Aquaculture 557 (2022) 738329

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Short communication

Physiological responses of channel catfish (Ictalurus punctatus) reared at

different stocking densities in a recirculating aquaculture system
Mohamed M. Refaey a, b, Dapeng Li a, *, Xing Tian a, Kommaly Onxayvieng a, c, Rong Tang a, *
a
College of Fisheries in Huazhong Agricultural University, Hubei Provincial Engineering Laboratory for Pond Aquaculture, Engineering Research Center of Green
development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, Wuhan 430070, China
b
Department of Animal Production, Faculty of Agriculture, Mansoura University, Al-Mansoura 35516, Egypt
c
Department of Livestock and Fisheries, Ministry of Agriculture and Forestry, Vientiane, Lao Democratic People’s Republic

A R T I C L E I N F O A B S T R A C T

Keywords: This study investigated the physiological responses of channel catfish (Ictalurus punctatus) reared under different
Channel catfish stocking densities (SDs). Juvenile channel catfish with an average initial body weight of 40.6 ± 2.23 g were
Stocking density reared at three densities of 2.03 (low SD; LSD), 6.09 (medium SD; MSD), and 12.18 (high SD; HSD) kg m− 3 for 60
Stress
days. Serum biochemistry, antioxidant defense status, immune parameters, and hepatic heat shock proteins
Immunity
Antioxidative enzymes
(hsps) mRNA expression were analyzed. Serum cortisol levels are significantly elevated in MSD and HSD. A
significant increase in lysozyme (LZM) activity and the contents of immunoglobulin M (IgM) and complement
component 3 (C3) were observed with the increased SD. Total antioxidant capacity (T-AOC) and the activities of
superoxide dismutase (SOD) and glutathione peroxidase (GPx) did not significantly affect SD. I. punctatus reared
in HSD showed significantly increased catalase (CAT) activity, malonaldehyde (MDA) content, and nitric oxide
(NO) levels. Hepatic hsp70 and hsp90 mRNA expression were significantly downregulated in HSD compared to
LSD. Overall, HSD caused chronic stress in I. punctatus, leading to biochemical and immune function variations

1. Introduction
Fish production is affected by stocking density (SD) in fish farms.
Fish farmers seek to increase productivity and profitability by increasing
the SD of fish, despite its harmful effects on farmed fish (Lupatsch et al.,
2010). Several studies have reported that increased fish SD causes
chronic stress, leading to growth suppression, reduction of feed intake
and feed efficiency (Li et al., 2012; De Las Heras et al., 2015; Liu et al.,
2016; Refaey et al., 2018; Onxayvieng et al., 2021). Fish reared in high
SD (HSD) exhibited a decline in thyroid hormone levels, metabolic
changes in lipid, protein, and carbohydrates, as well as the incidence of
physical injuries and altered behavior (Anras and Lagardere, 2004;
Sangiao-Alvarellos et al., 2005; Costas et al., 2008).
Fish during the cultural period are subjected to many stressful
environmental conditions, like HSD, causing the secretion of much more
cortisol (Ellis et al., 2012). Cortisol plays an important role in restoring
balance during exposure to stress and after stress (Goos and Consten,
2002), which is considered a good indicator of stressful situations in fish
(Ellis et al., 2012). Rearing fish in higher SD results in chronic stress,
causing the formation of reactive oxygen species (ROS) (Braun et al.,
2010). Therefore, the body generates antioxidant enzymes like super­
oxide dismutase (SOD), catalase (CAT), and glutathione peroxidase
(GPx) to avoid the harmful effects of ROS (Trenzado et al., 2009; Liu
et al., 2018), which work to avoid the harmful effects of ROS. An in­
crease in antioxidants has been observed in juvenile golden pompano,
Trachinotus ovatus, reared in HSD (Yang et al., 2020). Additionally, nitric
oxide (NO) is an endogenous regulatory molecule in animals, contrib­
uting to many biological activities such as acid-base regulation, systemic
vasodilation, osmotic and ion regulation, neurotransmission, intracel­
lular messenger in a multitude of cell types, assisting in gas exchange,
and maintaining blood pressure (Ito et al., 2004; Zaccone et al., 2006),
especially under stress conditions.
In fish, the innate immune system has significant defense mecha­
nisms (Bowden, 2008). The immune responses vary under stressful
conditions, depending on several factors such as fish species, fish status
(size, age), duration of exposure to stress, and stress types. Several
studies have indicated that increasing SD leads to immunosuppression in
some fish species like rainbow trout, Onchorhynchus mykiss (Yarahmadi
et al., 2016), juvenile turbot, Scophthalmus maximus (Liu et al., 2016),
and juvenile Chinese sturgeon, Acipenser sinensis (Long et al., 2019).

* Corresponding authors.
E-mail addresses: ldp@mail.hzau.edu.cn (D. Li), tangrong@mail.hzau.edu.cn (R. Tang).

https://doi.org/10.1016/j.aquaculture.2022.738329
Received 25 December 2021; Received in revised form 2 May 2022; Accepted 5 May 2022
Available online 10 May 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
M.M. Refaey et al.
Contrarily, lysozyme (LZM) activity in sea bass, Dicentrarchus labrax,
increased when subjected to crowding stress (Caruso et al., 2005).
However, immune parameters were not affected by the increase of SD in
Senegalese sole, Solea senegalensis (Andrade et al., 2015). Additionally,
fish have several ways of overcoming environmental stress conditions.
One of these methods is heat shock proteins (HSPs) that play a vital role
in cellular homeostasis under environmental fluctuations (Roberts et al.,
2010). The stress protein family includes many types, but hsp70 and
hsp90 are considered the most common types of HSPs used to study
stress effects on fish (Ni et al., 2014a).
In the past several decades, channel catfish, Ictalurus punctatus, have
been reared in different cultural systems such as ponds, rivers, reser­
voirs, cage culture, and, more recently, in concrete tanks (Bureau,
2013). Consequently, it has become one of the most important farmed
fish species in China economically. Furthermore, Wellborn (1988) and
Wyatt et al. (2006) indicated that dissolved oxygen (DO) levels in
channel catfish fingerling rearing ponds should not fall below 4.0 mg L− 1
for extended periods and that they can tolerate exposure to low DO
concentrations up to 2.3–2.5 mg L− 1 (Torrans, 2005, 2008). Many
studies have reported that different stocking densities of channel catfish
ranged from 0.74 to 2.7 fish m− 2 (Bosworth et al., 2015) and 1.4 to 4.4
fish m− 2 (Li et al., 2003) in earth ponds, 90 to 720 fish m− 3 (Allen, 1974)
in circular tanks, 1.4 to 2.8 fish m− 3 (Green and Schrader, 2015), 2.9 to
8.5 fish m− 2 (Green, 2010), and 12.6 fish m− 2 (Green and McEntire,
2017) under biofloc technology. Nevertheless, available data on the
physiological and immune responses of I. punctatus reared in various
SDs, especially under the recirculating aquaculture system (RAS), is
limited. Therefore, this study aimed to estimate the impacts of different
SDs on serum biochemistry, antioxidant defense system, immune re­
sponses, and hepatic HSP mRNA expression parameters of I. punctatus
juveniles cultivated in RAS for 60 days.
2. Materials and methods
2.1. The bioethical guidelines
This experimental protocol was conducted according to the Institu­
tional Animal Care and Use Committees of Huazhong Agricultural
University, China. The approval number is HZAUFI-2017-002 (Approval
date: January 2017).
2.2. Fish and experimental procedures
This trial was conducted in the College of Fisheries, Huazhong
Agricultural University (Wuhan, China), under RAS, which has been
previously described by Refaey et al. (2018). Juveniles of I. punctatus
were purchased from Wuhan channel catfish farms in Hubei Province,
China. Fish were stocked in the circular fiberglass tanks; each tank
volume was about 0.20 m3 (a radius of 0.35 m with a depth of 0.52 m),
with flow-through water at a rate of about 0.5 L min− 1. Fish were fed the
commercial diet ad libitum by hand two times daily (10:00 am and 19:00
pm) for two weeks according to the American Fisheries Society (AFS,
2014), which considered this period as the adaptation period for the
experimental conditions.
Fish were reared at three SD levels: low (LSD, 10 fish tank− 1, 2.03 kg
m ), medium (MSD, 30 fish tank− 1, 6.09 kg m− 3), and high (HSD, 60
− 3
fish tank− 1, 12.18 kg m− 3). Three replicate tanks were established at
each density group. Three hundred I. punctatus fingerlings (mean initial
weight of 40.6 ± 2.23 g and a total length of 16.99 ± 0.5 cm) were
randomly distributed into nine tanks. Fish were fed a commercial diet
(whose approximate composition contained 11.80% moisture, 8.20%
ash, 30.20% of crude protein, and 6.00% of crude fat, which was pur­
chased from Guangdong Haid Group Co., Ltd., China) to satiation three
times daily at 10:00 am, 15:00 pm, and 20:00 pm, for 60 days.
Water quality parameters were monitored every two days using the
handheld multiparameter instrument (HQ40D Water Analyzer; Hach,
2
Aquaculture 557 (2022) 738329
Loveland, USA). The water temperature was recorded at 24.19 ±
2.05 ◦ C, while the pH was 8.34 ± 0.37. The DO never dropped below
5.76 ± 0.12 mg L− 1. Ammonia nitrogen (NH3− N) and nitrite (NO2-N)
were analyzed by spectrophotometry twice weekly, which never
exceeded 0.06 ± 0.005 mg L− 1, and 0.01 ± 0.004 mg L− 1, respectively.
There was no significant variance detected in the water quality param­
eters among the three experimental groups.
2.3. Collection of samples
After 60 days, the feeding was stopped 24 h before sampling. From
each tank, I. punctatus (n = 10) was put into the water containing tri­
caine methanesulfonate (MS-222; with a concentration of 100 mg L− 1).
Blood samples were obtained from the tail vein (using a 2 mL syringe)
and placed in a centrifuge tube (1.5 mL) for 60 min at room temperature
until clotting. The centrifugation of collected blood samples was done at
3000 ×g at 4 ◦ C for 15 min. Subsequently, the serum samples were
stored at − 80 ◦ C until the serum biochemistry, oxidative stress bio­
markers, and immunological parameters were analyzed. Next, fish liver
samples were obtained and kept in liquid nitrogen at − 80 ◦ C to perform
analysis of hepatic HSPs mRNA expressions.
2.4. Blood biochemistry
The concentration of serum cortisol was tested by the Gamma
radioimmunoassay counter (GC-911). Six samples from each density
were used to analyze the cortisol level by using a commercial RIA kit
(Coated Tube Cortisol 125I RIA Kit, BNIBT, Beijing, China) according to
the manufacturer's instructions. Serum biochemical parameters
included total protein (TP), albumin (ALB), alkaline phosphatase (ALP)
(n = 6 of each density) were determined by using a commercial kit
produced by a Chemix-800 automatic biochemical analyzer (Japan
Sysmex Corporation) and carried out following the manufacturer's rec­
ommendations. To obtain the globulin (GLB) values, they were calcu­
lated by the difference between TP and ALB. The ALP activities were
analyzed by the p-NPP methods.
2.5. Oxidative stress and immunological biomarkers
Total AOC (T-AOC, Kit Serial No: A015) was determined using the
ABTS method. Total SOD (T-SOD, Kit serial NO. A001–3) activity was
measured using kit reagent WST-1. GPx (Kit Serial No.: A005) and CAT
(Kit Serial No.: A007–2) activities were assessed by the colorimetric
method. The malonaldehyde (MDA, Kit Serial No.: A003) level was
determined by the thiobarbituric acid method (TBA method). NO (Kit
Serial No.: A013–2) content was investigated by the nitrate reductase
method. LZM (Kit serial No.: A050–1-1), immunoglobulin M (IgM; Kit
serial No.: E025–1) and complement 3 (C3; Kit serial No.: E032–1) were
measured by immune turbidimetry method as immunological
parameters.
Oxidative stress biomarkers and immunological parameters (n = 6 of
each density) were measured by the colorimetric method (Nano Quant,
infinite M200, Tecan) using commercial kits (Nanjing Jiancheng
Bioengineering Institute, China). The LZM activity was measured using
spectrophotometers.
2.6. Real-time RT-qPCR for hepatic HSPs
Liver tissues (50 mg; n = 6 of each density) were homogenized with
RNA-Solv® Reagent (Omega Bio-Tek, USA) according to the manufac­
turer's extraction total RNA instruction. Then, add 0.2 mL of chloroform
for phase separation for 5 min. Thereafter, the extracted RNA was
washed once with isopropanol alcohol. The RNA pellet was dissolved in
DEPC-treated water. The quantity of the RNA was measured using the
absorbance at 260 nm and at 280 nm. Synthesis of cDNA was conducted
with 2 μg of RNA from each sample using a PrimeScript™ RT reagent Kit
M.M. Refaey et al.
with gDNA Eraser (TaKaRa) following the manufacturer's protocol. The
cDNA was stored at − 20 ◦ C for later use.
The primers used for gene expression analyses are presented in
Table 1, which were designed using Primer Premier 5.0 software based
on I. punctatus sequences deposited in the NCBI GenBank (https://www.
ncbi.nlm.nih.gov/genbank/). The effectiveness of the primers was
determined using a PCR technique that included preheating at 95 ◦ C for
3 min, followed by 40 cycles of 95 ◦ C for 30 s, 60 ◦ C for 30 s, 72 ◦ C for 40
s, and a final extension at 72 ◦ C for 10 min, with 500 ng cDNA template,
0.2 M primer, 5 l 10 × Ex Taq Buffer, 2.5 mM dNTP, and 1.25 U Ex Taq
polymerase (TaKaRa, Japan). The PCR products were then electro­
phoresed in a 1% (w/v) agarose gel (1 × TAE) and shot on a Tanon 1600
gel imager utilizing Andy Safe TMDNA GelStain. Then, the PCR products
were purified using the EZNA gel extraction kit (Omega, USA), and then
sub-cloned into the pMD 19-T cloning vector (TaKaRa, Japan). Positive
clones containing inserts of an expected size were sequenced and vali­
dated by sequencing in Tsingke (Wuhan, China). The nucleotide se­
quences were compared with DNA sequences present in the GenBank
database using the BLAST network service at the NCBI (http://blast.
ncbi.nlm.nih.gov/).
Real-time PCR reactions were prepared using a mixture of 12.5 μL
SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2×) (TaKaRa), 2 μL of 5-fold
diluted cDNA, 1.0 μL of each primer (20 mM), and adding 9.5 μL ddH2O
to reach the total size (25 μL). After that, the qRT-PCR protocol was as
follows: 30 s at 95 ◦ C, followed by 40 cycles of 5 s at 95 ◦ C, 30 s at 60 ◦ C,
and 30 s at 72 ◦ C. The melting curve was used to confirm that a single
product was augmented and examined for the absence of primer-dimer
artifacts. Primer 18sRNA was used to normalize the obtained results and
was performed as a proportional gene quantification using the 2-ΔΔCT
method (Livak and Schmittgen, 2001).
2.7. Statistical analysis
The normality and homogeneity of variance of data were tested by
the Shapiro-Wilk and Levene tests, respectively. Serum biochemicals,
oxidative stress biomarkers, and hepatic HSPs mRNA expression were
statistically analyzed using SAS (version 9.2) and were exhibited as
mean ± SE. The difference among stoking densities was detected using a
one-way Analysis of Variance (ANOVA), followed by a Tukey post-hoc
test. A statistically significant difference was considered at P < 0.05.
3. Results
3.1. Serum biochemistry parameters
I. punctatus reared in HSD exhibited increased cortisol levels at a rate
of 1.7 times, followed by MSD that incremented by a rate of 1.3 times
compared with fish reared in LSD (P = 0.001; Fig. 1A). In terms of TP
and GLB levels, fish stocked in HSD had a significant increase (33.40 and
29.89 g L− 1, respectively) compared to LSD (29.56 and 27.44 g L− 1,
Table 1
The Sequence of primers of I. punctatus used in this experiment.
Target Primer Sequence (5ˊ - 3ˊ) PCR Accession
gene product number
length
F:
119
GTTCCCCAGATTGAGGTCACAT
hsp70 XM017489684.1
R:
TCAATGTCCTCCTTGCTGAGAC
F:
112
GTACCTGAACTTCATCCGTGGT
hsp90
R:
NM001329313.1
GAGCTCAGCAAACAGTTCCAAG
F:
169
18sRNA AAAGGATTGACAGATTGATAGC NC030416.1
R: GCCCTCTAAGAAGTTGGACGC
3
Aquaculture 557 (2022) 738329
respectively) and MSD (30.56 and 28.11 g L− 1, respectively) (P = 0.026
and 0.0342, respectively; Fig. 1B, C). Similarly, ALP activity was
augmented with increasing SD (LSD, MSD, and HSD: 45.01, 54.10, and
55.41 U L− 1, respectively) (P = 0.0001; Fig. 1E). No significant differ­
ence was detected in ALB values among different SDs (P = 0.1784;
Fig. 1D).
3.2. Antioxidant defense system
The effect of various SDs on the oxidative stress biomarkers of
I. punctatus is displayed in Table 2. No significant differences were
observed in T-AOC levels or T-SOD and GPx activities among various
SDs (P = 0.1108, 0.6614, and 0.8087, respectively). With increasing SD,
MDA concentration, CAT activity, and NO content were significantly
incremented (P = 0.0065, 0.0346, and 0.0002 respectively).
3.3. Immunological parameters
Fish reared in HSD were higher in LZM activity at a rate of 1.22 times
more than fish in either LSD or MSD (P = 0.0005; Fig. 2A). IgM content
was significantly increased at a rate of 6.55 times compared to both MSD
(2.18 times) and LSD (P = 0.0001; Fig. 2b). However, fish reared in both
MSD and HSD recorded an increase in C3 content at rates of 3.75 and
3.88 times, respectively, compared to those reared in LSD (P = 0.01;
Fig. 2C).
3.4. Hepatic HSPs mRNA expressions
Hepatic hsp70 and hsp90 mRNA expression decreased significantly
with increasing SD (P = 0.0001 and 0.0009, respectively; Fig. 3).
I. punctatus reared in LSD exhibited significantly higher hepatic mRNA
expression of hsp70 and hsp90 (2.18 and 1.64, respectively) than MSD
(1.12 and 0.95, respectively) and HSD (0.75 and 1.04, respectively).
4. Discussion
Cortisol levels in many fish species reared under RAS conditions
increased with increasing SD (Jia et al., 2016; Long et al., 2019;
Shourbela et al., 2021). Likewise, in channel catfish, Ainsworth et al.
(1985) indicated increased cortisol concentration with increased pond
stocking density. These results are like those obtained in our study.
During 60-days, the results appeared to show that increasing SD caused
the significant cortisol level, pointing to exposure of I. punctatus to
chronic stress. The stress induced by increasing SD could be related to
fish crowding, which intensifies competition for food and space among
individuals (Salas-Leiton et al., 2010). Wilson and Roys (1994) discov­
ered that aggressive behaviors of channel catfish when competing for
food, shelter, and space, as a results of increased density (HSD), were
associated with elevated cortisol levels. These behaviors contributed to
energy depletion, which is reflected in the decrease in growth observed
in our previous study (Refaey et al., 2018). Furthermore, increased
cortisol levels help to achieve homeostasis by stimulating metabolic
changes including an increase in serum glucose, triglyceride, and total
cholesterol levels, as well as decreased muscular fat content (Refaey
et al., 2018) to produce more energy to deal with stress (Yang et al.,
2020). Conversely, cortisol levels decreased with increasing stocking
density in thick-lipped grey mullet, Chelon labrosus and patagonian
blennie, Eleginops maclovinus ((De Las Heras et al., 2015; Oyarzún et al.,
2020). The discrepancies observed in previous studies of cortisone levels
under different SDs could be attributed to fish species, physiological
reactions of fish, stress exposure duration, and experimental conditions.
Serum TP can be used as an indicator of fish health when cultured at
various SDs (Zahedi et al., 2019). In this study, serum TP and GLB levels
of fish reared in HSD were higher than those in LSD or MSD. This in­
dicates that fish are increasing serum proteins in an attempt to overcome
increasing SD stress. Incremented TP may be linked to an increase in
M.M. Refaey et al. Aquaculture 557 (2022) 738329

A 60 B a
35 b
a b
50
30
b
Cortisol (ng mL-1)
40 25

TP (g L-1)
c 20
30
15
20
10
10 5

0 0
LSD MSD HSD LSD MSD HSD

C a D 3.0
30 b ab
2.5
25
2.0
GLB (g L-1)

ALB (g L-1)
20
1.5
15
1.0
10

5 0.5

0 0.0
LSD MSD HSD LSD MSD HSD

E 60 a a

50 b
ALP (U L-1)

40

30

20

10

0
LSD MSD HSD

Fig. 1. Effect of stocking density on serum biochemistry parameters (A) cortisol, (B) total protein (TP), (C) globulin (GLB), (D) albumin (ALB), and (E) alkaline
phosphatase activity (ALP) of I. punctatus. Vertical bars indicate standard error; mean with different letters indicate significant difference between groups (P < 0.05).
LSD, low stocking density; MSD, medium stocking density; HSD, high stocking density.

immunological proteins such as LZM, IgM, and C3 that the body pro­
duces in response to the stress of increasing SD (Ni et al., 2014b), as
observed in our study, indicating that I. punctuates the ability to survive
in HSD. The same consequence was observed in juvenile Amur sturgeon,
Acipenser schrenkii (Ni et al., 2014a), blunt snout bream, Megalobrama
amblycephala (Qi et al., 2016), and common carp, Cyprinus carpio
(Hoseini et al., 2019). ALP is one of the most important enzymes that
plays a vital role in the metabolism and the nutrient absorption process,
as well as enhances disease resistance by increasing the phagocytosis
process of pathogens (Xing et al., 2002). In this study, HSD increased
ALP activity in fish. ALP affects reducing stress and increases the fish's
ability to resist stress. ALP works to protect fish from infection during
the stages of injury healing and parasite infections (Iger and Abraham,
1990; Ross et al., 2000). In Asian sea bass (Lates calcarifer), Atlantic
salmon (Salmo salar), and M. amblycephala, the activity of plasma ALP
significantly incremented with increasing SD (Sadhu et al., 2014; Liu
et al., 2015; Qi et al., 2016). These results appear to some extent in
contradiction with the results obtained in our previous study (Refaey

4
M.M. Refaey et al. Aquaculture 557 (2022) 738329

Table 2 T-SOD and GSH-PX were not affected by different SDs, which might be
The biomarkers of oxidative stress of I. punctatus reared at different stocking attributed to the ability of I. punctatus to resist stress caused by increased
densities (Mean ± SE). SD. The same results were observed in S. senegalensis by Andrade et al.
Parameters Experimental groups (2015). However, several researchers found the negative impact of HSD
LSD MSD HSD
on T-SOD activity and GSH content (Liu et al., 2016), the concentration
of T-AOC, and the activities of GSH-PX, and CAT (Sahin et al., 2014;
T-AOC (U mL− 1) 5.41 ± 0.24 6.51 ± 0.60 6.45 ± 0.16
Andrade et al., 2015; Yarahmadi et al., 2016). In contrast, Yang et al.
T-SOD (U mL− 1) 28.57 ± 0.90 29.59 ± 0.77 28.91 ± 0.71
GSH-PX (U mgprot− 1) 468.2 ± 8.02 483.5 ± 31.27 486.6 ± 17.64 (2020) recently stated that T-AOC and the antioxidant enzymes (SOD
CAT (U mL− 1) 2.48 ± 0.50b 2.58 ± 0.34b 4.37 ± 0.66a and GSH-PX) significantly increased with increasing SD of T. ovatus. The
MDA (nmol L− 1) 7.07 ± 0.49b 9.65 ± 0.50a 9.45 ± 0.61a differences in the adaptive responses of the antioxidant system observed
NO (μmol L− 1) 3.67 ± 0.32c 6.47 ± 0.29b 8.55 ± 0.99a in previous studies can be attributed to the fish species, the degree of
Mean in the same row having different letters are significantly different (P < stress, and the duration of exposure to the stress. Meanwhile, CAT ac­
0.05). LSD, low stocking density; MSD, medium stocking density; HSD, high tivity increased with increasing SD, indicating exposure of fish to an
stocking density; T-AOC, total antioxidant capacity; T-SOD, total superoxide increase in ROS like H2O2. The elevated activity of CAT works to elim­
dismutase; GSH-PX, glutathione peroxidase; CAT, catalase; MDA, malonalde­ inate H2O2 by converting it to H2O and O2 (Paital et al., 2011), which
hyde; NO, nitric oxide. reduces the harmful effect of H2O2. These findings are consistent with
those by Andrade et al. (2015) and Yang et al. (2020). In the current
et al., 2018), which indicated increasing growth in LSD compared to study, the increase in the MDA level of I. punctatus that was reared in
HSD. At the same time, in this study, immune parameters improved, MSD and HSD compared to those reared in LSD, suggests that lipid
such as serum proteins and immune enzymes, in HSD compared to LSD. peroxidation occurred. MDA is a final product of lipid peroxidation re­
This could be due to the increasing stocking density that stimulates the actions. This may be related to the formation of ROS like H2O2, which
immune system to overcome high-density stress. stimulates lipid peroxides and is also an indicator of cellular damage.
Under increased SD, the relationship between ROS and antioxidant According to the report by Sahin et al. (2014), stress caused by increased
systems is imbalanced, which causes oxidative stress in fish (Jia et al., SD accelerated the production of ROS, attacking polyunsaturated fatty
2016). In the present study, the concentration of T-AOC and activities of acids in cell membranes and causing lipid peroxidation.

A 45 B 9 a
a
40 8
35 b 7
b
30 6
LZM (µg mL-1)

IgM (g L-1)

25 5
20 4
b
15 3
10 2
b
5 1
0 0
LSD MSD HSD LSD MSD HSD

C 14

12 a a

10
C3 (g L-1)

4 b

0
LSD MSD HSD

Fig. 2. Immune parameters (A) lysozyme activity (LZM), (B) immunoglobin M (IgM), and (C) complement 3 (C3) of I. punctatus reared at different stocking densities.
Vertical bars indicate standard error; different letters denote significant differences between groups (P < 0.05). LSD, low stocking density; MSD, medium stocking
density; HSD, high stocking density.

5
M.M. Refaey et al.
LSD MSD HSD
2.50
a signaling. Other studies indicated that hsp70 mRNA levels significantly
Relative mRNA experssion
2.00
a
1.50
b
b
b
1.00
c 5. Conclusion
0.50
0.00
HSP70 HSP90
Fig. 3. Qualitative expression analysis of hepatic HSPs (HSP70and HSP90)
mRNA investigated by RT-PCR in I. punctatus reared at different stoking den­
sities. Vertical bars indicate standard error; different letters denote significant
difference between groups (P < 0.05). LSD, low stoking density; MSD, medium
stoking density; HSD, high stoking density.
NO in animals is an endogenous regulatory molecule contributing to
many biological activity regulations. Some studies have revealed the
impact of nitric oxide on increasing the ability to withstand stressful
conditions such as external ammonia (Choudhury and Saha, 2012;
Kumari et al., 2019) and transport (Refaey and Li, 2018). Both Choud­
hury and Saha (2012) and Refaey and Li (2018) demonstrated that nitric
oxide plays a significant role in dealing with environmental stress.
Shourbela et al. (2021) found that Nile tilapia, Oreochromis niloticus,
reared under HSD, showed a lower NO level in tissue. However, NO
levels significantly increased with increasing SD of I. punctatus, indi­
cating that the fish's ability to cope with stress was enhanced through
increased blood supply to different body organs to meet the growing
demand for oxygen and energy under higher SD.
LZM is one of the diverse anti-microbial proteins and contributes to
an effective role in the bio-defense system in fish (Saurabh and Sahoo,
2008). According to the results of our study, LZM activity incremented
with increasing SD. The increment of LZM activity reflects enhancing the
immunity of fish to cope with the stress of HSD. The same results were
observed in some fish species reared in HSD (Caruso et al., 2005; Telli
et al., 2014; Hoseini et al., 2019). However, some species showed a
converse trend (Sadhu et al., 2014; Yousefi et al., 2016; Liu et al., 2019).
In S. senegalensis, different SDs had no effect on LZM activity (Andrade
et al., 2015). Contradictory results obtained in previous studies may be
due to the affected LZM activity due to numerous factors, such as fish
species, fish size, and the degree and duration of stress (Yildiz, 2006).
Concerning IgM and C3 contents, which followed the same pattern as
LZM activity, a significant increase was achieved by increasing SD. The
enhancement of these parameters could be an attempt to overcome the
adverse effects of increased SD. In contrast, some studies indicated that
increased SD suppressed IgM and reduced the alternative complement
pathway (ACP) of several fish species (Costas et al., 2013; Liu et al.,
2015; Yarahmadi et al., 2016). The differences between the current
study and previous studies could be attributed to differences in immune
responses of different fish species, as well as experimental conditions
such as the duration of stress exposure and degree of intensification.
In the current study, HSD led to an adverse effect on hepatic hsp70
and hsp90 mRNA levels. The same findings were observed in
S. senegalensis and E. maclovinus reared in HSD conditions (Salas-Leiton
et al., 2010; Oyarzún et al., 2020), explaining that it may be due to the
increased cortisol level inhibiting hsp70 expression. This explanation
supports the findings herein. Additionally, the decrease in hsp70 and
hsp90 may be due to their consumption to protect the fish body from
damage produced by HSD chronic stress. Neckers and Ivy (2003)
6
Aquaculture 557 (2022) 738329
exhibited that hsp70 is primarily involved in the recovery of stress-
induced protein abnormalities, whereas hsp90 is necessary for cell
increased with increasing SD (Liu et al., 2016; Yarahmadi et al., 2016;
Liu et al., 2019; Zahedi et al., 2019; Yang et al., 2020). Notable differ­
ences among previous studies in the hsp70 mRNA levels could be due to
variations in the physiological responses of different fish species and the
duration of exposure to the stresses.
This study demonstrated that increased SD caused chronic stress on
I. punctatus. A significant increase in some immunological parameters
occurred in the I. punctatus suffering from crowding stress, suggesting
that I. punctatus could have the ability to cope with the stress of
increased density. Moreover, more studies should be carried out to
determine the appropriate density on a commercial scale and to reduce
the undesirable effects of increasing SD on the productivity of
I. punctatus.
CRediT author statement
Mohamed M. Refaey: experimental design, culturing fish, samples
collection, data analysis, and writing manuscript. Xing Tian and Kom­
maly Onxayvieng: culturing fish and collecting samples. Dapeng Li:
experimental design, funding acquisition, writing - review & editing.
Rong Tang: experimental design and data analysis.
Author statement
Mohamed M. Refaey: experimental design, culturing fish, samples
collection, data analysis, and writing manuscript.
Xing Tian and Kommaly Onxayvieng: culturing fish and collecting
samples.
Dapeng Li: experimental design, funding acquisition, writing - re­
view & editing.
Rong Tang: experimental design and data analysis.
Declaration of Competing Interest
There are no conflicts of interest.
Acknowledgement
This research was supported by the National Key Research and
Development Program of China (2019YFD0900303), supported by the
Earmarked Fund for China Agriculture Research System (CARS-45-24),
the National Natural Foundation of China (31502140), and the Coor­
dinated Promotion Program of Green and High-Quality Aquaculture
Technology in Hubei Province. We thank Dr. Qing Xiao for her valuable
work in laboratory management and biological measurement.
References
AFS, 2014. American Fisheries Society 2014. Guidelines for the Use of Fishes in
Research, Library of Congress Control Number 2014943876, ISBN 978–1–934874-
39-4. American Fisheries Society Web site address. www.fisheries.org.
Ainsworth, A.J., Bowser, P.R., Beleau, M.H., 1985. Serum cortisol levels in channel
catfish, from production ponds. Prog. Fish-Cult. 47 (3), 176–181. https://doi.org/
10.1577/1548-8640(1985)47<176:SCLICC>2.0.CO;2.
Allen, K.O., 1974. Effects of stocking density and water exchange rate on growth and
survival of channel catfish Ictalurus punctatus (Rafinesque) in circular tanks.
Aquaculture 4, 29–39. https://doi.org/10.1016/0044-8486(74)90016-7.
Andrade, T., Afonso, A., Pérez-Jiménez, A., Oliva-Teles, A., de Las Heras, V., Mancera, J.
M., Costas, B., 2015. Evaluation of different stocking densities in a Senegalese sole
(Solea senegalensis) farm: implications for growth, humoral immune parameters, and
oxidative status. Aquaculture 438, 6–11. https://doi.org/10.1016/j.
aquaculture.2014.12.034.
M.M. Refaey et al.
Anras, M.L.B., Lagardere, J.P., 2004. Measuring cultured fish swimming behaviour: first
results on rainbow trout using acoustic telemetry in tanks. Aquaculture 240,
175–186. https://doi.org/10.1016/j.aquaculture.2004.02.019.
Bosworth, B., Ott, B., Torrans, L., 2015. Effects of stocking density on production traits of
channel catfish × blue catfish hybrids. N. Am. J. Aquac. 77, 437–443. https://doi.
org/10.1080/15222055.2015.1024363.
Bowden, T.J., 2008. Modulation of the immune system of fish by their environment. Fish
Shellfish Immunol. 25, 373–383. https://doi.org/10.1016/j.fsi.2008.03.017.
Braun, N., de Lima, R.L., Baldisserotto, B., Dafre, A.L., de Oliveira Nuñer, A.P., 2010.
Growth, biochemical and physiological responses of Salminus brasiliensis with
different stocking densities and handling. Aquaculture 301, 22–30. https://doi.org/
10.1016/j.aquaculture.2010.01.022.
Bureau, C., 2013. China Fisheries Yearbook. Chinese Agriculture Express, Beijing (In
Chinese).
Caruso, G., Genovese, L., Maricchiolo, G., Modica, A., 2005. Haematological,
biochemical, and immunological parameters as stress indicators in Dicentrarchus
labrax and Sparus aurata farmed in off-shore cages. Aquac. Int. 13, 67–73. https://
doi.org/10.1007/s10499-004-9031-5.
Choudhury, M.G., Saha, N., 2012. Influence of environmental ammonia on the
production of nitric oxide and expression of inducible nitric oxide synthase in the
freshwater air-breathing catfish (Heteropneustes fossilis). Aquat. Toxicol. 116-117,
43–53. https://doi.org/10.1016/j.aquatox.2012.03.006.
Costas, B., Aragão, C., Mancera, J.M., Dinis, M.T., Conceição, L.E., 2008. High stocking
density induces crowding stress and affects amino acid metabolism in Senegalese
sole Solea senegalensis (Kaup 1858) juveniles. Aquac. Res. 39, 1–9. https://doi.org/
10.1111/j.1365-2109.2007.01845.x.
Costas, B., Aragao, C., Dias, J., Afonso, A., Conceição, L.E.C., 2013. Interactive effects of
a high-quality protein diet and high stocking density on the stress response and some
innate immune parameters of Senegalese sole Solea senegalensis. Fish Physiol.
Biochem. 39, 1141–1151. https://doi.org/10.1007/s10695-013-9770-1.
De Las Heras, V., Martos-Sitcha, J.A., Yúfera, M., Mancera, J., Martínez-Rodríguez, G.,
2015. Influence of stocking density on growth, metabolism, and stress of thick-lipped
grey mullet (Chelon labrosus) juveniles. Aquaculture 448, 29–37. https://doi.org/
10.1016/j.aquaculture.2015.05.033.
Ellis, T., Yildiz, H.Y., López-Olmeda, J., Spedicato, M.T., Tort, L., Øverli, Ø., Martins, C.I.
M., 2012. Cortisol and finfish welfare. Fish Physiol. Biochem. 38, 163–188. https://
doi.org/10.1007/s10695-011-9568-y.
Goos, H.J.T., Consten, D., 2002. Stress adaptation, cortisol, and pubertal development in
the male common carp, Cyprinus carpio. Mol. Cell. Endocrinol. 197, 105–116.
https://doi.org/10.1016/s0303-7207(02)00284-8.
Green, B.W., 2010. Effect of channel catfish stocking rate on yield and water quality in an
intensive, mixed suspended-growth production system. N. Am. J. Aquac. 72 (2),
97–106. https://doi.org/10.4172/2155-9546.1000314.
Green, B.W., McEntire, M.E., 2017. Comparative water quality and channel catfish
production in earthen ponds and a biofloc technology production system. J. Appl.
Aquac. 29 (1), 1–15. https://doi.org/10.1080/10454438.2016.1261751.
Green, B.W., Schrader, K.K., 2015. Effect of stocking large channel catfish in a biofloc
technology production system on production and incidence of common microbial
off-flavor compounds. J. Aquac. Res. Development 6 (3), 314. https://doi.org/
10.4172/2155-9546.1000314.
Hoseini, S.M., Yousefi, M., Hoseinifar, S.H., Doan, H.V., 2019. Effects of dietary arginine
supplementation on growth, biochemical, and immunological responses of common
carp (Cyprinus carpio L.), stressed by stocking density. Aquaculture 503, 452–459.
https://doi.org/10.1016/j.aquaculture.2019.01.031.
Iger, Y., Abraham, M., 1990. The process of skin healing in experimentally wounded
carp. J. Fish Biol. 36, 421–437. https://doi.org/10.1111/j.1095-8649.1990.
tb05622.x.
Ito, K., Chen, J., Khodadadian, J.J., Seshan, S.V., Eaton, C., Zhao, X., Felsen, D., 2004.
Liposome-mediated transfer of nitric oxide synthase gene improves renal function in
ureteral obstruction in rats. Kidney Int. 66, 1365–1375. https://doi.org/10.1111/
j.1523-1755.2004.00899.x.
Jia, R., Liu, B.L., Han, C., Huang, B., Lei, J.L., 2016. Influence of stocking density on
growth performance, antioxidant status, and physiological response of juvenile
turbot, Scophthalmus maximu, reared in land-based recirculating aquaculture system.
J. World Aquacult. Soc. 47 (4), 587–599. https://doi.org/10.1111/jwas.12295.
Kumari, S., Choudhury, M.G., Saha, N., 2019. Hyper-ammonia stress causes induction of
inducible nitric oxide synthase gene and more production of nitric oxide in air-
breathing Magur catfish, Clarias magur (Hamilton). Fish Physiol. Biochem. 45,
907–920. https://doi.org/10.1007/s10695-018-0593-y.
Li, M.H., Mannning, B.B., Robinson, E.H., Bosworth, B.G., 2003. Effect of dietary protein
concentration and stocking density on production characteristics of pond-raised
channel catfish Ictalurus punctutus. J. World Aquac. Soc. 34 (2), 147–155. https://
doi.org/10.1111/j.1749-7345.2003.tb00051.x.
Li, D., Liu, Z.D., Xie, C.X., 2012. Effect of stocking density on growth and serum
concentrations of thyroid hormones and cortisol in Amur sturgeon, Acipenser
schrenckii. Fish Physiol. Biochem. 38, 511–520. https://doi.org/10.1007/s10695-
011-9531-y.
Liu, B., Liu, Y., Wang, X., 2015. The effect of stocking density on growth and seven
physiological parameters with assessment of their potential as stress response
indicators for the Atlantic salmon (Salmo salar). Mar. Freshw. Behav. Physiol. 48,
177–192. https://doi.org/10.1080/10236244.2015.1034956.
Liu, B., Jia, R., Han, C., Huang, B., Lei, J., 2016. Effects of stocking density on antioxidant
status, metabolism, and immune response in juvenile turbot (Scophthalmus maximus).
Comp. Biochem. Physiol. C 190, 1–8. https://doi.org/10.1016/j.cbpc.2016.07.007.
Liu, G., Ye, Z., Liu, D., Zhao, J., Sivaramasamy, E., Deng, Y., Zhu, S., 2018. Influence of
stocking density on growth, digestive enzyme activities, immune responses,
7
Aquaculture 557 (2022) 738329
antioxidant of Oreochromis niloticus fingerlings in biofloc systems. Fish Shellfish
Immunol. 81, 416–422. https://doi.org/10.1016/j.fsi.2018.07.047.
Liu, B., Fei, F., Li, X., Wang, X., Huang, B., 2019. Effects of stocking density on stress
response, innate immune parameters, and welfare of turbot (Scophthalmus maximus).
Aquacult. Int. 27, 1599–1612. https://doi.org/10.1007/s10499-019-00413-2.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2-ΔΔCт method. Methods 25, 402–408. https://doi.
org/10.1006/meth.2001.1262.
Long, L., Zhang, H., Ni, Q., Liu, H., Wu, F., Wang, X., 2019. Effects of stocking density on
growth, stress, and immune responses of juvenile Chinese sturgeon (Acipenser
sinensis) in a recirculating aquaculture system. Comp. Biochem. Physiol. C Toxicol.
Pharmacol. 219, 25–34. https://doi.org/10.1016/j.cbpc.2019.02.002.
Lupatsch, I., Santos, G.A., Schrama, J.W., 2010. Effect of stocking density and feeding
level on energy expenditure and stress responsiveness in European sea bass
Dicentrarchus labrax. Aquaculture 298, 245–250. https://doi.org/10.1016/j.
aquaculture.2009.11.007.
Neckers, L., Ivy, S.P., 2003. Heat shock protein 90. Curr. Opin. Oncol. 15 (6), 419–424.
https://doi.org/10.1097/00001622-200311000-00003.
Ni, M., Wen, H., Li, J., Chi, M., Ren, Y., Song, Z., Ding, H., 2014a. Two HSPs gene from
juvenile Amur sturgeon (Acipenser schrenckii): cloning, characterization, and
expression pattern to crowding and hypoxia stress. Fish Physiol. Biochem. 40,
1801–1816. https://doi.org/10.1007/s10695-014-9969-9.
Ni, M., Wen, H., Li, J., Chi, M., Bu, Y., Ren, Y., Ding, H., 2014b. The physiological
performance and immune response of juvenile Amour sturgeon (Acipenser schrenkii)
to stocking density and hypoxia stress. Fish Shellfish Immunol. 36, 325–335. https://
doi.org/10.1016/j.fsi.2013.12.002.
Onxayvieng, K., Piria, M., Fuka, M.M., Gavrilović, A., Liang, X., Liu, L., Li, D., 2021. High
stocking density alters growth performance, blood biochemical profiles, and hepatic
antioxidative capacity in gibel carp (Carassius gibelio). Fish Physiol. Biochem. 47,
203–212. https://doi.org/10.1007/s10695-020-00905-6.
Oyarzún, R., Paredes, R., Saravia, J., Morera, F.J., Muñoz, J.L.P., Ruiz-Jarabo, I., Vargas-
Chacoff, L., 2020. Stocking density affects the growth performance, intermediary
metabolism, osmoregulation, and response to stress in patagonian blennie Eleginops
maclovinus. Aquaculture 515, 734–744. https://doi.org/10.1016/j.
aquaculture.2019.734565.
Paital, B., Kumar, S., Farmer, R., Tripathy, N.K., Chainy, G.B.N., 2011. In silico
prediction and characterization of 3D structure and binding properties of catalase
from the commercially important crab, Scylla serrate. Interdiscip. Sci. Comput. Life
Sci. 3, 1913–2751. https://doi.org/10.1007/s12539-011-0071-z.
Qi, C., Xie, C., Tang, R., Qin, X., Wang, D., Li, D., 2016. Effect of stocking density on
growth, physiological responses, and body composition of juvenile blunt snout
bream, Megalobrama amblycephala. J. World Aquacult. Soc. 47, 358–368. https://
doi.org/10.1111/jwas.12278.
Refaey, M.M., Li, D., 2018. Transport stress changes blood biochemistry, antioxidant
defense system, and hepatic HSPs mRNA expressions of channel catfish Ictalurus
punctatus. Front. Physiol. 9, 1628. https://doi.org/10.3389/fphys.2018.01628.
Refaey, M.M., Li, D., Tian, X., Zhang, Z., Zhang, X., Li, L., Tang, R., 2018. High stocking
density alters growth performance, blood biochemistry, intestinal histology, and
muscle quality of channel catfish Ictalurus punctatus. Aquaculture 492, 73–81.
https://doi.org/10.1016/j.aquaculture.2018.04.003.
Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins
(chaperones) in fish and shellfish and their potential role in relation to fish health: a
review. J. Fish Dis. 33, 789–801. https://doi.org/10.1111/j.1365-2761.2010.01183.
x.
Ross, N.W., Firth, K.J., Wang, A., Burka, J.F., Johnson, S.C., 2000. Changes in hydrolytic
enzyme activities of naïve Atlantic salmon Salmo salar skin mucus due to infection
with the salmon louse Lepeophtheirus salmonis and cortisol implantation. Dis. Aquat.
Org. 41, 43–51. https://doi.org/10.3354/dao041043.
Sadhu, N., Sharma, S.R.K., Joseph, S., Dube, P., Philipose, K.K., 2014. Chronic stress due
to high stocking density in open sea cage farming induces variation in biochemical
and immunological functions in Asian seabass (Lates calcarifer, Bloch). Fish Physiol.
Biochem. 40, 1105–1113. https://doi.org/10.1007/s10695-014-9909-8.
Sahin, K., Yazlak, H., Orhan, H., Tuzcu, M., Akdemir, F., Sahin, N., 2014. The effect of
lycopene on antioxidant status in rainbow trout (Oncorhynchus mykiss) reared under
high stocking density. Aquaculture 418–419, 132–138. https://doi.org/10.1016/j.
aquaculture.2013.10.009.
Salas-Leiton, E., Anguis, V., Martín-Antonio, B., Crespo, D., Planas, J.V., Infante, C.,
Manchado, M., 2010. Effects of stocking density and feed ration on growth and gene
expression in the Senegalese sole (Solea senegalensis): potential effects on the immune
response. Fish Shellfish Immunol. 28, 296–302. https://doi.org/10.1016/j.
fsi.2009.11.006.
Sangiao-Alvarellos, S., Guzmán, J.M., Láiz-Carrión, R., Míguez, J.M., Del Río, M.P.M.,
Mancera, J.M., Soengas, J.L., 2005. Interactive effects of high stocking density and
food deprivation on carbohydrate metabolism in several tissues of gilthead sea
bream Sparus auratus. J. Exp. Zool. A Comp. Exp. Biol. 303, 761–775. https://doi.
org/10.1002/jez.a.203.
Saurabh, S., Sahoo, P.K., 2008. Lysozyme: an important defense molecule of fish innate
immune system. Aquac. Res. 39, 223–239. https://doi.org/10.1111/j.1365-
2109.2007.01883.x.
Shourbela, R.M., El-Hawarry, W.N., Elfadadny, M.R., Dawood, M.A.O., 2021. Oregano
essential oil enhanced the growth performance, immunity, and antioxidative status
of Nile tilapia (Oreochromis niloticus) reared under intensive systems. Aquaculture
542, 736868. https://doi.org/10.1016/j.aquaculture.2021.736868.
Telli, G.S., Ranzani-Paiva, M.J.T., de Carla Dias, D., Sussel, F.R., Ishikawa, C.M.,
Tachibana, L., 2014. Dietary administration of Bacillus subtilis on hematology and
non-specific immunity of Nile tilapia Oreochromis niloticus raised at different stocking
M.M. Refaey et al.
densities. Fish Shellfish Immunol. 39, 305–311. https://doi.org/10.1016/j.
fsi.2014.05.025.
Torrans, E.L., 2005. Effect of oxygen management on culture performance of channel
catfish in earthen ponds. N. Am. J. Aquac. 67 (4), 275–288. https://doi.org/
10.1577/A04-071.1.
Torrans, E.L., 2008. Production responses of channel catfish to minimum daily dissolved
oxygen concentrations in earthen ponds. N. Am. J. Aquac. 70 (4), 371–381. https://
doi.org/10.1577/A07-102.1.
Trenzado, C.E., Morales, A.E., Palma, J.M., de la Higuera, M., 2009. Blood antioxidant
defenses and hematological adjustments in crowded/uncrowded rainbow trout
(Oncorhynchus mykiss) fed on diets with different levels of antioxidant vitamins and
HUFA. Comp. Bioch. chem. Physiol. C 149 (3), 440–447. https://doi.org/10.1016/j.
cbpc.2008.10.105.
Wellborn, T.L., 1988. Channel Catfish, Life history and Biology. Southern Regional
Aquaculture Centre, (SRAC) Publication No. 180.
Wilson, J.L., Roys, L.L., 1994. Behavioral interactions in juvenile channel catfish,
Ictalurus punctatus. J. Appl. Aquac. 3 (3–4), 363–382. https://doi.org/10.1300/
J028v03n03_12.
Wyatt, T., Barkoh, A., Matinez, J., Sparrow, R., 2006. Guidelines for the Culture of Blue
and Channel Catfish. Texas Parks and Wildlife Department Inland Fisheries Division.
Xing, J., Zhan, W.B., Zhou, L., 2002. Endoenzymes associated with haemocyte types in
the scallop (Chlamys farreri). Fish Shellfish Immunol. 13, 271–278. https://doi.org/
10.1006/fsim.2001.0402.
Aquaculture 557 (2022) 738329
Yang, Q., Guo, L., Liu, B., Guo, H., Zhu, K., Zhang, N., Zhang, D., 2020. Effects of stocking
density on the growth performance, serum biochemistry, muscle composition and
HSP70 gene expression of juvenile golden pompano Trachinotus ovatus (Linnaeus,
1758). Aquaculture 518, 734–741. https://doi.org/10.1016/j.
aquaculture.2019.734841.
Yarahmadi, P., Miandare, H.K., Fayaz, S., Caipang, C.M.A., 2016. Increased stocking
density causes changes in expression of selected stress- and immune-related genes,
humoral innate immune parameters, and stress responses of rainbow trout
(Oncorhynchus mykiss). Fish Shellfish Immunol. 48, 43–53. https://doi.org/10.1016/
j.fsi.2015.11.007.
Yildiz, H.Y., 2006. Plasma lysozyme levels and secondary stress response in rainbow
trout, Oncorhynchus mykiss (Walbaum) after exposure to Leteux-Meyer mixture.
Turk. J. Vet. Anim. Sci. 30, 265–269.
Yousefi, M., Paktinat, M., Mahmoudi, N., Pérez-Jiménez, A., Hoseini, S.M., 2016. Serum
biochemical and non-specific immune responses of rainbow trout (Oncorhynchus
mykiss) to dietary nucleotide and chronic stress. Fish Physiol. Biochem. 42,
1417–1425. https://doi.org/10.1007/s10695-016-0229-z.
Zaccone, G., Mauceri, A., Fasulo, S., 2006. Neuropeptides and nitric oxide synthase in the
gill and the air-breathing organs of fishes. J. Exp. Zool. 305A, 428–439. https://doi.
org/10.1002/jez.a.267.
Zahedi, S., Akbarzadeh, A., Mehrzad, J., Noori, A., Harsij, M., 2019. Effect of stocking
density on growth performance, plasma biochemistry and muscle gene expression in
rainbow trout (Oncorhynchus mykiss). Aquaculture 498, 271–278. https://doi.org/
10.1016/j.aquaculture.2018.07.044.