R E S E A R C H A R T I C L E

Sex-specific Effects of α2δ-1 in the Ventromedial

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
Hypothalamus of Female Mice Controlling Glucose
and Lipid Balance

Jennifer A. Felsted,1 Alice Meng,2 Dominique Ameroso,3 and Maribel Rios2,3,4

1
Graduate Program in Biochemical and Molecular Nutrition, Friedman School of Nutrition Science
and Policy, Tufts University, Boston, Massachusetts 02111; 2Graduate Program in Cell Molecular and
Developmental Biology, Graduate School of Biomedical Sciences, Tufts University School of Medicine,
Boston, Massachusetts 02111; 3Graduate Program in Neuroscience, Graduate School of Biomedical
Sciences, Tufts University School of Medicine, Boston, Massachusetts 02111; and 4Department of
Neuroscience, Tufts University School of Medicine, Boston, Massachusetts 02111

ORCiD number: 0000-0003-1760-8090 (M. Rios).

The thrombospondin receptor alpha2delta-1 (α2δ-1) plays essential roles promoting the activity
of SF1 neurons in the ventromedial hypothalamus (VMH) and mediating glucose and lipid
metabolism in male mice. Its role in the VMH of female mice remains to be defined, especially
considering that this hypothalamic region is sexually dimorphic. We found that α2δ-1 depletion
in SF1 neurons differentially affects glucose and lipid balance control and sympathetic tone in
females compared to males. Mutant females show a modest increase in relative body weight
gain when fed a high-fat diet (HFD) and normal energy expenditure, indicating that α2δ-1 is not
a critical regulator of energy balance in females, similar to males. However, diminished α2δ-1
function in the VMH leads to enhanced glycemic control in females fed a chow diet, in contrast
to the glucose intolerance reported previously in mutant males. Interestingly, the effects of
α2δ-1 on glucose balance in females are influenced by diet. Accordingly, females but not males
lacking α2δ-1 exhibit diminished glycemic control as well as susceptibility to hepatic steatosis
when fed a HFD. Increased hepatic sympathetic tone and CD36 mRNA expression and reduced
adiponectin levels underlie these diet-induced metabolic alterations in mutant females. The
results indicate that α2δ-1 in VMH SF1 neurons critically regulates metabolic function through
sexually dimorphic mechanisms. These findings are clinically relevant since metabolic alterations
have been reported as a side effect in human patients prescribed gabapentinoid drugs, known
to inhibit α2δ-1 function, for the treatment of seizure disorders, neuropathic pain, and anxiety
disorders. (Endocrinology 161: 1–13, 2020)

Key Words: ventromedial hypothalamus, energy balance, glucose balance, lipid balance,

sympathetic tone, sex-specific

T
he ventromedial hypothalamus (VMH) plays a
well-established role in appetite and body weight
regulation (1-3) as well as in glucose homeostasis (4-
8) and lipid metabolism (9, 10). These effects are fa-
cilitated, in part, via regulation of sympathetic output
to metabolic organs in the periphery (11, 12). The
ISSN Online 1945-7170
© Endocrine Society 2020. All rights reserved. For permissions, please e-mail: journals.
permissions@oup.com
Received 5 December 2019. Accepted 21 April 2020.
First Published Online 27 April 2020.
Corrected and Typeset 10 June 2020.
underlying mechanisms remain poorly understood.
We reported a previously unrecognized and essential
role of alpha2delta-1 (α2δ-1) in suppressing appetite
and facilitating glycemic control, acting downstream
of brain-derived neurotrophic factor (BDNF) in the
VMH (13). α2δ-1 is an auxiliary subunit of voltage-
gated calcium channels, facilitating calcium currents
Abbreviations: AUC, area under the curve;BAT, brown adipose tissue; BDNF,
brain-derived neurotrophic factor; CD, chow diet;GTT, glucose tolerance
test;HFD, high fat diet;HSL, hormone-sensitive lipase;SF1, steroidogenic factor-
1;SM, skeletal muscle;TG, triglyceride; VMH, ventromedial hypothalamus;WAT,
white adipose tissue.

doi: 10.1210/endocr/bqaa068 Endocrinology, July 2020, 161(7):1–13   https://academic.oup.com/endo   1

2  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH
and neurotransmitter release (14). Additionally, it serves
as a receptor for thrombospondins to induce excitatory
synapse assembly through calcium-channel independent
mechanisms (15). α2δ-1 is expressed in brain regions
involved in metabolic control, with notably high expres-
sion in the VMH (16, 17).
Mice with central BDNF depletion exhibit dramatic
obesity, hyperglycemia, dyslipidemia, and decreased ex-
citatory tone in the VMH as well as a significant re-
duction in cell-surface expression of α2δ-1 in the VMH
(13). Rescuing this deficit broadly in the VMH via viral
gene delivery, significantly mitigated hyperphagia and
body weight gain and normalized glycemic control in
BDNF mutant mice. Moreover, a more discrete and se-
lective deletion of α2δ-1 in steroidogenic factor-1 (SF1)
neurons, which in the brain are exclusive to the VMH,
elicited significant reductions in neuronal activity and
sympathetic output without affecting calcium currents,
ultimately resulting in glucose intolerance and alter-
ations in lipid metabolism (18). In total, these studies
support a chief role of α2δ-1 as increasing VMH neur-
onal excitability and activity in a calcium channel-
independent manner to facilitate energy and glucose
balance control. However, a caveat of these previous
investigations is that they were performed exclusively
in males. Considering that the VMH is a sexually di-
morphic region of the brain, it is important to assess
whether α2δ-1 plays similar roles in females.
Here, we examined the effects of depleting α2δ-1
from SF1 neurons in female mice. We found that in con-
trast to males with similar deficits in α2δ-1, mutant fe-
males exhibit normal sympathetic output and lipolysis
in white adipose tissue and enhanced glycemic control
under chow conditions when compared to female con-
trols. However, mutant females display glucose intoler-
ance and increased susceptibility to hepatic steatosis
when challenged with a high-fat diet (HFD) compared
with controls. The collective findings indicate that the
effects of α2δ-1 in the VMH influencing metabolic
function are sexually dimorphic. These findings are clin-
ically relevant since metabolic alterations have been
reported as a side effect in human patients prescribed
gabapentinoid drugs, known to inhibit α2δ-1 function
(19), for the treatment of seizure disorders, neuropathic
pain, and anxiety disorders (20, 21).
Materials and Methods
Animals
All procedures were approved by the Institutional Animal
Care and Use Committee at Tufts University and conducted in
accordance with the National Institutes of Health Guide for
Care and Use of Laboratory Animals guidelines. Mice with
Endocrinology, July 2020, 161(7):1–13
specific α2δ-1 depletion in SF1-positive neurons of the VMH
were generated by breeding homozygous floxed α2δ-1 mice
(18) with SF1-Cre transgenic mice obtained from the Jackson
Laboratory (Stock No: 012462; Tg(Nr5a1-cre)7Lowl/J).
Experiments described herein used age-matched littermate
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
mutant (α2δ-12L/2L:SF1-Cre) and control (α2δ-12L/2L) mice to
reduce genetic background differences. Females from the
ages of 15 to 20 weeks were used for all of the experiments.
They were housed in proximity to males to promote regular
estrous cyclicity and they had a 14-hour light/10-hour dark
cycle (lights on from 6:00 am to 8:00 pm) and at a tempera-
ture of 72oF.
α2δ-1 immunofluorescence
Mice were deeply anesthetized and transcardially per-
fused with 10 mL of cold saline followed by 30 mL of 4%
paraformaldehyde (PFA), pH 7.2. Brains were immedi-
ately removed, post-fixed in 4% PFA for 4 hours at 4oC,
cryoprotected in a 30% sucrose solution and frozen in
mounting media until 30  μm-thick coronal sections were
obtained using a Leica CM1900 Cryostat. Free-floating brain
sections were blocked using 10% normal goat serum (NGS,
005-000-121, Jackson ImmunoResearch Laboratories, Inc.)
(22) and 0.25% Triton X-100 for 90 minutes at room tem-
perature. Brain sections were incubated overnight at 4°C
with mouse anti-α2δ-1 (D219, Sigma, 1:200) (23) followed
by incubations with fluorescence-conjugated secondary anti-
bodies at room temperature for 1 hour. A Nikon A1R micro-
scope configured for confocal microscopy was used to obtain
images of labeled brain sections. Scanning parameters for
the laser power, gain, and offset were determined using the
control group and then applied to all images throughout the
experiment.
Food intake and body weight measurements
Mice were individually housed with unrestricted access to
water and a premeasured amount of food. Body weight and
food intake measurements were monitored beginning at 6
weeks of age and measured weekly at the same time of day.
The amount of grams of food consumed each week was then
used to calculate caloric intake (kcal). Animals were fed either
a chow diet (CD; Harlan Teklad 2918; 3.1 kcal/g with 18%
from fat) or, at 8 weeks of age, switched to a 58% high-fat diet
with sucrose (HFD; Research Diets D12331; 5.56 kcal/g) for
up to 18 weeks.
Energy expenditure
Energy expenditure was assessed by indirect calorimetry
using OxyletPro Physiocage metabolic chambers, a LE405 Gas
Analyzer to sample air from individual cages, and Metabolism
v2.2 software to integrate gas samples and compute energy ex-
penditure (Panlab/Harvard Apparatus). Mice were housed in
individual metabolic assessment chambers containing normal
bedding and unrestricted access to food and water. The flow
rate of fresh air into each cage was set according to individual
animal’s body weight (e.g., a 34 g mouse would set a flow rate
of 0.34 L/min). Each cage was sampled every 15 minutes for
doi: 10.1210/endocr/bqaa068
3-minute increments. Data were discarded for the first day that
animals were in the chamber. Measurements for the remaining
3 test days were analyzed and the data, averaged across days,
are reported as average oxygen uptake and carbon dioxide
production.
Locomotor activity
Mice were individually housed in their home cages
(standard 15  × 24  cm plastic cages) and transported to
the testing room (14-hour light/dark cycle) for 6  days of
acclimation to the testing room. The home cage was situ-
ated such that the Smart Frame Activity System photobeam
frame surrounded it. During testing, locomotor activity, as
measured by beam breaks, was recorded continuously using
MotorMontitor software (Hamilton/Kinder). Data collected
from the first day were discarded. The remaining 5 days of
data were binned in hourly increments and averaged across
test days.
Glucose tolerance tests
For the glucose tolerance test (GTT), animals were fasted
overnight for 16 hours and then, using a scalpel, a small cut
was made in the distal portion of the tail to enable the col-
lection of a fasting baseline (0) blood glucose measurement.
Following this baseline measurement, 1.5 g/kg D-glucose was
administered intraperitoneally (i.p.). Subsequent blood sam-
ples were collected at 15, 30, 60, and 120 minutes post–glu-
cose injection. The GTT was performed at 20 weeks of age.
Two measurements were collected at each time-point and then
averaged. Data for fasting blood glucose measurements, blood
glucose time-course over 120 minutes, and area under the
curve (AUC) are presented.
Tissue collection and measurements
Mice were anesthetized using isofluorane and following
cervical dislocation, tissues were dissected, flash frozen in li-
quid nitrogen, and stored at −80°C until further analysis.
Tissues collected included liver, perigonadal white adipose
tissue (WAT), brown adipose tissue (BAT), skeletal muscle
(SM, soleus and gastrocnemius muscle), brain and serum. All
tissue collections were performed from 8 to 11 am. Serum
insulin (Rat/Mouse Insulin ELISA kit, Millipore Sigma)
(24), leptin (Mouse Leptin ELISA kit, Millipore Sigma) (25),
adiponectin (Mouse Adiponectin ELISA kit, Millipore Sigma)
(26), glycerol (Glycerol Assay kit, Millipore Sigma), and
NEFA (Free Fatty Acid quantification kit, Millipore Sigma)
levels were measured using commercially available kits and
used according to the manufacturer’s instructions. Triglyceride
and total cholesterol concentrations in liver, WAT, and serum
samples were determined by the Vanderbilt Hormone Assay
and Analytical Services Core (Vanderbilt University, Nashville,
TN). Norepinephrine content in liver, WAT, BAT, SM, and
serum samples was analyzed using high-performance liquid
chromatography (HPLC) methods by the Neurochemistry
Core Laboratory at the Vanderbilt Brain Institute (Vanderbilt
University School of Medicine, Nashville, TN).
https://academic.oup.com/endo  3
Quantitative RT-PCR analysis
Total RNA was extracted from liver tissue using the RNeasy
lipid tissue mini kit (Qiagen, Valencia, CA) kit. Following cDNA
synthesis, real-time PCR amplification was performed using a
MX-3000P Stratagene cycler and 2X SYBR green PCR master
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
mix (Qiagen, Valencia, CA). A two-step protocol was used: 95°C
for 10 minutes and 45 cycles with 95°C for 30 seconds, 55°C
for 30 seconds, and 72°C for 30 seconds. The following primers
were used for the analysis: DGAT1, TCCGCCTCTGGGCATTC
(forward) and GAATCGGCCCACAATCCA (reverse);
DGAT2, AGTGGCAATGCTATCATCATCGT (forward) and
AAGGAATAAGTGGGAACCAGATCA (reverse); CD36,
CCGAGGACCACACTGTGTC (forward) and AACCCCA
CAAGAGTTCTTTCAAA (reverse); SCD1, TTCTTGCGATA
CACTCTGGTGC (forward) and CGGGATTGAATGTTC
TTGTCGT (reverse); TNFα, CTCCAGGCGGTGCCTATG
(forward) and GGGCCATAGAACTGATGAGAGG (reverse);
SREBP‐1c, GCAGCCACCATCTAGCCTG (forward) and CAGCA
GTGAGTCTGCCTTGAT (reverse); Fas, GGAGGTGGTG
ATAGCCGGTAT (forward) and TGGGTAATCCATAGA
GCCCAG (reverse); PPARγ, CACAAGAGCTGACCCAATGGT
(forward) and GATCGCACTTTGGTATTCTTGGA (reverse).
Western blot analysis
Protein lysates were generated by homogenization of
tissues with a polytron homogenizer in T-Per protein ex-
traction reagent (Thermo Fisher) containing protease and
phosphatase inhibitors. Western blot analysis of samples
was conducted using standard methods. Blot images were
acquired using a Fuji film LAS-4000 Image reader and
densitometry performed using ImageStudioLite. The fol-
lowing primary antibodies were used: mouse anti-α2δ-1
(1:2000, Sigma, St. Louis, MO) (23), mouse anti-β tubulin
(1:10,000 Sigma, St. Louis, MO) (27), rabbit anti-HSL
(28), anti-pHSLS660 (29) or anti-pHSLS565 (30)(1:1000; Cell
Signal Technology, Danvers, MA) and mouse anti-β-actin
(1:10,000; Thermo Fisher) (31).
Statistical analysis
Analytical software used to perform the statistical ana-
lysis included GraphPad Prism and SAS (Statistical Analysis
Software). Repeated measures ANOVA, using Bonferroni’s
method to adjust for multiple comparisons, was performed
to analyze weekly food intake and body weight meas-
urements as well as the time course data for the glucose
tolerance tests. Two-way ANOVAs and Bonferroni’s mul-
tiple comparisons tests were used to analyze norepineph-
rine, triglycerides, total cholesterol, serum leptin, serum
adiponectin, serum glycerol, serum nonesterified free fatty
acids, hepatic transcript, and hormone-sensitive lipase
(HSL) concentrations. Student unpaired t tests were per-
formed to analyze group comparisons for locomotor
activity, energy expenditure, AUC, and serum insulin.
Comparisons were determined by be statistically signifi-
cant when P  <  0.05. All values are depicted as mean ±
standard error of the mean (SEM).
4  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH
Results
Α2 δ -1 in the VMH of female mice is not a
critical regulator of energy balance
We showed previously that α2  δ -1 depletion
in VMH SF1 neurons of male mice does not have
an effect on feeding, energy expenditure or body
weight when fed a chow (CD) or high-fat diet
(HFD), negating a required role in the regulation of
energy balance (18). Because the VMH is sexually
dimorphic (32), we investigated whether α2  δ -1
is also dispensable in mutant females. For this, we
crossed floxed α2  δ -1 mice with SF1-cre mice to
generate α2 δ -1 2L/2L:SF1-cre mutant and α2 δ -1 2L/2L
control females. Figs.  1A and 1B show that α2  δ
-1 is depleted in the VMH of α2 δ -1 2L/2L:SF1-cre as
previously reported for mutant males (18). Because
SF1 is also expressed in the adrenal glands, cre-
mediated recombination is expected to occur in
this tissue. However, as we reported previously,
α2δ-1 is not expressed in wild-type adrenal glands
(18) and thus, its depletion in this region is not a
confounding factor.
ANOVA analysis did not show a significant effect
of genotype on body weight in mutant females fed CD
(Fig.  1C). Moreover, no significant changes in CD in-
take were observed (Fig.  1D). Total body weights in
α2 δ -12L/2L:SF1-cre females compared with α2  δ -12L/2L
controls were not significantly different when challenged
with a HFD starting at 8 weeks of age (Fig. 1E). When
we calculated percentage body weight gain following
transition from a CD to a HFD, we found that there was
a significant effect of genotype (P  =  0.003) and a sig-
nificant interaction of genotype and time (P < 0.0001);
however, this effect was modest, with mutants exhib-
iting a 38% weight gain compared with 28% in controls
(data not shown). Measurements of HFD intake revealed
a significant interaction of genotype and time (P = 0.02)
(Fig. 1F), with mutants exhibiting a mild increase in food
intake. Finally, measurements of lean and fat mass in fe-
males fed a CD (Fig.  1G) or a HFD (Fig.  1H) did not
reveal any significant differences in mutants compared
with controls.
Locomotor activity under CD conditions was
normal in mutant females (Fig. 1I). Furthermore, en-
ergy expenditure was not affected in α2δ-1 2L/2L:SF1-
Cre
mutants fed a CD or HFD (Fig. 1J). In aggregate,
the findings suggest that α2δ-1 expression in SF1
neurons is not required for the regulation of energy
expenditure in female mice. These findings indicate
that VMH α2δ-1 does not play a critical role in en-
ergy balance regulation in females.
Endocrinology, July 2020, 161(7):1–13
α2δ-12L/2L:SF1-cre mutant females exhibit
enhanced and diminished glycemic control
under chow and HFD conditions, respectively
The VMH plays requisite roles in the regulation of
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
glucose balance (4-8). We asked whether α2δ-1 in SF1
neurons is essential for those effects in female mice.
α2δ-12L/2L:SF1-Cre females fed a CD had a significant in-
crease in glucose tolerance compared with α2δ-12L/2L
controls fed a similar diet (Fig. 2A and 2B). Accordingly,
there was a significant effect of genotype (P = 0.0006) in
the GTT (2A) and a trend (P = 0.09) towards a signifi-
cant reduction in AUC in mutants compared with con-
trols (Fig. 2B). Consistent with their enhanced glycemic
control, α2δ-12L/2L:SF1-Cre females fed a CD showed a
significant (P  =  0.04) reduction in fasted levels of cir-
culating insulin (Fig.  2C), suggesting increased insulin
sensitivity. These findings in females are opposite to our
previous observations in α2δ-12L/2L:SF1-Cre mutant males
fed a similar diet, which display glucose intolerance (18)
(Table 1).
We tested the effects of dietary challenge on glucose
homeostasis in α2δ-12L/2L:SF1-Cre females. In contrast to
our findings in females fed a CD, female mutants sub-
jected to a HFD displayed mild glucose intolerance com-
pared with α2δ-12L/2L females fed a similar diet (Fig. 2D
and 2E). Accordingly, there was a main effect of geno-
type (P = 0.02) in the GTT (Fig. 2D). Furthermore, fe-
male mutants fed a HFD had similar circulating levels
of insulin to those of diet-matched controls (Fig.  2F).
Examination of α2δ-12L/2L:SF1-Cre and control males fed
a HFD did not reveal significant differences in the GTT
or AUC (Fig. 2G and 2H) (Table 1). In total, the data in-
dicate that depletion of α2δ-1 in SF1 neurons produces
sex-specific effects on glycemic control. Moreover, they
suggest that perturbing VMH α2δ-1 function has a bi-
directional effect on glucose balance influenced by diet
in females but not in males.
Depletion of α2δ-1 in SF1 neurons in females
increases susceptibility to diet-induced hepatic
steatosis
Lipid metabolism is greatly influenced by neuronal
activity in the VMH (9, 10). We asked whether α2δ-1
depletion in this hypothalamic region affected lipid
balance control in female mice. For this, we measured
levels of triglycerides (TG) and cholesterol in serum,
WAT, and liver of fed α2δ-12L/2L:SF1-Cre mutants and
α2δ-12L/2L controls. There was a significant effect of diet
on TG levels in serum (P = 0.003), WAT (P = 0.007), and
liver (P = 0.03) (Fig. 3A, 3B and 3C). Notably, there was
a significant effect of genotype (P = 0.05) and a trend
(P = 0.07) towards a significant interaction of diet and
doi: 10.1210/endocr/bqaa068 https://academic.oup.com/endo  5

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022

Figure 1.  α2δ-1 deletion in SF1 neurons in female mice does not affect energy balance regulation. (A) Representative brain sections from
female α2δ-12L/2L:SF1-Cre and α2δ-12L/2L mice immunolabeled with anti-α2δ-1. Scale bar = 50 µM. (B) Western blot analysis of α2δ-1 protein content
in the VMH of female α2δ-12L/2L:SF1-Cre and α2δ-12L/2L mice (n = 3–4). *P = 0.005 unpaired t test. Body weights (C) and food intake (D) of female
α2δ-12L/2L:SF1-Cre and α2δ-12L/2L mice fed a chow diet (n = 9-11). Body weights: ANOVA: Genotype, F (1,16) = 2.9, P = 0.1; Time, F (12, 192) = 31.8,
P < 0.0001; * P < 0.05. Body weights (E) and food intake (F) of female α2δ-12L/2L:SF1-Cre and α2δ-12L/2L mice fed HFD (n = 9-11). Body weights
ANOVA: Genotype, F (1, 18) = 1.6, P = 0.2; Time, F (4.6, 82) =108.7, P < 0.0001; * P < 0.05; Food intake: Genotype and time, F (12, 175) = 2.1,
P = 0.02. (G) Body composition in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females fed a CD. (H) Body composition in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L
females fed a HFD. (I) Locomotor activity of female α2δ-12L/2L:SF1-Cre and α2δ-12L/2L mice (n = 4-9) fed a chow diet. (J) Energy expenditure in
females expressed as average VO2 (left) and VCO2 (right) (n = 3-6).
6  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH Endocrinology, July 2020, 161(7):1–13

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
Figure 2.  α2δ-12L/2L:SF1-cre mutant females exhibit enhanced glycemic control under chow conditions and increased glucose intolerance following
chronic administration of a HFD. (A) Time course for glucose tolerance test (GTT) in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females on CD (n = 8-10 per
group). ANOVA: Genotype, F (1, 15) = 6, P = 0.03 (genotype); Time, F (2.0, 29.9) = 41.9 and P < 0.0001. * P = 0.05; **, P = 0.01. (B) Area under
the curve (AUC) for GTT under CD conditions (n = 8-10). Unpaired, two-tailed t test: P = 0.09. (C) Fasting serum insulin levels in α2δ-12L/2L and
α2δ-12L/2L:SF1-Cre females (n = 8-9) on CD. Unpaired, two-tailed t test: * P = 0.04. (D) Time course for GTT in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females
on HFD (n = 9-11 per group). ANOVA: Genotype, F (1, 90) = 5.5, P = 0.02; Time, F (4, 90), P < 0.001 * P = 0.05. (E) AUC for GTT under HFD
conditions (n = 9-11 per group). (F) Fasting serum insulin levels in α2δ-12L/2L and α2δ-12L/2L:SF1-Cre females (n = 7-11) on HFD. (G) Time course for
GTT in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L males on HFD (n = 10-11 per group). (H) AUC for GTT under HFD conditions in males (n = 10-11 per group).

genotype on TG content in the liver. Indeed, whereas
hepatic content of TG significantly increased as a conse-
quence of HFD administration in mutant females, it did
not in controls. Accordingly, α2δ-12L/2L:SF1-Cre females
fed a HFD exhibited a significant increase in TG levels
in the liver compared with their α2δ-12L/2L counterparts
(Fig.  3C). We reported previously that TG content in
serum, WAT, and liver of α2δ-12L/2L:SF1-Cre males fed a
CD was normal (18). Here, we investigated whether the
effects of dietary challenge observed in mutant females
were also present in mutant males. α2δ-12L/2L:SF1-Cre
males fed a HFD contained normal and decreased levels
of TG in serum and WAT, respectively (Fig.  3D and
E). However, TG content in liver was not significantly
different in α2δ-12L/2L:SF1-Cre males compared with
α2δ-12L/2L controls (Fig. 3F) (Table 1). The results indi-
cate that α2δ-1 depletion in SF1 neurons results in sus-
ceptibility to diet-induced hepatic steatosis in females.
Levels of cholesterol were also differentially af-
fected by diet in α2δ-12L/2L:SF1-Cre females compared
with α2δ-12L/2L controls. There was a significant effect
of genotype (P  =  0.02) on circulating levels of choles-
terol (Fig.  3G). In WAT, there was a significant effect
of genotype (P  =  0.04) and a significant interaction
of genotype and diet (P  =  0.05) on cholesterol levels.
Accordingly, WAT cholesterol levels were significantly
higher in control HFD females compared with HFD
mutants (Fig. 3H). There were no significant differences
in cholesterol content in liver under either diet (Fig. 3I).
Mutant males fed a CD exhibited normal and decreased
levels of cholesterol in serum and WAT, respectively, as
reported previously (18). However, cholesterol content
in WAT, serum and liver were normal following admin-
istration of a HFD (data not shown).
Next, we interrogated mechanisms driving lipid ac-
cumulation in the livers of α2δ-12L/2L:SF1-Cre females
doi: 10.1210/endocr/bqaa068 https://academic.oup.com/endo  7

Table 1.  Effects of Depleting α2δ-1 in the VMH of Female and Male Mice: Metabolic Parameters in Female
and Male α2δ-12L/2L:SF1-Cre Mice Compared With Their Sex- and Diet-Matched Controls
Metabolic Parameter α2δ-1-12L/2L:SF1-cre Females α2δ-1-12L/2L:SF1-cre Males

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
Food Intake (CD) Normal Normal*
Food Intake (HFD) Mild increase Normal*
Body Weight (CD) Normal Normal*
Body Weight (HFD) 10% increase in relative weight gain Normal*
Energy Expenditure Normal Normal*
Fat and Lean Mass Normal Normal*
Glucose Tolerance (CD) Improved Reduced*
Glucose Tolerance (HFD) Reduced Normal
Fasted Insulin Levels (CD) Reduced (44% of control levels) Normal*
Fasted Insulin Levels (HFD) Normal Normal*
Liver TG (HFD) Increased (120% of control levels) Normal
Lipolysis in WAT Normal Elevated*
  Serum Glycerol levels Normal Elevated (315% of control levels) *
  Activated HSL levels in WAT Normal Elevated *
Serum NE Content (CD) Normal Reduced (27% of control levels)*
WAT NE Content (CD) Normal Reduced (55% of control levels)*
Liver NE Content (HFD) Increased (450% of control levels) Normal
*Previously reported in (18)

fed a HFD. For this, we measured hepatic transcript
content of factors involved in lipogenesis and TG syn-
thesis, including Fas, SREBP-1c, DGAT1, DGAT2,
CD36, SCD1, PPARγ and TNFα in control and mu-
tant females fed CD or HFD. Quantitative RT-PCR
analysis revealed that expression of Fas, SREBP-1c,
DGAT1, DGAT2, SCD1, PPARγ, and TNFα was com-
parable in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females fed
similar diets. In contrast, whereas levels of the fatty
acid translocase CD36 were similar in controls and
mutants fed a CD, they were significantly elevated
in mutants fed a HFD compared with controls fed a
similar diet (Fig. 4). This finding suggests that CD36-
mediated increases in hepatic fatty acid uptake con-
tribute to susceptibility to diet-induced liver steatosis
in α2δ-12L/2L:SF1-Cre females.
Normal lipolysis but diminished adiponectin
secretion by WAT in α2δ-12L/2L:SF1-Cre females fed
a HFD
During lipolysis, triglycerides are hydrolyzed and free
fatty acids and glycerol are released from WAT into the
circulation. This process is augmented during conditions
of negative energy balance to provide the animal with
substrates for oxidative metabolism and ATP produc-
tion in peripheral tissues. Disinhibited lipolysis can re-
sult in increased hepatic lipid accumulation and reduced
insulin sensitivity (33, 34). We reported previously that
α2δ-12L/2L:SF1-Cre mutant males fed a CD exhibited an
elevation in lipolysis as indicated by increased levels of
the activated form of the lipolytic enzyme, hormone sen-
sitive lipase (pHSLS660) in WAT and a 315% elevation
in circulating levels of glycerol (18). We investigated
whether this was also the case in female mutants, con-
tributing to the metabolic alterations that they exhibit.
Measurements of total protein levels of HSL and its
activated (pHSL660) and inhibited forms (pHSL565) in
WAT were performed in the fed state, similar to meas-
urements of TG content in liver and WAT. We found
that levels of HSL, pHSL660, and pHSL565 were similar
in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females administered
similar diets (Fig. 5A, 5B and 5C). Consistent with these
findings, whereas there was a significant effect of diet on
circulating levels of glycerol and free fatty acids (FFA),
there was no significant effect of genotype, indicating
that lipolysis in WAT was not affected in mutant fe-
males (Fig. 5D and 5E) (Table 1).
Next, we asked whether adiponectin levels were al-
tered in α2δ-12L/2L:SF1-Cre females, as this adipokine
counters excess lipid storage in the liver (35, 36).
Indeed, we found that whereas levels of adiponectin
were similar in α2δ-12L/2L:SF1-Cre and α2δ-12L/2L females
fed a CD, they were significantly reduced in mutant fe-
males fed HFD compared with diet-matched controls
(Fig.  5F). Serum levels of leptin were also measured
and found to be comparable in α2δ-12L/2L:SF1-Cre and
α2δ-12L/2L females fed a CD or HFD and only influ-
enced by diet (data not shown).
In total, the results indicate that, unlike male
α2δ-12L/2L:SF1-Cre mice, mutant females exhibit normal
levels of lipolysis. Furthermore, they suggest that dimin-
ished circulating levels of adiponectin in α2δ-12L/2L:SF1-Cre
females could underlie their susceptibility to diet-induced
hepatic steatosis.
Hepatic sympathetic tone in α2δ-12L/2L:SF1-Cre females
is significantly elevated by HFD administration.
8  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH Endocrinology, July 2020, 161(7):1–13

Figure 3.  Depletion of α2δ-1 in SF1 neurons in females elicits deficits in lipid balance control. Levels of triglycerides in serum (A), Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
perigonadal white adipose tissue (WAT) (B) and liver (C) of α2δ-12L/2L and α2δ-12L/2L:SF1-Cre (n = 4-5 per group) females. ANOVA, Serum: Diet, F
(1,12) = 13.8, P = 0.003; WAT: Diet, F (1,12) = 10.7, P = 0.007; Liver: Diet, F (1,12) = 13.7, P = 0.03 (diet) and Genotype, F (1,12) = 4.7, P = 0.05.
Levels of triglycerides in serum (D), perigonadal WAT (E) and liver (F) of α2δ-12L/2L and α2δ-12L/2L:SF1-Cre males (n = 8-9 per group) fed a HFD. Levels
of cholesterol in serum (G), WAT (H) and liver (I) of α2δ-12L/2L females (n = 4-5 per group). ANOVA, Serum: Genotype, F (1, 12) = 6.9, P = 0.02;
WAT: Genotype, F (1, 12) = 5.6, P = 0.04 (genotype) and genotype x diet, F (1,12) = 4.9, P = 0.05. * P < 0.05.

The VMH regulates peripheral glucose and lipid me-
tabolism through the control of sympathetic output
to metabolic organs (5, 10, 37-39). We found previ-
ously that sympathetic tone was significantly reduced
in α2δ-12L/2L:SF1-Cre males fed a CD as indicated by
45% and 63% reductions in norepinephrine (NE) con-
tent in WAT and serum, respectively (18). Because SF1
neurons critically regulate sympathetic tone in the per-
iphery, we asked whether alterations in this branch of
the autonomic system in α2δ-12L/2L:SF1-Cre females might
contribute to the metabolic alterations that they exhibit.
There was a significant effect of diet on NE content in
WAT. However, levels of NE in serum, WAT, BAT, and
smooth muscle were normal in mutant females com-
pared with diet-matched controls (Fig.  6A-6D). In
contrast, levels of NE in liver were significantly and
dramatically elevated in α2δ-12L/2L:SF1-Cre females com-
pared with α2δ-12L/2L controls fed a HFD (Fig. 6E). This
doi: 10.1210/endocr/bqaa068
Figure 4.  Increased expression of CD36 mRNA in the liver of
α2δ-12L/2L:SF1-Cre females fed a HFD. Quantitative RT-PCR analysis
of transcript levels in liver of factors involved in lipogenesis and
TG synthesis in α2δ-12L/2L and α2δ-12L/2L:SF1-Cre females (n = 6 per
group). CD36, ANOVA: Genotype: F (1, 17) = 4.4, P = 0.05; Diet,
F (1, 17) = 31.1, P < 0.001; Genotype × Diet: F (1, 17) = 9.2, P = 0.007.
* P = 0.003.
effect of HFD on hepatic sympathetic outflow was not
observed in mutant males (Fig. 6F) (Table 1), which also
contained normal levels of NE in serum, WAT, BAT, and
smooth muscle (data not shown). The data indicate that
α2δ-1 depletion in the VMH exerts sexually dimorphic
effects on sympathetic tone, diminishing sympathetic
function in males but not in females fed a CD and
increasing hepatic sympathetic outflow in females but
https://academic.oup.com/endo  9
not in males fed a HFD. Furthermore, considering pre-
vious findings showing that increased sympathetic tone
onto the liver elicits hepatic steatosis (40), the increase
in hepatic sympathetic outflow in α2δ-12L/2L:SF1-Cre fe-
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
males fed a HFD likely contributes to their susceptibility
to TG accumulation.
Discussion
Here, we show that effects of α2δ-1 in the VMH
influencing glucose and lipid balance and sympathetic
outflow are sexually dimorphic. In females, α2δ-1 de-
pletion results in improved glycemic control under CD
conditions and in mild body weight gain, glucose intoler-
ance, elevated sympathetic tone, and TG accumulation
in the liver when fed a HFD. These bidirectional effects
influenced by diet, suggest an important role of α2δ-1
coordinating adaptive mechanisms during challenging
dietary conditions. They are also clinically relevant
considering that alterations in metabolic function have
been reported in individuals treated with gabapentinoid
drugs, which inhibit α2δ-1 (19-21).
Depleting α2δ-1 in SF1 neurons had very mild ef-
fects on body weight of females and only when chal-
lenged with a HFD, indicating that α2δ-1 in those cells
does not play a critical role in energy balance regula-
tion, similar to males. However, sex-specific effects of
α2δ-1 in the VMH were evident in mechanisms control-
ling glucose homeostasis. We reported previously that
α2δ-12L/2L:SF1-Cre males fed a CD are glucose intolerant
relative to littermate controls, indicating an essential
and body weight-independent role of α2δ-1 facilitating
glycemic control. In contrast, α2δ-12L/2L:SF1-Cre females
fed a CD exhibited a significant increase in glucose tol-
erance and reduced fasted levels of serum insulin, sug-
gesting enhanced insulin sensitivity. Diet influenced the
consequences of depleting α2δ-1 in the female VMH.
Accordingly, mutant females fed a HFD exhibited a mild
reduction in glycemic control compared with α2δ-12L/2L
females fed a similar diet. This effect was absent in mu-
tant males fed a HFD, which performed similarly to con-
trol males in the GTT. Because there were no significant
effects of genotype on total body weights of α2δ-12L/2L
females fed a CD or a HFD, it is unlikely that observed
alterations in glucose balance are driven by changes in
body weight. Because SF1 is also expressed in the pi-
tuitary and we used the SF1-cre line of mice, it is also
important to consider that altered α2δ-1 function in
this region might contribute to the observed metabolic
alterations. In total, the data suggest that α2δ-1 facili-
tates adaptive cellular mechanisms mediating metabolic
flexibility in female mice.
10  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH Endocrinology, July 2020, 161(7):1–13

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
Figure 5.  Normal lipolysis but diminished adiponectin secretion by WAT in α2δ-12L/2L:SF1-Cre females fed a HFD. Representative blot
(A) and quantification of Western blot analysis of HSL (B), pHSL660 (C) and pHSL565 (D) protein content in WAT samples obtained from fed
α2δ-12L/2L (C) and α2δ-12L/2L:SF1-Cre females (M) fed CD or HFD (n = 6). Serum levels of FFA (E), Glycerol (F) and adiponectin (G) in α2δ-12L/2L and
α2δ-12L/2L:SF1-Cre females fed CD or HFD (n = 6). ANOVA, Adiponectin: Diet, F (1, 19) = 8.3, P = 0.01 and Genotype, F (1, 19) = 4.0, P = 0.05.
* P = 0.008.

Lipid balance control is also differentially influenced
by VMH α2δ-1 in females versus males. Accordingly,
α2δ-12L/2L:SF1-Cre females fed a CD did not exhibit the
elevation in lipolysis in WAT observed previously in
α2δ-12L/2L:SF1-Cre males administered the same diet (18).
However, mutant females but not males had increased
susceptibility to hepatic steatosis when fed a HFD.
Decreased cholesterol content in WAT also suggests that
lipid balance during dietary challenge is influenced by
VMH α2δ-1 in female mice. This is a significant finding
considering that dyslipidemia often precedes alter-
ations in glycemic control, which are also exhibited by
α2δ-12L/2L:SF1-Cre females fed a HFD. For example, pre-
vious studies showed that abnormal cholesterol levels
greatly impact adipocyte metabolic activity, which can
ultimately have deleterious effects on insulin sensitivity
(41). Furthermore, we found that circulating levels of
adiponectin were significantly reduced in α2δ-12L/2L:SF1-
Cre
females fed a HFD, suggesting impaired WAT func-
tion. Because adiponectin was reported to facilitate
metabolic flexibility in mice, this deficit likely contrib-
utes to metabolic dysfunction in mutant females fed a
HFD. Specifically, HFD-induced hepatic fat accumula-
tion and reductions in insulin sensitivity were prevented
in transgenic mice with elevated levels of circulating
adiponectin (35, 36).
Identified elevations in hepatic sympathetic outflow
are expected to contribute to the susceptibility to diet-
induced liver steatosis observed in α2δ-12L/2L:SF1-Cre fe-
males. In support, Hurr and Morgan reported recently
doi: 10.1210/endocr/bqaa068 https://academic.oup.com/endo  11

Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
Figure 6.  Increased hepatic sympathetic output in α2δ-12L/2L:SF1-Cre females fed a HFD. Norepinephrine content in serum (A), white adipose
tissue (WAT) (B), brown adipose tissue (BAT) (C), skeletal muscle (SM) (D) and liver (E) of fed α2δ-12L/2L and α2δ-12L/2L:SF1-Cre (n = 7-8) females fed a
chow diet (CD) or high-fat diet (HFD). ANOVA, WAT: Diet, F (1, 28) = 9.6, P = 0.004 (diet); Liver: Genotype, F (1, 26) = 5.7, P = 0.02. * P = 0.03.
(F) Norepinephrine content in liver of α2δ-12L/2L and α2δ-12L/2L:SF1-Cre males fed a HFD (n = 7-8).

that diet-induced liver steatosis was associated with an
increase in the firing rate of hepatic sympathetic fibers
in mice and increased transcript content of the fatty acid
translocase CD36 in the liver (40). Importantly, hepatic
sympathetic denervation mitigated free fatty acid up-
take and TG accumulation in livers of mice fed a HFD
and this was mediated, in part, by blunting diet-induced
elevations in CD36 mRNA expression in the liver. This
is particularly relevant as a great proportion of hepatic
TG is derived from FFA uptake from the circulation by
cell membrane transporters (42) and as α2δ-12L/2L:SF1-
Cre
females fed a HFD also exhibited elevated expres-
sion of hepatic CD36. The collective evidence suggests
that α2δ-1 in the VMH of female mice is a critical
component of central mechanisms regulating hepatic
sympathetic outflow and that in its absence, hepatic
sympathetic overactivity leads to increased CD36 ex-
pression and TG accumulation in the liver. It is also im-
portant to note that unlike mutant females, sympathetic
tone to the livers of α2δ-12L/2L:SF1-Cre males fed a HFD
was similar to that of male controls. Sex-specific effects
on sympathetic tone following depletion of VMH α2δ-1
were also evident in animals fed a CD. Whereas NE con-
tent in serum and WAT was dramatically reduced in
α2δ-12L/2L:SF1-Cre males (18), it was normal in females as
demonstrated here.
Altered SF1 neuronal activity is a plausible central
mechanism driving metabolic alterations in female mu-
tant mice. In support, activation of SF1 neurons via
DREADD technology increases insulin sensitivity and
glucose uptake in the periphery (5). α2δ-1 serves both
as a voltage-gated calcium channel subunit and as a re-
ceptor for thrombospondins (TSPs), facilitating excita-
tory synapse assembly (14, 15). Eroglu et al (15) showed
that cortical neurons in transgenic mice overexpressing
α2δ-1 contained a higher density of excitatory synapses
and elevated frequency of miniature EPSCs compared
with wild-type mice (15). In contrast, inhibiting α2δ-1
12  Felsted et al    Sex-Specific Effects of α2δ-1 in Female VMH
via administration of gabapentin blunted the effects of
thrombospondins inducing excitatory synaptogenesis.
Finally, we showed that depleting α2δ-1 reduces the ex-
citatory tone and activity of SF1 neurons without af-
fecting calcium currents in male mice (18), implicating
actions of α2δ-1 facilitating excitatory synapse assembly.
It remains unclear why α2δ-1 depletion results in
sex-specific effects on glucose and lipid balance and
sympathetic output in the periphery. One possibility is
that α2δ-1 couples to different and opposing signaling
cascades in females versus males, differentially affecting
neuronal activity. However, considering that there are
no examples in the literature indicating that α2δ-1 in-
hibits excitatory transmission and that there is evidence
that it does not affect inhibitory transmission (15), this
scenario is unlikely. Alternatively, there might be sex dif-
ferences in the pattern of α2δ-1 expression or in the
requirement of this thrombospondin receptor within
distinct SF1+ neuronal subpopulations. This is important
considering that diverse leptin-induced, leptin-inhibited
and insulin-inhibited SF1 neuronal subpopulations have
been identified in the VMH, indicating functional het-
erogeneity within this cell population (43). Future inves-
tigations outside the scope of the current study should
examine this possibility. Sex-specific effects might also
arise from α2δ-1 influencing effects of estrogen on
VMH neuronal activity and energy and glucose balance
control in females but not in males. This possibility is
worth considering as there is a higher density of es-
trogen receptors in female versus male VMH (44) and
that estrogen signaling via ERα in the VMH is protective
against obesity and glucose intolerance in females but
not in males (45). Finally, potential interactions between
sex and genetic background should also be considered.
Indeed, mice studied in our investigations were in a
mixed C57Bl6 and FVB/NJ background, and females
in both of those backgrounds exhibit resistance to diet-
induced obesity and diet-induced alterations in glycemic
control compared with males (46, 47).
In summary, our studies revealed female-specific and
bimodal effects of VMH α2δ-1 impacting glucose and
lipid balance control and sympathetic tone. The col-
lective findings illustrate the importance of assessing
sex-specific mechanisms regulating metabolic func-
tion and inform pathological mechanisms underlying
metabolic disturbances in individuals administered the
anti-epileptic and antinociceptive drugs gabapentin and
pregabalin, which bind and inhibit α2δ-1 (20, 21).
Acknowledgments
Financial Support:  These studies were supported by NIH/
NIDDK (DK117935) and American Diabetes Association
Endocrinology, July 2020, 161(7):1–13
(1-16-IBS-247) grants to M.R. J.A.F. was supported by NIH
Training Grant T32 DK062032 and D.A. by F31 DK118789.
We thank the core facilities at Tufts University and the
Vanderbilt lipid core facility, which are supported by the
Tufts Center for Neuroscience Research and NIDDK grant
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
DK59637, respectively, for facilitating these studies.
Additional Information
Correspondence: Maribel Rios, PhD, 136 Harrison
Avenue, Boston, MA 02111. E-mail: maribel.rios@tufts.edu.
Disclosure Summary:  The authors declare no conflicting
financial interest.
Data Availability:  Data sets generated during and/or ana-
lyzed during the current study are not publicly available but
are available from the corresponding author on reasonable re-
quest.
References
1. Elmquist JK. Hypothalamic pathways underlying the endocrine,
autonomic, and behavioral effects of leptin. Int J Obes Relat
Metab Disord. 2001;25(Suppl 5):S78-S82.
2. Hetherington  AW, Ranson  SW, Hypothalamic lesions and adi-
posity in the rat. Anat Rec. 1940;78:149–172.
3. King  BM. The rise, fall, and resurrection of the ventromedial
hypothalamus in the regulation of feeding behavior and body
weight. Physiol Behav. 2006;87(2):221-244.
4. Cotero  VE, Routh  VH. Insulin blunts the response of glucose-
excited neurons in the ventrolateral-ventromedial hypothalamic
nucleus to decreased glucose. Am J Physiol Endocrinol Metab.
2009;296(5):E1101-E1109.
5. Coutinho  EA, Okamoto  S, Ishikawa  AW, et  al. Activation of
SF1 Neurons in the Ventromedial Hypothalamus by DREADD
Technology Increases Insulin Sensitivity in Peripheral Tissues.
Diabetes. 2017;66(9):2372-2386.
6. Musatov  S, Chen  W, Pfaff  DW, et  al. Silencing of estrogen re-
ceptor alpha in the ventromedial nucleus of hypothalamus
leads to metabolic syndrome. Proc Natl Acad Sci U S A.
2007;104(7):2501-2506.
7. Tong Q, Ye C, McCrimmon RJ, et al. Synaptic glutamate release by
ventromedial hypothalamic neurons is part of the neurocircuitry
that prevents hypoglycemia. Cell Metab. 2007;5(5):383-393.
8. Zhang R, Dhillon H, Yin H, et al. Selective inactivation of Socs3
in SF1 neurons improves glucose homeostasis without affecting
body weight. Endocrinology. 2008;149(11):5654-5661.
9. Kumon A, Takahashi A, Hara T, Shimazu T. Mechanism of lip-
olysis induced by electrical stimulation of the hypothalamus in
the rabbit. J Lipid Res. 1976;17(6):551-558.
10. Ruffin M, Nicolaidis S. Electrical stimulation of the ventromedial
hypothalamus enhances both fat utilization and metabolic rate
that precede and parallel the inhibition of feeding behavior. Brain
Res. 1999;846(1):23-29.
11. Saito  M, Minokoshi  Y, Shimazu  T. Accelerated norepinephrine
turnover in peripheral tissues after ventromedial hypothalamic
stimulation in rats. Brain Res. 1989;481(2):298-303.
12. Takahashi  A, Ishimaru  H, Ikarashi  Y, Maruyama  Y. Aspects of
hypothalamic neuronal systems in VMH lesion-induced obese
rats. J Auton Nerv Syst. 1994;48(3):213-219.
13. Cordeira JW, Felsted JA, Teillon S, et al., Hypothalamic dysfunc-
tion of the thrombospondin receptor alpha2delta-1 underlies the
overeating and obesity triggered by brain-derived neurotrophic
factor deficiency. J Neurosci. 2014;34(2):554–65.
14. Davies  A, Hendrich  J, Van  Minh  AT, Wratten  J, Douglas  L,
Dolphin  AC. Functional biology of the alpha(2)delta
doi: 10.1210/endocr/bqaa068
subunits of voltage-gated calcium channels. Trends Pharmacol
Sci. 2007;28(5):220-228.
15. Eroglu  C, Allen  NJ, Susman  MW, et  al. Gabapentin receptor
alpha2delta-1 is a neuronal thrombospondin receptor responsible
for excitatory CNS synaptogenesis. Cell. 2009;139(2):380-392.
16. Cole RL, Lechner SM, Williams ME, et al. Differential distribution
of voltage-gated calcium channel alpha-2 delta (alpha2delta) sub-
unit mRNA-containing cells in the rat central nervous system and
the dorsal root ganglia. J Comp Neurol. 2005;491(3):246-269.
17. Taylor CP, Garrido R. Immunostaining of rat brain, spinal cord, sen-
sory neurons and skeletal muscle for calcium channel alpha2-delta
(alpha2-delta) type 1 protein. Neuroscience. 2008;155(2):510-521.
18. Felsted  JA, Chien  CH, Wang  D, et  al. Alpha2delta-1 in SF1+
Neurons of the Ventromedial Hypothalamus Is an Essential
Regulator of Glucose and Lipid Homeostasis. Cell Rep.
2017;21(10):2737-2747.
19. Gee  NS, Brown  JP, Dissanayake  VU, Offord  J, Thurlow  R,
Woodruff  GN. The novel anticonvulsant drug, gabapentin
(Neurontin), binds to the alpha2delta subunit of a calcium
channel. J Biol Chem. 1996;271(10):5768-5776.
20. DeToledo JC, Toledo C, DeCerce J, Ramsay RE. Changes in body
weight with chronic, high-dose gabapentin therapy. Ther Drug
Monit. 1997;19(4):394-396.
21. Hoppe C, Rademacher M, Hoffmann JM, Schmidt D, Elger CE.
Bodyweight gain under pregabalin therapy in epilepsy: mitigation
by counseling patients? Seizure. 2008;17(4):327-332.
22. RRID:AB_2336990. Available from: https://scicrunch.org/
resolver/AB_2336990.
23. RRID:AB_1078663. Available from: https://scicrunch.org/
resolver/AB_1078663.
24. RRID:AB_2783856. Available from: https://scicrunch.org/
resolver/AB_2783856.
25. RRID:AB_2827832. Available from: https://scicrunch.org/
resolver/AB_2827832.
26. RRID:AB_2651034. Available from: https://scicrunch.org/
resolver/AB_2651034.
27. AB_2210370. Available from: https://scicrunch.org/resolver/
AB_2210370.
28. RRID:AB_2296900. Available from: https://scicrunch.org/
resolver/AB_2296900.
29. AB_490997. Available from: https://scicrunch.org/resolver/
AB_490997.
30. RRID:AB_2135498. Available from: https://scicrunch.org/
resolver/AB_2135498.
31. RRID:AB_2537661. Available from: https://scicrunch.org/
resolver/AB_2537661.
32. Cao J, Patisaul HB. Sexually dimorphic expression of hypothal-
amic estrogen receptors α and β and Kiss1 in neonatal male and
female rats. J Comp Neurol. 2011;519(15):2954-2977.
https://academic.oup.com/endo  13
33. Schweiger  M, Schreiber  R, Haemmerle  G, et  al. Adipose trigly-
ceride lipase and hormone-sensitive lipase are the major en-
zymes in adipose tissue triacylglycerol catabolism. J Biol Chem.
2006;281(52):40236-40241.
34. Zeng W, Pirzgalska RM, Pereira MM, et al. Sympathetic neuro-
Downloaded from https://academic.oup.com/endo/article/161/7/bqaa068/5825490 by Universidade Federal do Rio Grande do Norte user on 22 January 2022
adipose connections mediate leptin-driven lipolysis. Cell.
2015;163(1):84-94.
35. Asterholm  IW, Scherer  PE. Enhanced metabolic flexibility
associated with elevated adiponectin levels. Am J Pathol.
2010;176(3):1364-1376.
36. Combs TP, Pajvani UB, Berg AH, et al. A transgenic mouse with
a deletion in the collagenous domain of adiponectin displays ele-
vated circulating adiponectin and improved insulin sensitivity.
Endocrinology. 2004;145(1):367-383.
37. Carreño FR, Seelaender MC. Liver denervation affects hepatocyte
mitochondrial fatty acid transport capacity. Cell Biochem Funct.
2004;22(1):9-17.
38. Takahashi  A, Shimazu  T. Hypothalamic regulation of lipid me-
tabolism in the rat: effect of hypothalamic stimulation on lipo-
genesis. J Auton Nerv Syst. 1982;6(2):225-235.
39. Vander Tuig JG, Knehans AW, Romsos DR. Reduced sympathetic
nervous system activity in rats with ventromedial hypothalamic
lesions. Life Sci. 1982;30(11):913-920.
40. Hurr  C, Simonyan  H, Morgan  DA, Rahmouni  K, Young  CN.
Liver sympathetic denervation reverses obesity-induced hepatic
steatosis. J Physiol. 2019;597(17):4565-4580.
41. Le  Lay  S, Krief  S, Farnier  C, et  al. Cholesterol, a cell size-
dependent signal that regulates glucose metabolism and
gene expression in adipocytes. J Biol Chem. 2001;276(20):
16904-16910.
42. Coburn CT, Knapp FF Jr, Febbraio M, Beets AL, Silverstein RL,
Abumrad  NA. Defective uptake and utilization of long chain
fatty acids in muscle and adipose tissues of CD36 knockout mice.
J Biol Chem. 2000;275(42):32523-32529.
43. Sohn  JW, Oh  Y, Kim  KW, Lee  S, Williams  KW, Elmquist  JK.
Leptin and insulin engage specific PI3K subunits in hypothalamic
SF1 neurons. Mol Metab. 2016;5(8):669-679.
44. Frank  A, Brown  LM, Clegg  DJ. The role of hypothalamic es-
trogen receptors in metabolic regulation. Front Neuroendocrinol.
2014;35(4):550-557.
45. Xu Y, Nedungadi TP, Zhu L, et al. Distinct hypothalamic neurons
mediate estrogenic effects on energy homeostasis and reproduc-
tion. Cell Metab. 2011;14(4):453-465.
46. Han  JC, Liu  QR, Jones  M, et  al. Brain-derived neurotrophic
factor and obesity in the WAGR syndrome. N Engl J Med.
2008;359(9):918-927.
47. Ingvorsen  C, Karp  NA, Lelliott  CJ. The role of sex and body
weight on the metabolic effects of high-fat diet in C57BL/6N
mice. Nutr Diabetes. 2017;7(4):e261.