SARAS 12th Bio Zoology Guide English Medium For Tamilnadu State Board

45 Years in Life Science Book Publishing.
Since 1974
Bio-Zoology
12
12
ER
Only Book having Objective Questions
framed line by line from the Text Book
Solved Book back Questions
PT SAMPLE
A
SolvedAdditional Questions
CHAPTERS
CH
Government Exam Question Papers

This book contains Two Supplement Books
Question Bank Book Short Answer Book
E
Unit Test Question Papers - Chapterwise Definitions Do you know questions

PL
Assessment Test Question Papers - 4 Differences Days of Importance

PTA Question Papers - 6 Discoveries Diagrams
Diseases Abbreviations
M
For memory Laws and Theories

SA
Edited by Designed by
Dr., Capt. N. Arumugam, M.Sc.,M.Phil.,Ph.D.,FZI,FIAES P. Senthil Kumar, M.Sc., M.Phil., B.Ed.
Gold Medalist, Zoological Society of India, PG Asst. in Biology,
Fellow, Indian Academy of Environmental Sciences, SMSV Higher Secondary School,
Fellow, Zoological Society of India, Karaikudi.
Principal and Head (Rtd.), Dept. of Zoology, Vivekananda College,
12th Bio-Zoology
Agasteeswaram, Kanyakumari Dist - 629 701.
SARAS PUBLICATION
114/35G, A.R.P. Camp Road, Periavilai, Kottar P.O.,
NAGERCOIL, Kanyakumari Dist. - 629 002. Tamil Nadu
Website : www.saraspublication.com
E-mail: info@saraspublication.com
I
Telephone: 04652 - 265026, 265099; Cell: 098421 23441.
Call us 04652 265026 or whatsapp 7598265026 Buy full book online www.saraspublication.com
SaraS Publication
Biosciences Book Pu blisher
12th Bio-Zoology - Line by Line Solved Questions
ER
Copyright Publisher
Published by Saras Publication, Nagercoil.
PT
Printed by Saras Offset Printers, 1337/5, Sattur Road, Sivakasi - 626 189
Cell: 09842323441, E-mail:print@sarasprinter.in
A
45 years in Life Science Book publishing. Since 1974
First Edition : 2020
CH
All rights reserved.

No part of this book may be reproduced in any form, by photostat, microfilm, xerography or
E
any other means, or incorporated into any information retrieval system, electronic or
PL
mechanical, without the written permission of the copyright owner.

M
Authors Chapters
Price : Rs. 390/-
A. Aravinth
SA
M.Sc., -8
Pages : 424 + 60 + 72 (2 Supplement books)
S. Boustine M.Sc., M.Phil., - 6,11,12
Published by Dip. Counselling
SARAS PUBLICATION R. Jeya Saroj Bagya Rose -9
12th Bio-Zoology
114/35G, A.R.P. Camp Road, Periavilai, M.Sc., M.Phil., B.Ed.,PGDMM

Kottar P.O., Nagercoil, S. Angel Suby M.Sc., BLS., PGDCA. - 7, 3
Kanyakumari Dist -629 002.
M. Deepa M.Sc., PGDIW -1, 2, 4, 5, 10
Telephone : 04652 265026, 265099
& WWT., PGDCR., DMLT.
Cell phone : 09842123441
Shop online : www.saraspublication.com
E-mail : info@saraspublication.com
II
https://www.saraspublication.com/books/12th-bio-zoology-tamilnadu-state-board-syllabus/
Contents
1. Reproduction in Organisms
2. Human Reproduction
3. Reproductive Health
4. Principles of Inheritance and Variation
5. Molecular Genetics
6. Evolution
ER
7. Human Health and Diseases
8. Microbes in Human Welfare
9. Applications of Biotechnology
10. Organisms and Population PT
A
11. Biodiversity and its Conservation
CH
12. Environmental Issues

12th Biology Public Exam Question Paper
12th Zoology Public Exam Question Paper
E
PTA Question Papers -6

PL
Do You Know Questions (In box Question)

Assessment Test
M
SA
 12th Bio-Zoology
III
SaraS Publication
Biosciences Book Pu blisher
Our Titles for 12th Biology

12th Bio-Botany + 2 Supplement Books
Line by Line Solved Questions
12th Bio-Zoology + 2 Supplement Books
12th Bio-Botany
Book Back Solved Questions
12th Bio-Zoology
Book Back Solved Questions
12th Botany for Pure Science
ER
PT
12th Zoology for Pure Science
A
12th Bio Botany
1 Mark solved Questions - 1050
CH
12th Bio Zoology

1 Mark solved Questions - 1050
E
12th Model Solved Question Papers 12

PL
12th caphp-jhtutpay; + 2 Supplement Books

thp thp tpdh tpilfs;
M
th
12 caphp-tpyq;fpay; + 2 Supplement Books
thp thp tpdh tpilfs;
SA
12th caphp-jhtutpay;
Gj;jf tpdh tpilfs;
th
12 caphp-tpyq;fpay;
Gj;jf tpdh tpilfs;
12th Bio-Zoology
12th caphp-jhtutpay;
1 kjpg;ngz; tpdh tpilfs;;
th
12 caphp-tpyq;fpay;
1 kjpg;ngz; tpdh tpilfs;;
th
12 caphpay; tpilaspf;fg;gl;l
khjphp tpdhj;jhs;f
; s; 12
IV th
12 CBSE Biology
SaraSPublication
Biosciences Book Publisher
5 Molecular Genetics
Book Back Solved Questions - 1 Mark
I. Choose the Correct Answers allowed to grow for two generations.
1. Hershey and Chase experiment with DNA extracted from these cells is
bacteriophage showed that ultracentrifuged in a cesium chloride
a) Protein gets into the bacterial cells density gradient. What density
b) DNA is the genetic material distribution of DNA would you expect
in this experiment?
ER
c) DNA contains radioactive sulphur
d) Viruses undergo transformation (a) One high and one low density band.
2. DNA and RNA are similar with (b) One intermediate density band.
respect to
a) Thymine as a nitrogen base PT
(c) One high and one intermediate
density band.
A
b) A single-stranded helix shape (d) One low and one intermediate
CH
c) Nucleotide containing sugars, density band.

nitrogen bases and phosphates 6. What is the basis for the difference
d) The same sequence of nucleotides in the synthesis of the leading and
lagging strands of DNA molecules?
E
for the amino acid phenyl alanine

(a) Origin of replication occurs only
PL
3. A mRNA molecule is produced by

a) Replication b) Transcription at the 5' end of the molecules.
c) Duplication d) Translation (b) DNA ligase works only in the
M
4. The total number of nitrogenous 3'  5' direction.

(c) DNA polymerase can join new
SA
bases in human genome is estimated to

be about nucleotides only to the 3' end of
CH.5: Molecular Genetics
the growing strand.

a) 3.5 million b) 35000
(d) Helicases and single-strand
c) 35 million d) 3.1 billion
binding proteins that work at
5. E. coli cell grown on 15N medium
the 5' end.
are transferred to 14N medium and
1. (b) DNA is the genetic material 5. (d) One low and one intermediate
2. (c) Nucleotide containing sugars, density band.
nitrogen bases and phosphates 6. (c) DNA polymerase can join new
3. (b) Transcription nucleotides only to the 3' end of
4. (d) 3.1 billion the growing strand. 116
SaraSPublication
7. Which of the following is the correct the origins.

sequence of event with reference to the (c) Replication occurs at about 1
central dogma? million base pairs per minute.
(a) Transcription, Translation, (d) There are numerous different
Replication bacterial chromosomes, with replication
(b) Transcription, Replication, occurring in each at the same time.
Translation 10. The first codon to be deciphered
(c) Duplication, Translation, was______ which codes for ________.
Transcription (a) AAA, proline
(d) Replication, Transcription, (b) GGG, alanine
Translation (c) UUU, phenylalanine
ER
8. Which of the following statements (d) TTT, arginine
about DNA replication is not correct? 11. Meselson and Stahl’s experiment
(a) Unwinding of DNA molecule
PT
proved
occurs as hydrogen bonds break. (a) Transduction
(b) Replication occurs as each base (b) Transformation
A
is paired with another exactly like it. (c) DNA is the genetic material
CH
(c) Process is known as semi- (d) Semi-conservative nature of

conservative replication because one DNA replication
old strand is conserved in the new 12. Ribosomes are composed of two
E
molecule. subunits; the smaller subunit of a

PL
(d) Complementary base pairs are ribosome has a binding site for _______
held together with hydrogen bonds. and the larger subunit has two binding
9. Which of the following statements is
M
sites for two____.

not true about DNA replication in 13. An operon is a:
SA
eukaryotes? (a) Protein that suppresses gene

(a) Replication begins at a single
expression
origin of replication. (b) Protein that accelerates gene
(b) Replication is bidirectional from expression
7. (d) Replication, Transcription, the same time.
Translation 10. (c) UUU, phenylalanine
8. (b) Replication occurs as each 11. (d) Semi-conservative nature of
base is paired with another DNA replication
exactly like it. 12. mRNA,tRNA
9. (d) There are numerous different 13. (c) Cluster of structural genes with
bacterial chromosomes, with related function 117
replication occurring in each at
SaraSPublication
(c) Cluster of structural genes with (a) Transcription of lac y, lac z, lac
related function a genes occurs.
(d) Gene that switches other genes (b) Repressor is unable to bind to
on or off the operator.
14. When lactose is present in the (c) Repressor is able to bind to the
culture medium: operator.
(d) Both (a) and (b) are correct.
Book Back Solved Questions - 2 Marks
1. Give reasons. Genetic code is uni- 4. State any three goals of the human
versal. genome project.
1. All living systems use nucleic 1. To identify all the genes in human
ER
acids. DNA, which is approximately 30,000.
2. The triplet codon directs the 2. To determine the sequence of
synthesis of the same amino acid in
all organisms. PT
three billion chemical base pairs that
makeup the human DNA.
A
3. Eg. The codon UUU encodes for 3. To store these information in
the amino acid, phenylalanine in all
CH
databases.
organisms. 4. To improve tools for data
2. Name the parts marked ‘A’ and ‘B’ analysis.
in the given transcription unit.
E
5. To transfer related technologies

PL
3 to other sectors.
A 6. To address the ethical, legal and
social issues that may arise from the
M
3
project.
SA
A - Promoter
B 5. Why the human genome project is
B - Coding strand called a mega project?

1. The project was aimed to identify
3. Mention any two ways in which single
all the genes (about 30000) in human
nucleotide polymorphism (SNPs) identi-
fied in human genome can bring revolu- DNA.
tionary change in biological and medical 2. Human genome has approximately
science. 3x109 bp.
1. It helps in finding chromosomal lo- 3. Human genome is about 25 times
cations of disease associated sequences. larger than the genome of other
2. It helps in tracing human history. organisms.
118
14. (d) Both (a) and (b) are correct.
SaraSPublication
6. It has taken 13 years to complete 3. It reads specific codes of mRNA

this project. molecules.
6. Why tRNA is called an adapter mol- 7. Name the anticodons required to rec-
ognize the following codons: AAU,
ecule?
CGA, UAU and GCA.
1. tRNA molecule acts as a vehicle.
Codons Anticodons
It picks up the amino acids scattered
1. AAU - UUA
throughout the cytoplasm. 2. CGA - GCU
2. The anticodon of tRNA base pairs 3. UAU - AUA
with the codon of mRNA. 4. GCA - CGU
8. If the coding sequence in a transcription unit is written as follows:
ER
5TGCATGCATGCATGCATGCATGCATGC3
Write down the sequence of mRNA.
3'ACGUACGUACGUACGUAC G U A C G U A C G 5'
PT
9. What are the three structural differences between RNA and DNA?
A
RNA DNA
CH
1. Ribonucleic acid. 1. Deoxyribonucleic acid.

2. It contains ribose sugar, 2. It contains deoxyribose sugar,
3. Uracil is present. 3. Uracil is not present.
E
4. Thymine is not present. 4. Thymine is present.

PL
5. Every nucleotide residue has an 5. Additional -OH group is not present.

additional -OH group at 2'
M
position in the ribose.

6. RNA is a single stranded molecule. 6. DNA is a double stranded molecule.
SA
Book Back Solved Questions- 3 Marks

1. Differentiate - Leading strand and lagging strand.

Leading Strand Lagging Strand
1. It is the newly synthesized strand 1. It is the newly synthesized strand
formed from template strand. formed from coding strand.
2. Replication is continuous. 2. Replication is discontinuous.
3. It produces a single DNA strand. 3. It produces many DNA fragments
called Okazaki fragments.
4. Gaps are not formed in this strand. 4. Gaps are formed in this strand.
119
5. DNA ligase is not required. 5. DNA ligase is required.
SaraSPublication
2. Differentiate - Template strand and coding strand.

Template Strand Coding Strand
1. This strand of DNA is used for 1. This strand of DNA is not used for
transcription. transcription.
2. The polarity of this strand is 3'5'. 2. The polarity of this strand is 5'3'.
3. This strand is transcribed into 3. This strand is not transcribed into
mRNA. mRNA.
4. The nucleotides are complemen- 4. Nucleotides are similar to that in
tary to mRNA. mRNA.
3. In E.coli, three enzymes, -galac-
ER
4. This prevents structural genes from
tosidase, permease and transacetylase translation.
are produced in the presence of lactose. 5. So, enzymes are not produced.
Explain why the enzymes are not syn-
thesized in the absence of lactose.
RNA
PT
poly-
merase unable
A
to bind to
1. In the absence of lactose, the i promoter
CH
In absence
gene (regulator gene) transcribes a of inducer
repressor mRNA.
2. The repressor mRNA produces a Repressor mRNA Repressor binds to the operator
region (O) and prevents RNA
E
repressor protein. polymerase from transcribing the

PL
3. This protein binds to the operator operon

region of the operon. Repressor
Fig. Lac Operon model.
M
4. Distinguish between structural gene, regulatory gene and operator gene.

SA
Structural Gene Regulatory Gene Operator Gene

1. It codes for mRNA, 1. It codes for a repre- 1. Repressor protein binds to

proteins, rRNA and ssor protein. operator gene and inhibits
tRNA. structural gene.
2. One or more struc- 2. Only one regulatory 2. Only one operator gene
tural genes may be gene is present. is present.
present.
3. Active when lactose 3. Active when lactose 3. Active when lactose is
is present. is absent. present.
4. Inactivated by the 4. Inactivated by 4. Inactivated by repressor 120
absence of glucose lactose. protein.
SaraSPublication Biosciences Book Publisher
5. A low level of expression of lac op- level has led to the development of novel
eron occurs at all the windows for treat- pharmaceuticals.
ment of various genetic disorders . Jus-
7. Why did Hershey and Chase use ra-
tify the statement.
dioactively labelled phosphorus and sul-
? phur only? Would they have got the
6. How is the two stage process of pro- same result if they use radiolabelled car-
tein synthesis advantageous? bon and nitrogen?
This helps to turn on or off protein Reason
synthesis at any one stage. This is because phosphorus is
1. Protein synthesis takes place in present only in DNA and sulphur is
two stages, namely:
ER
present only in protein.
1. Transcription 1. They wanted to observe whether
2. Translation
PT
DNA or protein entered the bacteria,
2. Gene expression can be turned
when infected by bacteriophages.
on or off. This is known as gene
2. All nucleic acids contain
A
regulation.
phosphorus and not sulphur.
CH
3. By controlling the level of

3. Proteins contain sulphur and no
expression, the amount of protein
phosphorus. The amino acids, cysteine
product made by a gene can be
and methionine contain sulphur. These
E
controlled.
4. This may occur at different amino acids are present in the protein
PL
levels: coats of bacteriophages.

• Transcription level 4. Labelling the phages with these
M
• Post-transcription level isotopes helps to track viral proteins

and nucleic acids during the infection
SA
• Translation level
Most often, it occurs at transcription process. He wanted to find whether
level. DNA or protein entered the bacteria.

5. Turning ‘on’ or ‘off’ the correct Radiolabelled Carbon
genes, is essential for the normal and Nitrogen
functioning of a cell. No, they would not get the same
6. Dysregulation of these genes can result.
cause diseases such as cancer, Reason
autoimmunity, etc. Carbon and nitrogen are present
7. Gene regulation at transcription both in DNA and protein.
121
SaraSPublication
Book Back Solved Questions - 5 Marks

1. From their examination of the struc- Kornberg proposed the following
ture of DNA, what did Watson and model for the nucleosome.
Crick infer about the probable mecha- 1. A nucleosome is a unit of histone
nism of DNA replication, coding capa- octamer wrapped by DNA.
bility and mutation? 2. It is made up of 8 histone
Mechanism of DNA Replication molecules of the following four types:
They inferred semi-conservative H2A H2B
method of replication. H3 H4
In semi-conservative replication, 3. The histone octamer is positively
ER
both strands serve as template to form charged and the DNA is negatively
two new DNA molecules, each having charged.
one parent strand and one newly 4. Typical nucleosome contains 200
synthesized strand.
Coding Capability
PT
bp of DNA helix.
5. Histone octamers are in close
A
During replication, the strand with po- contact.
CH
larity 3' 5' acts as template strand. 6. DNA is coiled on the outside of
The strand with 5' 3' acts as the nucleosome.
coding strand. 7. Neighbouring nucleosomes are
connected by linker DNA. Linker DNA
E
Both strands take part in replication.

is exposed to enzymes.
PL
But the template strand alone takes

part in transcription. 8. DNA makes two complete turns
around the histone octamers.
M
Mutation
When replication occurs at a faster 9. The two turns are sealed off by a
histone H1 molecule.
SA
rate, errors may occur.

10. Chromatin lacking H1 has a
Errors occurring leads to mutation.

beads-on-a-string appearance. DNA
2. Explain the formation of a nucleo-
enters and leaves the nucleosome at
some. random places.
Nucleosomes are structures formed 11. H1 of one nucleosome can
when negatively charged DNA is
interact with H1 of neighbouring
wrapped around the positively charged nucleosome.
histone octamer. 12. This results in further folding of
Nucleosomes are a series of
the fibre.
repeating units that form the
chromatin. 122
SaraSPublication
ER
PT
A
CH
Fig. Condensation of DNA.
3. It is established that RNA is the first 7. The term ‘RNA world’ was first
genetic material. Justify giving reasons.
E
used by Walter Gilbert in 1986.

1. RNA is the genetic material in
PL
8. Walter Gilbert in 1986, proposed

TMV. that RNA is the first genetic material
2. It was demonstrated and separated on the Earth.
M
by Conrat and Singer in 1957. 9. RNA acts as both, genetic

3. A typical cell contains ten times
SA
material and catalyst.

as much RNA as DNA. 10. It catalyses several biochemical
4. The first genetic material as RNA reactions:

was hypothesised by ‘RNA world’.  Metabolism
5. RNA world is the first stage in  Translation
the evolution of life.  Splicing
6. ‘RNA world’ was independently 11. Catalytic ribosome is known as
proposed by the following biologists: ribozyme.
 Leslie Orgel
12. RNA is more reactive and
Francis Crick unstable than DNA.
Carl Woese
13. This led to the evolution of more
stable DNA. 123
SaraSPublication Biosciences Book Publisher
14. Some RNA molecules function as the two template strands.

gene regulators by binding to DNA. This a) Replication fork
affects gene expression. b)
5' 3'
4. a) Identify the figure given below.
Template
b) Redraw the structure as a repli-
strands
cating fork and label the parts.
Replication
3' fork
DNA 3' 5'
polymerase DNA
polymerase
5' DNA ligase
Okazaki
3'
ER
fragments
5' 3' 5' Leading Lagging 3' 5'

strand strand
c) Write the source of energy for this

replication and name the enzyme in- c)
PT Source of Energy
A
volved in this process. Deoxy nucleotide triphosphate
CH
d) Mention the differences in the syn- Enzymes Involved

thesis of DNA, based on the polarity of DNA polymerase
E
d)
PL
3' 5' Polarity 5' 3' Polarity

M
1. The strand with polarity 3' 5' 1. Strand with polarity 5' 3' is the
acts as the template strand. coding strand.
SA
2. Replication in this strand is conti- 2. Replication in this strand is discon-

nuous. tinuous.
3. Replication produces the leading 3. Replication produces the lagging
strand. strand.
4. Gaps are not present in the lead- 4. Gaps are present in the lagging
ing strand. strand.
5. It produces a single DNA strand. 5. It produces many DNA fragments
called Okazaki fragment.
6. Ligase is not required. 6. Ligase is needed to seal off the gaps.
124
Human Health
7 and Diseases
Book Back Solved Questions - 1 Mark
Choose the Correct Answer 5. Choose the correctly matched pair.
1. A 30 year old woman has bleedy a) Amphetamines - Stimulant
diarrhoea for the past 14 hours. Which b) LSD - Narcotic
one of the following organisms is likely c) Heroin - Psychotropic
ER
to cause this illness? d) Benzodiazepine - Pain killer
a) Streptococcus pyogenes 6. The Athlete’s foot disease in human
b) Clostridium difficile
c) Shigella dysenteriae
PT
is caused by ———
A
a) Bacteria b) Fungi
d) Salmonella enteritidis c) Virus d) Protozoan
CH
2. Exo-erythrocytic schizogony of 7. Cirrhosis of liver is caused by chronic

Plasmodium takes place in ........ intake of ———
E
a) RBC b) Leucocytes a) Opium b) Alcohol

PL
c) Stomach d) Liver
c) Tobacco d) Cocaine
3. The sporozoites of Plasmodium
M
vivax are formed from ........... 8. The sporozoite of the malarial para-
a) Gametocytes b) Sporoblasts site is present in ——
SA
CH.7: Human Health and Diseases

c) Oocysts d) Spores a) Saliva of infected female Anopheles
4. Amphetamines are stimulants of the mosquito.
CNS, whereas barbiturates are ........... b) RBC of human suffering from
a) CNS stimulant malaria.
b) Both a and b c) Spleen of infected humans.
c) Hallucinogenic d) Gut of female Anopheles mos-
d) CNS depressants quito.
1. (c) Shigella dysenteriae 6. (b) Fungi
2. (d) Liver 7. (b) Alcohol
3. (c) Oocysts 8. (a) Saliva of infected female
4. (d) CNS depressants Anopheles mosquito.
5. (a) Amphetamines - Stimulant 199
20. The antigen binding site can ‘fit’ 2. The immune system fails to
to a specific antigenic determinant of distinguish between self and non-
an antigen. self.
21. The stem region of the antibody 3. It attacks its own body.
monomer determines the antibody 4. It produces antibodies called
class.
auto antibodies and cytotoxic-T
It serves common function in all
cells.
antibodies.
3. Auto immunity is a misdirected 5. They destroy our own tissues.
immune response. Justify. 6. They cause auto-immune disease.
Justification 7. Thus, auto immunity is a
1. Auto immunity is an abnormal misdirected immune response.
ER
immune response against own body.
Additional Solved Questions - 1 Mark
1. Disease caused by bacteria. 2. Kala-azar PT
- (ii) Fungi
A
a) Typhoid b) Measles 3. Measles - (iii) Bacteria
CH
c) Cold d) Dengue 4. Diptheria - (iv) Protozoan

2. Non infectious disease a) 1 - (ii), 2 - (iv), 3 - (i), 4 - (iii)
a) Typhoid b) Cholera b) 1 - (iii), 2 - (iv), 3 - (i), 4 - (ii)
E
c) Chicken pox d) Arthritis c) 1 - (iv), 2 - (iii), 3 - (ii), 4 - (i)

PL
3. Test to confirm typhoid is d) 1 - (iv), 2 - (iii), 3 - (i), 4 - (ii)

M
a) Widal b) ELISA 6. Common cold is caused by the virus

c) Western blot d) Southern blot a) HIV b) Rhino virus
SA

4. Name the protozoan disease c) RNA virus d) DNA virus
a) Mumps b) Measles 7. Swine flu was first identified in
c) Dengue d) Kala-azar a) 1990 b) 1991
5. Match the following with correct c) 1919 d) 1921
sequence 8. Zoonotic virus
Diseases Pathogens a) HIV b) Nipah
1. Athlete’s foot - (i) Virus c) Polio virus d) Poxy virus
1. (a) Typhoid 5. (a) 1 - (ii), 2 - (iv), 3 - (i), 4 - (iii)

2. (d) Arthritis 6. (b) Rhino virus
3. (a) Widal 7. (c) 1919
4. (d) Kala-azar 8. (b) Nipah 204
9. In which disease, blood and visceral a) i - a, ii - b, iii - d, iv - c

organs are affected by yellow fever and b) i - b, ii - a, iii - c, iv - d
dengue fever. c) i - b, ii - a, iii - d, iv - c
a) Neurotropic diseases d) i - c, ii - d, iii - a, iv - b
b) Pneumotropic diseases 13. Kala-azar is transmitted by
c) Dermotropic disease a) Tsetse fly b) Sand fly
d) Viscerotropic diseases c) House fly d) Mosquitoes
10. Mumps disease is caused by virus. 14. The pathogenic bacteria causing
a) Paramyxovirus bubonic plague is
b) Rubella virus a) Yersinia pestis
c) Flavivirus b) Clostridium tetani
d) Alpha virus c) Shigella sp
11. African sleeping sickness is caused
ER
d) Streptococcus
by 15. Life cycle of Plasmodium
a) Trypanosoma
b) Musca domestica PT
a) Schizogony b) Gamogony
c) Sporogony d) All the above
A
c) Entamoeba 16. It is a pandemic disease
CH
d) Nipah virus a) Polio b) Swine flu

12. Match the following with correct pair c) Cancer
i) T.gambiense - a)Glossina morsitans d) Heart attack
E
ii) T.rhodesiense - b) Glossina palpalis 17. Incubation period of malaria is

PL
iii) T.cruzi - c)Leishmania donovani a) 15 days b) 12 days

iv) Kala azar - d) Triatoma megista c) 16 days d) 14 days
M
18. Find the wrong pair

SA

Viral disease Affecting organ
(a) Dermotropic - Skin and subcutaneous tissues
(b) Neurotropic - Central nervous system
(c) Pneumotropic - Brain and spinal cord
(d) Viscerotropic - Blood and visceral organs
14. (a) Yersinia pestis

9. (d) Viscerotropic diseases 15. (d) All the above
10. (a) Paramyxovirus 16. (b) Swine flu
11. (a) Trypanosoma 17. (b) 12 days
12. (c) i - b, ii - a, iii - d, iv - c 18. (c) Pneumotropic- Brain
13. (b) Sand fly and spinal cord 205
19. Oocyst undergoes meiosis by a ............ weeks of age.

process called a) 2 and 3 wks b) 6 and 12 wks
a) Schizogony b) Gamogony c) 12 and 16 wks d) 12 and 20 wks
c) Sporogony d) Trophozoite 27. Female filarial worm gives rise to
20. Disease caused by Flavi virus juveniles called
a) Dengue fever b) Typhoid a) Microfilariae larvae
c) Malaria d) Measles b) Wuchereria bancrofti
21. Vector for filariasis c) Helminthiasis
a) Anopheles mosquito d) Ascariasis
b) Aedes aegypti 28. Amoebiasis is called
c) Culex mosquito a) Amoebic dysentery
d) Tse-tse fly b) Amoebic colitis
ER
22. Periodicity of fever occurred by c) Both (a) and (b)
Plasmodium malariae is d) None of the above
a) Every 24 hrs b) Every 48 hrs
c) Every 38 hrs d) Every 72 hrs PT
29. Identify the viral disease
a) Typhoid b) Amoebiasis
A
23. Hereditary material in retrovirus c) Ascariasis d) Common cold
CH
a) DNA b) RNA 30. Ability of body to fight against the

c) Lipoprotein d) Vitamin disease causing pathogen
24. Select the correct pair a) Susceptibility
E
a) P. vivax - 72 hrs b) Auto immune disease

PL
b) P. malariae - 36 - 48 hrs c) Immunity d) Antibody

c) P. ovale - 48 hrs 31. Substance capable of eliciting
M
d) P. falciparum - 42 hrs immune response.

SA

25. Ascaris lumbricoides is called a) Antibody b) Antigen
a) Ring worm b) Round worm c) Immunity d) Susceptibility
c) Tape worm d) Filarial worm 32. Antibacterial agent that cleaves
26. WHO does not recommend use of bacterial cell wall.
RTS, S vaccine in babies between a) Interferon b) Neutrophils
19. (c) Sporogony 26. (b) 6 and 12 wks

20. (a) Dengue fever 27. (a) Microfilariae larvae
21. (c) Culex mosquito 28. (c) Both (a) and (b)
22. (d) Every 72 hrs 29. (d) Common cold
23. (b) RNA 30. (c) Immunity
24. (c) P. ovale - 48 hrs 31. (b) Antigen
25. (b) Round worm 32. (c) Lysozyme 206
14. Define Hygiene according to WHO? 2. Exogenous antigens

H “Conditions and practices that 21. Name the two types of immunity.
help to maintain health” and prevent Innate immunity
the spread of diseases. Acquired immunity
15. Define Immunology? 22. Define haptens.

 Study of immune system.  Substances that are non-immuno-
 Immune system protects from genic but can react with the products
various infective agents. of a specific immune response.
 Immunology refers to study of 23. Define adjuvants.
immune mechanisms used by the body Substances that can enhance the
for protection from environmental immune response to an antigen.
agents. 24. Define antigenicity.
16. Define antigen.
ER
Property of an antigen, that allows
‘Antibody generator’
it to react with the products of the
Any substance capable of eliciting
immune response.
‘Immunogen’
PT
specific immune response.
25. Define antibodies.
A
• Immunoglobulin
It reacts with antibodies.
CH
• Protein molecules synthesized on

It is represented by Ag.
exposure to antigen.
17. Define immunity?
• Combine specifically with the
Overall ability of body to fight against
E
antigen.
PL
the disease causing pathogen.

18. Name the cutaneous infection • Represented by Ig or ab.
26. Define epitope.
M
caused by fungi? To which genera do

these fungi belong to? • Antigenic determinant
SA

Dermatomycosis • Active part of an antigen
Genera 27. Define paratope.
 Trichophyton  Antigen binding site of an antibody.
 Microsporum  It recognizes and binds to an antigen.
 Epidermophyton 28. What are the four types of dendritic

19. Classify antibodies. cells.
IgG (gamma) 1. Langerhans cells
IgM (mu) 2. Interstitial cells
IgA (alpha) 3. Myeloid cells
IgD (delta) 4. Lymphoid cells
IgE (epsilon)
29. What is zoonotic virus? Give example.
20. Classify antigens. Virus transmitted from animals to 215
1. Endogenous antigens
human beings.
Eg. Nipah virus 35. Define haematopoiesis?

30. What is Korsakoff syndrome? Production of blood cells in the bone
 Chronic memory disorder
marrow.
 Caused by alcohol misuse
36. What are lymphoid organs?
31. Define trophozoite? They are organs of the immune system,
An active, infective and feeding involved in the origin, maturation and
proliferation of lymphocytes.
form of some protozoan parasites
inside the body of the host. 37. How are lymphoid organs classified
Eg. Entamoeba, Plasmodium according to their functions?
32. What happens if one’s immune 1. Primary lymphoid organs (or)
system do not function efficiently? Central lymphoid organs
Lack of immunity occurs. 2. Secondary lymphoid organs (or)
ER
One becomes susceptible to infection Peripheral lymphoid organs
38. The barriers in the innate immunity
 Causes many diseases
33. Define Acquired immunity. PT

are given in the following table. Identify
A
  Immunity that an individual
A,B,C,D
CH
acquires after birth. Type of Barrier Barrier

 It is the body’s resistance to a 1. Physical a) Skin, A_____
specific pathogen. 2. Physiological b) B_____
E
34. Write down the unique features of 3. C_____ c) Interferon

PL
acquired immunity? 4. Phagocytic d) WBC, D_____

M
Antigenic specificity A - Mucus membrane

Diversity
B - Temperature, chemical
SA

Recognition of self and non-self
mediators like interferon
Immunological memory
C - Chemical mediators
D - Macrophages
39. How does malaria differ from chikungunya with reference to their vectors?
Malarial Vector Chikungunya Vector

1. Malaria is transmitted by the bite 1. Chikungunya is transmitted by the
of female Anopheles mosquito. bite of female Aedes aegypti mosquito.
2. Vector prefers biting during night. 2. Vector prefers biting during day time.
3. Breeds in contaminated water. 3. Breeds in clean water.
216
40. Identify the parts A to E. ♣It filters and traps pathogens that
A travel through the lymph.
B 7. The lymph, leaving the lymph
node carries antibodies secreted by
C plasma cells against pathogens.
43. Define antibody affinity.
D Strength of antigen-antibody
reaction between a single antigenic
E determinant and a single combining
Ans: site of the antibody.
A - Thyroid gland 44. Define vaccination.
B - Trachea H Process of administering a
C - Thymus vaccine into the body.
ER
D - Heart HAct of introducing a vaccine into
E - Lung the body to produce immunity to a

41. Write notes on Adenoids. PT
specific disease.
45. Define allergy.
A
♣ Adenoids are antibody producing
glands.  Allergy-allo-altered, erg-reaction.

CH
♣ They are located in the roof of the  Exaggerated response of the immune
mouth, behind the soft palate where system to certain antigens present in the
E
the nose connects to the throat. environment.

PL
♣ They produce antibodies to fight  It is a hypersensitivity reaction.
against infections.  It is caused by allergen.

M
 It is a form of over active immune

♣ They shrink during adolescence.
response mediated by
SA

♣ They disappear by adulthood.
42. Write a note on lymph node. - IgE

1. Lymph node is a secondary lym- - Mast cells
 It is also due to the release of the
phoid organ.
2. It is a part of the body’s immune following substances by mast cells:
 Histamine
system.
 Serotonin
3. It is a small bean-shaped structure.
4. It is packed tightly with white 46. Define allergen.
HAn antigen that causes an allergic
blood cells, namely lymphocytes and
reaction.
macrophages.
HSubstances to which an over active
5. Lymph passes through lymph node.
immune response is produced.
6. It is the first one to encounter the
H Eg.  Mites
antigen that enters the tissue spaces. 217
 Pollen
47. What is digenic organism? Give example. 2. Amphetamines

An organism which completes its life 3. Barbiturates
cycle in two hosts is said to be digenic. 4. Tranquilizers
Plasmodium vivax completes its life 5. Lysergic acid diethylamide (LSD)
cycle in Anopheles mosquito and man. 53. How does smoking tobacco causes
Female Anopheles mosquito - oxygen deficiency in the body?
Z It increases carbon monoxide
Primary host; Man - Secondary host
Eg. Plasmodium vivax content in blood.
48. Write the symptoms of allergic Z This reduces the concentration of
reactions. haem-bound oxygen.

 Sneezing Z This causes oxygen deficiency in
 Watery eyes the body.
ER
 Running nose 54. Name the drugs which slow the
 Difficulty in breathing activity of the brain.
49. What are the organisations involved
in AIDS awareness programme? PT
Depressants like
1. Alcohol
A
WHO - World Health Organisation
2. Barbiturates
CH
NACO - National AIDS Control

3. Tranquilizers
Organisation
NGO - Non-Governmental Organi- 55. Write notes on Heroin.
E
sation 1. Heroin is also called smack.

PL
50. Some allergens trigger sneezing and 2. It is chemically diacetyl morphine.

3. It is a white, odourless and bitter
M
wheezing in human beings. What causes

this type of response by the body. crystalline compound.
SA

 Hypersensitivity - overactive 4. It is obtained by acetylation of
immune response. morphine.
 Production of IgE type antibody.
56. Name an opioid drug and its source
 Production of mast cells.
plant. How does the drug affect the
 Release of chemicals like histamine
human body?
and serotonin.
Opioid Drug
51. Name two plants with hallucino-
Heroin
genic properties.
1. Atropa belladonna Source Plant
2. Datura Poppy plant
52. Name some drugs used to treat Effect on Users
depression. 1. Heroin is a depressant.
218
1. Methamphetamine 2. It slows down the body functions
2. Interstitial cells
3. Myeloid cells
4. Lymphoid cells
112. Write notes on Metastasis?
 Metastasis means spreading of
cancer cell to other parts of the body.

 It gives rise to secondary tumour.
113. Define Anaphylaxis.

Fig. Dentritic cell. Immediate hypersensitivity reaction.
2. These extensions resemble den- Occurs as a result of rapid genera-
drites of nerve cells. lized mast cell degranulation.

3. They are antigen presenting cells. It is a
ER
4. They present antigen to T-helper Sudden
cells. Systemic
5. They are four types:
1. Langerhans cells
PT
Severe and
Immediate allergy
A
Additional Solved Questions - 3 Marks
CH
1. List the viral diseases in human and Site of Infection

give their causative organisms. • Intestine
E
1. Common cold - Rhino virus • Brain

PL
2. Measles - Rubella virus • Spinal cord

M
3. Mumps - Mumps virus Mode of Transmission

(Paramyxovirus)  Droplet infection
SA

4. Viral hepatitis - Hepatitis-B virus  Faecal -Oral route
5. Dengue fever - Flavi virus Symptoms

6. Chikungunya - Toga virus/  Fever
Alpha virus  Muscular stiffness
7. Chicken pox - Varicella-zoster Muscular weakness
virus  Paralysis
8. Poliomyelitis - Polio virus  Respiratory failure
2. Which viral disease causes paralysis? 3. Write notes on personal hygiene.

Write about it.  Maintaining one’s body clean
 It includes activities like

Poliomyelitis
H Bathing
Causative Agent
HWashing hands
Polio virus-RNA virus 225
H Trimming finger nails Caused by a protozoa, Entamoeba

H Wearing clean clothes histolytica
H Keeping the surfaces in home Entamoeba histolytica lives in the
and work place clean and large intestine of humans.

pathogen free  It feeds on food particles and
 Toilets and bathrooms should be bacteria.

clean and pathogen free Infective stage is trophozoite.
4. What is the protozoan disease  Trophozoite penetrates the walls
causing stools with excess mucous? of the host intestine (colon).

Write about it?  Secretes histolytic enzymes.
Amoebiasis Symptoms
 It is a protozoan disease.  Diarrhoea Ulceration
 Amoebic dysentery or Amoebic  Dysentery Bleeding
ER
colitis.  Abdominal pain
 Stool with excess mucus
5. Classify immunity. PT
A
Immunity
CH
Innate Immunity Adaptive immunity

E
PL
M
Natural Artificial
SA

Active Passive Active Passive
(Infection) (Maternal) (Immunization) (Antibody transfer)
6. Name the three species of Trypanosoma causing sleeping sickness in man.
Species Transmission Disease
1. T.gambiense Glossina palpalis Gambian (or)
(Tsetse fly) Central African sleeping sickness
2. T.rhodesiense Glossina morsitans Rhodesian (or)
East African sleeping sickness
3. T.cruzi Triatoma megista Chagas disease (or)
American trypanosomiasis 226
7. Write a note on innate immunity.  Oval shaped areas of thickened tissue

 Natural phenomenon of resistance embedded in the mucus-secreting lining
to infection. of the small intestine of human and
 An individual possesses it from vertebrates.
birth.  Secondary lymphoid organ.
 Innate defense mechanisms are  Peyer’s patches contain
non-specific.   Variety of immune cells

 They are effective against a wide
 Macrophages
range of infectious agents.   Dendritic cells
 Innate immunity is of the following
 T-cells
types: B-cells
1. Anatomical - Skin,
barriers Mucus membrane 10. What are the chief applications of
ER
2. Physiological - Temperature antigen-antibody reactions?
barriers Low pH 1. To determine blood groups.
Chemical
mediators
PT
2. To study serological ascertain-
ment of exposure to infectious agents.
A
3. Phagocytic - Monocytes, 3. To develop immunoassays for the
CH
barriers Neutrophils, quantification of various substances.

Macrophages 4. To detect the presence or absence
4. Inflammatory- Serotonin of protein in serum.
E
barriers Histamine 5. To determine immunodeficiency

PL
Prostaglandins diseases.
11. Identify the figure and label A, B,
M
8. What is the bone marrow equivalent

lymphoid organ of birds? Mention its C, D.
SA

gp41
location and role. gp120
Bone Marrow Equivalent D
Lymphoid Organ Matrix protein
Bursa of Fabricius A
Location B
Attached to the dorsal side of the C
cloaca.
Role
 B-lymphocytes mature in the Identification: HIV
bursa. A - Capsid protein
 They bring humoral immunity. B - Reverse transcriptase
9. What are Peyer’s patches. C - Single stranded RNA
227
D - Lipid bilayer
12. How is cancer treated by immuno- or differentiate and mature into

therapy. different blood cells.
 Immunotherapy is also called 7. B and T lymphocytes are
biological therapy. produced in the bone marrow.
 It is a type of cancer treatment. 8. B cells stay in the bone marrow
 Monoclonal antibodies are used to until they mature.
improve or restore immune system 9. T cells leave the bone marrow and
function. mature in the thymus.
 Immunotherapy is important in 15. How skin and mucus membrane
getting rid of the malignant cells. act as barriers for infections?
 It is used after the tumour has been Skin
removed. Skin is an anatomical barrier of
ER
13. Write down the scopes of Immuno- innate immunity.
logy. Z Prevents the entry of microbes.
1. Immunotherapy
2. Microbial immunology PT
Z It provides acidic environment with
pH 3 - 5. It retards the growth of

A
3. Clinical immunology microbes
CH
4. Cellular immunology Mucus Membrane

5. Allergy and immunology Mucus is an anatomical barrier of
6. Translational immunology innate immunity.
E
7. Transplantation immunology Z It entraps foreign microorganisms.

PL
8. Neuro-inflammatory disorders Z It competes with microbes for

9. Tumour immunology
M
attachment.
10. Vaccine immunology 16. What is diapedesis?
SA

11. Inflammatory disorders • The leakage of vascular fluid with
12. Occular immunology and leucocytes through the capillaries in
inflammation the inflammatory areas is called
14. Write notes on Bone marrow. diapedesis.
1. Primary lymphoid organ • The vascular fluid contains the
2. Bone marrow is a lymphoid tissue. following chemotactic signals:
3. It is found within the spongy - Serotonin
portion of the bone. - Histamine
4. It contains stem cells known as - Prostaglandins
haematopoietic cells. • The chemotactic signals influx the
5. These cells multiply through cell phagocytic cells into the affected area.
division. • It occurs during tissue damage
228
6. They either remain as stem cells and infections.
• It is an innate immunity.   Auto antibodies may block the

• It is an inflammatory barrier. functions performed by that organ.
17. How does immunodeficiency  Eg. 1. Hashimoto’s thyroiditis
occur? What are its types? 2. Graves’ disease

Immunodeficiency 3. Addison’s disease
Immunodeficiency results from the 2. Non-organ Specific Autoimmune
failure of one or more components of Diseases
the immune system.  It is also known as systemic diseases.
Types  Autoimmune activity spreads
1. Primary immune deficiencies are throughout the body.

caused by   Eg. 1. Rheumatoid arthritis
• Genetic developmental defects 2. Multiple sclerosis
2. Secondary immune deficiencies
ER
20. Name the plant source of Canna-
are caused by binoids. What are natural cannabinoids
 Use of Cytolytic drugs
 Useof Immunosuppressivedrugs
 Infections
PT
and give its effects?
Plant Source
A
Cannabis sativa-Indian hemp plant
 Radiation
CH
Natural Cannabinoids
18. How to prevent AIDS.
1. Marijuana 2. Ganja
 Safe sex
3. Hashish 4. Charas
E
 Promoting regular check-up

Effects
PL
 Safe blood transfusion

1. Cannabinoids interfere in the
 Use of disposable needles
transport of neurotransmitter and
M
 Use of condoms during sexual

dopamine.
contact
SA

2. They stimulate the action of central
 AIDS awareness programme
nervous system.
19. Classify and explain autoimmune
3. They produce increase energy
diseases
and sense of euphoria.
Classification of
Autoimmune Diseases 21. How does alcohol act in human
1. Organ specific autoimmune body?
Alcohol is a psychoactive drug.
diseases
It acts on brain.
2. Non-organ specific autoimmune
  It affects a person’s mind and
diseases
1. Organ Specific Autoimmune behaviour.
It acts as a depressant.
Diseases
 It slows down the activity of ner-
Auto immune process is directed 229
against one organ. vous system.
22. Differentiate Malignant and Benign tumour.

Malignant Tumour Benign Tumour
1. Cancerous 1. Non-cancerous
2. Harmful tumours 2. Harmless tumours
3. Spread to other body parts. 3. Do not spread to other body parts.
4. They invade cells. 4. They do not invade cells.
5. They grow rapidly. 5. They grow at slow rate.
6. They are larger in size. 6. They are small in size.
7. Cell growth and differentiation 7. Cell growth and differentiation
is not controlled. is controlled.
ER
23. What is the immune response which ponse”.
produce antibodies immediately? 24. Expand the following: 1. MALT
Explain.
Immune Response PT
2. CMI 3. AIDS 4. NACO 5. HIV
1. MALT - Mucosal Associated
A
Secondary immune response (or) Lymphoid Tissue
CH
Booster response. 2. CMI - Cell Mediated Immunity

Secondary Immune Response 3. AIDS - Acquired Immuno
1. Secondary immune response Deficiency Syndrome
E
occurs when a person is exposed to 4. NACO - National AIDS Control

PL
the same antigen again. Organisation

2. It is the result of immunological
M
5. HIV - Human Immuno-

memory. deficiency Virus
SA

3. The immune system starts produ- 25. List the effects of alcohol during
cing antibodies immediately. adolescence.
4. After recognition of antigen, new 1. Alcohol produces excess acid in
army of plasma cells are generated. stomach.
5. Within 2-3 days, the antibody 2. Alcohol affects the ability of the
concentration in the blood rises steeply. liver to breakdown fat.
6. It reaches much higher level than 3. It leads to the following:
primary response. • Irritation of the stomach lining
7. Antibody level remains for longer • Ulcers.
period. • High blood pressure
8. Secondary immune response • Stroke
occurs in the bone marrow. • Coronary artery disease
230
9. This is also called as “booster res- • Heart attack
• Korsakoff syndrome-Chronic fight a specific bacterial infection, the

memory disorder bacteria may become resistant to the
4. Destruction of liver cells. specific antibiotic.
5. “Liver cirrhosis” scar tissue grows 2. Hence the specific antibiotic can
in the place of dead liver cells. no longer be used to treat the bacterial
26. What role does Helper T-cells and infection.
Killer T-cells play? 3. Some bacteria have developed
Helper T-Cells resistance to many antibiotics.
1. Helper T-cells release a chemical Therefore, infections caused by these
called cytokine. bacteria are difficult to be cured.
2. Cytokine activates B cells. Reducing Bacterial Resistance
Killer T-Cells 1. Avoid using antibiotics to treat
1. Killer T-cells move around the minor infections.
ER
body. 2. Do not use antibiotics to treat viral
2. They destroy the damaged or
PT
infections.
infected cells. 3. Complete the prescribed doses.
27. How bacteria develop resistance to
A
4. Skipping doses or failing to
antibodies? How bacterial resistance complete the prescription doses may
CH
can be reduced? allow antibiotic resistance to develop.

Bacterial resistance Eg. Common cold or flu.
1. If an antibiotic is used too often to
E
PL
28. Differentiate Amoebic dysentery and Bacillary dysentery.

M
Amoebic dysentery Bacillary dysentery

SA

1. Protozoan disease 1. Bacterial disease
2. Amoebiasis 2. Shigellosis
3. Caused by Entamoeba histolytica. 3. Caused by Shigella sp.
29. Give the difference between B-lymphocytes and T-lymphocytes.

B-Lymphocytes T-Lymphocytes
1. B-cells 1. T-cells
2. B-lymphocytes mature in the 2. T-lymphocytes mature in the thymus.
bone marrow.
3. They produce antibodies. 3. They do not produce antibodies.
4. They are activated by T-cells. 4. They are activated by antigen-
presenting cells.
5. Produce plasma cells. 5. Do not produce plasma cells. 231
30. Name the disease caused by round Importance of MALT

worm. List their symptoms. 1. It is rich in the following lympho-
Disease cytes:
Ascariasis  T cells
Symptoms  B cells
Abdominal pain
 Plasma cells
Vomiting
 Macrophages
Headache
Diarrhoea
2. MALT regulates immune res-
Anaemia ponse to specific antigens encountered
Irritability along mucosal epithelium.
Nutritional deficiency
32. Write the possible preventive
ER
Enteritis
measures for malaria.
Hepatitis
1. Killing the insect vector.
Bronchitis
Heavyinfectionleadstostuntedgrowth. PT
2. Spray oil over the water.
3. Bacillus thuringiensis culture can
A
31. What is MALT? State its impor- be sprayed to kill mosquito larvae.
CH
tance.
4. Stocking water bodies with fishes
MALT
such as Gambusia, that feeds on
 MucosaAssociated Lymphoid Tissue
E
mosquito larvae.
PL
 It is a diffuse system of lymphoid

5. Avoid mosquito bites.
tissue. It is present in
M
6. Use mosquito nets, wire gauging

 Respiratory tract
of windows and doors.
SA

 Digestive tract
 Urogenital tract
33. Differentiate between humoral immunity and cell-mediated immunity.

Humoral Immunity Cell-mediated Immunity
1. Humoral immunity produces 1. Cell mediated immunity does not
antibodies. produce antibodies.
2. B-cells mediate this immunity. 2. T-cells mediate this immunity.
3. Pathogens are destroyed by 3. Pathogens are destroyed by macro-
antibodies. phages and natural killer cells.
232
34. Differentiate infectious and non-infectious diseases.

Infectious Diseases Non-infectious Diseases
1. Infectious diseases are transmitted 1. Non-infectious diseases are not
from one person to another. transmitted from one person to
another.
2. They are transmitted through air, 2. They are caused due to genetic,
water, food, physical contact or nutritional or degenerative problems.
vector
3. Communicable diseases. 3. Non-communicable diseases.
4. They are caused by pathogens. 4. They are not caused by pathogens.
5. Eg.  Malaria 5. Eg.  Diabetes
 Cholera  Cancer, etc.
ER
 Typhoid, etc.
35. Which cell does a HIV virus initially

invade? Give the other cell where HIV PT
antibody.
2. Non covalent bonds or inter-
A
replication takes place? How many molecular forces
CH
days can it survive? List the routes of 3. Affinity of antibody

transmission. 37. (i) Identify the given diagram and
Initial invasion of HIV label the parts A to F.
E
Macrophages
PL
Other cell where replication occurs A B

Helper T- lymphocytes C
M
Survival of HIV
SA

 1.5 days inside a cell.
D
 6 hours outside a cell.
Routes of Transmission
E
1. Unsafe sexual contact
F
2. Blood contaminated needles (ii) Name the disease which it causes
3. Organ transplants (i) Identification : Entamoeba
4. Blood transfusion histolytica
5. Vertical transmission from HIV A - Endosome
infected mother to child. B- Food vacuole
36. Point out the factors that determine C - Plasmalemma
binding force of antigen-antibody D - Ectoplasm
reaction. E - Endoplasm
1. Closeness between antigen and 233
F - Nucleus like precipitation, agglutination, etc.

(ii) Amoebiasis The final stage includes destruction
38. Alcohol abuse during adolescence of antigen or its neutralization.
damages the liver. Name the disease and 40. (i) What is the bond that hold the
explain. antigen to the antibody combining site.
Disease (ii) What are types of bonds?
Liver cirrhosis (i) Covalent bond hold the antigen
Explanation to the antibody.
1. Use of alcohol during adolescence (ii) The covalent bonds include
may lead to liver cirrhosis. 1. Hydrogen bonds
2. Alcohol interferes with the ability 2. Electrostatic bonds
of liver to break down fat. 3. Van der Waals forces
ER
3. Fat accumulates in the liver. 4. Hydrophobic bonds
4. Accumulated fat and alcohol 41. What are the applications of antigen
destroy the liver cells. The liver cells
die. PT
antibody reaction.
1. To determine blood groups for
A
5. The dead cells are replaced by the transfusion.
CH
growth of scar tissues. 2. To study serological ascertainment

6. Scarring of liver is called liver of exposure to infectious agents.
cirrhosis. 3. To develop immunoassays for the
E
39.(i) What is antigen antibody quantification of various substances.

PL
reaction? 4. To detect the presence or absence

(ii) Write the stages of antigen of protein in serum.
M
antibody reaction. 5. To determine the characteristics

SA

(i) The reaction between an antigen of certain immunodeficiency diseases.
and antibody is called antigen antibody 42. What is the reaction between
reaction. particulate antigen and antibody? Write
(ii) The reaction between an antigen about it with a diagram.
and antibody is the basis for humoral Agglutination reaction
immunity or antibody mediated Agglutination Reaction
immunity. The reaction between particulate
The reaction between antigen and antigen and antibody is called
antibody occurs in three stages. agglutination reaction.
During the first stage, the reaction It results in clumping or aggluti-
involves the formation of antigen - nation of antigens.
antibody complex. Eg. Reaction between bacteria and
The next stage, leads to visible events antibody. 234
(Particulate Toxins of microbes

antigen).  Surface proteins of microbes
Role of Vaccines
Vaccines “teach” our body how to
defend itself when viruses or bacteria,
invade it.
Fig. Agglutination. 45. Vaccines are preparations of
43. What happens when a soluble pathogenic organism used to prevent
antigen is mixed with an antibody? infection?. Why they do not cause
Illustrate this with a diagram. disease in human?
When a soluble antigen is mixed with 1. Disease causing organisms are
an antibody, a visible precipitate is killed.
2. They are inactivated killed.
ER
formed.
This reaction is called precipitation 3. They are weakened.
reaction.
The antibody, producing precipitate, PT
4. They are attenuated.
5. Microbe’s toxins are used.
A
is called precipitin. 6. Surface proteins of microbes are
CH
used.
7. They are used in very little
amount.
E
This allows the immune system to

PL
recognize the organism without

(soluble actually experiencing the disease.
M
antigen) 46. (i) Identify the figure.

SA

Fig. Precipitation. (ii) Explain the process.
44. (i) What is a vaccine? (iii) What are the cells involved in this
(ii) What is its role? process.
(i) Vaccine
. A vaccine is a biological
preparation that provides active
acquired immunity to a particular (i) Phagocytosis
disease. (ii) Specialised cells engulf and digest
It resembles a disease-causing pathogens. It is called phagocytosis.
microorganism.
It is made from The cells are called phagocytes.
 Weakened microbes
(iii)  Macrophages
 Attenuated microbes  Monocytes
 Killed microbes  Neutrophils

235
Additional Solved Questions - 5 Marks

1. Differentiate Active immunity and Passive immunity.
Active Immunity Passive Immunity
1. Active immunity is produced acti- 1. Passive immunity is received
vely by host’s immune system. passively.
2. It is produced due to contact with 2. It is produced due to antibodies
pathogen or by its antigen. obtained from outside.
3. It is durable and effective in 3. It is transient and less effective.
protection.
4. Immunity is effective only after a 4. Immunity develops immediately.
short period.
5. Immunological memory is present. 5. Immunological memory is not
ER
present.
6. Booster effect on subsequent dose 6. Subsequent dose is less effective.
is possible. PT
A
2. Give the difference between primary immune response and secondary immune
CH
response.
Primary Immune Response Secondary Immune Response
E
1. It occurs as a result of primary 1. It occurs as a result of second and

PL
contact with an antigen. subsequent contacts with the same

antigen.
M
2. Antibody level reaches peak in 2. Antibody level reaches peak in 3-5

SA

7-10 days. days.
3. It requires a long period to develop 3. It establishes immunity in a
immunity. short time.
4. Antibody level declines rapidly. 4. Antibody level remains high for
longer period.
5. It appears in lymph nodes and 5. It appears mainly in bone marrow
spleen. followed by spleen and lymph nodes.
3. Which gland secretes thymosin? Structure
Explain its structure and function.  Thymus is a primary lymphoid
Thymosin Secreting Gland organ.

  Thymus is a flat and bilobed
 Thymus
organ.
236
 Located behind the sternum, above 4. Which disease is caused by HIV?

the heart. Explain the structure of HIV.
 Each lobe of the thymus contains Disease Caused by HIV
numerous lobules. AIDS-Acquired Immuno Deficiency
 These lobules are separated from Syndrome
each other by septa. Structure of HIV
 Septa are formed of connective
1. HIV is a RNA virus.
tissue. 2. It belongs to the genus Lentivirus.
 Each lobule is differentiated into
3. HIV is spherical in shape.
two compartments namely: 4. It is about 100-120 nm in
1. Cortex - Outer compartment diameter.
2. Medulla - Inner compartment
5. It has the following components
Cortex is the outer compartment.
ER
i) Envelope
It is densely packed with
ii) Matrix protein
immature T-cells called thymocytes.
Medulla is the inner compartment.
It is sparsely populated with thymocytes.

PT
iii) Capsid
iv) Core 
A
 In early teens, thymus begins to
6. HIV is surrounded by a lipopro-
CH
atrophy and is replaced by adipose tein envelope.

tissue. 7. Envelope has glycoprotein spikes.
It is most active during neonatal
8. Glycoprotein spikes are gp41 and
E
gp 120. gp41
PL
and pre-adolescent periods.

gp120
Thyroid gland Lipid bilayer
M
Trachea Matrix protein

Right lobe
SA

Capsid protein
Thymus left lobe
Reverse
Septae
transcriptase
Lobule Two single -
stranded RNAs
A Lungs
Heart B Fig: Structure of HIV
Fig: Thymus. A - Location B - Structure
Functions 9. Below the envelope, a layer of
 Thymus secretes Thymosin.
matrix protein is present.
 Thymus stimulates the T-cell to
10. Capsid is present inner to the
become mature and immuno- matrix protein.
competent. 11. Capsid is made up of protein
subunits. 237
12. A dense core is present inner to cytoplasm and becomes the signet ring
the capsid stage.
13. The core contains two single 11. The nucleus divides asexually
stranded RNA and reverse transcrip- to produce the schizont.
tase enzyme. 12. Large schizont shows yellowish
14. The RNA contains the enzyme brown pigmented granules. They are
protease and ribonuclease. called Schuffners granules.
5. Name the stage of Plasmodium that 13. Schizont divides and produces
is transmitted to human body by the mononucleated merozoites.
vector. Describe the life cycle of the In human
parasite in human.
Stage of Plasmodium Sporozoites
ER
Sporozoite stage of Plasmodium is
transmitted to human by the vector.
Life Cycle of
Plasmodium in Human PT Liver Merozoites
A
1. Anopheles mosquito contains Schizont
CH
sporozoites in its salivary gland. form

Merozoites
2. When it bites, sporozoites are Mid trophozoite S rupture from
RBCs
injected into the blood of human. phase begins RBC Nucleus
E
3. It is carried by blood to the liver

PL
cells. Hemozoin
Early trophozoiteSignet ring
M
4. In liver, they undergo multiple

forms forms
asexual fission known as schizogony.
SA

5. They produce merozoites.
6. Merozoites are released from the Gametocytes of
liver cells. Plasmodium
7. They penetrate the RBCs.
8. Inside the RBC, the merozoite Fig. Life cycle of Plasmodium in man.
begins to develop as unicellular 14. Finally the erythrocyte lyses,
trophozoites. releasing merozoites and haemozoin
9. Trophozoite grows in size and a toxin into the blood.
central vacuole develops. 15. Sudden release of merozoites
triggers an attack on RBCs.
10. As the vacuole increases in size,
16. Merozoites also infect other
the nucleus is pushed to one side of
erythrocytes.
238
17. Lysis of red blood cells results in 6. The Zygote becomes elongated to
cycles of fever and other symptoms. form ookinete.
18. This is known as erythrocytic 7. Ookinete migrates to the
cycle. mosquito’s gut wall.
19. Erythrocytic cycle repeats every 8. It develops into oocyst.
48 - 72 hrs. 9. Oocyst undergoes meiosis by a
20. Occasionally, merozoites differ- process called sporogony.
entiate into microgametoycytes and 10. It produces sporozoites.
macrogametocytes. 11. These sporozoites migrate to the
21. During mosquito bite, these salivary glands of the mosquito.
gametocytes are ingested by the In mosquito gut
mosquito.
Sporozoites
ER
6. In which host, sexual phase of life
cycle of Plasmodium occurs? Explain. Salivary
PT
Host glands
Mosquito - Primary host
A
Sexual phase of life cycle Oocyst DNA replication followed
CH
of Plasmodium by sporogony
1. When the female Anopheles
mosquito bites a man, the male and Ookinete
E
female gametocytes of the parasite DNA replication and

PL
enter into the gut of the mosquito. Zygote Meiosis

2. In the gut, infected erythrocytes
M
lyse. Microgamete Macrogamete

SA

3. Macrogametocyte becomes mac- Macrogametocyte
rogamete (female gamete).
4. Microgametocyte becomes micro- Macrogametocyte
gamete (male gamete) by exflagellation.
5. Male and female gametes fertilize Exflagellation
to form a diploid zygote. Fig. Life cycle of Plasmodium in
mosquito.
7. Give the differences between normal cells and cancer cells.
Normal Cells Cancer Cells
1. Small cells 1. Large cells.
2. Nuclei is uniform in shape. 2. Nuclei is variable in shpae.
3. Large cytoplasmic volume. 3. Small cytoplasmic volume. 239
Normal Cells Cancer Cells

4. Conformity in cell size and shape. 4. Variation in cell size and shape.
5. Cells arranged into discrete tissues 5. Arrangement of cells are disorganised
6. May possess differentiated cell 6. Loss of normal specialized features.
structures.
7. Normal presentation of cell surface 7. Elevated expression of certain
markers. cell markers.
8. Lower levels of dividing cells. 8. Large number of dividing cells.
9. Cell tissues clearly demarcated. 9. Poorly defined tumor boundaries.
8. Write short notes on prevention and out the problems.
ER
control for drug and alcohol abuse.  Helps the young to vent their feelings
Some ways to prevent drugs and
alcohol abuse are: PT
of anxiety and guilt.
3. Education and Counselling
A
1. Effectively dealing with peer
To create positive attitude.
CH
pressure.
To deal with many problems.
2. Seeking help from parents and
To accept disappointments in life.
E
peers.
PL
3. Education and counselling 4. Looking for Danger Signs

4. Looking for danger signs. Teachers and parents need to look
M
5. Seeking professional and medical for danger signs that indicate tendency
SA

assistance. to go in for addiction.
1.EffectivelyDealingwithPeerPressure. 5. Seeking Professional and Medical

1. Should have better group of friends Assistance
H Medical assistance from
to avoid friends / peer groups pressure.
2. Seeking Help from Parents and psychologists and psychiatrists helps
Peers individuals .
H Deaddiction and rehabilitation
 Seek help from parents and peer
groups for their guidance. programmes help to overcome their

 Getting proper advices will sort
problems.
240

SARAS 12th Bio Zoology Guide English Medium For Tamilnadu State Board

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

SARAS 12th Bio Zoology Guide English Medium For Tamilnadu State Board

Uploaded by

Copyright:

Available Formats

45 Years in Life Science Book Publishing.

Government Exam Question Papers

Unit Test Question Papers - Chapterwise Definitions Do you know questions

Assessment Test Question Papers - 4 Differences Days of Importance

For memory Laws and Theories

Agasteeswaram, Kanyakumari Dist - 629 701.

12th Bio-Zoology - Line by Line Solved Questions

All rights reserved.

mechanical, without the written permission of the copyright owner.

114/35G, A.R.P. Camp Road, Periavilai, M.Sc., M.Phil., B.Ed.,PGDMM

12. Environmental Issues

PTA Question Papers -6

Do You Know Questions (In box Question)

 12th Bio-Zoology

Our Titles for 12th Biology

12th Bio Zoology

12th Model Solved Question Papers 12

12th caphp-jhtutpay; + 2 Supplement Books

c) Nucleotide containing sugars, density band.

for the amino acid phenyl alanine

3. A mRNA molecule is produced by

4. The total number of nitrogenous 3'  5' direction.

bases in human genome is estimated to

the growing strand.

7. Which of the following is the correct the origins.

(c) Process is known as semi- (d) Semi-conservative nature of

molecule. subunits; the smaller subunit of a

sites for two____.

eukaryotes? (a) Protein that suppresses gene

5. To transfer related technologies

B - Coding strand called a mega project?

6. It has taken 13 years to complete 3. It reads specific codes of mRNA

1. Ribonucleic acid. 1. Deoxyribonucleic acid.

4. Thymine is not present. 4. Thymine is present.

5. Every nucleotide residue has an 5. Additional -OH group is not present.

position in the ribose.

Book Back Solved Questions- 3 Marks

1. Differentiate - Leading strand and lagging strand.

2. Differentiate - Template strand and coding strand.

repressor protein. polymerase from transcribing the

3. This protein binds to the operator operon

4. Distinguish between structural gene, regulatory gene and operator gene.

Structural Gene Regulatory Gene Operator Gene

1. It codes for mRNA, 1. It codes for a repre- 1. Repressor protein binds to

SaraSPublication Biosciences Book Publisher

3. By controlling the level of

levels: coats of bacteriophages.

• Post-transcription level isotopes helps to track viral proteins

level. DNA or protein entered the bacteria.

Book Back Solved Questions - 5 Marks

Both strands take part in replication.

But the template strand alone takes

rate, errors may occur.

Errors occurring leads to mutation.

Fig. Condensation of DNA.

used by Walter Gilbert in 1986.

8. Walter Gilbert in 1986, proposed

by Conrat and Singer in 1957. 9. RNA acts as both, genetic

material and catalyst.

4. The first genetic material as RNA reactions:

SaraSPublication Biosciences Book Publisher

14. Some RNA molecules function as the two template strands.

5' 3' 5' Leading Lagging 3' 5'