YNPEP-01701; No of Pages 9

Neuropeptides xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Neuropeptides

journal homepage: www.elsevier.com/locate/npep

Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in
the hypothalamic–pituitary–gonadal (HPG) axis and peripheral organs
(fat, pancreas and liver) in male rats
M. Dudek a, P.A. Kołodziejski b, E. Pruszyńska-Oszmałek b, M. Sassek b, K. Ziarniak a,
K.W. Nowak b, J.H. Sliwowska a,⁎
a
Laboratory of Neurobiology, Institute of Zoology, Poznan University of Life Sciences, Wojska Polskiego 71C, 60-625 Poznan, Poland
b
Department of Animal Physiology and Biochemistry, Poznan University of Life Sciences, Wołynska 33, 60-625 Poznan, Poland

a r t i c l e i n f o a b s t r a c t

Article history: Recent data indicates that kisspeptin, encoded by the KISS1 gene, could play a role in transducing metabolic in-
Received 24 June 2015 formation into the hypothalamic–pituitary–gonadal (HPG) axis, the mechanism that controls reproductive func-
Received in revised form 12 December 2015 tions. Numerous studies have shown that in a state of negative energy balance, the hypothalamic kisspeptin
Accepted 20 January 2016
system is impaired. However, data concerning positive energy balance (e.g. diabetes and obesity) and the role
Available online xxxx
of kisspeptin in the peripheral tissues is scant.
Keywords:
We hypothesized that: 1) in diet-induced obese (DIO) male rats and/or rats with diabetes type 1 (DM1) and type
Obesity 2 (DM2), altered reproductive functions are related to an imbalance in Kiss1 and GPR54 mRNA in the HPG axis;
Diabetes and 2) in DIO and/or DM1 and/or DM2 rats, Kiss1 and GPR 54 expression are altered in the peripheral tissues in-
Hypothalamic–pituitary–gonadal (HPG) axis volved in metabolic functions (fat, pancreas and liver).
Fat Animals were fed a high-fat or control diets and STZ (streptozotocin — toxin, which destroys the pancreas) was
Pancreas injected in high or low doses to induce diabetes type 1 (DM1) or diabetes type 2 (DM2), respectively. RT-PCR and
Liver Western blot techniques were used to assess the expression of Kiss1 and GRP54 in tissues.
Kiss1
At the level of mRNA, we found that diabetic but not obese rats have alterations in Kiss1 and/or GPR54 mRNA
GPR54
levels in the HPG axis as well as in peripheral tissues involved in metabolic functions (fat, pancreas and liver).
The most severe changes were seen in DM1 rats. However, in the case of protein levels in the peripheral tissues
(fat, pancreas and liver), changes in Kiss1/GPR54 expression were noticed in DIO, DM1 and DM2 animals and
were tissue-specific.
Our data support the hypothesis that alterations in Kiss1/GPR54 balance may account for both reproductive and
metabolic abnormalities reported in obese and diabetic rats.
© 2016 Elsevier Ltd. All rights reserved.

1. Introduction Kisspeptins (encoded by the KISS1 gene), acting upstream of GnRH,

Reproductive function in vertebrates is regulated by a cascade of
events organized in the hypothalamic–pituitary–gonadal axis (HPG).
The hypothalamus, situated at the top of the axis, synthetizes and
secretes gonadotropin releasing hormone (GnRH), which stimulates
the pituitary to secrete gonadotropins: luteinizing hormone (LH) and
follicle stimulating hormone (FSH) (Fink, 2000; Schwartz, 2000).
Gonadotropins, in turn, stimulate gonads to produce gametes and
synthetize and release sex steroid hormones, which act on the brain, an-
terior pituitary and peripheral organs (Hotchkiss and Knobil, 1994).
⁎ Corresponding author.
E-mail addresses: monika.dudeekk@gmail.com (M. Dudek), pawelbigi@o2.pl
(P.A. Kołodziejski), ewaprusz@up.poznan.pl (E. Pruszyńska-Oszmałek),
macsass@up.poznan.pl (M. Sassek), kamilziarniak@gmail.com (K. Ziarniak),
kwnowak@up.poznan.pl (K.W. Nowak), joanna.sliwowska@gmail.com (J.H. Sliwowska).
are potent stimulators of the HPG axis in a number of species, including
humans (Caraty et al., 2010; Dhillo et al., 2007; Gottsch et al., 2004;
Irwig et al., 2004; Navarro et al., 2004; Shahab et al., 2005). Both in
humans and mice, mutations in the KISS1 receptor (GPR54 or KISS1R)
were associated with hypogonadotropic hypogonadism, a condition
characterized by low sex steroids and gonadotropin levels (de Roux
et al., 2003; Seminara et al., 2003). Importantly, perturbations in energy
balance, including negative energy balance (e.g. undernutrition) or pos-
itive energy balance (e.g. obesity and diabetes) frequently result in im-
pairments of fertility (Pasquali et al., 2007; Wahab et al., 2015) and
hypothalamic hypogonadotropic hypogonadism was reported in obese
and diabetic patients (Skorupskaite et al., 2014). Moreover, in men,
low serum testosterone (T) and lower LH pulse frequency were often
associated with obesity and diabetes mellitus type 2 (DM2) (Al Hayek
et al., 2013; Costanzo et al., 2014; Ding et al., 2006; Ford and Liu,
2005; George et al., 2013; Glass et al., 1977; Lakshman et al., 2010;

http://dx.doi.org/10.1016/j.npep.2016.01.005
0143-4179/© 2016 Elsevier Ltd. All rights reserved.

Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
2 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx
Stellato et al., 2000; Wu et al., 2008). As metabolic status is important for
reproduction, it would be reasonable to assume that kisspeptin can pro-
vide a link between metabolism and fertility. Indeed, kisspeptin-10 ad-
ministration restored LH and T secretion in hypotestosteronaemic men
with DM2 (George et al., 2013).
Similarly to studies in humans, in the streptozotocin (STZ)-induced
(STZ — toxin, which destroys pancreas cells) rat model of diabetes type
1 (DM1), reduced T and LH as well as testis and prostate weights were
found (Castellano et al., 2006; Szkudelski, 2001). Moreover, in male rats
with STZ-induced diabetes, Kiss1 mRNA levels decreased and the
postorchidectomy rise in Kiss1 mRNA was blunted. Importantly, repeat-
ed administration of kisspeptin rescued the LH and T responses and in-
creased testis and prostate weights (Castellano et al., 2006). Thus, it is
suggested that altered expression and function of the hypothalamic
Kiss1 system is involved in the etiopathogenesis of hypogonadotropism
(Castellano et al., 2005).
On the other hand, data concerning Kiss1 expression in a state of
obesity depends on animal models. In high-fat diet (HFD)-induced
obese rats, elevation of hypothalamic Kiss1 mRNA was reported
(Brown et al., 2008). In female DBA/2J mice that were fed HFD and
that were highly susceptible to obesity-induced infertility, a decrease
in the hypothalamic Kiss1 mRNA and the number of kisspeptin-
immunoreactive (-ir) cells was found (Quennell et al., 2011). By con-
trast, in C57BL/6J mice fed a HFD there was no change in Kiss1 mRNA
in the hypothalamus (Quennell et al., 2011). In genetically obese male
Zucker rats (Brown et al., 2008) and in leptin deficient female ob/ob
mice (genetic model of DM2) a decrease in hypothalamic Kiss1 mRNA
was found (Quennell et al., 2011; Smith et al., 2006). But there is a
lack of data on Kiss1 and GPR54 expression in animal models of DM2 in-
duced by HFD and STZ injections. Importantly, DM2, which accounts for
90% of diabetes cases reported around the world, is often associated
with obesity (Mendis et al., 2015). As obesity and diabetes rates surge
across the globe, the WHO recognized both obesity and diabetes as
our biggest public health problem. Of particular interest for the current
paper, in Eastern Europe and in the United States, about 50% of women
are overweight (Mendis et al., 2015). For this reason, we see a need to
gain more knowledge about the integration of metabolic and reproduc-
tive systems both in healthy organisms as well as in cases of obesity and
diabetes.
Of particular interest for this paper, it is also suggested that
kisspeptin has additional roles outside of reproduction — possibly in-
volving regulation of metabolic functions. Besides the hypothalamus
(Lehman et al., 2013), Kiss1/GPR54 are expressed in peripheral tissues
including those in the pituitary, gonads, fat, liver, and pancreas
(Bellingham et al., 2009; Castellano et al., 2006; Cockwell et al., 2013;
Gutierrez-Pascual et al., 2007; Hauge-Evans et al., 2006; Quennell
et al., 2010) and metabolic status influences Kiss1 expression peripher-
ally. Kiss1 mRNA in the pituitary was elevated in obese Zucker male rats,
but in male rats on HFD it was unchanged (Brown et al., 2008). In HFD-
induced obese female rats, ovarian Kiss1 and kisspeptin were down-
regulated (Zhou et al., 2014). But there is no study on Kiss1/GPR54 ex-
pression in the pituitary and testes of diabetic rats.
Kiss1 mRNA has been detected in rat adipose tissue (Brown et al.,
2008; Cockwell et al., 2013) and food restriction (18 h) increased
Kiss1 mRNA in the fat of both male and female rats (Brown et al.,
2008). In contrast, Kiss1 mRNA was reduced in obese HFD-fed and
obese Zucker rats. In women, a positive correlation between Kiss1
mRNA and BMI (body mass index) was reported in the visceral (omen-
tal) adipose tissue (Cockwell et al., 2013). In an experiment in which a
rat's arcuate nucleus of the hypothalamus (ARC) was damaged, hypo-
thalamic Kiss1 mRNA was reduced, but Kiss1 mRNA in the fat was unaf-
fected. This suggests that regulation of Kiss1 mRNA in the adipose tissue
is independent of the hypothalamus (Brown et al., 2008).
Kisspeptin and its receptor are also expressed in the pancreas, and
pancreatic islet function may be dependent on kisspeptin signaling
(Hauge-Evans et al., 2006; Kotani et al., 2001). Kisspeptin can regulate
Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
insulin secretion in the presence of glucose in mice and humans
(Hauge-Evans et al., 2006). The administration of kisspeptin causes
rapid glucose-induced insulin secretion in rats' islets, with greater re-
sponse to KP-10 compared to KP-13 (Bowe et al., 2012). It is also well
documented that insulin has a direct effect on glucagon secretion,
both in control animals and humans with DM1 and DM2 (D'Alessio,
2011; Dumonteil et al., 1998; Kawamori and Kulkarni, 2009;
Kawamori et al., 2009; Muller et al., 1973). In vitro studies on mice's pri-
mary hepatocytes have shown that kisspeptin expression was stimulat-
ed by glucagon (Song et al., 2014). In addition, in vivo experiments in
mice, both controls and those lacking glucagon receptors in hepato-
cytes, have revealed that treatment by glucagon stimulates kisspeptin
expression, but only in control animals (Song et al., 2014). Finally, the
role of the kisspeptin system in metabolic function has been suggested
by recent findings from studies in Kiss1r KO mice, which lack functional
kisspeptin signaling. Results from Kiss1r KO mice fed with both stan-
dard chow diet and HFD indicate that aside from stimulating the HPG
axis, the kisspeptin system is also an important player in body weight,
energy balance, locomotion, and glucose regulation (Tolson et al.,
2014). Thus, the presence of the tri-hormonal circuit linking kisspeptin,
islets, and liver in the regulation of glucose, glucagon and insulin secre-
tion was proposed/see review (Hussain et al., 2015).
In light of the above findings, we tested the hypothesis that alter-
ations in the HPG axis are related to imbalanced levels of Kiss1 and
GPR54 mRNA in diet-induced obese (DIO) male rats and/or rats with di-
abetes type 1 (DM1) and diabetes type 2 (DM2) compared to control. As
Kiss1 and GPR54 are also expressed in the peripheral tissues involved in
metabolic functions, which are deregulated in obesity and diabetes, we
evaluated whether Kiss1 and GPR54 expression in fat, the pancreas and
the liver are altered in DIO, DM1 and DM2 male rats.
2. Materials and methods
2.1. Experimental animals
Adult male Wistar rats (200 ± 30 g, 10 week old age) were pur-
chased from Animal Breeding (Brwinów, Poland) and given 1 week of
acclimatization. All protocols and experimental procedures were ap-
proved by the Local Ethics Commission for Investigation on Animals,
Poznań University of Life Sciences (Poland).
2.2. Inductions of obesity and diabetes states in rats
Male Wistar rats were housed in standard cages for rats and main-
tained under controlled conditions (room temperature 21 °C ± 1 °C;
constant humidity with 12/12-h light–dark cycle). After 1 week of accli-
matization, animals were divided into four groups: 1) control group (C;
n = 8) — fed a regular chow diet (Labofed B, Morawski Kcynia,
Poland); 2) type 1 diabetes group (DM1; n = 8) — fed regular chow
(Labofed B, Morawski Kcynia, Poland); 3) diet induced obesity group
(DIO; n = 8) — fed a high-fat diet (HFD) consisting of 50% energy from
fat (Morawski Kcynia, Poland); and 4) type 2 diabetes group (DM2;
n = 8) — fed a high-fat diet (HFD) consisting of 50% energy from fat
(Morawski, Kcynia, Poland). Animals received diets for 6 weeks ad
libitum and had water access.
In order to induce diabetes, rats fed a regular chow diet were
injected intraperitoneally (i.p.) with streptozotocin — STZ (DM1
group). Rats were first injected with STZ (70 mg/kg body weight in citric
buffer; pH = 4.4) followed by a second injection of STZ (30 mg/kg body
weight). Development of the diabetic phenotype was monitored, mea-
suring fasting (12 h) glucose levels in blood taken from the tail tip
(using a Roche AccuCheck Active device, range 10–600 mg/dl). Serum
levels of insulin after overnight (12 h) fasting were determined.
After 6 weeks on HFD, a single dose of STZ (25 mg/kg body weight)
was administered to induce diabetes (mimicking early stage of DM2).
These animal models are well characterized and commonly used
 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx
(Reed et al., 2000; Szkudelski, 2001; Vater et al., 2013; Zhang et al.,
2008). Fasting (overnight) glucose and insulin levels were assessed.
Plasma insulin levels were measured using a radioimmunoassay
(RIA) kit (Rat Insulin RIA, RI-13K, Merck, Millipore, Darmstadt,
Germany), with sensitivity of 0.1 ng/ml; inter-assay: 8.5–9.4; and intra-
assay: 1.4–4.6.
Additionally, animals from all groups were weighed at termination,
two weeks after their last STZ-injections. Animals were decapitated
and hypothalami, pituitaries, testes, gonadal fat, pancreas and livers
were dissected and immediately frozen in liquid nitrogen and stored
at −80 °C for further analysis.
2.3. Semiquantitive real time PCR
Total RNA was extracted using Tripure Reagent Roche according to
the manufacturer's instructions. cDNA was generated from 1 μg using
a commercial Transcriptor First Strand cDNA Synthesis Kit (Cat. #
04,597,030,001, Roche). Real-time PCR was performed with gene-
specific intron spanning primers (Table 1). Each real-time PCR reaction
containing Fast SYBR® Green Master Mix (Cat.# 1,406,113, Applied
Biosystems), 3 μl of cDNA diluted 1:10 and 3 μl of primer's mix was car-
ried out in a QuantStudio 12K Flex™ Real-Time PCR system (Applied
Biosystems). Results were normalized with a glyceraldehyde-3-
phosphate dehydrogenase (GADPH) reference gene. The sequence of
primers and product size have been included in Table 1.
2.4. Western blots
2.4.1. Preparation of samples
Protein isolation was performed by tissue homogenization in a RIPA
buffer (25 mM Tris–HCl pH 7.6, 150 mM NaCl, 5 mM EDTA, 1% NP-40 or
1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) supplemented
with a protease inhibitor cocktail (Roche Diagnostics, Penzberg,
Germany). Then samples (n = 4/tissue) were centrifuged for 10 min
and 10,000 g of intermediate phase protein was collected and stored
at −80 °C.
2.4.2. Electrophoresis and protein transfer
20 μg of total protein per lane (for pancreas and liver) and 15 μg of fat
were mixed 1:3 with β-mercaptoethanol supplemented Laemmli Buffer
(Biorad, USA) and denatured for 5 min at 95 °C. Electrophoresis was
performed in 10% polyacrylamide gel at 150 V. Then proteins were
transferred to the nitrocellulose membrane. Non-specific binding to
membranes was blocked using 3% BSA in a TBST solution (20 mM Tris
base, 150 mM NaCl, 0.15% Tween20) for 1 h at room temperature.
2.4.3. Western blots
Membranes were incubated overnight at 4 °C with primary antibod-
ies, rabbit anti-kisspeptin AC564 (INRA, Physiologie de la Reproduction
et des Comportements, Nouzilly, France) and rabbit anti-GPR54 (cat No
254512, ABBIOTEC, San Diego, USA) (1:1000 dilution), in a TBST solu-
tion supplemented with 1% BSA. The primary kisspeptin and GPR anti-
bodies were previously used (Desroziers et al., 2010; Guimiot et al.,
2012; Zhou et al., 2014). Membranes were washed 3 times for 10 min
in a TBST buffer and then incubated with anti-rabbit secondary antibody
for 1 h at room temperature (1:5000, # OABP 01378, Aviva Systems San
Diego, USA). Signals were visualized using Amersham ECL Prime West-
ern Blotting Detection Reagent (GE Healthcare Europe, Freiburg,
Table 1
Sequence of primers and product size used in the study.
Gene Left primer (5′˃3′) Right primer (5′˃3′)
KISS1 atgatctcgctggcttcttg ccaggcattaacgagttcct
GPR54 cttcatgtgcaaattcgtcaa aagtggcacatgtggcttg
Gapdh ctgcaccaccaactgcttag tgatggcatggactgtgg
Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
3
Germany) on a Versa Doc scanner (BioRad, USA). β-actin was used as
a reference protein (anti β-actin antibody, Sigma-Aldrich, Germany).
2.5. Statistics
Body weight, glucose and insulin serum levels were presented as
mean ± SEM (Graph Pad Prism, GraphPad Software, Inc., USA). RT
PCR and Western blot data was presented as percentage of control
levels. Statistical analysis was performed using ANOVA on body weight,
glucose and insulin on the RT PCR and Western blot results to explore
group effects (groups: DIO — obese, DM1 — diabetes type 1, DM2 — di-
abetes type 2 and C — control). This was followed by a Fisher post hoc
test (Statistica, StatSoft, Poland). Statistical significance was accepted
at p b 0.05.
3. Results
3.1. The impact of a high-fat diet and streptozotocin-induced types 1 and 2
diabetes on body weight and metabolic parameters in rats
Body weight data and metabolic parameters (glucose and insulin
serum levels) are presented in Fig. 1. There was a group effect on body
weight (p = 0.000001). DIO rats were significantly heavier compared to
C rats (means: DIO: 734.3 ± 36.54 vs. C: 597.5 ± 26.6; p b 0.005,
Fig. 1A). On the other hand, DM1 rats had a reduction in body weight
compared to C, DIO and DM2 animals (means: DM1: 490.1 ± 19.47 vs.
C: 597.5 ± 26.6; p b 0.01; DM1: 490.1 ± 19.47 vs. DIO: 734.3 ± 36.54;
p b 0.00001 and DM1: 490.1 ± 19.47 vs. DM2 743 ± 23.87;
p b 0.000001). Additionally, DM2 males had a higher body weight com-
pared to C (means: DM2: 743 ± 23.87 vs. C: 597.5 ± 26.6; p b 0.001),
Fig. 1A.
There was a group effect on fasting glucose serum levels
(p b 0.0000001). As predicted, DM1 animals had higher levels of glucose
compared to C, DIO and DM2 males (all p's b 0.0000001, Fig. 1B). There
was an approximate 40% increase in glucose levels in DM2 compared to
C rats, (p = 0.18, trend).
Moreover, as predicted, there was a group effect on insulin fasting
serum levels (p b 0.000005). Serum insulin levels in the DM1 group
were the lowest (mean: 0.6735 ± 0.15 mg/dl) compared to C and
other experimental groups (DM1 vs. C; p b 0.005; DM1 vs. DIO;
p b 0.0005; DM1 vs. DM2; p b 0.0000001, Fig. 1C). On the other hand,
in DM2 males, serum insulin levels were the highest (mean: 3.601 ±
0.14 mg/dl) compared to C and other experimental groups (all
p's N 0.01).
3.2. Kiss1 and GRP54 mRNA in the HPG axis of control (C), obese (DIO), and
diabetes type 1 (DM1) type 2 (DM2) rats
There was no difference in hypothalamic Kiss1 mRNA levels among
the groups (p N 0.356; Fig. 2A). But there was a group effect on GPR54
mRNA (p b 0.0003), with an increase in DM1 and DM2 compared to C
rats (p b 0.05 and p b 0.0001, respectively, Fig. 2B). The highest levels
of GPR54 mRNA were found in the DM2 group (about 26% over the con-
trol value). In DM2 rats, GPR54 mRNA was also higher compared to
DM1 animals (p b 0.05).
In the pituitary, there was no group effect on Kiss1 mRNA and GPR54
mRNA (p = 0.09 and p = 0.172, respectively) (Fig. 2C and D).
The biggest changes within the HPG axis were found in the testes,
with a group effect on Kiss1 mRNA (p b 0.01). In DM1 rats, Kiss1
mRNA in testes was about 14% higher compared to C (p b 0.005),
about 7% higher compared to DIO and about 19% higher compared to
DM2 rats (p b 0.0005). In DM2 animals, Kiss1 mRNA was also about
Product size
12% lower compared to DIO rats (p b 0.05). In the testes there was
141 also a group effect on GPR54 mRNA (p = 0.0027). In general, in DM1 an-
62 imals GPR54 mRNA was the lowest of all the groups (about 30% lower
92
compared to C, 58% lower compared to DM2 and 42% lower compared
4 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx

Fig. 1. Body weight (A), serum glucose (B) and insulin (C) levels in control (C), obese (DIO) and diabetes type 1 (DM1) and type 2 (DM2) rats. (A): Body weight: a: DIO N C, (p b 0.005); b:
DM1 b C, (p b 0.01); c: DM1 b DIO, (p b 0.00001); d: DM1 b DM2, (p b 0.0000001); e: DM2 N C, (p b 0.001). (B): Glucose levels: a: DM1 N C, (p b 0.01); b: DM1 N DIO, (p b 0.00001); c:
DM1 N DM2, (p b 0.000001); d: DM2 N C, (p = 0.18) (C): Insulin levels: a: DM2 N C, (p b 0.01); b: DM2 N DIO, (p b 0.001); c: DM2 N DM1, (p b 0.0000001); d: DM1 b C, (p b 0.005); e:
DM1 b DIO, (p b 0.0005).

to DIO males; p's: p b 0.01, p b 0.00005, p b 0.001, respectively). On the
other hand, in DM2 males GPR54 mRNA was about 28% higher com-
pared to C animals (p b 0.05) (Fig. 2E and F).
3.3. Kiss1 and GRP54 mRNA in the peripheral organs (fat, pancreas, liver) of
control (C), obese (DIO), and diabetes type 1 (DM1) and diabetes type 2
(DM2) rats
Kiss1 and GPR54 mRNA have been found in fat, pancreas and liver tis-
sues. There was a group effect on Kiss1 mRNA in the fat, with a dramatic
increase in Kiss1 mRNA in DM1 males (p = 0.00097) compared to con-
trols and all other experimental groups (Fig. 3A). In DM1, Kiss1 mRNA
was 1000% higher compared to C, DIO and DM2 rats (p b 0.0005,
p b 0.001 and p b 0.0005, respectively). Similarly to Kiss1 mRNA, there
was also a group effect on GPR54 mRNA in the fat (p = 0.014), with
the highest levels reported in DM1 males. These had an approximate
400% increase compared to C (p b 0.005), about 200% compared to DIO
(p b 0.05) and about 400% compared to DM2 rats (p b 0.01); Fig. 3B.
In the pancreas, there was a group effect on Kiss1 mRNA (p =
0.0273), with Kiss1 mRNA being about 190% higher in DM1 and about
130% higher in DM2 compared to control animals (p b 0.005 and
p b 0.05, respectively); Fig. 3 C. We have also discerned a group effect
on GPR54 mRNA (p = 0.0413). There was a 450% increase in GPR54
mRNA in DM1 compared to C (p b 0.05), about 480% compared to DIO
(p b 0.05), and about 530% compared to DM2 rats (p b 0.05); Fig. 3 D.
In contrast to the fat and the pancreases, there was no group effect
on Kiss1 mRNA in the liver (p = 0.239). However, an inspection of
Fig. 3 indicates a tendency toward an increase in DIO, DM1 and DM2 an-
imals compared to controls (p = 0.066). Additionally, in the liver, there
was a group effect on GPR54 mRNA (p = 0.0084), with the levels of the
receptor being highest in DM1 animals compared to controls and all
other experimental groups. There was an approximate 860% increase
in GPR54 mRNA compared to C (p b 0.005), about 770% increase com-
pared to DIO (p b 0.01), and an approximate 790% increase compared
to DM2 males (p b 0.01); Fig. 3E and F.
3.4. Kisspeptin and GRP54 levels in the peripheral organs (fat, pancreas,
liver) of control (C), obese (DIO), and diabetes type 1 (DM1) and diabetes
type 2 (DM2) rats
Kisspeptin and GPR54 were expressed in fat, the pancreas and liver,
with the lowest levels observed in the fat. There was a group effect on

Fig. 2. Effects of diet-induced obesity (DIO) and STZ-induced diabetes type 1 and type 2 in male rats on Kiss1 mRNA (A, C, E) and GPR54 mRNA (B, D, F) levels in the hypothalamus (A, B), the
pituitary (C, D) and the testes (E, F). mRNA values were determined by semi quantitative real-time RT-PCR and are expressed as percentage changes compared to controls fed ad libitum
(mean ± S.E.M.). Letters represent the difference among groups. C — control; DIO — obese rats; DM1 — rats with diabetes type 1; DM2 — rats with diabetes type 2. (A–B): Hypothalamus:
(A) (p N 0.356); (B) a: DM1 N C (p b 0.05), b: DM2 N C (p b 0.0001); c: DM2 N DM1 (p b 0.05). (C–D): Pituitary: (C) (p = 0.09) and (D) (p = 0.172); (E–F) Testes: (E) a: DM1 N C,
(p b 0.01); b: DM1 N DM2, (p b 0.005); c: DM2 b DIO, (p b 0.05); (F): a: DM1 b C, (p b 0.01); b: DM1 b DIO, (p b 0.001); c: DM2 N C, (p b 0.05); d: DM1 b DM2, (p b 0.00005).

Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx 5

Fig. 3. Effects in male rats of diet-induced obesity (DIO) and STZ-induced type 1 and type 2 diabetes on Kiss1 mRNA 1 (A, C, E) and GPR54 (B, D, F) mRNA levels in adipose tissue (fat) (A, B),
the pancreas (C, D) and the liver (E, F). mRNA values were determined by semi quantitative real-time RT-PCR and are expressed as percentage changes compared to controls fed ad libitum
(mean ± S.E.M.). Letters represent the difference amongt groups. C — control; DIO — obese rats; DM1 — rats with diabetes type 1; and DM2 — rats with diabetes type 2. (A-B): Fat: (A): a:
DM1 N C, (p b 0.0005), b: DM1 N DIO (p b 0.001); c: DM1 N DM2 (p b 0.0005). (B): a: DM1 N C, (p b 0.005); b: DM1 N DOI, (p b 0.05); c: DM1 N DM2, (p b 0.01). (C–D): Pancreas: (C): a:
DM1 N C, (p b 0.005); b: DM2 N C, (p b 0.05); (D): a: DM1 N C (p b 0.05), b: DM1 N DIO (p b 0.05), c: DM1 N DM2 (p b 0.05). (E–F) Liver: (E):(p = 0.239) (F): a: DM1 N C, (p b 0.005); b:
DM1 N DIO, (p b 0.01); c: DM1 N DM2, (p b 0.01).

kisspeptin levels in the fat (p b 0.0000001), and we noted that in the DIO
and DM2 groups, kisspeptin was beyond detectible levels (Fig. 4A). Ad-
ditionally, in the fat we reported a 58% decrease in kisspeptin levels in
DM1 rats compared to controls (p b 0.00005). Similarly to kisspeptin,
we were unable to detect GPR54 in DIO and DM2 animals in the fat
and there was no difference between levels of this peptide in DM1 com-
pared to C groups (p = 0.100, Fig. 4B).
In the pancreas, there was a group effect on kisspeptin levels (p =
0.000015), with kisspeptin being about 30% lower both in DIO and
DM2 compared to C groups (p's b 0.05, Fig. 4C). In DM1, levels of
kisspeptin were undetectable. There was also a group effect on GPR54
(p = 0.000356), with the levels of the receptor being lower in DIO com-
pared to C rats (p b 0.05). Moreover, in the DM1 group, GPR54 levels
were below detectable values (Fig. 4D).
Finally, in the liver, there was a group effect on kisspeptin levels
(p = 0.036633), with an increase (about 50%) in levels of kisspeptin
in DM2 compared to C rats (p b 0.05) (Fig. 4E). A similar trend was
also observed in DIO animals (p = 0.053). Additionally, kisspeptin
levels were lower in DM1 compared to DIO and DM2 rats (p's b 0.05).
However, in the liver, there was no statistically significant difference
in GPR54 levels between the groups (p = 0.453820; Fig. 4F).
4. Discussion
Based on our understanding, this is the first comprehensive study of
the expression of Kiss1 and GPR54 in HPG axis, which control reproduc-
tive functions and peripheral tissues (fat, pancreas, liver), which control
metabolism in obese and diabetic (DM1 and DM2) rats. We have con-
firmed the hypothesis that diabetic but not obese male rats have alter-
ations in Kiss1 and/or GPR54 mRNA in the HPG axis. Within the HPG
axis, the biggest changes were revealed in the testes and small but sig-
nificant alterations in the hypothalamus. However, in agreement with
previous findings in rats (Brown et al., 2008), we did not find changes
at the level of the pituitary. Additionally, we have observed changes in
Kiss1 and/or GPR54 mRNA levels in the peripheral tissues (fat, pancreas
and liver) in diabetic but not in obese male rats. The most severe alter-
ations were present in STZ-induced DM1 male rats. Importantly, the
analysis of proteins for kisspeptin and GPR54 in fat, the pancreas and
the liver has shown that differences were group- and tissue-specific.
Thus, we proposed that: 1) alterations in Kiss1/GPR54 balance in the hy-
pothalamus and testes may contribute to reproductive impairments ob-
served in these animals; and 2) alterations in kisspeptin/GPR54 balance
in peripheral tissues involved in metabolic functions (fat, liver and pan-
creas) may contribute to impaired regulation of glucose-stimulated in-
sulin secretion observed in obese and diabetic rats.
The lack of changes we noted in Kiss1 mRNA in the hypothalamus of
male rats with diabetes (two weeks after STZ injections) compared to
controls is in agreement with data from short-term diabetic male rats
(one week after STZ injection) (Castellano et al., 2009). Moreover,
using immunocytochemistry in the above-mentioned model, we also ob-
served no differences among the groups in the number of kisspeptin-ir
cells in the ARC (in preparation). However, both in long-term diabetic
males and females (four weeks after STZ injections), a decrease in
Kiss1 mRNA in the hypothalamus was found (Castellano et al., 2006,
2009). Thus, it seems that the difference between results may be related
to the animal model of diabetes (e.g. use of different doses of STZ, timing
after injections, severity of disease). Castellano et al. (2006) found that
diabetic rats (DM1) had glucose levels of approximately 600 mg/dl,
and in our study, glucose levels were about 393 mg/dl. It is also worth
mentioning that in both Castellano's and our study, the RT PCR technique
was used on entire hypothalamic fragments, which made it impossible
to distinguish between the two different nuclei where Kiss1 is
expressed: the anteroventral periventricular nucleus (AVPV) and the ar-
cuate nucleus (ARC).
Similarly to Luque et al. (2007), in their study of obese male C57BL/6J
mice fed a HFD for 16 weeks, and to the Quennell study of C57BL/6J
HFD-fed female mice (2011), we did not find differences in hypotha-
lamic Kiss1 mRNA in DIO compared to C rats. Moreover, neither Luque
et al. (2007) nor our study revealed changes in GPR54 mRNA in DIO an-
imals. However, we found an increase in GPR54 mRNA in both DM1 and

Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
6 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx

DM2 compared to C rats. On the other hand, experiments with short-
time (72-h) food deprivation showed a decrease in Kiss1 mRNA in pre-
pubertal male rats (Castellano et al., 2005) and adult female rats (Brown
et al., 2008) as well as an increase in GPR54 mRNA in the hypothalamus
of pubertal rats (Castellano et al., 2005). Importantly, a number of stud-
ies in diabetic human patients and experimental diabetic animals have
reported preserved GnRH content and secretory capacity in the hypo-
thalamus, suggesting that the central cause of reproductive impairment
lies upstream of GnRH neurons (Howland and Zebrowski, 1976; Sexton
and Jarow, 1997; Spindler-Vomachka and Johnson, 1985).
We did not find changes in pituitary Kiss1 mRNA and GPR54 mRNA
in DM1 and DM2 groups. This is in agreement with studies in human di-
abetic patients and diabetic rats, which showed that pituitary response
in terms of LH discharge to exogenous KP injections is conserved
(Castellano et al., 2006; George et al., 2013). Unfortunately, we did not
have enough tissue in this study to examine the protein levels in the
pituitary.
A novel finding is that within the HPG axis, the strongest alterations
in Kiss1 and GPR54 mRNA were found in the rats' testes. Kiss1 and
GPR54 mRNA was detected in mouse testes and immunocytochemistry
confirmed the presence of this peptide in the Leydig cells (Hsu et al.,
2014; Salehi et al., 2015). We have also reported that in DM1 animals,
Kiss1 mRNA expression was the highest and was accompanied by a de-
crease in GPR54 mRNA. In contrast, in DM2 animals, a significant in-
crease in GPR54 mRNA levels was reported. Thus, the results suggest
that metabolic status influences the expression of Kiss1 and GPR54

Fig. 4. Effects in male rats of diet-induced obesity (DIO) and STZ-induced diabetes type 1 and type 2 on kisspeptin (A, C, E) and GPR54 (B, D, F) levels in the adipose tissue (fat) (A, B), the
pancreas (C, D) and the liver (E, F). Values were determined by Western blot and were expressed as percentage changes compared to controls fed ad libitum (mean ± S.E.M.). Letters
represent the difference between groups. C — control; DIO — obese rats; DM1 — rats with diabetes type 1; DM2 — rats with diabetes type 2. (A–B): Fat: (A): a: DM1 N C, (p b 0.00005),
nd — non detectable. (B): nd — non detectable; (C–D): Pancreas: (C): a: DIO b C, (p b 0.05); b: DM2 b C, (p b 0.05); nd — non detectable; (D): a: DIO b C (p b 0.05); nd — non
detectable. (E–F) Liver: (E): a: DM2 N C, (p b 0.05); b: DIO N C, (trend p = 0.053); c: DM1 b DIO, (p b 0.05), d: DM1 b DM2 (p b 0.05).

Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx
Fig. 4 (continued).
mRNA in the testes and has differential effects in DM1 and DM2 male
rats. Our unpublished data also indicated that DM1 and DM2 rats had
lower levels of T and LH compared to C animals. Thus, it seems of partic-
ular interest to further explore alterations in testes in this animal model.
Moreover, we have added to the literature that Kiss1 mRNA in rats is
present not only in visceral (epididymal) adipose tissue (Brown et al.,
2008) but also in gonadal fat (current data). Of relevance, studies in
women have shown a significant positive correlation between Kiss1
mRNA and BMI in omental adipose tissue. However, no correlation
was found in subcutaneous fat (Cockwell et al., 2013).
Results of previous experiments suggested that Kiss1 expression in
fat is independent of the hypothalamus (Brown et al., 2008). Moreover,
nutritional status differentially alters Kiss1 mRNA in fat, pituitary and
hypothalamus tissues. While food restriction (18 h) increased Kiss1
mRNA in fat in both male and female rats, it decreased Kiss1 mRNA in
males' pituitary and females' hypothalamus (Brown et al., 2008). In con-
trast, a reduction in the fat expression of Kiss1 mRNA was reported in
response to HFD treatment and in obese Zucker rats (Brown et al.,
2008). In our study, we did not find a significant increase in Kiss1
mRNA in DIO and DM2 animals, but we reported a robust increase in
DM1 rats compared to other groups. Thus, our data confirmed the pre-
vious findings that changes in Kiss1 and GPR54 mRNA in fat were inde-
pendent of the hypothalamus. Moreover, we have shown that the most
severe alterations were present in DM1 rats. However, levels of both
Kiss1 and GPR54 mRNA and respective proteins were relatively low in
fat compared to other examined tissues, and kisspeptin and GPR54
were undetectable in DIO and DM2 animals using Western blots. We
have reported a decrease in DM1 animals compared to C animals.
Thus, in spite of higher Kiss1 mRNA in DM1, protein levels were lower
compared to control rats. We did not explore the mechanism responsi-
ble for alterations in protein levels in these animals. However, processes
like alternative splicing, folding, assembly into multimers, transport to
an appropriate subcellular location, or posttranslational protein modifi-
cation can occur, leading to lower levels of kisspeptin in DM1 rats
(Anderson and Seilhamer, 1997; Wang et al., 2008). Interestingly, we
also demonstrated that both DIO and DM2 rats fed a high-fat diet had
undetectable levels of kisspeptin and GPR54 in their fat. Further exper-
iments are needed to explore the mechanisms of kisspeptin/GRP54 ac-
tions in fat, examining different types of adipose tissue in this animal
model.
Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
7
Our study confirmed previous data showing Kiss1 and GPR54 ex-
pression in the pancreas, which may affect the functioning of the pan-
creatic islets (Dahri et al., 1995; Hauge-Evans et al., 2006; Kotani et al.,
2001; Rizza et al., 1980). Moreover, we have shown that proteins for
kisspeptin and GPR54 are also present in this tissue. It was found that
kisspeptin-ir and GPR54-ir cells were co-localized in beta and alpha
cells within the islets (Hauge-Evans et al., 2006). Recently, several stud-
ies suggested a role for kisspeptin in the regulation of B-cell secretion.
Exposure of mouse and human islets to kisspeptin caused the stimula-
tion of glucose-induced insulin (Hauge-Evans et al., 2006; Vikman and
Ahrén, 2009). However, kisspeptin did not influence the basal rate of se-
cretion at a sub-stimulatory concentration of glucose; rather, it regulat-
ed insulin secretion at physiological concentrations of glucose in
isolated mouse islets (Hauge-Evans et al., 2006). Since pancreatic beta
cells have an important role in fuel homeostasis, and kisspeptin and
GPR54 are present there, it is speculated that the kisspeptin system
may be involved in the magnitude of insulin secretion in response to cir-
culation nutrients (Hauge-Evans et al., 2006). Our current study con-
firms this scenario, as Kiss1 and GPR54 expression was altered in the
pancreas in DIO, DM1 and DM2 animals. We have observed a downreg-
ulation of kisspeptin in DIO and DM2 animals and its levels were below
detectible values in DM1, likely due to destruction of the pancreas by
STZ injections. Similarly, we were unable to detect GPR54 in this tissue
in DM1 rats. Thus, we have shown that in the case of increased glucose
concentrations (DM2 and DM1 animals), the kisspeptin/GPR54 system
may not function properly and is unable to control insulin secretion.
This is in agreement with the proposed tri-hormonal endocrine circuit
between islets and the liver implied in the control of glucose regulation
(Hussain et al., 2015). Importantly, our data in DM2 animals confirms
the results obtained from humans with diabetes type 2, where an in-
crease in liver kisspeptin levels was observed (Song et al., 2014).
In general, early in the pathogenesis of DM2, deregulated glucagon
secretion from pancreatic alpha cells occurs prior to impaired glucose-
stimulated insulin secretion (GSIS) from beta cells (Song et al., 2014).
Hyperglucagonemia, which occurs early during development of DM2,
upregulates Kiss1 production by the liver. Kiss1 in turn functions as a
hormone to suppress GSIS. Thus, in DM2, the beta cell is exposed to
two counteracting stimuli elicited by glucagon action on the liver. It
was proposed that glucagon-induced hepatic glucose production
(HGP) and hyperglycemia stimulate, whereas kisspeptin production
8 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx
inhibits GSIS. It is suggested that a pathogenic mechanism, in the case of
DM2, involves hyperglucagonemia via hepatic kisspeptin to impair in-
sulin secretion (Song et al., 2014). These findings could also point to-
ward the therapeutic potential for kisspeptin antagonism to improve
beta cell function in diabetes (Song et al., 2014). It was also reported
that mice selectively lacking pancreas GPR54 receptors and fed with
HFD showed improved glucose tolerance due to increased glucose stim-
ulating insulin secretion (GSIS) (Song et al., 2014). Moreover, our data
indicates that impairment in the kisspeptin system exists in DM1 rats,
both in the levels of kisspeptin and GPR54; and in the pancreas, levels
of the proteins were undetectable, likely due to damage of the tissue
via STZ. Thus, we proposed that, in the case of DM1 animals, very low
(liver and fat) or completely absent kisspeptin/GPR54 signaling (the
case of the pancreas) may contribute to impaired regulation of
glucose-stimulated insulin secretion.
Importantly, recent findings of impaired glucose tolerance in Kiss1R
KO female mice could be related to alterations in kisspeptin signaling,
not only in the brain but also peripherally. Both in vitro and in vivo stud-
ies showed that kisspeptin treatment augments glucose-induced insulin
secretion supporting a possible role in beta cell functions, and
underlining impairments observed in Kiss1R KO (Hauge-Evans et al.,
2006; Pallais et al., 2006).
Our study confirms above findings and added to the literature that
positive energy balance has profound effects on the HPG axis and pe-
ripheral organs involved in metabolic functions activing via kisspeptin.
Source of funding
This study was supported by the OPUS grant NCN 2011/01/B/NZ4/
04992 to J.H.S.
Conflicts of interest
None.
References
Al Hayek, A.A., Khader, Y.S., Jafal, S., Khawaja, N., Robert, A.A., Ajlouni, K., 2013. Prevalence
of low testosterone levels in men with type 2 diabetes mellitus: a cross-sectional
study. J. Fam. Commun. Med. 20, 179–186.
Anderson, L., Seilhamer, J., 1997. A comparison of selected mRNA and protein abundances
in human liver. Electrophoresis 18, 533–537.
Bellingham, M., Fowler, P.A., Amezaga, M.R., Rhind, S.M., Cotinot, C., Mandon-Pepin, B.,
Sharpe, R.M., Evans, N.P., 2009. Exposure to a complex cocktail of environmental
endocrine-disrupting compounds disturbs the kisspeptin/GPR54 system in ovine hy-
pothalamus and pituitary gland. Environ. Health Perspect. 117, 1556–1562.
Bowe, J.E., Foot, V.L., Amiel, S.A., Huang, G.C., Lamb, M.W., Lakey, J., Jones, P.M., Persaud,
S.J., 2012. GPR54 peptide agonists stimulate insulin secretion from murine, porcine
and human islets. Islets 4, 20–23.
Brown, R., Imran, S., Ur, E., Wilkinson, M., 2008. KiSS-1 mRNA in adipose tissue is regulat-
ed by sex hormones and food intake. Mol. Cell. Endocrinol. 281, 64–72.
Caraty, A., Franceschini, I., Hoffman, G.E., 2010. Kisspeptin and the preovulatory
gonadotrophin-releasing hormone/luteinising hormone surge in the ewe: basic as-
pects and potential applications in the control of ovulation. J. Neuroendocrinol. 22,
710–715.
Castellano, J., Navarro, V., Fernandez-Fernandez, R., Nogueiras, R., Tovar, S., Roa, J.,
Vazquez, M., Vigo, E., Casanueva, F., Aguilar, E., 2005. Changes in hypothalamic
KiSS-1 system and restoration of pubertal activation of the reproductive axis by
kisspeptin in undernutrition. Endocrinology 146, 3917–3925.
Castellano, J.M., Navarro, V.M., Fernández-Fernández, R., Roa, J., Vigo, E., Pineda, R.,
Dieguez, C., Aguilar, E., Pinilla, L., Tena-Sempere, M., 2006. Expression of hypothalam-
ic KiSS-1 system and rescue of defective gonadotropic responses by kisspeptin in
streptozotocin-induced diabetic male rats. Diabetes 55, 2602–2610.
Castellano, J.M., Navarro, V.M., Roa, J., Pineda, R., Sanchez-Garrido, M.A., Garcia-Galiano,
D., Vigo, E., Dieguez, C., Aguilar, E., Pinilla, L., Tena-Sempere, M., 2009. Alterations in
hypothalamic KiSS-1 system in experimental diabetes: early changes and functional
consequences. Endocrinology 150, 784–794.
Cockwell, H., Wilkinson, D.A., Bouzayen, R., Imran, S.A., Brown, R., Wilkinson, M., 2013.
KISS1 expression in human female adipose tissue. Arch. Gynecol. Obstet. 287,
143–147.
Costanzo, P.R., Suarez, S.M., Scaglia, H.E., Zylbersztein, C., Litwak, L.E., Knoblovits, P., 2014.
Evaluation of the hypothalamic–pituitary–gonadal axis in eugonadal men with type 2
diabetes mellitus. Andrology 2, 117–124.
Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
D'Alessio, D., 2011. The role of dysregulated glucagon secretion in type 2 diabetes. Diabe-
tes Obes. Metab. 13 (Suppl. 1), 126–132.
Dahri, S., Reusens, B., Remacle, C., Hoet, J., 1995. Nutritional influences on pancreatic de-
velopment and potential links with non-insulin-dependent diabetes. Proc. Nutr.
Soc. 54, 345–356.
de Roux, N., Genin, E., Carel, J.C., Matsuda, F., Chaussain, J.L., Milgrom, E., 2003.
Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived pep-
tide receptor GPR54. Proc. Natl. Acad. Sci. 10972–10976.
Desroziers, E., Mikkelsen, J., Simonneaux, V., Keller, M., Tillet, Y., Caraty, A., Franceschini, I.,
2010. Mapping of kisspeptin fibres in the brain of the pro-oestrous rat.
J. Neuroendocrinol. 22, 1101–1112.
Dhillo, W.S., Chaudhri, O.B., Thompson, E.L., Murphy, K.G., Patterson, M., Ramachandran, R.,
Nijher, G.K., Amber, V., Kokkinos, A., Donaldson, M., Ghatei, M.A., Bloom, S.R., 2007.
Kisspeptin-54 stimulates gonadotropin release most potently during the preovulatory
phase of the menstrual cycle in women. J. Clin. Endocrinol. Metab. 92, 3958–3966.
Ding, E.L., Song, Y., Malik, V.S., Liu, S., 2006. Sex differences of endogenous sex hormones and
risk of type 2 diabetes: a systematic review and meta-analysis. JAMA 295, 1288–1299.
Dumonteil, E., Magnan, C., Ritz-Laser, B., Meda, P., Dussoix, P., Gilbert, M., Ktorza, A.,
Philippe, J., 1998. Insulin, but not glucose lowering corrects the hyperglucagonemia
and increased proglucagon messenger ribonucleic acid levels observed in
insulinopenic diabetes 1. Endocrinology 139, 4540–4546.
Fink, G., 2000. Neuroendocrine Regulation of Pituitary Function, Neuroendocrinology in
Physiology and Medicine. Springer, pp. 107–133.
Ford, E.S., Liu, S., 2005. Invited commentary: acne in adolescence—protecting the heart
but damaging the prostate later in life? Am. J. Epidemiol. 161, 1102–1106.
George, J.T., Veldhuis, J.D., Tena-Sempere, M., Millar, R.P., Anderson, R.A., 2013. Exploring
the pathophysiology of hypogonadism in men with type 2 diabetes: kisspeptin-10
stimulates serum testosterone and LH secretion in men with type 2 diabetes and
mild biochemical hypogonadism. Clin. Endocrinol. 79, 100–104.
Glass, A.R., Swerdloff, R.S., Bray, G.A., Dahms, W.T., Atkinson, R.L., 1977. Low serum testos-
terone and sex-hormone-binding-globulin in massively obese men. J. Clin.
Endocrinol. Metab. 45, 1211–1219.
Gottsch, M.L., Cunningham, M.J., Smith, J.T., Popa, S.M., Acohido, B.V., Crowley, W.F.,
Seminara, S., Clifton, D.K., Steiner, R.A., 2004. A role for kisspeptins in the regulation
of gonadotropin secretion in the mouse. Endocrinology 145, 4073–4077.
Guimiot, F., Chevrier, L., Dreux, S., Chevenne, D., Caraty, A., Delezoide, A.L., de Roux, N.,
2012. Negative fetal FSH/LH regulation in late pregnancy is associated with declined
kisspeptin/KISS1R expression in the tuberal hypothalamus. J. Clin. Endocrinol. Metab.
97, 2221–2229.
Gutierrez-Pascual, E., Martínez-Fuentes, A., Pinilla, L., Tena-Sempere, M., Malagon, M.,
Castano, J., 2007. Direct pituitary effects of kisspeptin: activation of gonadotrophs
and somatotrophs and stimulation of luteinising hormone and growth hormone se-
cretion. J. Neuroendocrinol. 19, 521–530.
Hauge-Evans, A., Richardson, C., Milne, H., Christie, M., Persaud, S., Jones, P., 2006. A role
for kisspeptin in islet function. Diabetologia 49, 2131–2135.
Hotchkiss, J., Knobil, E., 1994. The menstrual cycle and its neuroendocrine control. Physiol.
Reprod. 2, 711–749.
Howland, B., Zebrowski, E., 1976. Some effects of experimentally-induced diabetes on pi-
tuitary–testicular relationships in rats. Horm. Metab. Res. 8, 465–469.
Hsu, M.-C., Wang, J.-Y., Lee, Y.-J., Jong, D.-S., Tsui, K.-H., Chiu, C.-H., 2014. Kisspeptin mod-
ulates fertilization capacity of mouse spermatozoa. Reproduction 147, 835–845.
Hussain, M.A., Song, W.-J., Wolfe, A., 2015. There is kisspeptin—and then there is
kisspeptin. Trends Endocrinol. Metab. 26, 564–572.
Irwig, M.S., Fraley, G.S., Smith, J.T., Acohido, B.V., Popa, S.M., Cunningham, M.J., Gottsch,
M.L., Clifton, D.K., Steiner, R.A., 2004. Kisspeptin activation of gonadotropin releasing
hormone neurons and regulation of KiSS-1 mRNA in the male rat. Neuroendocrinol-
ogy 80, 264–272.
Kawamori, D., Kulkarni, R.N., 2009. Insulin modulation of glucagon secretion: the role
of insulin and other factors in the regulation of glucagon secretion. Islets 1,
276–279.
Kawamori, D., Kurpad, A.J., Hu, J., Liew, C.W., Shih, J.L., Ford, E.L., Herrera, P.L., Polonsky,
K.S., McGuinness, O.P., Kulkarni, R.N., 2009. Insulin signaling in alpha cells modulates
glucagon secretion in vivo. Cell Metab. 9, 350–361.
Kotani, M., Detheux, M., Vandenbogaerde, A., Communi, D., Vanderwinden, J.-M., Le Poul,
E., Brézillon, S., Tyldesley, R., Suarez-Huerta, N., Vandeput, F., 2001. The metastasis
suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G
protein-coupled receptor GPR54. J. Biol. Chem. 276, 34631–34636.
Lakshman, K.M., Bhasin, S., Araujo, A.B., 2010. Sex hormone-binding globulin as an inde-
pendent predictor of incident type 2 diabetes mellitus in men. J. Gerontol. A Biol. Sci.
Med. Sci. 65, 503–509.
Lehman, M.N., Hileman, S.M., Goodman, R.L., 2013. Neuroanatomy of the kisspeptin sig-
naling system in mammals: comparative and developmental aspects. Adv. Exp.
Med. Biol. 784, 27–62.
Luque, R.M., Kineman, R.D., Tena-Sempere, M., 2007. Regulation of hypothalamic expres-
sion of KiSS-1 and GPR54 genes by metabolic factors: analyses using mouse models
and a cell line. Endocrinology 148, 4601–4611.
Mendis, S., Davis, S., Norrving, B., 2015. Organizational update: the world health organiza-
tion global status report on noncommunicable diseases 2014; one more landmark
step in the combat against stroke and vascular disease. Stroke 46, 121–122.
Muller, W.A., Faloona, G.R., Unger, R.H., 1973. Hyperglucagonemia in diabetic
ketoacidosis. Its prevalence and significance. Am. J. Med. 54, 52–57.
Navarro, V.M., Castellano, J.M., Fernandez-Fernandez, R., Barreiro, M.L., Roa, J., Sanchez-
Criado, J.E., Aguilar, E., Dieguez, C., Pinilla, L., Tena-Sempere, M., 2004. Developmental
and hormonally regulated messenger ribonucleic acid expression of KiSS-1 and its
putative receptor, GPR54, in rat hypothalamus and potent luteinizing hormone-
releasing activity of KiSS-1 peptide. Endocrinology 145, 4565–4574.
 M. Dudek et al. / Neuropeptides xxx (2016) xxx–xxx
Pallais, J.C., Bo-Abbas, Y., Pitteloud, N., Crowley Jr., W.F., Seminara, S.B., 2006. Neuroendo-
crine, gonadal, placental, and obstetric phenotypes in patients with IHH and muta-
tions in the G-protein coupled receptor, GPR54. Mol. Cell. Endocrinol. 254-255,
70–77.
Pasquali, R., Patton, L., Gambineri, A., 2007. Obesity and infertility. Curr. Opin. Endocrinol.
Diabetes Obes. 14, 482–487.
Quennell, J., Rizwan, M., Relf, H.L., Anderson, G., 2010. Developmental and steroidogenic
effects on the gene expression of RFamide related peptides and their receptor in
the rat brain and pituitary gland. J. Neuroendocrinol. 22, 309–316.
Quennell, J.H., Howell, C.S., Roa, J., Augustine, R.A., Grattan, D.R., Anderson, G.M., 2011.
Leptin deficiency and diet-induced obesity reduce hypothalamic kisspeptin expres-
sion in mice. Endocrinology 152, 1541–1550.
Reed, M.J., Meszaros, K., Entes, L.J., Claypool, M.D., Pinkett, J.G., Gadbois, T.M., Reaven,
G.M., 2000. A new rat model of type 2 diabetes: the fat-fed, streptozotocin-treated
rat. Metabolism 49, 1390–1394.
Rizza, R.A., Gerich, J.E., Haymond, M.W., Westland, R.E., Hall, L.D., Clemens, A.H., Service,
F.J., 1980. Control of blood sugar in insulin-dependent diabetes: comparison of an ar-
tificial endocrine pancreas, continuous subcutaneous insulin infusion, and intensified
conventional insulin therapy. N. Engl. J. Med. 303, 1313–1318.
Salehi, S., Adeshina, I., Chen, H., Zirkin, B.R., Hussain, M.A., Wondisford, F., Wolfe, A.,
Radovick, S., 2015. Developmental and endocrine regulation of kisspeptin expression
in mouse leydig cells. Endocrinology 156, 1514–1522.
Schwartz, N.B., 2000. Neuroendocrine Regulation of Reproductive Cyclicity, Neuroendo-
crinology in Physiology and Medicine. Springer, pp. 135–145.
Seminara, S.B., Messager, S., Chatzidaki, E.E., Thresher, R.R., Acierno Jr., J.S., Shagoury, J.K.,
Bo-Abbas, Y., Kuohung, W., Schwinof, K.M., Hendrick, A.G., Zahn, D., Dixon, J., Kaiser,
U.B., Slaugenhaupt, S.A., Gusella, J.F., O'Rahilly, S., Carlton, M.B., Crowley Jr., W.F.,
Aparicio, S.A., Colledge, W.H., 2003. The GPR54 gene as a regulator of puberty. N.
Engl. J. Med. 349, 1614–1627.
Sexton, W.J., Jarow, J.P., 1997. Effect of diabetes mellitus upon male reproductive function.
Urology 49, 508–513.
Shahab, M., Mastronardi, C., Seminara, S.B., Crowley, W.F., Ojeda, S.R., Plant, T.M., 2005. In-
creased hypothalamic GPR54 signaling: a potential mechanism for initiation of pu-
berty in primates. Proc. Natl. Acad. Sci. 102, 2129–2134.
Skorupskaite, K., George, J.T., Anderson, R.A., 2014. The kisspeptin-GnRH pathway in
human reproductive health and disease. Hum. Reprod. 20, 485–500.
Smith, J.T., Acohido, B.V., Clifton, D.K., Steiner, R.A., 2006. KiSS-1 neurones are direct tar-
gets for leptin in the ob/ob mouse. J. Neuroendocrinol. 18, 298–303.
Please cite this article as: Dudek, M., et al., Effects of high-fat diet-induced obesity and diabetes on Kiss1 and GPR54 expression in the
hypothalamic–pituitary–gonadal (HPG..., Neuropeptides (2016), http://dx.doi.org/10.1016/j.npep.2016.01.005
9
Song, W.-J., Mondal, P., Wolfe, A., Alonso, L.C., Stamateris, R., Ong, B.W., Lim, O.C., Yang,
K.S., Radovick, S., Novaira, H.J., 2014. Glucagon regulates hepatic kisspeptin to impair
insulin secretion. Cell Metab. 19, 667–681.
Spindler-Vomachka, M., Johnson, D., 1985. Altered hypothalamic–pituitary function in the
adult female rat with streptozotocin-induced diabetes. Diabetologia 28, 38–44.
Stellato, R.K., Feldman, H.A., Hamdy, O., Horton, E.S., McKinlay, J.B., 2000. Testosterone,
sex hormone-binding globulin, and the development of type 2 diabetes in middle-
aged men: prospective results from the Massachusetts male aging study. Diabetes
Care 23, 490–494.
Szkudelski, T., 2001. The mechanism of alloxan and streptozotocin action in B cells of the
rat pancreas. Physiol. Res. 50, 537–546.
Tolson, K.P., Garcia, C., Yen, S., Simonds, S., Stefanidis, A., Lawrence, A., Smith, J.T.,
Kauffman, A.S., 2014. Impaired kisspeptin signaling decreases metabolism and pro-
motes glucose intolerance and obesity. J. Clin. Invest. 124, 3075–3079.
Vater, A., Sell, S., Kaczmarek, P., Maasch, C., Buchner, K., Pruszynska-Oszmalek, E.,
Kolodziejski, P., Purschke, W.G., Nowak, K.W., Strowski, M.Z., Klussmann, S., 2013. A
mixed mirror-image DNA/RNA aptamer inhibits glucagon and acutely improves glu-
cose tolerance in models of type 1 and type 2 diabetes. J. Biol. Chem. 288, 21136–21147.
Vikman, J., Ahrén, B., 2009. Inhibitory effect of kisspeptins on insulin secretion from isolat-
ed mouse islets. Diabetes Obes. Metab. 11, 197–201.
Wahab, F., Shahab, M., Behr, R., 2015. The involvement of gonadotropin inhibitory hor-
mone and kisspeptin in the metabolic regulation of reproduction. J. Endocrinol.
225, 49–66.
Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S.F.,
Schroth, G.P., Burge, C.B., 2008. Alternative isoform regulation in human tissue
transcriptomes. Nature 456, 470–476.
Wu, F.C., Tajar, A., Pye, S.R., Silman, A.J., Finn, J.D., O'Neill, T.W., Bartfai, G., Casanueva, F., Forti,
G., Giwercman, A., Huhtaniemi, I.T., Kula, K., Punab, M., Boonen, S., Vanderschueren, D.,
European Male Aging Study, G., 2008. Hypothalamic–pituitary–testicular axis disrup-
tions in older men are differentially linked to age and modifiable risk factors: the
European Male Aging Study. J. Clin. Endocrinol. Metab. 93, 2737–2745.
Zhang, M., Lv, X.Y., Li, J., Xu, Z.G., Chen, L., 2008. The characterization of high-fat diet and
multiple low-dose streptozotocin induced type 2 diabetes rat model. Exp. Diabetes
Res. 2008, 704045.
Zhou, Q., Chen, H., Yang, S., Li, Y., Wang, B., Chen, Y., Wu, X., 2014. High-fat diet decreases
the expression of Kiss1 mRNA and kisspeptin in the ovary, and increases ovulatory
dysfunction in postpubertal female rats. Reprod. Biol. Endocrinol. 12, 127 http://
www.who.int/mediacentre/factsheets/fs311/en/.