Am J Physiol Gastrointest Liver Physiol 302: G365–G374, 2012.

First published November 23, 2011; doi:10.1152/ajpgi.00437.2011.

Estrogen prevents increased hepatic aquaporin-9 expression and glycerol

uptake during starvation
Janne Lebeck,1 Patrizia Gena,2 Heidi O’Neill,1,3 Mariusz T. Skowronski,4 Sten Lund,5 Giuseppe Calamita,2
and Jeppe Praetorius1
1
Department of Biomedicine, the Water and Salt Research Center, Aarhus University, 5The Medical Research Laboratories,
Clinical Institute and Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark;
2
Department of General and Environmental Physiology, University of Bari Aldo Moro, Bari, Italy; 3Department of
Biochemistry, RCSI, Dublin, Ireland; 4Department of Animal Physiology, University of Warmia and Mazury, Olsztyn, Poland
Submitted 24 October 2011; accepted in final form 21 November 2011

Lebeck J, Gena P, O’Neill H, Skowronski MT, Lund S, Ca-
lamita G, Praetorius J. Estrogen prevents increased hepatic aqua-
porin-9 expression and glycerol uptake during starvation. Am J
Physiol Gastrointest Liver Physiol 302: G365–G374, 2012. First
published November 23, 2011; doi:10.1152/ajpgi.00437.2011.—In
starvation, glycerol is released from adipose tissue and serves as an
important precursor for hepatic gluconeogenesis. By unknown sex-
specific mechanisms, women suppress the endogenous glucose pro-
duction better than men and respond to metabolic stress with higher
plasma glycerol levels. Hepatic glycerol uptake is facilitated by
aquaporin-9 (AQP9), a broad-selectivity neutral solute channel, and
represents an insulin-regulated step in supplying gluconeogenesis
with glycerol. In the present study, hepatic AQP9 abundance was
increased 2.6-fold in starved male rats as assessed by immunoblotting
and immunohistochemistry. By contrast, starvation had no significant
effect on hepatic AQP9 expression in female rats. Coordinately,
plasma glycerol levels remained unchanged with starvation in male
rats, whereas it was increased in female rats. The different responses
to starvation were paralleled by higher glycerol permeability in
basolateral hepatocyte membranes from starved male rats compared
with starved females. Ovariectomy led to a starvation-response pattern
identical to that observed in male rats with increased hepatic AQP9
expression and unchanged plasma glycerol levels. In cultured hepa-
tocytes, 17␤-estradiol and the selective estrogen receptor ␣-agonist,
propyl pyrazole triol, caused a decrease in AQP9 expression. Our
results support that a sex-specific regulation of the hepatic glycerol
channel AQP9 during starvation contributes to the higher plasma
glycerol levels observed in women during fasting and possibly results
in a lower cytosolic availability of glycerol. Furthermore, the sexual
dimorphism in the hepatic handling of glycerol during starvation
might be explained by 17␤-estradiol preventing the starvation-in-
duced increase in hepatic AQP9 abundance.
AQP9; orchiectomy; ovariectomy; estradiol; gluconeogenesis
IN STATES OF LOW ENERGY SUPPLY, hepatic generation and release
of glucose from glycogenolysis and gluconeogenesis is crucial
for maintaining the function of many organs. Glycerol is an
important gluconeogenic precursor accounting for ⬃25% of
hepatic glucose de novo synthesis in starved rats (31). Sex
differences in the metabolic response to starvation exist in both
humans and rodents. In general, females appear to preserve the
lean body mass better than males during fasting by utilizing
relatively more fat than muscle mass for energy needs (6, 16,
42). In humans, females suppress their endogenous glucose
Address for reprint requests and other correspondence: J. Lebeck, Dept. of
Biomedicine, the Water and Salt Research Center, Aarhus Univ., Wilhelm
Meyers Allé 3, DK-8000 Aarhus, Denmark (e-mail: jl@ana.au.dk).
http://www.ajpgi.org 0193-1857/12 Copyright © 2012 the American Physiological Society
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
production to a greater extent than males during starvation (5)
and respond to starvation with lower blood glucose levels (24).
Furthermore several observations have been made of females
responding to both fasting and moderate-intensity exercise
with higher plasma glycerol levels than males (5, 6, 14, 25).
Aquaporin-9 (AQP9) is a broad-selectivity neutral solute
channel that facilitates the hepatic uptake of glycerol (33, 37,
38). In the liver, AQP9 protein expression is predominantly
confined to the basolateral plasma membrane domain in
perivenous hepatocytes (7, 33). The importance of AQP9 in
controlling hepatic uptake of glycerol is illustrated by the
increased plasma glycerol levels found in AQP9 knockout
(KO) mice (33). Previous studies in male animals have dem-
onstrated that hepatic AQP9 expression is increased in states
with low plasma insulin levels, such as starvation and strepto-
zotocin-induced diabetes mellitus as well as in insulin-resistant
obese (db⫹/db⫹) mice (4, 19). These findings led to the notion
that AQP9 plays an important role in supplying glycerol for the
increased gluconeogenesis in these states (23). In support,
AQP9-deficient Leprdb/Leprdb mice that become obese and
develop type 2 diabetes had lower blood glucose levels than
Leprdb/Leprdb, suggesting that the obese AQP9 KO mice has a
reduced capacity to generate glucose (33).
The expression of AQP9 protein has been demonstrated to
be ⬃20% higher in male than in female rats in the postprandial
state (26). Therefore, we speculated that sex-specific regulation
of hepatic AQP9 during starvation might contribute to explain-
ing the higher plasma glycerol level observed in females during
metabolic stress as well as the lower plasma glucose during
starvation in females. In the present study, we found that the
increase in hepatic AQP9 expression previously observed in
starved males does not occur in females. In addition, the higher
expression of AQP9 in starved males is paralleled by higher
glycerol permeability of the basolateral hepatocyte membrane
and increased plasma glycerol level only in starved females.
This supports the notion that sex-specific regulation of AQP9
during starvation contributes to the higher plasma glycerol
level observed in females. However, despite a possibly lower
availability of glycerol as a gluconeogenic substrate in females,
blood glucose levels did not differ between male and female
rats in the starved state. Ovariectomy enabled a starvation-
induced increase in hepatic AQP9 expression in females with-
out a concurrent increase in plasma glycerol levels just as
observed in starved males. Studies on hepatocytes support the
idea that the sexual dimorphism in hepatic AQP9 regulation
might be ascribed to 17␤-estradiol suppressing hepatic AQP9
expression.
G365
G366 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM

MATERIALS AND METHODS
Animal experiments. Wistar rats (Taconic Europe, Lille Skensved,
Denmark; and Harlan, San Pietro al Natisone, Italy) were kept at 21°C
with a 12-h:12-h artificial light/dark cycle and 55% humidity. All rats
had free access to tap water and were maintained on a standard rodent
diet (Altromin, Lage, Germany; or Harlan). All experimental proto-
cols were approved by the Danish Ministry of Justice or similar
authorities in Italy.
Protocol 1: 96-h starvation. Male and female rats were age
matched. Male rats weighed 302 ⫾ 3 g (n ⫽ 13), and female rats
weighed 204 ⫾ 3 g (n ⫽ 13). In the starved groups (n ⫽ 7 each), the
food was removed 96 h before the experiment was terminated. The
rats were anesthetized with isoflurane; after laparotomy, a blood
sample was taken from the abdominal aorta, and liver samples were
collected.
Protocol 2: streptozotocin-induced diabetes mellitus. Male (n ⫽ 9,
205 ⫾ 1 g body wt) or female rats (n ⫽ 20, 182 ⫾ 2 g body wt) were
rendered diabetic by intravenous injection of streptozotocin (55 mg/kg
body wt) (Sigma, St. Louis, MO) as previously described (29).
Fourteen days after the injection, the animals were anesthetized with
halothane, and the experiment was terminated as described in
protocol 1.
Protocol 3: orchiectomy. Male rats (n ⫽ 14, 300 ⫾ 2 g body wt)
were anaesthetized with isoflurane and injected with buprenorphine
subcutaneously (6 ␮g/250 g). The testes and epididymis were ex-
posed, and, in the castrated group (n ⫽ 8), the rete testis and the
testicular blood vessels were ligated and the testes removed. In the
sham-operated group (n ⫽ 6), the scrotal incision was closed after
exposure. The experiment was terminated on the 25th postoperative
day as described in protocol 1.
Protocol 4: ovariectomy and 72-h starvation. Female rats weighing
205 ⫾ 2 g (n ⫽ 18) were anaesthetized with isoflurane and injected
with buprenorphine (6 ␮g/250 g). The ovaries were exposed by a
small incision on each side of the abdominal cavity, ligated, and
removed in the two ovariectomized groups (n ⫽ 5 and 7). In the
control group (n ⫽ 6), the exposed ovaries were replaced in the
abdomen. For the starved ovariectomized group, the food was re-
moved 72 h before terminating the experiment on the 25th postoper-
ative day as described in protocol 1.
Cell culture. The WIF-B9 hepatocytes were grown at 7% CO2, at
37°C in F12 Coon’s modification medium (Sigma) supplemented with
L-glutamine (Invitrogen, Carlsbad, CA), antibiotic antimycotic solu-
tion (Sigma), sodium hypoxanthine, aminopterin and thymidine sup-
plement (Invitrogen), and 5% FBS (Invitrogen), where the total
estradiol (E2) level was ⬃10⫺10 M. Before experiments the cells were
kept in control medium containing 0.5% FBS for 20 h. In the
experiments with propyl pyrazole triol (PPT) (Tocris Bioscience) the
control medium contained either 0% or 0.5% FBS as indicated. Gel
samples were prepared after 24-h exposure to the experimental me-
dium indicated in the figure. The presented data were obtained from
two or three independent experiments, and n indicates the total
number of wells.
Semiquantitative immunoblotting. SDS-PAGE and immunoblotting
were performed as previously described (35). The bands detected with
Hyperfilm (Amersham Bioscience, Uppsala, Sweden) were semiquan-
tified within the linear range using ImageJ software after background
subtraction, and each lane was adjusted to the band intensity of actin
from the same membrane.
Immunohistochemistry. The animals were perfusion fixed with 3%
paraformaldehyde in 0.01 M (pH 7.4) through the abdominal aorta.
Paraffin tissue sections (2 ␮m) were obtained, and immunofluores-
cence labeling for AQP9 was performed as previously described (35).
Microscopy was performed using a Leica TCS SL (SP2) laser scan-
ning confocal microscope with the HCX PL APO ⫻40 objective.
Quantitative analysis was performed with Image-Pro Analyzer 6.2
software. For each image, a binary mask was created to define the
total area of all hepatocytes in the image (Fig. 1E). A second mask
defined the AQP9 immunofluorescence signal above background (Fig.
1F). The total immunofluorescence signal within the area of the
second mask was divided by the total hepatocyte area from the area

Fig. 1. Immunohistochemical analysis of aquaporin-9

(AQP9) abundance in livers from male and female rats
exposed to either 96-h starvation or streptozotocin (STZ)
injection. Representative images of immunofluorescence
labeling with anti-AQP9 antibody (Alpha Diagnostics, San
Antonio, TX) in the centrilobular region from control (A or
C) and starved (B or D) male and female rats and control
(H or J) and STZ-diabetes mellitus (DM) male and female
rats, as indicated. Arrows indicate AQP9 labeling in the
basolateral plasma membrane domain facing the sinusoids.
CV: central vein. E and F: examples of masks used for the
semiquantitative analysis of hepatic AQP9 abundance rel-
ative to total cell area in the immunofluorescence images.
E: mask of the total cell area from B. F: mask of the
fluorescence labeling representing AQP9 in B. E: summa-
rized values of the AQP9 immunofluorescence signal/cell
area, n ⫽ 4 in each group. Means ⫾ SE were normalized
to the control male rat level. *Denotes statistically signif-
icant difference.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org

Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
mask of the same original image. Mean values ⫾ SE from four control
rats and four starved rats were computed for both male and female rats
and normalized to the level of the control male value.
PCR. Total RNA was extracted from rat liver using TRIzol Reagent
Solution (Ambion, Austin, TX). Two micrograms of total RNA from
each sample were transcribed to cDNA using High-Capacity cDNA
Reverse Transcription Kit (Applied Biosystems, Foster City, CA).
Real-time qPCR reactions had the following final concentrations: 1⫻
mAqp9 Target Primers and probe and 1⫻ TaqMan Universal PCR
Master mix (Applied Biosystems) and 20 ng of each cDNA sample.
qPCR was carried out using the StepOne Real-Time PCR System
(Applied Biosystems) and the following cycling conditions: incuba-
tion required for optimal AmpErase UNG enzyme activity (50°C for
2 min), AmpliTaq Gold DNA Polymerase activation (95°C for 10
min), and 40 cycles of annealing (95°C for 15 s) and extension (60°C
for 1 min). A negative control without cDNA was run in parallel with
each assay, and data were normalized to ␤-actin. For RT-PCR, total
RNA was extracted from rat liver or WIF-B9 hepatocytes using the
RiboPure Kit (Ambion). To generate cDNA, RT-PCR was performed
after DNAse treatment using 10 U/␮l SuperScript II Reverse Tran-
scriptase (Invitrogen). PCR from the obtained cDNA was performed
with HotStarTaq Master Mix (Qiagen, Valencia, CA) and 10% cDNA
and 0.5 pmol of each primer (Table 1).
Stopped-flow light-scattering measurement of membrane glycerol
and water permeability. Liver samples were homogenized and vesi-
cles of basolateral plasma membranes were prepared by differential
centrifugation as devised previously (3). The enriched basolateral
plasma membranes were collected, and the protein concentration was
assayed by the Lowry method. Volume changes were monitored by
the light scattering at 450-nm wavelength using a BioLogic MPS-200
stopped-flow reaction analyzer (BioLogic, Claix, France) permeabil-
ity was measured by light scattering at 20°C as previously described
(3). Glycerol permeability (Pgly; cm/s) was computed using the
equation: Pgly ⫽ 1/[(S/V)␶], where S/V is surface-to-volume ratio and
␶ (1/Ki) is the exponential time constant fitted to the vesicle-swelling
phase of light-scattering time course corresponding to glycerol entry.
Osmotic water permeability was measured by light scattering as
previously described (32). Data were fitted to a single exponential
function, and the related rate constant (Ki, per second) of the water
efflux out of the vesicles was determined.
Plasma measurements. P-glucose was measured using a Precision
Xceed apparatus (Abbott, North Chicago, IL). P-glycerol was mea-
sured using a Free Glycerol Determination Kit (Sigma), P-nonesteri-
fied fatty acids (NEFA) using NEFA-HR(2) R1 Set (Waco Chemicals,
Waco, TX), and P-insulin with an ELISA-kit (no. EIA-2943; DRG
Instruments, Winooski, VT). Estradiol was measured in FBS using a
Coat-a-Count Estradiol RIA kit (Siemens Healthcare Diagnostics,
Deerfield, IL).
Presentation of data and statistical analyses. Data are presented as
mean values ⫾ SE. Statistical analysis was accomplished by unpaired
Table 1. Primer sequences
Transcript Direction
Rat AQP9, AQP9 Forward
Reverse
INSR Forward
Reverse
ESR1 Forward
Reverse
PGR Forward
Reverse
ESR2 Forward
Reverse
Human AQP9, hAQP9 Forward
Reverse
AQP9, aquaporin-9; INSR, rat insulin receptor; ESR1, rat estrogen receptor-␣; PGR, rat progesterone receptor; ESR2, rat estrogen receptor-␤.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
G367
Student’s t-test or ANOVA unless otherwise stated. Nonparametric
tests were used when indicated in figure legends. P values ⬍0.05 were
considered statistically significant.
RESULTS
Starvation increases hepatic AQP9 expression only in male
rats. Male and female rats were subjected to 96-h starvation to
assess the influence of sex on regulation of hepatic AQP9 in a
state with increased gluconeogenesis. The expression of AQP9
in response to starvation was examined by immunohistochem-
istry. Representative images are shown in Fig. 1. As previously
described, labeling for AQP9 in the liver is primarily localized
to the basolateral plasma membrane domain of hepatocytes
surrounding the central veins (Fig. 1, A–D and H–K), with
decreased labeling toward the portal triad. When quantifying
the AQP9 immunofluorescence signal in the perivenous region
of control and starved rats, we found a 3.4-fold increase in
starved male rats compared with controls (Fig. 1G). By con-
trast, starvation had no significant effect on hepatic AQP9
abundance in female rats. In the postprandial state, no differ-
ence in hepatic AQP9 expression was observed between males
and females. After starvation, however, the hepatic AQP9
abundance was 1.8-fold higher in males compared with fe-
males. A similar sex-specific pattern of hepatic AQP9 expres-
sion was observed when examining the effect of streptozoto-
cin-induced diabetes in male (Fig. 1, H and I) and female rats
(Fig. 1, J and K) by immunohistochemistry. The observed
sex-specific regulation of hepatic AQP9 in response to starva-
tion was confirmed by immunoblotting, thus demonstrating a
2.6-fold increase in total AQP9 protein abundance in starved
male rats (Fig. 2, A and C) and no increase in AQP9 expression
in starved females (Fig. 2, B and C).
Higher membrane permeability to glycerol and water in
hepatocytes from starved male rats. A separate 96-h starvation
experiment was conducted to evaluate the biophysical impact
of the sex-specific regulation of hepatic AQP9 abundance in
starvation. First, the observed sex difference in hepatic AQP9
expression after starvation was confirmed by both qPCR and
immunoblotting (Fig. 3A). Stopped-flow light-scattering anal-
ysis was carried out using basolateral membrane vesicles
prepared from livers of starved male and female rats. Glycerol
permeability (Pgly) was measured by light scattering following
a 150 mM inwardly directed gradient of glycerol. Figure 3B
shows representative biphasic light-scattering traces. The ini-
tial shrinkage of vesicles until osmotic equilibrium is reached
Sequence Product Size, bp
CAGCTCCATTCATATCCACGCC 258
TGAAGACCTCAAACCCCCATCC
TCCCAACATCTCCTCCACCATC 349
CAGCTCCTCATCACCATATCGC
TCCAATTCTGACAATCGACGCC 280
TCTCTGACGCTTGTGCTTCAAC
TCCAGCTCTTTGCTGACCAGTC 585
AAATTCCACAGCCAGTGCCC
CCATTGCCAATCATCGCTCCTC 438
TCGCTAGAACTTCTCTGCCTCC
GCAACATACCCAGCTCCGTATC 272
GCTCTGAAGACTTCAAACCCCC
G368 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
Fig. 2. A and B: semiquantitative immunoblots using anti-AQP9 antibody
(Alpha Diagnostics) on liver homogenates from fed controls and 96-h starved
male and female rats. Each lane represents a sample from 1 rat. C: densito-
metric analysis of the immunoblots. Mean band densities ⫾ SE are presented
relative to controls. *Denotes statistically significant difference by Welch
corrected Student’s t-test.
is followed by a slower decrease reflecting swelling of the
vesicles caused by diffusional entry of glycerol and osmotic
water influx. The Pgly value of the vesicles from the starved
males was significantly higher than the one obtained with the
female counterpart (Fig. 3D). Furthermore, the basolateral
membrane Pgly values of male and female hepatocytes de-
creased to a comparable level, when the vesicles were chal-
lenged with a 10-min treatment with 0.5 mM phloretin, a
compound known to inhibit the AQP9-mediated diffusion of
glycerol (38).
Water permeability in vesicles of basolateral hepatocyte
membranes from female and male rats were measured in
response to a 140 mM inwardly directed gradient of mannitol.
Figure 3C shows representative light-scattering data. In line
with the glycerol permeability experiments, the coefficient of
osmotic water permeability (Pf) of vesicles from starved males
was significantly higher than that of the starved females.
Again, this sex-dependent difference was diminished when
exposing the vesicles for 5 min to 0.3 mM HgCl2, a blocker of
the AQP9 water conductance (Fig. 3E). Hence, the sex differ-
ence in hepatic AQP9 abundance was followed by a matching
sex difference in basolateral hepatocyte membrane permeabil-
ity for both glycerol and water, suggesting a lower hepatic
uptake capacity of glycerol in females during starvation.
Hepatic GlyK protein is more abundant in male rats. Once
glycerol is in the cytosol, glycerol kinase (GlyK) phosphory-
lates it into glycerol-3-phosphate (G-3-P). The hepatic GlyK
abundance was analyzed to evaluate whether the initial hepatic
glycerol metabolism was regulated in a sex-specific manner. In
the postprandial state, male rats demonstrated a twofold higher
abundance of GlyK compared with females (Fig. 4, A and D).
However, the hepatic GlyK abundance was unaffected by
starvation in both males and females (Fig. 4, B–D), thus
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
suggesting a persisting sex difference in hepatic GlyK abun-
dance during starvation.
Starvation increases plasma glycerol levels only in female
rats. Compared with fed controls, p-insulin was decreased by
78% and 80% in response to starvation in male and female rats,
respectively (Table 2). Starvation caused increased p-NEFA
levels in both male and female rats, whereas only starved
females displayed a significant increase in p-glycerol (Fig. 4E),
thus giving a crude indication of the fact that the lipolytic rate
and thereby release of NEFA is increased in both females and
males, whereas the sex-specific increase in hepatic AQP9
could explain the lack of a significant increase in p-glycerol in
starved males.
Starvation increases hepatic AQP9 expression female rats
after ovariectomy. The observed sex differences in the initial
hepatic handling of glycerol led us to hypothesize that either
male sex would have a stimulatory effect or female sex would
have an inhibitory effect on its regulation. Orchiectomy of
male rats caused a 1.5-fold increase in hepatic AQP9 abun-
dance (Fig. 5, A and B) with a correlated drop in plasma
glycerol (Fig. 5C). By contrast, ovariectomy alone had no
effect on the hepatic expression of AQP9 and GlyK (Fig. 6, A,
B, and E), and p-glycerol remained unchanged (Fig. 6G).
However, similar to starved males, starvation in ovariecto-
mized females resulted in a 1.9-fold increase in hepatic AQP9
abundance, whereas no effect on hepatic GlyK abundance was
observed (Fig. 6, C, D, and F). Also in similarity to starved
males and contrasting the changes in starved intact females,
plasma glycerol remained unchanged in the starved ovariecto-
mized rats. Starved ovariectomized rats displayed increased
plasma NEFA concentration, whereas ovariectomy alone had
no effect on the plasma level of neither glycerol nor NEFA
(Fig. 6G). Throughout the experiment, the ovariectomized rats
gained more weight than the sham-operated controls, whereas
starvation of ovariectomized rats resulted in a final weight
similar to the controls (Table 3). Both plasma insulin and blood
glucose levels were decreased in the starved ovariectomized
rat, whereas no statistically significant difference was observed
between control and ovariectomized females (Table 3). In all,
ovariectomy caused a male response pattern of the hepatic
AQP9 expression and plasma glycerol levels upon starvation.
Effects of insulin, 17␤-estradiol, and PPT in WIF-B9 hepatocytes.
The observed obliteration of the female response to starvation in
terms of hepatic AQP9 expression and p-glycerol level in
ovariectomized rats led to the hypothesis that female sex
hormones plays a suppressive role in the regulation of hepatic
AQP9 expression. An in vitro system was chosen to test this
hypothesis directly, as it would be difficult to accomplish by in
vivo experiments with its many confounding factors. As pre-
viously described, WIF-B9 hepatocytes are a rat hepatoma and
human fibroblast hybrid cell line that expresses rat AQP9
mRNA and protein (Fig. 7, A and B) (12). Here, we find that
human AQP9 mRNA is also expressed in the WIF-B9 cells
(Fig. 7A). Furthermore, the rat insulin receptor as well as the
transcript for estrogen receptor-␣ (ER␣, ESR1) was detected in
both male rat liver and WIF-B9 cells. By contrast, the tran-
script for estrogen receptor-␤ (ER␤, ESR2) was only detected
in the WIF-B9 cells, and the progesterone receptor was absent
from both rat liver and WIF-B9 cells (Fig. 7A). To determine
the effect of insulin exposure on the AQP9 abundance in
 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
WIF-B9, the hepatocytes were subjected to different physio-
logical relevant concentrations of insulin. AQP9 protein ex-
pression was regulated in a concentration-dependent manner
with highest protein abundance at low insulin levels (Fig. 7B),
demonstrating that the regulation of AQP9 in WIF-B9 hepa-
tocytes is comparable with the in vivo regulation observed in
males. Similarly, we found that 17␤-estradiol (E2) decreased
WIF-B9 AQP9 expression in a concentration-dependent man-
ner with a 2.3-fold difference between 10⫺13 and 10⫺10M of E2
(Fig. 7C). Because rat liver and the WIF-B9 cell line differ in
ER subtype expression, we used the highly selective ER␣
agonist PPT to evaluate the role of signaling through the more
liver-relevant ER␣ upon the expression of AQP9. As shown in
Fig. 7D, PPT also caused a decreased abundance of AQP9,
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
G369
Fig. 3. Glycerol and water permeability of basolateral
membrane vesicles from hepatocytes of male and fe-
male rats after 96-h starvation. A: qPCR and immuno-
blotting for hepatic AQP9 expression in the basolateral
membrane vesicle specimens from starved male and
female rats used for the stopped-flow light-scattering
studies. Means ⫾ SE values were normalized to male
expression levels. *Represents statistically significant
difference. B: basolateral glycerol permeability: repre-
sentative traces of stopped-flow light-scattering in re-
sponse to a 150 mM inwardly directed concentration
gradient of glycerol in males and females, as indicated.
The initial increase in light-scattering (timing of 0.1 s)
results from osmotic water efflux (vesicle shrinkage)
followed by a slower decrease (timing of seconds)
caused by glycerol entry triggering influx of water
(vesicle swelling). Trend lines exemplify the slopes
used for the calculations behind the summarized data in
D. C: basolateral water permeability: representative
traces of stopped-flow light scattering in response to a
140 mM inwardly directed hypertonic mannitol gradient
in males and females, as indicated. Trend lines exem-
plify the slopes used for the calculations behind the
summarized data in E. D: coefficients of basolateral
membrane glycerol permeability (Pgly) from starved
male and female rats. The Pgly values were calculated in
the presence and absence of 0.5 mM phloretin for
10 min. Data are presented as means ⫾ SE; n ⫽ 5.
E: calculated coefficients of osmotic water permeability
(Pf) of basolateral membrane vesicles from starved male
and female rats. The Pf values are calculated in the
presence and absence of 0.3 mM HgCl2 for 5 min. Data
are means ⫾ SE; n ⫽ 4. *, #Represent statistically
significant differences.
demonstrating that signaling through ER␣ alone also decreases
the abundance of AQP9. However, a decreased expression of
AQP9 was only observed in the presence of 0.5% FBS,
suggesting that additional factors need to be present in order
for PPT to suppress the abundance of AQP9. Finally, coad-
ministering insulin and E2 significantly reduced AQP9 abun-
dance compared with insulin alone (P ⬍ 0.05, Fig. 7E). Thus
E2 seems to suppress the effect of low insulin on AQP9
expression by directly affecting the hepatocytes.
DISCUSSION
The overall metabolism of fuel molecules displays sex
differences, and in this context many hepatic proteins are
G370 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM

Fig. 4. Semiquantitative immunoblots with antibody against glycerol kinase (GlyK) (Abcam, Cambridge, MA) in liver homogenates from fed and 96-h-starved
male and female rats. A: GlyK expression in females vs. males in the fed state. B and C: GlyK expression in control and starved male or female rats, respectively.
D: densitometric analysis of the immunoblots. Mean band densities ⫾ SE were corrected to mean female level (A) or control levels (B and C). *Denotes
statistically significant differences by Welch’s corrected t-test. E: plasma concentrations of glycerol and nonesterified fatty acids (NEFA) in control (n ⫽ 6) and
starved (n ⫽ 7) male rats and control (n ⫽ 3) and starved (n ⫽ 7) female rats. Values are means ⫾ SE, and *denotes statistically significant difference.

expressed in a sexually dimorphic fashion (13, 17, 39). With
relevance to hepatic glycerol metabolism, the expression of
AQP9 protein is ⬃20% higher in male than in female rats in
the postprandial state (26). The hepatic abundance of AQP9 is
inversely regulated in response to variations in plasma insulin
levels, possibly through a negative insulin response element
(IRE) in the promoter region of AQP9 (19). However, the
evidence supporting insulin as a key regulator of hepatic AQP9
expression has been generated only in male rodents. In the
present study, we found that the insulin-related regulation of
hepatic AQP9 during starvation is blunted in female rats, most
likely through the action of E2.
In the starved state, the hepatic expression of AQP9 was
found to be approximately twofold higher in males than in
females, and by far exceeds the ⬃20% higher abundance of
hepatic AQP9 observed in males in the postprandial state (26).
It could be speculated that this sex-specific regulation of AQP9
could be due to variations in the plasma insulin level between
sexes. Here, the relative decrease in plasma insulin levels in
response to starvation was similar in male and female rats
although the absolute values tended to be higher in males. This
could potentially influence the regulation of hepatic AQP9
abundance, but in contrast to the observed changes the trend
toward lower insulin levels in female rats would predict an
even more pronounced increase in the expression of AQP9 in
females.
Glycerol is known to permeate AQP9 in heterologous ex-
pression systems. To verify this in the native tissue, we found
it necessary to ascertain whether the difference in hepatic
AQP9 abundance was sufficient to cause a biologically rele-
vant difference in glycerol permeation. Here, we show that the
sexual dimorphism in hepatic AQP9 abundance in starved rats
is correlated with higher permeability for both glycerol and
water in the basolateral plasma membranes of hepatocytes
from males. These findings are consistent with a biophysical
study by Calamita and coworkers reporting 1) positive corre-
lation between AQP9 protein abundance and glycerol perme-
ability, 2) a significantly lower (⬃50%) Pgly in the basolateral
hepatocyte plasma membrane of AQP9 KO mice than that of
wild-type mice, 3) unlike AQP9 wild-type mice no increase in
Pgly occurs in AQP9 KO mice during fasting, and 4) the
existence of facilitated pathways other than AQP9 providing
minor contribution to the transport of glycerol into the hepa-
tocyte (P. Gena, A. Rojek, D. Ferri, E. Fanelli, M. Svelto, G.

Table 2. Biological parameters in fed controls and starved female and male rats
Female Male

Controls Starved Controls Starved

n 6 7 6 7
NEFA/glycerol ratio 2.4 ⫾ 0.5 2.8 ⫾ 0.3 3.0 ⫾ 0.3 4.6 ⫾ 0.2*
Blood glucose, mmol/l 5.8 ⫾ 0.2 3.8 ⫾ 0.3* 5.0 ⫾ 0.1 3.5 ⫾ 0.2*
Plasma insulin, pmol/l 51.2 ⫾ 1.5 10.5 ⫾ 2.3* 130.8 ⫾ 39.7 28.7 ⫾ 10.1*
Start body weight, g 207.7 ⫾ 1.4 201.4 ⫾ 4.8 300.3 ⫾ 4.8 304.6 ⫾ 3.0
Final body weight, g 209.7 ⫾ 2.0 175.4 ⫾ 4.2* 310.2 ⫾ 6.8 274.9 ⫾ 3.1*
Values are means ⫾ SE; n, number of rats. For p-insulin, n ⫽ 3 for female controls. *Represents statistically significant difference between control and starved
males or between control and starved females. NEFA, nonesterified fatty acids.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org

Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
Fig. 5. A: semiquantitative immunoblotting of liver homogenates from control
and orchiectomized (Orchx) male rats using an anti-AQP9 antibody (Alpha
Diagnostics). B: densitometric analysis of the immunoblots. Mean band den-
sities ⫾ SE were corrected to mean control level. C: plasma concentrations of
glycerol and NEFA in control (n ⫽ 6), and Orchx (n ⫽ 8) values are means ⫾
SE. *Represents statistically significant difference.
Calamita, unpublished observations). Thus AQP9 seems to be
the major contributor to transport of glycerol over the basolat-
eral plasma membrane of hepatocytes. Nevertheless, the pres-
ence of other aquaglyceroporins in liver has also been reported.
In a recent study, both AQP3 and AQP7 expression was
identified in human liver (32). Immunohistochemical analysis
did not suggest that the expression of these proteins overlap
with that of AQP9 and their functional roles within the liver
remains to be elucidated. To our knowledge none of the
water-selective aquaporins expressed in the liver (AQP0,
AQP1, AQP4, AQP8, and AQP11) colocalize with AQP9 in
the basolateral plasma membrane domain (20). Thus a func-
tional overlap with AQP9 in these membranes seems most
unlikely. Moreover, evidence for a sex-specific regulation of
any of these aquaporins has not been reported thus far. Finally,
the HgCl2-insensitive water permeability and the phloretin-
resistant glycerol permeability in hepatocytes do not change
with sex in our study. Thus AQP9 remains the best candidate
for explaining the sex difference in permeability after starva-
tion.
In response to starvation, lipolysis is initiated and glycerol
and NEFA are released for further metabolism. In this study,
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
G371
plasma levels of NEFA were increased in both sexes, whereas
the plasma glycerol levels were was only significantly in-
creased in starved females. These findings indicate that the
lipolytic rate is increased in both male and female rats and
suggest that males metabolize glycerol more efficiently than
females. The observed plasma levels of glycerol are within
range of previous observations (11, 22). In contrast to our
findings based on aortic blood, increased plasma glycerol
levels in starved male rodents were reported elsewhere after
blood sampling from the prehepatic portal vein (19, 34). To our
knowledge, there is no general consensus regarding sex differ-
ences in plasma glycerol levels in humans. However, several
groups have reported higher plasma glycerol levels in women
than in men in response to both fasting and moderate-intensity
exercise (5, 6, 14, 25). This sex-specific difference has also
been observed in exercising type 1 diabetics (10). In some of
the studies, the higher plasma glycerol levels were accompa-
nied by the plasma levels of NEFA and were therefore thought
to arise solely from a higher lipolytic rate in women. However,
the AQP9 expression pattern observed in the present study
suggests that sexual dimorphism in hepatic handling of glyc-
erol contributes to the higher plasma glycerol levels observed
in women in response to fasting. Furthermore, the lower
intracellular hepatic availability of glycerol as a gluconeogenic
substrate in starved females would be in line with the notion of
women suppressing their glucose de novo synthesis to a greater
extent than men during starvation (5) and with the lower blood
glucose levels in women during prolonged fasting (24).
Once in the cytosol, glycerol is phosphorylated by GlyK into
G-3-P, thereby maintaining an inward glycerol gradient. In the
present study, hepatic GlyK protein abundance was higher in
males compared with females in the postprandial state. This is
in accordance with a higher hepatic GlyK activity in the
postprandial state in male rats in previous studies (8, 40). In our
study, the GlyK protein level was not affected by starvation in
neither males nor females, indicating that the sex differences in
abundance persist during starvation. The existing data on the
relationship between fasting and hepatic GlyK appear incon-
sistent. Fasting of male mice has been reported to increase the
hepatic GlyK mRNA expression (19, 19, 30), whereas a
decreased activity has been observed in starved male rats (36).
We next speculated that the sexual dimorphism could be
mediated by sex hormones and in particular by testosterone or
Fig. 6. Semiquantitative immunoblotting of liver ho-
mogenates from control, ovariectomized (Ovx), and
72-h-starved ovariectomized (Starved ovx) female rats
using the same antibodies as in the starvation study.
Ovariectomized rats were either compared with con-
trols or starved ovariectomized rats. A, B, C, and
D: immunoblotting with antibodies against AQP9 and
GlyK. E and F: densitometric analysis of the immuno-
blots. Mean band densities ⫾ SE were corrected to
mean control level (E) or ovariectomized levels (F),
respectively. G: plasma concentrations of glycerol and
NEFA in control (n ⫽ 6), Ovx (n ⫽ 5) and Starved Ovx
(n ⫽ 7) values are means ⫾ SE. *Represents statisti-
cally significant difference.
G372 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM

Table 3. Biological parameters from control, ovariectomized, and starved ovariectomized rats
Controls Ovariectomized Starved Ovariectomized

n 6 5 7
NEFA/glycerol ratio 3.5 ⫾ 0.2 3.3 ⫾ 0.4 5.5 ⫾ 0.4*†
Blood glucose, mmol/l 5.7 ⫾ 0.1 5.8 ⫾ 0.4 3.7 ⫾ 0.3*†
Plasma insulin, pmol/l 72.2 ⫾ 14.7 189.9 ⫾ 49.9 21.7 ⫾ 4.1†
Start body weight, g 207.1 ⫾ 3.3 200.8 ⫾ 3.3 206.3 ⫾ 4.3
Final body weight, g 242.2 ⫾ 4.4 279.6 ⫾ 7.7* 234.9 ⫾ 6.7†
Values are means ⫾ SE; n, number of rats. *Represents statistically significant difference when compared to control rats, and †represents statistically
significant difference when compared to ovariectomized rats.

estrogens. Decreasing the testosterone levels by orchiectomy
caused a small but significant increase in hepatic AQP9 ex-
pression, suggesting that male testosterone levels are not es-
sential for an increase in hepatic AQP9 abundance to occur.
Decreasing the estrogen levels by ovariectomy had no effect on
hepatic AQP9 abundance. The higher weight gain observed in
the ovariectomized rats is a well-described phenomenon as-
cribed to increased food intake (reviewed in Ref. 2). The
weight gain was accompanied by a trend for higher plasma
levels of insulin, which could influence the regulation of
hepatic AQP9 abundance and thereby mask the effect of
ovariectomy. However, the increased hepatic AQP9 abundance
found in starved ovariectomized rats suggests that ovary-
derived factors exert an inhibitory effect on regulation of
hepatic AQP9 abundance during starvation. This is in accor-
dance with neonatal exposure to diethylstilbestrol causing
lower hepatic AQP9 abundance in 20-day-old male rats (41).
Furthermore, ovariectomy resulted in an elimination of the
increased plasma glycerol level found in response to starvation
in intact females. This could either be ascribed to increased
hepatic glycerol uptake through AQP9 or decreased glycerol
production from lipolysis. An attenuated lipolytic response is,
however, contradicted by the increased plasma NEFA levels in
the starved ovariectomized rats. Thus ovariectomy leads to a
male response pattern to starvation regarding AQP9 expression
and plasma glycerol levels.

Fig. 7. Regulation of AQP9 abundance in WIF-B9

hepatocytes. A: RT-PCR for mRNA encoding rat
AQP9 (AQP9), rat insulin receptor (INSR), rat
estrogen receptor-␣ (ESR1), rat progesterone re-
ceptor (PGR), rat estrogen receptor-␤ (ESR2),
and human AQP9 (hAQP9) in male rat liver (L),
WIF-B9 hepatocytes (W), and rat kidney cortex
(C). Plus and minus signs denote the presence and
absence of reverse transcriptase in the RT reac-
tion, respectively. H2O indicates the lack of tem-
plate. B: densitometric analysis of immunoblots
with antibody against COOH-terminal of rat
AQP9 (RA2674 – 685) (33) abundance in WIF-B9
cells after 24-h exposure to different concentra-
tions of insulin (n ⫽ 6 – 8 per concentration).
C: densitometric analysis of immunoblots for rat
AQP9 abundance in WIF-B9 cells after 24-h ex-
posure to different concentrations of 17␤-estra-
diol (n ⫽ 10 per concentration). D: densitometric
analysis of immunoblots for rat AQP9 abundance
in WIF-B9 cells after 24-h exposure to propyl
pyrazole triol (PPT) in media containing either
0% or 0.5% FBS (n ⫽ 11–32 per column).
E: densitometric analysis of immunoblots for rat
AQP9 abundance in WIF-B9 cells after 24-h ex-
posure to insulin with or without E2 (n ⫽ 11 per
column). *Denotes statistically significant differ-
ences by nonparametric ANOVA or for E Stu-
dent’s t-test.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org

Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
Estrogens are recognized as important modulators of meta-
bolic homeostasis with effects on both glucose and lipid
metabolism (reviewed in Refs. 9 and 27), and in normal rat
liver ER␣ is the predominant estrogen receptor (18). ER␣ KO
mice have increased body weight and display decreased whole
body insulin sensitivity with impaired suppression of the en-
dogenous glucose production by insulin (1, 15). In the present
study, we found that AQP9 protein abundance is suppressed by
E2 in a concentration-dependent manner in cultured hepato-
cytes. In addition, the ER␣-selective agonist PPT also caused
a decrease in hepatocyte AQP9 expression when administered
in media containing 0.5% serum. This suggests that E2 through
ER␣ could be at least partially responsible for the observed sex
difference in the regulation of hepatic AQP9 during starvation.
Furthermore, the inhibition of AQP9 induction during starva-
tion by E2 is in line with the previously described suppression
of hepatic glucose production by estradiol (9).
Classical genomic effects of ERs are conducted by binding
to estrogen response elements (EREs). In addition, ERs are
known to regulate gene transcription by binding to other
DNA-bound transcriptions factors, such as AP1, NF-␬B and
some SP-1 binding sites (9). Previous analysis of the 5=
flanking region of human AQP9 found consensus recognition
sites for AP-1 and NF-␬B (38), and in mouse putative sites for
AP1, NF-␬B, and SP-1 were identified (19). Thus there seems
to be several candidate sequences for interaction with E2 in the
promoter region of AQP9, even though no putative EREs have
been identified. Another possible mechanism could be E2
modulating other signaling pathways such as the insulin sig-
naling pathway itself. In rat uterus, E2 acutely increased the
phosphorylation status of Akt and the downstream target
FoxO1 (21), the transcription factor known to interact with the
IRE in the promoter region of AQP9 (28). We here found that
ovariectomy alone had no apparent effect on the initial hepatic
glycerol handling, suggesting that E2 per se has no effect on
hepatic AQP9 abundance. Along the same line, PPT treatment
of hepatocytes only caused a decrease in AQP9 abundance in
the presence of FBS.
In conclusion, we demonstrate that the induction of hepatic
AQP9 expression and hepatic glycerol permeability during
starvation/low-insulin levels is blunted in female rats. The
higher expression of hepatic AQP9 observed in starved male
rats is paralleled by higher glycerol permeability in hepatocytes
from males and a concomitant lack of increase in plasma
glycerol. Ovariectomy obliterated both the starvation-induced
sex-specific regulation of AQP9 and the increase in plasma
glycerol observed in starved intact females. Our studies on
hepatocytes supported that the sexual dimorphism in hepatic
AQP9 regulation may be ascribed to E2 suppressing the ex-
pression of hepatic AQP9. This E2-mediated regulation of
hepatic AQP9 expression might contribute to the reported sex
differences in glycerol metabolism, such as the higher plasma
glycerol level reported in fasting and exercising women.
ACKNOWLEDGMENTS
We thank Dr. Doris Cassio, Université Paris-Sud, for kindly providing the
WIF-B9 hepatocytes and Inger Merete S. Paulsen, Helle Høyer, Else-Merete
Løcke, Tina Drejer, Christian V. Westberg, and Elsebeth Søgaard Hornemann
for expert technical assistance.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
G373
GRANTS
The Water and Salt Research Center at Aarhus University was estab-
lished and funded by the Danish National Research Foundation (Danmarks
Grundforskningsfond). J. Lebeck is supported by grants from the Faculty of
Health Sciences, Aarhus University. Funding for G. Calamita was provided
by Ricerca Scientifica e Tecnologica from Fondazione Cassa di Risparmio
di Pugli and PRIN20089SRS2X_003 from Ministero dell’Istruzione,
dell’Università e della Ricerca.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
1. Bryzgalova G, Gao H, Ahren B, Zierath JR, Galuska D, Steiler TL,
Dahlman-Wright K, Nilsson S, Gustafsson JA, Efendic S, Khan A.
Evidence that oestrogen receptor-alpha plays an important role in the
regulation of glucose homeostasis in mice: insulin sensitivity in the liver.
Diabetologia 49: 588 –597, 2006.
2. Butera PC. Estradiol and the control of food intake. Physiol Behav 99:
175–180, 2010.
3. Calamita G, Ferri D, Gena P, Carreras FI, Liquori GE, Portincasa P,
Marinelli RA, Svelto M. Altered expression and distribution of aqua-
porin-9 in the liver of rat with obstructive extrahepatic cholestasis. Am J
Physiol Gastrointest Liver Physiol 295: G682–G690, 2008.
4. Carbrey JM, Gorelick-Feldman DA, Kozono D, Praetorius J, Nielsen
S, Agre P. Aquaglyceroporin AQP9: solute permeation and metabolic
control of expression in liver. Proc Natl Acad Sci USA 100: 2945–2950,
2003.
5. Clore JN, Glickman PS, Helm ST, Nestler JE, Blackard WG. Accel-
erated decline in hepatic glucose production during fasting in normal
women compared with men. Metabolism 38: 1103–1107, 1989.
6. Davis SN, Galassetti P, Wasserman DH, Tate D. Effects of gender on
neuroendocrine and metabolic counterregulatory responses to exercise in
normal man. J Clin Endocrinol Metab 85: 224 –230, 2000.
7. Elkjaer M, Vajda Z, Nejsum LN, Kwon T, Jensen UB, miry-Moghad-
dam M, Frokiaer J, Nielsen S. Immunolocalization of AQP9 in liver,
epididymis, testis, spleen, and brain. Biochem Biophys Res Commun 276:
1118 –1128, 2000.
8. Fathipour A, Pridham JB. Proceedings: Control of glycerokinase activ-
ity by sex hormones. Biochem Soc Trans 2: 1116 –1118, 1974.
9. Foryst-Ludwig A, Kintscher U. Metabolic impact of estrogen signalling
through ERalpha and ERbeta. J Steroid Biochem Mol Biol 122: 74 –81,
2010.
10. Galassetti P, Tate D, Neill RA, Morrey S, Davis SN. Effect of gender on
counterregulatory responses to euglycemic exercise in type 1 diabetes. J
Clin Endocrinol Metab 87: 5144 –5150, 2002.
11. Gauthier MS, Favier R, Lavoie JM. Time course of the development of
non-alcoholic hepatic steatosis in response to high-fat diet-induced obesity
in rats. Br J Nutr 95: 273–281, 2006.
12. Gradilone SA, Tietz PS, Splinter PL, Marinelli RA, Larusso NF.
Expression and subcellular localization of aquaporin water channels in the
polarized hepatocyte cell line, WIF-B. BMC Physiol 5: 13, 2005.
13. Gustavsson C, Yassin K, Wahlstrom E, Cheung L, Lindberg J,
Brismar K, Ostenson CG, Norstedt G, Tollet-Egnell P. Sex-different
hepatic glycogen content and glucose output in rats. BMC Biochem 11: 38,
2010.
14. Hales CN, Walker JB, Garland PB, Randle PJ. Fasting plasma con-
centrations of insulin, non-esterified fatty acids, glycerol, and glucose in
the early detection of diabetes mellitus. Lancet 1: 65–67, 1965.
15. Heine PA, Taylor JA, Iwamoto GA, Lubahn DB, Cooke PS. Increased
adipose tissue in male and female estrogen receptor-alpha knockout mice.
Proc Natl Acad Sci USA 97: 12729 –12734, 2000.
16. Hill JO, Talano CM, Nickel M, DiGirolamo M. Energy utilization in
food-restricted female rats. J Nutr 116: 2000 –2012, 1986.
17. Jalouli M, Carlsson L, Ameen C, Linden D, Ljungberg A, Michalik L,
Eden S, Wahli W, Oscarsson J. Sex difference in hepatic peroxisome
proliferator-activated receptor alpha expression: influence of pituitary and
gonadal hormones. Endocrinology 144: 101–109, 2003.
18. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson
S, Gustafsson JA. Comparison of the ligand binding specificity and
transcript tissue distribution of estrogen receptors alpha and beta. Endo-
crinology 138: 863–870, 1997.
G374 SEX DIFFERENCES IN HEPATIC GLYCEROL METABOLISM
19. Kuriyama H, Shimomura I, Kishida K, Kondo H, Furuyama N,
Nishizawa H, Maeda N, Matsuda M, Nagaretani H, Kihara S, Naka-
mura T, Tochino Y, Funahashi T, Matsuzawa Y. Coordinated regula-
tion of fat-specific and liver-specific glycerol channels, aquaporin adipose
and aquaporin 9. Diabetes 51: 2915–2921, 2002.
20. Lehmann GL, Larocca MC, Soria LR, Marinelli RA. Aquaporins: their
role in cholestatic liver disease. World J Gastroenterol 14: 7059 –7067,
2008.
21. Lengyel F, Vertes Z, Kovacs KA, Kornyei JL, Sumegi B, Vertes M.
Effect of estrogen and inhibition of phosphatidylinositol-3 kinase on Akt
and FOXO1 in rat uterus. Steroids 72: 422–428, 2007.
22. Lin EC. Glycerol utilization and its regulation in mammals. Annu Rev
Biochem 46: 765–795, 1977.
23. Maeda N, Hibuse T, Funahashi T. Role of aquaporin-7 and aquaporin-9
in glycerol metabolism; involvement in obesity. Handb Exp Pharmacol
233–249, 2009.
24. Merimee TJ, Tyson JE. Stabilization of plasma glucose during fasting;
Normal variations in two separate studies. N Engl J Med 291: 1275–1278,
1974.
25. Mittendorfer B, Horowitz JF, Klein S. Gender differences in lipid and
glucose kinetics during short-term fasting. Am J Physiol Endocrinol Metab
281: E1333–E1339, 2001.
26. Nicchia GP, Frigeri A, Nico B, Ribatti D, Svelto M. Tissue distribution
and membrane localization of aquaporin-9 water channel: evidence for
sex-linked differences in liver. J Histochem Cytochem 49: 1547–1556,
2001.
27. Nilsson S, Gustafsson JA. Estrogen receptors: therapies targeted to
receptor subtypes. Clin Pharmacol Ther 89: 44 –55, 2011.
28. O’Brien RM, Streeper RS, Ayala JE, Stadelmaier BT, Hornbuckle
LA. Insulin-regulated gene expression. Biochem Soc Trans 29: 552–558,
2001.
29. O’Neill H, Lebeck J, Collins PB, Kwon TH, Frokiaer J, Nielsen S.
Aldosterone-mediated apical targeting of ENaC subunits is blunted in rats
with streptozotocin-induced diabetes mellitus. Nephrol Dial Transplant
23: 1546 –1555, 2008.
30. Patsouris D, Mandard S, Voshol PJ, Escher P, Tan NS, Havekes LM,
Koenig W, Marz W, Tafuri S, Wahli W, Muller M, Kersten S.
PPARalpha governs glycerol metabolism. J Clin Invest 114: 94 –103,
2004.
31. Peroni O, Large V, Odeon M, Beylot M. Measuring glycerol turnover,
gluconeogenesis from glycerol, and total gluconeogenesis with [2–13C]
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00437.2011 • www.ajpgi.org
Downloaded from journals.physiology.org/journal/ajpgi (083.165.053.135) on July 28, 2021.
glycerol: role of the infusion-sampling mode. Metabolism 45: 897–901,
1996.
32. Rodriguez A, Catalan V, Gomez-Ambrosi J, Garcia-Navarro S, Ro-
tellar F, Valenti V, Silva C, Gil MJ, Salvador J, Burrell MA, Calamita
G, Malagon MM, Fruhbeck G. Insulin- and leptin-mediated control of
aquaglyceroporins in human adipocytes and hepatocytes is mediated via
the PI3K/Akt/mTOR signaling cascade. J Clin Endocrinol Metab 96:
E586 –E597, 2011.
33. Rojek AM, Skowronski MT, Fuchtbauer EM, Fuchtbauer AC, Fenton
RA, Agre P, Frokiaer J, Nielsen S. Defective glycerol metabolism in
aquaporin 9 (AQP9) knockout mice. Proc Natl Acad Sci USA 104:
3609 –3614, 2007.
34. Scholz RW, Woodward BM, Rhoades RA. Utilization in vitro and in
vivo of glucose and glycerol by rat lung. Am J Physiol 223: 991–996,
1972.
35. Skowronski MT, Lebeck J, Rojek A, Praetorius J, Fuchtbauer EM,
Frokiaer J, Nielsen S. AQP7 is localized in capillaries of adipose tissue,
cardiac and striated muscle: implications in glycerol metabolism. Am J
Physiol Renal Physiol 292: F956 –F965, 2007.
36. Tepperman HM, Tepperman J. Adaptive changes in ␣-glycerophos-
phate-generating enzymes in rat liver. Am J Physiol 214: 67–72, 1968.
37. Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S,
Guggino WB, van Hoek AN, Hediger MA. Molecular characterization
of a broad selectivity neutral solute channel. J Biol Chem 273: 24737–
24743, 1998.
38. Tsukaguchi H, Weremowicz S, Morton CC, Hediger MA. Functional
and molecular characterization of the human neutral solute channel aqua-
porin-9. Am J Physiol Renal Physiol 277: F685–F696, 1999.
39. Valle A, Silvestri E, Moreno M, Chambery A, Oliver J, Roca P, Goglia
F. Combined effect of gender and caloric restriction on liver proteomic
expression profile. J Proteome Res 7: 2872–2881, 2008.
40. Vernon RG, Walker DG. Glycerol metabolism in the neonatal rat.
Biochem J 118: 531–536, 1970.
41. Wellejus A, Jensen HE, Loft S, Jonassen TE. Expression of aquaporin
9 in rat liver and efferent ducts of the male reproductive system after
neonatal diethylstilbestrol exposure. J Histochem Cytochem 56: 425–432,
2008.
42. Widdowson EM. The response of the sexes to nutritional stress. Proc
Nutr Soc 35: 175–180, 1976.