Professional Documents
Culture Documents
By
MADHU MALLESHAPPA
ASSISTANT PROFESSOR
1
DECLARATION BY THE STUDENT
I also declare that this project is the outcome of my own efforts and that it has
not been submitted to any other university or institute for the award of any other
Degree or Diploma or Certificate.
2
CERTIFICATE OF ORIGINALITY
Date: 24 / 5 / 2021
3
4
ACKNOWLEDGEMENT
Afridulla baig
(18bbgr103)
5
Abstract
Plants occur absorbed with complicated microbes, which can stimulate plant progress. Stress
understanding, plant nourishment Increased, and combat with plant pathogens. Being sure of
the aspect of some microbes can prevail pathogenically. The genera which refer to plant
growth-promoting Rhizobacteria to influences plant growth comprises Pseudomonas Bacillus
Azospirillum agrobacterium, azotobacter. We plant the cowpea grain in a container within 3
weeks cowpea plant at the vegetative phase was uprooted the entire core procedure along
with surface attaching to and symbiotic bacteria from base nodules of the cowpea plant. The
specimens are cultured in an LB agar medium. Across staining and biochemical tests
specified and depicted rhizobacteria Isolation from Isolates using the CTAB technique
Amplification purification and sequencing of 16SrRNA gene with 27F and 1492R primers
after that Sanger sequencing and data inspection isolates. By this review, we comprehend the
designation and hereditary description of PGPR from the cowpea plant.
6
Table of Contents
8 Conclusion 35-36
9 References 36
10 Appendices 36-37
7
LIST OF TABLES
LIST OF FIGURES/GRAPHS
8
the cortical cells and form a
bacterioid state thereby
nodules are formed.
9
relation of Acinetobacter
calcoaceticus strain obtained
using Clustal Omega
3.11 Phylogenetic tree showing 31
the relation of Pseudomonas
stutzeri strain obtained using
Clustal Omega
10
Chapter 1: Introduction of the organization or the company:
Our organization Bio Edge Solutions is a multidisciplinary contract research organization that
benefits R&D actions in the area of microbiology, molecular biology, and bioinformatics.
Our firm was commenced in January in the year 2020. Dr. Shruthi SD is the founder of our
corporation.
She has accomplished her Postdoctoral study from the Microbiology and Cell Biology
Department of the Indian Institute of Science, Bangalore. Has administered as an
academician at Biotechnology departments of Kuvempu University, Shivamogga, and The
Oxford Educational Institutions, Bangalore. She has earned limited years of Entrepreneurial
background from Chromgene Biotech, Bangalore.
She has disseminated numerous exploration manuscripts, journals, and edition divisions in
National and International bulletins, and illustrated oral/poster demonstrations in National
and International committees. She has provided guest sermons in several universities,
administered workshops, and possesses indicated her dignity as an editorial council partner of
esteemed publications.
All these enjoyments witness her mastery, creativity, familiarity, and alliances around the
nation. With the impulse to fill the scientific space, she has inaugurated this business.
• Organization chart
11
Our across-the-board firm is only dealt with by our founder itself. Eight people prevail over
the quantity of the company. Our company is a contract research organization that delivers
aid to biotechnological patronage. The privilege of our corporation is governed by Dr.
Shruthi SD only.
And our firm is found at this address 1st floor M-400, 8th cross, 1st stage 8 Peenya Industrial
Area, Bangalore - 560058. In our organization, there are only three divisions and their names
are bioinformatics, molecular biology, and microbiology.
The stocks and actions of the foundation are biotechnology techniques and products. Products
are all molecular biology apparatuses and reagents. Our firm formulates all ways of services
connected to Biotechnology and continues to be one of the standard service providers.
The investigation squad always entertains questions concerning the probable examination of
tests to achieve their consumers. We wholeheartedly motivate the federation with life
sciences organizations, academies, educational societies, eminent scientists, and different
units. Beneath ties that strengthen our employment cascade and technological skill.
Here is the catalog of assistance furnished by our firm and they prevail in Sanger sequencing
and Microbial designation actions, next-generation sequencing aids, DNA Barcoding RAPD,
RFLP, and Karyotyping. GCMS, LCMS, and additional alienation strategies,
Phytochemistry, Pharmacology, and Toxicity researches scientific dissertation and
Bioinformatics, Student coaching and Contract study undertakings (We are interested in
educating the learner congregation and impel them towards the wonderful contemporary
nation of Biology. It will boost pupils to achieve an apprenticeship report, and theoretical
endeavors adapted to their University wants. Desire requests publication-based investigation
12
to stir the understandings of the youthful era. Will help in enforcing intellectual rational
rounds and operate workshops at the academy premises).
Visionary Universities and Pharmaceutical unions are only the victim clients for our liturgies
given in our group. And here are some benevolent reserve rules and engagement recreations
they are business bonds, laborer fees, vacate strategy, sexual harassment in the bureau
system, Maternity and paternity abandon program, Adaptive job lineage contract.
transmission action, non-discrimination code, clothes ordinance agreement, 4 Grievance
policy voyage program, enactment supervision, and judgment.
Our corporation possesses barely tie-ups with the distinct academies of study thinkers and the
list of names are Garden City University, Institute of Transdisciplinary Health Sciences and
Technology, Nutrinorm, Rashtreeya Sikshana Samithi Trust Institutions, Ramaiah Institute of
Technology, The Maharaja Sayajirao University of Baroda, Mangalore University,
Davangere University, Tumkur University, Indian Institute of Science, Kuvempu University,
CSIR NBRI, Bangalore University, UAHS University of Agricultural Sciences SJU,
NMAMIT, Shri Dharmasthala Manjunatheshwara College, Children's Education Society,
Vijayanagara Sri Krishnadevaraya University. Accreditations of the firm are ISO. The
Recruitment of our company is occupied by our possessor but presently there is no
recruitment taking off and we don't maintain any recruiting implements.
The name of our department is Bio Edge Solutions. The nature of products and services
provided in the department is which supports R&D activities in the field of Microbiology and
Molecular Biology. Our major focus is to provide the best service to clients by executing
every project with excellence. Integrity and innovation will be the prime motto at Bio Edge
Solutions.
Here is the catalog of assistance furnished by our firm and they prevail Sanger sequencing
and Microbial designation actions next-generation sequencing aids DNA Barcoding RAPD,
RFLP, and Karyotyping. GCMS, LCMS, and additional alienation strategies,
Phytochemistry, Pharmacology, and Toxicity researches Scientific dissertation and
Bioinformatics, Student coaching and Contract study undertakings (We are interested in
educating the learner congregation and impel them towards the wonderful contemporary
13
nation of Biology. It will boost pupils to achieve an apprenticeship report, and theoretical
endeavors adapted to their University wants. Desire requests publication-based investigation
to stir the understandings of the youthful era. Will help in enforcing intellectual rational
rounds and operate workshops at the academy premises).
Additional custom-made operations to enforce every mission. The active procedure of our
division is firstly we all are appointed to get data pertained to our program problem by
performing literature researches from various survey and study dissertations. After that
everyday assignments were provided to each learner. Which should be obtained within the
interval? And we should also follow laboratory protection laws and restrictions. The
laboratories are qualified with numerous stuff that can hurt you if utilized recklessly. You
will be memorizing multiple processes throughout the course - none as significant as the
safeguard processes and goals. Prosperous study scholars obey sanctuary platforms,
reimburse awareness to the task being accomplished, and use widespread understanding when
using appliances and chemicals. Beginners in the biotechnology laboratory must remember a
frontage before initiating the practicals. Performance timings for my program were from 12
to 6 pm. And normal timings were from 10 to 6 pm.
Creative methods attended in the bureau were Sequential enactment of the proposal with
organized methods Customized plans to the patron's provisions. Key functions and
14
obligations of numerous partners in the division are The major positions of an administrator
are to ensure the customary functioning of a unit or group of laborers. Most employers want
their executives to talk, employ, and instruct new workers. A director enunciates both low
and extended-term objectives to assure a firm's longevity. scientists are credible for
formulating effort and analyzing advice from governed laboratory-based inquiries,
examinations, and prosecutions.
Lab Assistant job in scientific and medical laboratory situations readying trials processing
specimens, protecting lab device, and improving after operations. Pair up, maintain, and neat
laboratory tools and utensils, such as microscopes, scales, pipets, and test tubes. Survey squad
to achieve missions. The repair person helps to repair the devices and equipment. As an
Accounting Manager will oversee, monitor, and assess all customary analysis actions that
will be ascertaining monetary status by expanding and carrying out systems for receiving,
assessing, substantiating, and documenting economic advice to conserve bargain ordinances,
accounts, and GST-related facets.
HR (Human Resources) office is a faction that is liable for governing the breadwinner life
cycle and allocating hand advantages. to strengthen the steady running of league recreations
by accepting sustenance of hand wants. The innkeeper's role is to Fulfills tourists by
welcoming them. cheering, and supervising them suitably. the instances that transpired during
the internship are only we were not given with varieties. And we took some time to nurture
the harvest plants and then proceeded with our project. A Director is a basis of a combined
body of Directors called the Board reliable the superintendence, control, and path of the
liaisons of the Company. Director is regaled as officers of an organization. Fewer employee,
workspace are situations occurred during the internship.
And here stand some basic operating protocols pursued in the division Students in the
biotechnology lab must retain exposure before turning on the practicals. They should be lent
schoolings as to how to govern crucial devices incorporating microscope, logical equilibrium,
and pH gauge. The direction should similarly contain abilities for Fire, damaged glasses, the
fall of chemicals, scrape with strong tools like scalpel, blades, etc. dealing with dangerous
chemicals, UV, removal of wastes like degraded media, and drying up of tumbles. Decent
laboratory practice manners will benefit you with great achievement. Follow the subsequent
approaches very rigidly. These will insulate you and your examinations. Dos and Don'ts
inside the laboratory.
15
1. The beginner should wear a neat lab coat every moment before you arrive at a lab.
2. Pupils should not fluctuate from the pedagogy given by the mentor inside the
laboratory.
3. Yelling, playing, and galloping inside the laboratory is precisely restricted.
4. Utilizing itinerant phones in the lab is rigorously forbidden.
5. Do not fume, gulp, or eat in the lab.
6. Since the beginning task, clear the work of furniture with disinfectants like 70%
liquor or dilute detergents like Dettol or Lysol.
7. The table should possess a notebook and only glassware and appliances that are
wanted.
8. In the trial of any occurrence or trauma educate your educator instantly.
9. Devoid the education and management of the lecturer one should not tickle any
device.
10. Guarantee access to respective journal documents before putting up with chemicals or
utilizing tools.
11. When the lineage of an organism is spilled cover the region, deal with it with ethyl
alcohol ( after turning off the Bunsen blaze) or any other disinfectant for some
moment, and accordingly just wet the region
12. All microbial species should prevail overseen with maintenance.
13. Protect borrowed watery populations, supernatants, and glasswares in autoclavable
bottles.
14. Remove infected containers and plastic cartons in autoclavable satchels.
15. Omit organic mixtures (phenol and chloroform ) in trash pots.
16. Accomplish not pipette out broth species, concentrated acids, and alkalizes by mouth.
17. All culture pipes must be maintained in the vertical posture in racks
18. Tagging of Petri plates, tubes, flasks, etc. ought to be performed before initiating an
endeavor.
19. Substances like chemicals, tints, reagent jars, different glass-wares, must be renovated
in their recent spot.
20. Equipment like scalpel, forceps, inoculation needles, etc. that appear in connection
with populations or agar medium (sterile) should be disinfected by giving rise to the
fraction that gets on into the trench or Petri plate, blushing hectic on Bunsen flame,
grace in 70%alcohol and fire warmth it by ratifying over the blaze to burn off the
booze.
16
21. Saturate microscope lens before and after use.
22. Restrain the entrances and windows neared while inoculating or during the transfer of
sanitary cultures.
23. Harmful chemicals should be dealt with safeguard and while removing used ones they
should be disposed of in labeled pots. Lethal chemicals, besides organic compounds,
comprise mercury solutions, some halogens, mutagenic chemicals, radioactive
entities, etc.
24. Cracked knives, strong tools, and damaged goblet chunks should be expunged of in
different bottles I
25. Early relief apparatuses must be sighted in each laboratory
26. Lightweight fire extinguishers should be held close.
27. Manipulate certain poisonous and mutagenic chemicals under a vapor lid.
28. Commit not to endanger yourself to UV lights.
29. Wear defense goblets, (UV ) gloves, cloaks, pungent gloves, and rubber aprons while
bargaining with strong acids and bases.
30. Tidy the table and inoculation room. Rinse your hands and accordingly just leave the
laboratory.
And here stand the many kinds of device /instruments wielded in our bureau and their names
are Bunsen burner or spirit lantern, Laminar clean atmosphere, liquid bath, Oven, Hot
container, Incubators, Refrigerators, Micropipettes, PCR, Autoclave, Tripod stand with
asbestos carpet, Centrifuge, pH cadence, Colony counter, Spectrophotometer, Microscope,
and photomicrographic camera Balances, Homogenizers, Magnetic stirrer, Distilled liquid
plant. , Deep freeze, centrifuge, Rotary Shaker, Electric heaters, Lyophilizer.
Tools: Inoculation platinum coil Transfer pointers, Forceps, Scalpels, Scissors, Ocular
micrometer, Burette racks. Goblet -Wares: Test tubes, Petri plates, Conical pitchers, Culture
tubes Centrifuge tubes, Screw topped urns for tissue culture, Durham's tubes Beakers,
Funnels Separating funnels, Assessing shafts, Graduated and bulb pipettes, Burettes. Others
Non -porous and porous cotton. , Aluminum foil, Wire instrument baskets, Stains on staining
shelves, Glass damaging pencil, Nail polish resin to clog slides. Disinfectants: liquor, Dettol,
etc. Compartments to keep wielded glassware, pipette, Petri dish, Microbial culture media,
Chemicals Reagents Filter manuscript, etc.
17
The monetary aspects of the department are less than 29 lakhs. Our all-around company is
only regulated by our founder itself that is Dr. Shruthi SD. Different audits and procedures
commemorated in the branch are according to MSME approaches regime of Karnataka.
Annually formerly audit will be performed. To calculate deals and bargains. Strengthening
legal methods. Academies and Pharma leagues are the special victim prospects for our
liturgies donated in our union. No genuine subordination in governing the division everything
is pursued according to the MSME Government of Karnataka. Main adversaries in the
demand Euro fins Barcode Bioscience, Bio kart India Medauxin. Meticulous planning of the
project, executing every step with perfection. We follow customized protocols to execute
every project. There is no innovative technology as such.
A general instruction was given that how the work will go on. Our co-guide divided our work
into 4 parts that are 15 days will be our literature study, 1 month will be wet lab process, 15-
20 days will be bioinformatics data analysis and the last 20 days will be report writing. On
basis of this plan, our project was started. She instructed us to gather the information for
these Plant growth-promoting rhizophore (PGPR), Microscopic techniques and methods
[types of rhizophores (genus, species, shape, gram-positive or negative)], biochemical test
(specific test like catalase, citrate, indole, motility, MRVP), genetic characterization, DNA
isolation, Gene amplification, Sanger sequencing we collected information from various
review literature that how the work is done already in this field. And again what needs to be
done in this field was started.
1. Assortment of root fixing soil from cowpea plant and culturing Rhizobacteria
2. Culturing of symbiotic bacteria from root nodules of cowpea cereal.
3. Isolation and identification of bacterial colonies received.
4. Molecular depiction of organisms.
5. Phylogenetic examination of separated bacteria to recognize their evolutionary
connection
The standard operational cycle of the department is based on general laboratory practices.
18
• Growing of cowpea plant.
Firstly we have prepared soil mixing for potting. Then we have sowed cowpea seed. The
plant growth was within 3 weeks. The plant was at the vegetative phase and was uprooted
with the universal base structure. Forward with soil grasping roots and symbiotic bacteria
from root nodules of the cowpea plant.
19
• When spilling plates, protect your court region sterile by aiding near a flame
or Bunsen burner.
• Put in the adequate quantity of needed antibiotic to the solution pour 20ml of
LB agar per 10cm Petri plate.
• Close the caps on the plates and enable them to chill for 30-60 minutes until
settled, accordingly invert the plates.
• The scatter the plate method was conducted to separate the organism from the
impure variety. 0.1ml was pipette out into plates with nutrient agar and
circulates with a goblet L form rod and incubated at 37°c for 24 hours.
• The extensively well-known colonies were isolated and conserved at 4°c.
• The next day pure colonies appeared in both symbiotic bacteria and
endophytic bacteria.
3. Identification and depiction of Rhizobacteria.
Gram staining: It is known as differential staining where applications of reagents will enable
us to differentiate bacteria or A single stain/ more than one stain that allows us to distinguish
into two types that are gram-positive and gram-negative.
• Take a slide and grease-free the slide with ethanol and add a drop of bacterial
media on the top of the slide, take another slide to make a smear of it, air dry
and then heat fix under a spirit lamp.
• The slide is flooded with primary stain (crystal violet) for 1 minute and then
washed with water.
• Then add gram iodine to the slide and leave it for 1 minute for CV-I complex.
after that wash it.
• Dip the slide in 70% ethanol for 30 seconds, which acts as a decolorizing
agent, and wash it.
• Now add secondary/counterstain safranin to the slide and leave for 1minute
and wash it and blot dry it.
• Observe under the microscope.
4. Biochemical test: the bacterial isolates were distinguished biochemically using some
general tests like catalase, citrate, indole, motility, MRVP test.
20
Catalase test: This test examines the presence of the catalase enzyme. This enzyme helps in
the breakdown of the toxic substance hydrogen peroxide into oxygen and water. If any
organism produces catalase enzyme bubble formation is seen when H 2O2 is added.
• Transfer a bacterial colony into a slide with the help of inoculating loop.
• Add a drop of 3% H2O2 into the slide and mix it.
• If more bubble formation is seen after 5-10 seconds then is a positive result.
• If no bubble formation occurs it’s a negative result.
Citrate Utilization test: The citrate utilization test is utilized to distinguish the capability of
bacteria to use sodium citrate as its carbon source.
• Insert Simmons citrate agar lightly on the tilt by stroking the top of a needle to
a colony that is 18 to 24 hours old.
• Incubate at 35 0C to 37 °C for 18 to 24 hours.
• Identify the advancement of blue color; indicating alkalization. If it remains
green then it is negative.
Indole test: this test signifies the capability of particular bacteria to break down tryptophan
to indole, pyruvic acid, and NH3 in the presence of the tryptophanase enzyme.
Motility test: This test is used in the differentiation of motile and non-motile bacteria. And
specifies the motility of the bacterium.
21
Motility test procedure:
MR/VP test: Methyl Red and Voges Proskauer are two distinct tests, which are conducted to
distinguish between two main types of facultative anaerobic enteric bacteria or acid-forming
and acetoin forming bacteria.
• Add 3-5 dips of methyl red to each trial tubes including test organisms.
• Identify the color transformation in the medium.
• If red color is seen its positive and yellow color is seen it's negative. After the
addition of methyl red indicator.
• Put up with culture in 1 ml of CTAB – homogenizing buffer. Vortex and set at 60°c
for 30 mins.
• Allow it to attain room temperature and put in a proportional amount of chloroform:
isoamyl alcohol (24:1).
• Swirl the culture for 10 mins for 10,000 rpm. Switch top layer to chilled isopropanol
and incubate overnight at 20°c.
• The solution is transferred to DNA silica columns; 750ml each time, and swirl at
10,000 rpm for 1min.
• The buffer is washed twice at 700 ml and spins at 10,000rpm. The buffer is washed at
500ml and spins again at 10,000rpm.
• Eliminate flow-through and arid swirl it for 2 mins at 10,000rpm to discard ethanol
content.
• Switch column to a fresh tube and add 20ml pre-warmed elution buffer.
• Subsequently, 5minutes spins at 10,000rpm for 1min.
• 1ml of RNAase is added to the DNA solution and set at 37°c for 1 hour. For now, run
2ml of DNA on a gel.
23
• 1gm of agarose powder is measured. This agarose powder is added with 1001x TAE
in a microwavable flask. Until the agarose is thoroughly dissolved microwave it for 2-
3 minutes.
• Now agarose gel is kept for cooling at 500C for 5 minutes. Add the agarose gel into
the gel tray with a comb placed.
• Until the agarose gel is solidified completely leave the gel for about 20-30 minutes.
• Each DNA sample is loaded with a buffer. After solidification, place the agarose gel
into the gel box. 1xTAE is filled in the gel box. till the gel is covered.
• The molecular weight ladder is carefully filled into the first lane of the gel. The DNA
samples are properly loaded into the remaining wells of the gel.
• At 80-150V the gel is run until the dye line is nearly 75-80% way down. Leave it for
45mins.
• The power source is turned off; the electrodes are disconnected from the power
source. Properly remove the gel from the gel box.
• DNA fragments are visualized in the presence of UV light. DNA fragments are seen
as bands in the gel.
PCR of the 16SrRNA gene with universal primers 27F and 1492R – 1200bp
dNTP(10mM) 1ul
24
Total reaction volume 25ul
• If the PCR process is completed, remove the PCR tubes and fill them with 3μl of gel
loading dye and mix thoroughly.
• In 1.5% agarose gel fill 5μl of the sample. In subsequent well fill 5μl of control DNA
and begin electrophoresis.
• Samples are run until the second dye reaches 70 to 80 % of the gel and see under UV
light.
• Result: 1200bp (size of base pair) are identified in a single band. This tells us about
the PCR amplification of the template using particular primers that occurred in a
certain product of a limited length.
25
Figure 3.1 Process of nodulation (a) interchange of rhizobial rhicadhesin with swarm lectins
and rhizobial addition with core cells (b) Excretion of nod components by rhizobia origins
root fur curling. (c) Rhizobia penetrate root hair and composition a pest thread through which
they perforate the cortical cells and form a bacterioid state thereby nodules are formed.
26
Figure 3.3 Serial dilution of soil bacteria.
Figure 3.4 (a) Pre cultured Petri plate showing root and soil sample of endophytic and
symbiotic bacteria in LB agar medium ;(b) bacterial colonies grown in Petri plates
27
Bac4 rod Pink Gram –ve Pseudomonas
Figure 3.6 DNA isolated from Bacteria and compared with 1KB ladder
Figure 3.7 Amplified 16srRNA genes from isolated DNA and compared with 1KB
ladder
28
Figure 3.8 Observation of DNA fragments(bands) in UV light
29
CCGCGTGTGTGAAGAAGGCCTTATGATTGTAAAGCACTTTAAGATACCGCAT
ACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTTGCGCTATTAGATGA
GCCTAAGTCGGATTAGCTAGTTGGTGGGGTAATGGCCTACCAAGGCGACGA
TCCGTAACTGGTCTGAGAGGATGATCCGTCACACTGGAACTGAGACACGGC
CCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAG
CCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTATGATTGTAAAGCA
CTTTAAG
>Bac2_27F_D07.ab1
CATGGCCGAAAGCCAAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCT
CCTGGATTTAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAG
TGGGGGATAACGTTCCGAAAGGAACGCTAATACCGCATACGTCCTACGGGA
GAAAGTGGGGGATCTTCGGACCTCGCGCTATCAGATGAGCCTAGGTCGGAT
TAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACGATCCGTAACTGGTC
TGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACG
GGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCA
TGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGA
GGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAG
CACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGT
TAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTCAAGTTGGA
TGTGAAATCCCCGGGCTCAACCCTGGGAACTGCATCCCAAAAC
30
Figure 3.10 Phylogenetic tree showing a relation of Acinetobacter calcoaceticus strain
obtained using Clustal Omega
Figure 3.11 Phylogenetic tree showing the relation of Pseudomonas stutzeri strain obtained
using Clustal Omega
Lab protection is one of the broadly crucial suspicions when you are working with medical
allowances, dangerous chemicals, and heavy-duty instruments. Because coincidences can
skillfully happen when operating in the lab, it is important to pay awareness to the adequate
maintenance and mode of the allowances you adopt in the lab. Operating in a lab is a high-
risk domain, and the lab repairperson and specialists will have systematic practice to resist
up-to-date on the adequate protection safeguards they prefer to take daily.
Here are some of the safety rules which are specific in our lab and should be followed by
every student and another person available in the lab. Wear decent Lab apparel, Chemicals
should be handled with care, proper maintenance of equipment, No food, drinks, and other
eatable stuff are not allowed. fewer employees mean everything is handled by only one
31
person, the workspace was less for every student while doing their project and unnoticed
work. Good customer and employee management.
Chapter 4: Scope for improvement of the operations with the recommended strategies
based on the problems and challenges observe
1 Fewer Everything handled by only one Their must lab Everything cannot be
employees person assistant and many handled by one
more people for person and the work
help must be distributed
equally.
2 Unnoticed One does well in any field The solution to such If you continuously
Work because they expect internship perform well your
recognition. As an intern, you challenges is to work can’t be
might be doing very well but understand that hard overlooked. So, don’t
still, find yourself in a position work doesn’t get feel dejected and
where your part is hardly unnoticed for long. keep up the good
appreciated. That can be It might get ignored work. It is quite likely
somewhat discouraging. the first time, the when you are new to
second time, but the organization and
perseverance is the are expected to be
key. there for a brief
period.
3 WorkSpace Because every student or Like there must be In our lab, only two
employee can't work at a time more than one lab in to three people can
while performing the a company. So they work because the
experiment we have one lab can work freely. availability of space
32
and the other for only keeping is less. One lab is not
the equipment. sufficient for 8-10
people. the problem
needs to be solved.
During the period of COVID-19, we have been called weekly twice or thrice only during
literature study. But for wet lab and bioinformatical studies, we have worked consistently.
Our mode of operation was limited manning. 10 days of illness leave to be granted if he is
suffering from any disease. COVID-19 Safety protocols and equipment followed in our
company are
• Maintain social distance while sitting, standing, walking, traveling, talking with each
other.
• Usage of handwash and hand sanitizers.
• Face mask, face shield must be used.
• Sterile environment
• Wellness and temperature check-ups every day in the company
• If you are sick please say at home.
• The places are cleaned and disinfected in the company on daily basis.
• Used things must be disposed of like tissue paper and so on.
• Good laboratory practices must be followed by everyone
33
Chapter 6 - Innovative practices observed in the organization or the company
HR is in charge of managing employee's wheel of life as they train, hire, enroll, fire, and
administer the employee's well-being. And maintain company activities with good care of
employee’s needs. The working protocol followed in our department or organization is well
versed. That each employee is assigned with the task which should be completed within the
period. Students are oriented before starting their practicals. Laboratory safety rules and
regulations to be followed. Every chemical, equipment, and other laboratory things should be
34
handled and use with proper care. Eight people are the size of our company. Our organization
is a contract research organization. Ownership of our business is handled by Dr. Shruthi SD.
In our company, they use biotechnological techniques and products such as molecular
biology kits and reagents. Services offered in our company are Sanger sequencing and
Microbial identification services, Next-generation sequencing services, DNA Barcoding,
RAPD, RFLP, and Karyotyping, GCMS, LCMS, and other separation techniques,
Phytochemistry, Pharmacology, and Toxicity studies, Scientific writing and Bioinformatics,
Student training and Contract research projects. The standard operating procedure followed in
our company are Students are oriented before starting the practicals in the lab, Clean and
decent lab apparel should be worn, Mobile phones, eating, and drinking is strictly prohibited,
Use tools, glassware, equipment, chemicals, and other things with care and concern.
Problems faced by us in our company are the Fewer employee, unnoticed work and
workspace. COVID-19 Safety protocols and equipment followed in our company are
Maintain social distance while sitting, standing, walking, traveling, talking with each other,
Usage of handwash and hand sanitizers, Face mask, face shield must be used, Sterile
environment, Wellness and temperature check-ups every day in the company, If you are sick
please say at home, The places are cleaned and disinfected in the company on daily basis,
Used things must be disposed of like tissue paper and so on, Good laboratory practices must
be followed by everyone. Meticulous planning of the project, executing every step with
perfection. We follow customized protocols to execute every project. Innovative practices
followed in our company are Current laboratory instruments.
Conclusion:
I had a great experience in Bio Edge Solutions and it’s just as memorable as I expected. I
have been completed my 3 months of the internship program. Which has been helped me to
gain immense knowledge in the field of microbiology and bioinformatics. With nice help and
perfect guidance from our company mentor Dr. Shruthi SD. The only person who handles all
the activities occurring in the company. And many research scholars are interested to do their
internship here because of their good guidance, time management, less cost of the fee, latest
laboratory instruments, and comprehensive planning of the project. For a student or research
person, it is a golden opportunity to get interned for academic advancement in this company.
I was able to gain knowledge in molecular techniques with the help of the latest laboratory
instruments/equipment. I also have learned that by the usage of bioinformatics study and their
tools we were able to determine evolutionary relationships of microorganisms with a
35
phylogenetic tree, FASTA sequence in BLAST of NCBI. Yes, there is a scope of finding
employment in the same organization. But due to COVID-19, there are no vacancies in the
company.
References
Bibliography
Journal
Ankur Tyagi, Vijay Kumar, Purushottam and Akash Tomar (2017) “ Isolation, Identification,
Biochemical and Antibiotic Sensitivity Characterization of Rhizobium Strains from Vigna
mungo (L) Hepper, Cicer arietinum L and Vigna radiata (L) R Wilczek”, International
Journal of Current Microbiology and Applied Sciences, October and December, Vol. 6,
No,12, pp. 2024-2035.
Bhim Pratap Singh (2015) “Screening and Characterization of Plant Growth Promoting
Rhizobacteria (PGPR)”, Bulletin of Environmental and Scientific Research, January and July,
Vol. 4, Issue(1-2), pp.1-14.
Nazish Nazir, Azra N. Kamili, Durdana Shah (2018-19) “Mechanism of Plant Growth
Promoting Rhizobacteria (PGPR) in enhancing plant growth”, International Journal of
Management, Technology And Engineering, July, Vol. 8, Issue VII, pp.709-721.
Chaitanya Kumar Jha, Meenu Saraf (2015) “Plant growth-promoting Rhizobacteria (PGPR)”,
E3 Journal of Agricultural Research and Development, April, Vol. 5, No, 2, pp. 0108-0119.
Appendices
The journey for improving agrarian results due to boosted strength on nutrition output has
necessarily overseen the indiscriminate use of chemical fertilizers and additional
agrochemicals. Biofertilizers are occurring as an adequate option to neutralize the
unfavorable environmental consequences put forth by artificial agrochemicals. Biofertilizers
36
stimulate the across-the-board development and earnings of crops in an eco-friendly way.
They comprise dwelling or stagnant embryones, which are pertained to the ground or utilized
for dealing with crop seeds. One of the foremost competitors in this admiration is
rhizobacteria. Plant growth-promoting rhizobacteria (PGPR) are a crucial clump of helpful,
root-colonizing bacteria growing in the plant rhizosphere and bulk surface. They show
synergistic and adverse interchanges with the dirt microbiota and engage in a collection of
actions of ecological importance. They facilitate plant growth by promoting biotic and abiotic
stress tolerance and benefit the nourishment of host grains. Due to their active expansion
approving actions, PGPRs are supposed an eco-friendly opportunity for risky chemical
fertilizers. The aim of PGPRs as biofertilizers is a natural method toward the endurable
intensification of husbandry. Nonetheless, their petition for improving farming harvests has
various pros and cons. Entreaty of probable biofertilizers that conduct well in the laboratory
and nursery situations always ceases to function to provide the expected consequences on
plant improvement in area locations. Here we study the several categories of PGPR-based
biofertilizers, communicate the challenges confronted in the extensive adoption of
biofertilizers, and contemplate the possibilities of utilizing biofertilizers to stimulate
endurable agriculture.
37