Gel
Logic 100 Imaging System (Kodak, USA).
To amplify by PCR highly conserved genomic regions,
revealed by ClustalW (Chenna et al. 2003), viral-specific

ª 2009 The Authors

1026 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
A.M. Silva et al.
primers were used. For HAV, primer sequences targeted
the genomic region corresponding to the interface of the
VP1 and VP3 capsid proteins and were identical to those
described previously (De Leon et al. 1990), except for the
addition of BamHI and KpnI restriction sites for cloning
(Table 2). Primer sequences for NVGI primer sequences
were designed specifically for this study to amplify the
genomic region corresponding to the interface of ORF1
and ORF2 and also have BamHI and KpnI restriction
sites for cloning (Table 2).
For PCR optimization, cloning and sequencing of the
amplicons, a first group of PCR was performed using
only the viral control samples. Bands with the desired
molecular weight were removed from the gel and purified
with QIAquickGel Extraction kit (Qiagen). The PCR
products were stored at )20C until further use. The
NVGI-positive stool sample was completely used in this
first group of reactions, so it was not possible to use it as
positive control of the bathing water samples.
For bathing water samples, when bands with the
desired molecular weight were not detected, a second
round of PCR was performed for each viral group.
Cloning and sequencing of HAV and NVGI probes
For viral control samples, HAV and NVGI PCR products
were digested with BamHI and KpnI (Fermentas) over-
night at 37C. The pBluescript II KS (+) vector (pBS KS;
Fermentas) was digested with the same restriction
enzymes for 2 h at 37C, followed by digestion with calf
intestine alkaline phosphatase (Fermentas) for 30 min at
37C. Ligation of inserts and vector was performed by T4
ligase (Invitrogen) in 1 : 1, 1 : 3 and 1 : 5 proportions
(vector : insert) for 1Æ5 h at 24C in a final volume of
10 ll. The total volume was used to transform competent
E. coli XL1B (donated by Bioalvo, S.A.). The cells were
incubated at 37C for 15 h in LB medium supplemented
with ampicillin (100 lg ml)1), IPTG (0Æ1mmol l)1) and
X-Gal (20mg ml)1) (Fermentas). Presumptive colonies
were screened for the presence of inserts. Plasmid DNA
was extracted with QIAprep Spin Miniprep kit (Qiagen),
according to the manufacturer’s instructions, and digested
with BamHI and KpnI. After insert sequencing, the
Table 2 List of primer sequences used for hepatitis A virus (HAV) and norovirus genogroup I (NVGI) detection
Primer
Target name Primer sequence (5¢–3¢)
HAV HAV-F CGGGATCCGCAGCACATCAGAAAGGTGAG*
HAV-R GGGGTACCCCTCCAGAATCATCTCCAAC
NVGI NVGI-F CGGGATCCCGTGGCAGGCCATGTTCCGCTG
NVGI-R GGGGTACCCCTAGACGCCATCATCATTTAC
*Restriction sites for BamHI (GGATCCC) and KpnI (GGATCC) used for cloning in pBluescript KS(+) are underlined.
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
Viral detection in bathing waters
sequences were introduced in Blast (Altschul et al. 1997)
for specificity confirmation.
Bacteriological water quality assessment
Bacteriological water quality was assessed for all samples
by standard methods, according to both the Portuguese
(Diário da República Decree no. 236 ⁄ 1998) and the
European (European Council Directive 2006 ⁄ 7 ⁄ EC) regu-
lations. For the bacteriological water quality assessment,
the membrane filtration technique combined with selec-
tive culture media for each parameter was used. Water
samples were filtrated through sterile membranes of
0Æ45 lm pore (Macherey-Nagel, Düren, Germany), using
a vacuum pump (Vacuubrand, Wertheim, Germany).
Each membrane was incubated in a selective medium at
an appropriate temperature: (i) for detection of total coli-
form bacteria, the membrane was incubated in m-lauryl
sulfate agar (MLSA; Sigma-Aldricht) medium at 36 ± 2C
for 24 h, and the yellow colonies tested for the absence of
oxidase activity, (ii) for detection of faecal coliform bacte-
ria, the membrane was incubated in MLSA medium at
44 ± 0Æ5C for 24 h, and the yellow colonies tested for
absence of oxidase activity, (iii) for detection of E. coli, an
oxidase negative yellow colony, grown in MLSA medium,
was transferred to Fluorocult medium (Merck, Germany)
and tested for the presence of glucuronidase enzyme and
for the production of indole from tryptophan after addi-
tion of Kovacs reagent (Merck) and (iv) for detection of
faecal enterococci, membrane was incubated in Slanetz
and Bartley agar medium (Oxoid, Cambridge, UK) at
36 ± 2C for 48 h, and the red colonies were transferred
to the Bile Aesculin agar medium (Merck) and tested for
the hydrolysis of aesculin (Clesceri et al. 1999).
Statistical analysis
The association between bacteriological water quality
categories and presence or absence of viral contamination
was tested via one-sided Fisher exact tests (statistica,
ver. 8; Statsoft, Tulsa, OK, USA). The relationship between
bacterial counts and viral presence was evaluated using a
binary logistic regression model (statistica, ver. 8).
Amplicon size
(bp, expected) Reference
212 bp De Leon et al. (1990)
118 bp Current study
1027
Viral detection in bathing waters A.M. Silva et al.

average bacterial counts were 52, 34, 14 and

Results
Cloning and sequencing of amplified HAV and NVGI
cDNA from control samples
Amplified cDNA from HAV and NVGI strains in water
samples were cloned into pBS KS to be sequenced and to
develop an accessible source of those cDNAs. The Blast
results of the sequenced products confirmed the identity
of the amplicons (results not shown).
Detection of HAV and NVGI in bathing water samples
After confirmation of primer pair specificity towards the
intended products, viral content of bathing water samples
was evaluated by RT-PCR. The RT-PCR results corre-
sponding to the first round of water samples collection
(Fig. 2) and second and third rounds of water samples
collection (Fig. 3) are shown for the HAV primer pair
(Figs 2a and 3) and NVGI primer pair (Figs 2b and 3).
Water samples were considered positive for the tested
viral group when bands of the expected size (Table 2)
were detected. Results are presented in Table 1. Overall,
95% of the samples were positive for HAV, whereas
NVGI was detected in 27% of the samples. In all samples,
either one or both types of viral contamination were
found. The latter case was found in 22% of the samples.
Bacteriological water quality
The results from the bacteriological water quality assess-
ment are presented in Table 1. Across all sampling sites,
12 CFU 100 ml)1 for total coliforms, faecal coliforms,
E. coli and faecal enterococci counts, respectively.
According to current Portuguese regulations (Diário da
República Decree no. 236 ⁄ 1998), all bathing water sam-
ples were considered of good quality except the Parede
beach water sample, which was considered acceptable.
According to the new European Community Directive
2006 ⁄ 7 ⁄ EC, all water samples would be considered of
excellent quality.
No association between bacteriological water quality
and viral contamination was found, either for HAV or
for NVGI (Fisher’s exact test, P = 0Æ95 and P = 0Æ53,
respectively). There was also no relationship between
bacterial counts and viral detection (P > 0Æ15 for all
regressions).
Discussion
The suitability of current bacterial indicators to assess
water quality is a controversial issue among microbiolo-
gists. Viruses are still not currently screened for, and few
studies performed the evaluation of viral water quality of
coastal waters (Rose et al. 2006). Presently, the mandatory
microbiological assessment of bathing water quality is
based only in the presence of two types of bacterial indi-
cators, above determined thresholds: faecal enterococci
and E. coli (European Community Directive 2006 ⁄ 7 ⁄ EC)
or total and faecal coliforms (Diário da República Decree
no. 236 ⁄ 1998). The inclusion of viruses in the list of
organisms to be detected in water quality assessment has
been suggested several times (Griffin et al. 2003; Fong

(a) M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M

200 bp HAV + (212 bp)

100 bp

(b) M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M

200 bp NVGI + (118 bp)

100 bp

Figure 2 Gel electrophoresis of the RT-PCR products of hepatitis A virus (HAV; a), norovirus genogroup I (NVGI; b) amplification from 16 bathing
water samples. All gel electrophoresis correspond to second round PCRs except (a) which is a first round. The conserved genomic regions have
222 bp (HAV+) and 118 bp (NVGI+); NS, non specific amplifications. Lanes: M, 100-bp DNA ladder (Invitrogen) with 16 fragments raging from
the top: 2072, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 bp. (a) 1, Belém; 2, Torre; 3, Carcavelos;
4, Parede; 5, Avencas; 6, Bafureira; 7, S. Pedro Estoril; 8, Azarujinha; 9, Poça; 10, Tamariz; 11, Moitas; 12, Conceição ⁄ Duquesa; 13, Rainha; 14,
Cresmina; 15, Guincho; 16, Abano; 17, HAV cDNA; 18, PCR negative control. (b) 1, Belém; 2, Torre; 3, Carcavelos; 4, Parede; 5, Avencas; 6,
Bafureira; 7, S. Pedro Estoril; 8, Azarujinha; 9, Poça; 10, Tamariz; 11, Moitas; 12, Conceição ⁄ Duquesa; 13, Rainha; 14, Cresmina; 15, Guincho;
16, Abano; 17, PCR negative control.

ª 2009 The Authors

1028 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
A.M. Silva et al. Viral detection in bathing waters

1 2 3 4 5 6 7 8 M 9 10 11 12 13 14 15

Hav + (212 bp) NVGI + (118 bp)

Figure 3 Gel electrophoresis of the RT-PCR products of hepatitis A virus (HAV; lanes 1–8), norovirus genogroup I (NVGI; lanes 9–15) amplification
from three bathing water samples of the second and third round of collection. All gel electrophoresis correspond to second round PCRs. The
conserved genomic regions have 222 bp (HAV+) and 118 bp (NVGI+). Lanes: M, 100-bp DNA ladder with 16 fragments raging from the top:
2072, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 bp. 1, Carcavelos (second collection); 2, Carca-
velos (third collection); 3, Bafureira (second collection); 4, Bafureira (third collection); 5, Guincho (second collection); 6, Guincho (third collection);
7, HAV cDNA; 8, PCR negative control; 9, Carcavelos (second collection); 10, Carcavelos (third collection); 11, Bafureira (second collection); 12,
Bafureira (third collection); 13, Guincho (second collection); 14, Guincho (third collection); 15, PCR negative control.

and Lipp 2005) and is mandatory in some countries or
autonomic regions (Ibarluzea et al. 2007).
Because of the small size of viral particles, mechanical
filtration is often not possible; therefore, ultrafiltration or
adsorption–elution methods, using electropositive or elec-
tronegative filters, are employed (Fong and Lipp 2005).
In this work, we chose to perform adsorption–elution of
viruses with an electropositive filter, because it is one of
the most commonly used techniques. This requires no
manipulation of pH, given that enteric viruses are nega-
tively charged at environmental pH (Lipp et al. 2001).
However, some co-eluates could have interfered with the
subsequent reactions and originated the observed nonspe-
cific amplifications.
The occurrence of nonspecific amplifications in the
bathing water samples, probably because of suboptimal
PCR conditions, highlights one of the potential drawbacks
of the detection of viruses using molecular methods.
Primer pair specificity was checked with Primer Blast
(Rozen and Skaletsky 2000) against the ‘nr’ database, and
no nonspecific products were predicted. Likewise, PCR
results from purified HAV RNA (Fig. 2a, lane 17) did not
yield any unexpected band, and the Blast results of the
sequenced products confirmed the identity of the ampli-
cons. It should be noted, however, that the primers may
be prone to self-amplification (Fig. 2a, lane 18, Fig. 3,
lane 8). Under suboptimal conditions, this could lead to
increased nonspecific amplification, which may be an
explanation for the extra bands found in most of the
bathing water samples, with both HAV and NVGI primer
pairs (Fig. 2a,b and 3).
In the current study, no association was found between
viral contamination and bacteriological water quality, and
viral contamination was detected even in samples with
zero or near zero total coliforms (Moitas, Cresmina,
Guincho and Bafureira in the second and third round of
collections; Table 1). This is in accordance with several
other reports and suggests that the indicators legally
demanded to assess the microbiological quality of drink-
ing water possibly do not reflect viral contamination
(Schvoerer et al. 2000; Noble and Fuhrman 2001; Jiang
and Chu 2004; Rose et al. 2006).
The detection of viral genomes does not imply that the
populations using these waters are at immediate risk.
However, when the viral signal is concurrent with high
levels of faecal indicator bacteria, it may suggest a recent
human sewage contamination and a potential health risk
(Rose et al. 2006). When the detection of viral genetic
material is not accompanied by high bacterial indicator
counts, it may suggest an old source of faecal contamina-
tion (Jiang and Chu 2004). Given that viral genetic mate-
rial is degraded within days when the capsid is removed,
this would mean that the detected particle is probably still
infectious (Fong and Lipp 2005). With the used method-
ology (RT-PCR), the viral load was not quantified, so a
quantitative assessment of the risk, as attempted by Rose
et al. (2006), was not possible.
The mode of transmission of HAV and noroviruses is
generally person to person or by oral intake after faecal con-
tamination. Waterborne transmission is less important in
the spread of hepatitis A than person-to-person contact and
accounts for 2% of the source of infection (Cuthbert 2001).
HAV has already been associated with a swimming pool out-
break because of contamination with sewage (Mahoney
et al. 1992). In contrast, noroviruses are considered to be
one of the main causes of waterborne gastroenteritis out-
breaks (Bosch et al. 2008) and were associated with several
outbreaks in recreational waters (e.g. Sartorius et al. 2007
and references within). Even though NVGI genomes were
found in less water samples than HAV (27% vs 95%, respec-
tively), their high infectivity make them a possible health
risk factor in the studied area.
Wastewater effluent discharges upstream of the recrea-
tional areas might have influenced the viral quality of
seawater and both human and ecosystem health. The
WWTP whose output is closer and upstream of the recre-
ational areas only had primary treatment at the time of
this study. The wastewater of 100 000 inhabitants of

ª 2009 The Authors

Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031 1029
Viral detection in bathing waters
Lisbon (upstream the recreational areas) still drains
untreated into the estuary, which could help to explain
the high detection rates of viral genomes, even with low
bacterial counts. Works are underway to add secondary
treatment to the above-mentioned WWTP and to link all
the sewage system of the city. It would be valuable to
repeat the assessment of viral contamination in the stud-
ied area after these works are completed, checking
whether the intervention led to improvements in the
water quality in this respect.
Viral fragments cloned in the current study are to be
implemented as probes in a DNA chip, for the simulta-
neous detection of different types of microbiological
contaminants (viruses and bacteria) in water samples
(Vale et al. 2009). This was the first assessment of patho-
genic viruses in beaches of the Lisbon bay area. The
current results reinforce the importance of the inclusion
of viral detection methodologies, especially near
important urban areas.
Acknowledgements
This work was funded by Fundação Calouste Gulbenkian,
program Environment and Health 2005.
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,
Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST
and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25, 3389–3402.
Bartram, J. and Fewtrell, L. (2001) Water Quality: Guidelines,
Standards and Health – Assessment of Risk and Risk Man-
agement for Water-related Infectious Diseases. London:
World Health Organization.
Bosch, A., Guix, S., Sano, D. and Pinto, R.M. (2008) New
tools for the study and direct surveillance of viral patho-
gens in water. Curr Opin Biotechnol 19, 295–301.
Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J.,
Higgins, D.G. and Thompson, J.D. (2003) Multiple
sequence alignment with the Clustal series of programs.
Nucleic Acids Res 31, 3497–3500.
Clesceri, L.S., Greenberg, A.E. and Eaton, A.D. (1999) Standard
Methods for Examination of Water & Wastewater. Atlanta,
GA: American Public Health Association.
Cuthbert, J.A. (2001) Hepatitis A: old and new. Clin Microbiol
Rev 14, 38–58.
De Leon, R., Shieh, Y.S.C., Baric, R.S. and Sobsey, M.D.
(1990) Detection of enteroviruses and hepatitis A virus in
environmental samples by gene probes and polymerase
chain reaction. Am Water Works Assoc Proc 1989,
833–853.
Fong, T.-T. and Lipp, E.K. (2005) Enteric viruses of humans
and animals in aquatic environments: health risks,
1030 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
A.M. Silva et al.
detection, and potential water quality assessment tools.
Microbiol Mol Biol Rev 69, 357–371.
Gerba, C.P., Goyal, S.M., LaBelle, R.L., Cech, I. and Bodgan,
G.F. (1979) Failure of indicator bacteria to reflect the
occurrence of enteroviruses in marine waters. Am J Public
Health 69, 1116–1119.
Griffin, D.W., Donaldson, K.A., Paul, J.H. and Rose, J.B.
(2003) Pathogenic human viruses in coastal waters. Clin
Microbiol Rev 16, 129–143.
Ibarluzea, J.M., Santa Marina, L., Moreno, B., Serrano, E.,
Larburu, K., Maiztegi, M.J. and Yarzabal, A. (2007)
Somatic coliphages and bacterial indicators of bathing
water quality in the beaches of Gipuzkoa, Spain. J Water
Health 5, 417–426.
Jiang, S.C. (2006) Human adenoviruses in water: occurrence
and health implications: a critical review. Environ Sci Tech-
nol 40, 7132–7140.
Jiang, S.C. and Chu, W. (2004) PCR detection of pathogenic
viruses in southern California urban rivers. J Appl Micro-
biol 97, 17–28.
Lipp, E.K., Farrah, S.A. and Rose, J.B. (2001) Assessment and
impact of microbial fecal pollution and human enteric patho-
gens in a coastal community. Mar Pollut Bull 42, 286–293.
Mahoney, F.J., Farley, T.A., Kelso, K.Y., Wilson, S.A., Horan,
J.M. and McFarland, L.M. (1992) An outbreak of hepatitis
A associated with swimming in a public pool. J Infect Dis
165, 613–618.
Metcalf, T.G., Melnick, J.L. and Estes, M.K. (1995) Environ-
mental virology: from detection of virus in sewage and
water by isolation to identification by molecular biology –
a trip of over 50 years. Annu Rev Microbiol 49, 461–487.
Noble, R.T. and Fuhrman, J.A. (2001) Enteroviruses detected
by reverse transcriptase polymerase chain reaction from
the coastal waters of Santa Monica Bay, California: low
correlation to bacterial indicator levels. Hydrobiologia 460,
175–184.
Prüss-Üstün, A., Bos, R., Gore, F. and Bartram, J. (2008) Safer
Water, Better Health: Costs, Benefits and Sustainability of
Interventions to Protect and Promote Health. Geneva: World
Health Organization.
Rose, M.A., Dhar, A.K., Brooks, H.A., Zecchini, F. and
Gersberg, R.M. (2006) Quantitation of hepatitis A virus
and enterovirus levels in the lagoon canals and Lido beach
of Venice, Italy, using real-time RT-PCR. Water Res 40,
2387–2396.
Rozen, S. and Skaletsky, H.J. (2000) Primer3 on the WWW
for general users and biologist programmers. In Bioinfor-
matics Methods and Protocols: Methods in Molecular Biology
ed. Misener, S. and Krawetz, S.A. pp. 365–386. Totowa,
NJ: Humana Press.
Sartorius, B., Andersson, Y., Velicko, I., De Jong, B., Lofdahl,
M., Hedlund, K.O., Allestam, G., Wangsell, C. et al. (2007)
Outbreak of norovirus in Vastra Gotaland associated with
recreational activities at two lakes during August 2004.
Scand J Infect Dis 39, 323–331.
ª 2009 The Authors
A.M. Silva et al.
Schvoerer, E., Bonnet, F., Dubois, V., Cazaux, G., Serceau, R.,
Fleury, H.J. and Lafon, M.E. (2000) PCR detection of
human enteric viruses in bathing areas, waste waters and
human stools in Southwestern France. Res Microbiol 151,
693–701.
Specht, R., Han, B., Wickramasinghe, S.R., Carlson, J.O.,
Czermak, P., Wolf, A. and Reif, O.W. (2004) Densonucle-
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 108 (2010) 1023–1031
Viral detection in bathing waters
osis virus purification by ion exchange membranes. Bio-
technol Bioeng 88, 465–473.
Vale, F.F., Silva, A.M., Granja, A.T., Vale, M.J. and Vieira, H.
(2009) Simultaneous detection of micro-organisms in water
samples for future chip applications: coliform bacteria,
non-mandatory bacteria, hepatitis A virus and noroviruses.
Phys Status Solidi C, doi: 10.1002/pssc.200881703.
1031
Copyright of Journal of Applied Microbiology is the property of Blackwell Publishing Limited and its content
may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express
written permission. However, users may print, download, or email articles for individual use.