210104 박사학위논문 서슬아 제본전

Thesis for the Degree of Doctor of Philosophy
Thymus vulgaris L. ameliorated atopic dermatitis

symptoms through controlling histamine release
Seul A Seo
Graduate School of Biotechnology

Kyung Hee University
Seoul, Korea
February, 2021
Seul A Seo
Graduate School of Biotechnology

Kyung Hee University
Seoul, Korea
February, 2021
by
Seul A Seo
Advised by
Prof. Tae - Hoo Yi, O.M.D., Ph.D.
Submitted to the Graduate School of Biotechnology and the Faculty of the

Graduate School of Kyung Hee University in the partial fulfillment of
the requirements for degree of Doctor of Philosophy
Dissertation Committee :
Chairman Yeon Ju Kim
Tong Ho Kang
Se Chan Kang
Eunson Hwang
Tae-Hoo Yi
Contents
List of Table.......................................................................................................................
List of Figure.................................................................................................................... ⅷ
Abbreviations.....................................................................................................................
Abstracts...........................................................................................................................
Ⅰ. Introduction.........................................................................................................
1. Thymus vulgaris L.......................................................................................................1
2. Atopic dermatitis.........................................................................................................8
2.1. Epidemiology of atopic dermatitis..........................................................................9
2.2. Causes of atopic dermatitis.....................................................................................9
2.3. Diagnosis of atopic dermatitis based on clinical features......................................10
2.4. Pathogenesis of atopic dermatitis.........................................................................11
2.4.1. Imbalance of Th1/Th2 immune response.......................................................
2.4.2. Skin barrier dysfunction.................................................................................
2.5. Itching in atopic dermatitis...................................................................................15
2.5.1. Role of histamine in itching...........................................................................
2.5.2. Psychological stress and itching.....................................................................
3. Mechanism of atopic dermatitis...............................................................................24
3.1. Mast cells activation.............................................................................................24
i
3.2. Inflammatory response in keratinocytes...............................................................28
4. Therapeutic agents of atopic dermatitis and allergic response...............................31
4.1. Ketotifen fumarate...............................................................................................33
4.2. Tacrolimus...........................................................................................................34
4.3. Natural products-derived therapeurics..................................................................36
5. Purpose of this study.................................................................................................40
Ⅱ. Materials and Methods ............................................................................................42
1. Materials....................................................................................................................42
2. Sample preparation...................................................................................................43
3. HPLC analysis...........................................................................................................45
4. In vitro study..............................................................................................................46
4.1. Cell culture...........................................................................................................46
4.2. Sample treatment..................................................................................................46
4.3. Measurement of cell viability...............................................................................47
4.4. Measurement of NO production...........................................................................47
4.5. β-hexosaminidase release assay............................................................................48
4.6. Histamine release assay........................................................................................49
4.7. Measurement of intracellular calcium..................................................................49
4.8. Enzyme-linked immunosorbent assay (ELISA)....................................................49
4.9. Reverse transcription-polymerase chain reaction (RT-PCR).................................50
4.10. Western blot analysis.........................................................................................52

ii
5. In vivo study...............................................................................................................53
5.1. Experimental animals...........................................................................................53
5.2. Induction of AD-like skin lesion and topical application......................................53
5.3. Evaluation of AD-like skin symptoms..................................................................54
5.4. Measurement of physiological skin alteration......................................................56
5.4.1. Video scope...................................................................................................56
5.4.2. High resolution ultrasound............................................................................56
5.4.3. Hydration......................................................................................................56
5.4.4. TEWL............................................................................................................57
5.4.5. Erythema.......................................................................................................57
5.5. Evaluation of scratching behavior........................................................................57
5.6. Measurement of serum IgE level..........................................................................58
5.7. Histopathological analysis....................................................................................58
6. Statistical analysis.....................................................................................................59
Ⅲ. Results.......................................................................................................................60
1. The identification of active components from T. vulgaris.......................................60
2. Effects of T. vulgaris on atopic dermatitis and histamine response: in vitro..........63
2.1. Effects of T. vulgaris on atopic dermatitis inflammation in Raw 264.7
cells.........................................................................................................................63
2.1.1. Cell viability..................................................................................................63
iii
2.1.2. NO production...............................................................................................64
2.2. Effects of T. vulgaris on histamine related allergic response in RBL-2H3
cells.......................................................................................................................66
2.2.1. Cell viability..................................................................................................66
2.2.2. β-hexosaminidase release..............................................................................67
2.2.3. Histamine release..........................................................................................68
2.2.4. Intracellular calcium levels............................................................................70
2.2.5. Signaling pathways in histamine release........................................................72
2.2.5.1. CRHR1 and CRHR2 expression.............................................................72
2.2.5.2. phosphorylation of PLCγ........................................................................74
2.2.5.3. phosphorylation of IP3R.........................................................................76
2.2.5.4. calcium channel protein expressions.......................................................78
2.3. Effect of T. vulgaris on atopic dermatitis inflammation in HaCaT
cells.......................................................................................................................80
2.3.1. Cell viability..................................................................................................80
2.3.2. Chemokines production.................................................................................81
2.3.3. mRNA expression of pro-inflammatory cytokines and
chemokines......................................................................................................83
2.3.4. Signaling pathways in inflammatory response...............................................85
2.3.4.1. MAPKs activation..................................................................................85
iv
2.3.4.2. NFκB and STAT1 activation..................................................................87
3. Effects of T. vulgaris on atopic dermatitis and histamine response: in vivo...........90
3.1. Morphological characteristics...............................................................................90
3.1.1. Body weight..................................................................................................90
3.1.2. Spleen weight................................................................................................92
3.1.3. Skin morphology...........................................................................................94
3.2. Physiological characteristics................................................................................97
3.2.1. Skin density...................................................................................................97
3.2.2. Skin hydration...............................................................................................99
3.2.3. TEWL..........................................................................................................100
3.2.4. Erythema index............................................................................................101
3.3. Itching related characteristics.............................................................................103
3.3.1. Scratching behavior.....................................................................................103
3.3.2. Serum IgE level...........................................................................................105
3.3.3. β-hexosaminidase and histamine release......................................................107
3.4. Signaling pathways related atopic dermatitis symptoms.....................................109
3.4.1. CRHR1 and CRHR2 expression..................................................................109
3.4.2. MAPKs activation.......................................................................................111
3.4.3. IκBα and NFκB activation...........................................................................113
3.4.4. Filaggrin expression....................................................................................115
3.5. Histological characteristics.................................................................................117

v
3.5.1. Epidermal thickness.....................................................................................117
3.5.2. Accumulation of mast cells..........................................................................119
Ⅳ. Discussion................................................................................................................121
Ⅴ. Conclusion................................................................................................................134
Ⅵ. References...............................................................................................................135
국 문 초 록 ......................................................................................................................146
vi
List of Table
Table 1. Previous studies of T. vulgaris on biological effects...............................................4
Table 2. Previous studies of components of T. vulgaris on biological effects.......................7
Table 3. Indication and side effects of therapeutic agents...................................................35
Table 4. Previous studies on the effect of natural products in AD.......................................38
Table 5. Previous studies on the effect of natural products in allergic skin
inflammation.................................................................................................................39
Table 6. List of primers for RT-PCR...................................................................................51
Table 7. Symptom indices depending on the severity of AD...............................................55
Table 8. Active components of T. vulgaris..........................................................................62
vii
List of Figure
Figure 1. Acute and chronic phases in AD..........................................................................14
Figure 2. Biosynthesis and metabolism of histamine...........................................................17
Figure 3. Effects of histamine through H1 and H4 receptors in skin allergic
reaction.........................................................................................................................18
Figure 4. Mechanism of mast cells activation.....................................................................27
Figure 5. Mechanism of inflammatory response in keratinocytes........................................30
Figure 6. Preparation of T. vulgaris extract.........................................................................44
Figure 7. HPLC analysis of T. vulgaris, caffeic acid, and rosmarinic acid
standard.........................................................................................................................61
Figure 8. Effects of T. vulgaris on cell viability and NO production in LPS-induced Raw
264.7 cells...........................................................................................................65
Figure 9. Effects of T. vulgaris on cell viability, β-hexosaminidase, and histamine release in
DNP-IgE/BSA-stimulated RBL-2H3 cells...........................................................69
Figure 10. Effects of T. vulgaris on intracellular calcium levels in DNP-IgE/BSA-stimulated
RBL-2H3 cells....................................................................................................71
Figure 11. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DNP-IgE/BSA-
stimulated RBL-2H3 cells...................................................................................73
Figure 12. Effects of T. vulgaris on phosphorylation of PLCγ in DNP-IgE/BSA-stimulated
viii
RBL-2H3 cells....................................................................................................75
Figure 13. Effects of T. vulgaris on phosphorylation of IP3R in DNP-IgE/BSA-stimulated
RBL-2H3 cells....................................................................................................77
Figure 14. Effects of T. vulgaris on expression of calcium channel proteins in
DNP-IgE/BSA-stimulated RBL-2H3 cells...........................................................79
Figure 15. Effects of T. vulgaris on cell viability and chemokines production in TNF-α/IFN-
γ-stimulated HaCaT cells.....................................................................................82
Figure 16. Effects of T. vulgaris on mRNA expression of pro-inflammatory cytokines and
chemokines in TNF-α/IFN-γ-stimulated HaCaT cells..........................................84
Figure 17. Effects of T. vulgaris on activation of MAPKs in TNF-α/IFN-γ-stimulated HaCaT
cells.....................................................................................................................86
Figure 18. Effects of T. vulgaris on NFκB signaling pathway in TNF-α/IFN-γ-stimulated
HaCaT cells.........................................................................................................88
Figure 19. Effects of T. vulgaris on STAT1 signaling pathway in TNF-α/IFN-γ-stimulated
HaCaT cells.........................................................................................................89
Figure 20. Effects of T. vulgaris on body weight in DFE-induced NC/Nga mice................91
Figure 21. Effects of T. vulgaris on spleen weight in DFE-induced NC/Nga
mice.....................................................................................................................93
Figure 22. Effects of T. vulgaris on skin morphology in DFE-induced NC/Nga
ix
mice.....................................................................................................................95
Figure 23. Effects of T. vulgaris on skin density in DFE-induced NC/Nga
mice.....................................................................................................................98
Figure 24. Effects of T. vulgaris on skin hydration, TEWL, and erythema index in DFE-
induced NC/Nga mice.......................................................................................102
Figure 25. Effects of T. vulgaris on scratching behavior in DFE-induced NC/Nga
mice...................................................................................................................104
Figure 26. Effects of T. vulgaris on serum IgE level in DFE-induced NC/Nga
mice...................................................................................................................106
Figure 27. Effects of T. vulgaris on β-hexosaminidase and histamine release in DFE-induced
NC/Nga mice.....................................................................................................108
Figure 28. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DFE-induced
NC/Nga mice.....................................................................................................110
Figure 29. Effects of T. vulgaris on activation of MAPKs in DFE-induced NC/Nga
mice...................................................................................................................112
Figure 30. Effects of T. vulgaris on IκBα and NFκB in DFE-induced NC/Nga
mice...................................................................................................................114
Figure 31. Effects of T. vulgaris on filaggrin expression in DFE-induced NC/Nga
mice...................................................................................................................116
x
Figure 32. Effects of T. vulgaris on epidermal thickness in DFE-induced NC/Nga
mice...................................................................................................................118
Figure 33. Effects of T. vulgaris on accumulation of mast cells in DFE-induced NC/Nga
mice...................................................................................................................120
Figure 34. Inhibitory effects of T. vulgaris on mast cells activation..................................124
Figure 35. Inhibitory effects of T. vulgaris on keratinocytes activation............................127
Abbreviations
AD Atopic dermatitis
CRH Corticotropin releasing hormone
CRHR1, 2 Corticotropin releasing hormone receptor 1, 2
DFE Dermatophagoides farina
H1R, H4R Histamine H1 receptor, Histamine H4 receptor
IL-6, 8 Interleukin 6, 8
MAPK Mitogen-activated protein kinase
MDC/CCL22 Macrophage-derived chemokine/C-C motif chemokine ligand 22
RANTES/CCL5 Regulated on activation, normal T cell expressed and secreted/ C-C
motif chemokine ligand 5
SC Stratum corneum
TARC/CCL17 Thymus and activation-regulated chemokine/C-C motif chemokine
xi
ligand 17
TEWL Transepidermal water loss
T. vulgaris Thymus vulgaris L.
xii
Abstracts

By Seul A Seo
Doctor of Philosophy in Science
Graduate School of Biotechnology, Kyung Hee University

Advised by Prof. Tae - Hoo Yi, O.M.D., Ph.D
Thymus vulgaris L., commonly known as thyme, is an aromatic herb widely used
worldwide. T. vulgaris has antioxidant, anti-inflammatory, and immunomodulatory activities
as well as skin anti-photoaging and protective effects. However, there have been no studies
regarding the inhibitory effects of T. vulgaris on AD. Therefore, the present study aimed to
demonstrate the effects of T. vulgaris on improving AD symptoms.
The active components of T. vulgaris were detected by HPLC analysis. In the
in vitro study, the anti-atopic effects of T. vulgaris were examined in LPS-stimulated
Raw264.7 cells, DNP-IgE/BSA-stimulated RBL-2H3 cells, and TNF-α/IFN-γ-stimulated
HaCaT cells using ELISA kits, RT-PCR, and western blotting. In the
in vivo study, the mitigating effects of T. vulgaris against AD were investigated by
measuring morphological and physiological changes, scratching behavior, AD symptom-
related protein expression, and histological changes in DFE-induced NC/Nga mice.
xiii
In the in vitro results, T. vulgaris significantly inhibited NO production in LPS-treated
Raw264.7 cells. When T. vulgaris was treated with at a concentration of 250 μg/mL, the
release of β-hexosaminidase and histamine was reduced by 52.7% and 38.0%, respectively,
than those of only DNP-IgE/BSA-induced RBL-2H3 cells. This was confirmed to be due to
the regulation of calcium-related signaling pathway. Furthermore, the production of TARC
and MDC was remarkably suppressed by 35.5% and 64.5% at 100 μg/mL of
T. vulgaris, respectively, compared with those of only TNF-α/IFN-γ-stimulated HaCaT
cells. T. vulgaris also influenced the decrease in mRNA expression of pro-inflammatory
cytokines and chemokines, such as IL-6, TARC, MDC, RANTES, and IL-8, via the
modulation of MAPKs, STAT1, and NF-κB pathways.
The results of the in vivo study confirmed that topical application of T. vulgaris
improved AD symptoms. Treatment with T. vulgaris led to a decline in the severity of
dermatitis, TEWL, erythema index. In addition, the number of scratches was significantly
decreased by T. vulgaris. This was affected by suppression of serum IgE level and histamine
release. Histological analysis results showed that T. vulgaris was involved in the reduction
of epidermal thickness as well as the reduction of mast cell infiltration. On the other hand,
the skin density and hydration level aggravated by DFE were recovered by topical
application of T. vulgaris.
Taken together, this study revealed the ameliorating effects of T. vulgaris on AD-induced
in vitro and in vivo models. The results suggest that T. vulgaris can be applied as a natural
xiv
product-derived therapeutic agent in both cosmetic and pharmaceutical industries as it
attenuates itching by controlling histamine release, thereby improving symptoms of AD.
Keywords Thymus vulgaris L., atopic dermatitis, histamine, itching
xv
Ⅰ. Introduction
1. Thymus vulgaris L.
Thymus vulgaris (T. vulgaris), commonly known as garden thyme, belong to the genus
Thymus (Lamiaceae family) and is native to Europe and Asia. It is highly aromatic, has
grey-green leaves, and blooms with purple or pink flowers in early summer [1].
T. vulgaris is considered to have high nutritional value because it is abundant in minerals
and vitamins that are beneficial to health. Vitamin A and vitamin C are abundant in
T. vulgaris, and vitamin B6 or pyridoxine, vitamin K, vitamin E, and folic acid are also
present. The health-promoting properties of T. vulgaris are known to be due to the
antioxidant and anti-inflammatory effects [2].
T. vulgaris is one of the most widely used spices in the world, characterized by having a
fragrant odor and a pungent taste. Because the flavor of T. vulgaris lasts for a long time, it
has an appetite-inducing effect and has been used in dishes such as soups, meat, pork
sausages, fish, and poultry dressings [2]. T. vulgaris essential oil is used in aromatherapy,
which is known to be able to alleviate bites and stings, rheumatic aches, and pains. In
addition, it helps blood circulation to smooth the skin and is effective in acne treatment due
to its antibacterial activity [3].
T. vulgaris is one of the best known traditional medicines that has been applied in the
1
form of tea, ointment, tincture, syrup or steam inhalation. Since T. vulgaris is believed to be
effective in treating respiratory diseases such as dry coughs, asthma, and bronchitis, it has
been traditionally used for the treatment of these diseases. It is also known that vitamin C
present in T. vulgaris helps to improve immunity [4, 5].
According to recent reports, it was verified that T. vulgaris essential oil and carvacrol, its
components, exert anti-inflammatory effects by allowing inhibition of inflammatory edema
and leukocyte migration [3]. In oxLDL-stimulated THP-1-macrophages model,
T. vulgaris suppressed the production of proinflammatory mediators such as TNF-α, IL-1B,
and IL-6 [6]. It was revealed that T. vulgaris has a potential immunomodulatory role,
antioxidant activity, and a protective effect against plumbum (Pb) toxicity [7]. In addition,
antibacterial [8], antifungal [9, 10], and neuroprotective [11] effects of
T. vulgaris have been reported.
Especially, in relation to the effect of T. vulgaris on skin, Sun et al. (2016) reported that
T. vulgaris is effective in improving skin wrinkles via inhibition of MAPK/AP-1 and
activation of NRF2-ARE antioxidant system. It was also demonstrated that
T. vulgaris and thymol, one of its active compounds, can reduce DNA damage induced by
UVA and UVB in NCTC 2544 cell line and protect skin against genotoxic damage caused by
UV radiation in an ex vivo human skin model. Moreover, study showed that T. vulgaris is
2
effective in the treatment of cutaneous leishmaniasis in balb/c mice. In relation to antifungal
activity, T. vulgaris essential oil and thymol has a therapeutic effect on experimentally
induced dermatomycoses in rats [9]. However, few studies on skin inflammation have been
reported.
3
Table 1. Previous studies of T. vulgaris on biological effects
Reference
Biological effect Model
PMIDa
Antioxidant, UVB-irradiated NHDFs and UVB exposed hairless

27641753
Anti-aging mice
UVA and UVB-irradiated NCTC 2544 cell line 26338540
Skin protective UVA and UVB exposed human skin model (ex
27023828
vivo)
ear edema, carrageenan induced pleurisy, and
Anti-inflammatory 22919415
chemotaxis in vitro.
Anti-inflammatory oxLDL-Stimulated THP-1-Macrophages 22577523
Anti-leishmaniasis cutaneous leishmaniasis in balb/c mice. 19248657
Antimicrobial, Gram-negative bacteria (E. coli), gram-positive
antioxidant, bacteria (S. aureus and P. acnes), and fungi (C. 21979069
anti-inflammatory albicans and P. ovale), LPS-induced THP-1 cells
Immunomodulatory,
Lead (Pb)-intoxicated rats 31172438
antioxidant
Dermatomycoses induced rats 18651285
Antifungal
Fusarium oxysporum strains 28062283
Antibacterial Phytopathogen Allorhizobium vitis 29288304
Neuroprotective 5-fluorouracil (5-FLU) administered rats 31475590
PMIDa; PubMed identifier (PMID) is a unique number assigned to each PubMed record.
4
It was reported that T. vulgaris contains monoterpene phenols including thymol,
p-cymene, and carvacrol [14]. In addition, it also contains various phenolic compound, such
as cynaroside, rosmarinic acid, and caffeic acid [15].
Thymol is a major component of essential oils and is a naturally occurring phenol
monoterpene derivative of cymene and isomer of carvacrol. Many studies have been reported
on the biological effect of thymol, which has been shown to exert antioxidant effects through
the regulation of antioxidant enzymes such as superoxide dismutase (SOD) and glutathione
peroxidase (GPx). In addition, it was demonstrated that thymol has anti-inflammatory effects
which act by reduction of LPS-stimulated inflammation and edema and alleviate atopic
dermatitis induced by Staphylococcus aureus membrane vesicles. p-cymene is a monocyclic
monoterpene which regulates the expression of pro-inflammatory cytokines through
suppression of MAPK and NF-B, thereby showing anti-inflammatory activity. Also, it has
antioxidant activity via reduction of lipid peroxidation and nitrite content and enhancement
of SOD and catalase activity. Carvacrol has a positive effect on the reduction of interleukin
(IL)-1β, IL-4, IL-8 and malondialdehyde (MDA) and immunomodulatory effects against
ovalbumin-induced asthma in rats.
Studies have revealed that rosmarinic acid alleviates atopic dermatitis and inhibits
reactive oxygen and nitrogen species and suppresses hydrogen
5
peroxide-induced oxidative stress and inflammatory response in normal human dermal
fibroblasts via down-regulation of NF-κB transcriptional activity. Cynaroside, also known as
luteolin 7-O-glucoside, enhances the antioxidant and antiapoptotic ability in ARPE-19 cells
by promoting the expression of p-Akt and attenuates inflammation through regulation of the
PPARγ/Nrf2/NF-κB signaling pathway. Jeon et al. demonstrated the anti-inflammatory
effect of caffeic acid through down-regulation of chemokines. Moreover, caffeic acid has
been found to induce cutaneous wound healing and restore the antioxidant defense system.
6
Table 2. Previous studies of components of T. vulgaris on biological effects
Reference
Component Structure Biological effects
PMIDa
Antioxidant 10703468
Thymol Anti-atopic 29679854
25856703
p-Cymene Anti-inflammatory
22486037
Carvacrol
Immunomodulatory 31881223
Anti-atopic 19239556
Rosmarinic
acid
Cynaroside
Anti-allergic 26104582
Caffeic acid Wound healing 26929003
Anti-aging 22360712
7
2. Atopic dermatitis
Atopic dermatitis (AD) is one of the allergic skin disorders that is associated with the
immune system. It is accompanied by itching, erythema, cracked skin, and swelling. The
activation of keratinocytes is known as a major characteristics of AD. It results in the
production of pro-inflammatory cytokines which promote chronic and self-amplifying
immune activation. For this reason, keratinocytes play a pivotal role in accelerating and
maintaining inflammation in AD [16].
AD is known as an immediate type hypersensitivity reaction mediated by the mast cells.
Mast cells are key effectors in IgE-mediated immediate allergic disease such as asthma and
AD. Mast cells are distributed in various tissues and cause the release of various mediators
such as histamine and pro-inflammatory cytokines through degranulation. In particular,
histamine is related to immediate phase of allergic inflammation which presents as
symptoms such as vasodilatation, increased vascular permeability and tissue edema. The
activation of mast cell-derived factors contributes to itching and inflammation in AD skin
[17].
8
2.1. Epidemiology of atopic dermatitis
Atopic dermatitis (AD) is a chronic and relapsing inflammatory skin disorder,
accompanied by eczema, itching, edema, and skin thickening [19]. AD is increasing in
adults as well as in children and is considered a major problem not only in developed
countries but also in developing countries. Therefore, AD is one of the serious diseases of
modern society which causes mental stress and worsens the quality of life. Although many
studies on AD have been conducted, the pathological and genetic mechanisms of AD are not
fully understood [20, 21].
2.2. Causes of atopic dermatitis
The exact causes of AD are not known, but is thought to be a complex disease triggered
by interaction of several factors. Genetic factors are known to include mutations in the
filaggrin gene, which is related to the skin barrier and environmental factors, including
stimuli such as air pollution, chemicals, irregular sleep, and stress. It is also associated with
immunomodulatory abnormalities caused by the destruction of the balance of the Th1 / Th2
immune response [19, 20, 22].
9
2.3. Diagnosis of atopic dermatitis based on clinical features
Diagnosis of AD is based on clinical features, requiring itchy skin and at least three of
the following: history of involvement of the skin creases, history of asthma or hay fever,
history of generally dry skin in the past year, onset in a child under two years of age, and
visible flexural dermatitis [19]. Acute skin lesions include erythematous macules and
papules, which are related to excoriations and erosions. In the chronic phase, lichenification
occurs after scratching the skin for a long time [23].
Clinical manifestations of atopic dermatitis are very diverse, and are classified into
infant, pediatric, and adult types according to age. In infancy, skin lesions occur on the scalp
or face, especially presenting as acute eczema such as erythema, edema, and swelling, and
often worsen suddenly. In childhood, skin lesions tend to occur on the flexures and dorsal
aspects of the limbs. In adolescents and adults, lichenification is observed as a result of skin
fibrosis and increased collagen erosion in the flexure, head and neck [22, 24].
10
2.4. Pathogenesis of atopic dermatitis
In normal skin, the Th1 and Th2 type immune responses are balanced to maintain
immunological homeostasis, and the skin barrier function is normally performed to protect
against external invasion. On the other hand, in AD skin, immunological homeostasis is
collapsed, resulting in an imbalance of immunity, and destruction of the skin barrier
increases invasion of external irritants and causes an inflammatory reaction [24].
2.4.1. Imbalance of Th1/Th2 immune response
The infiltration of T helper cells (Th cells) is characteristic of AD skin lesions.
According to function, these cells can be divided into T helper type 1 (Th1) cells and T
helper type 2 (Th2) cells, which can cause an inflammatory reaction of the skin depending
on the activity and duration of skin lesions [18, 25].
In the AD skin lesions, there is a difference in the expression of cytokine depending on
the phase. In the acute phase, Th2 cells secrete cytokines, including IL-4, IL-5, and IL-13,
and this activates mast cells to promote the secretion of soluble mediators such as histamine.
It stimulates B cells to promote the production of IgE [24]. Eczematous skin lesions are
known to be characteristic of the acute phase. On the other hand, in the chronic phase, the
production of Th1 cells is increased compared Th2, resulting in increased expression of
IFN-γ, IL-12, IL-5, and granulocyte-macrophage colony-stimulating factor (GM-CSF). The
11
characteristics of the chronic phase include lichenification of skin and tissue remodeling.
Since AD is accompanied by severe itching, the Th2 type immune response is converted into
a Th0 type immune response due to the wound caused by scratching the lesion site as the
disease progresses, resulting in chronic inflammation. Therefore, the response by Th2 cell
activation is characteristic of the acute phase, and the response by Th1 cells and/or Th0 cells
activation is characteristic of the chronic phase. This indicates that Th2 as well as Th1 play
an important role in inducing and maintaining skin inflammation in AD skin [17].
Recently, the role of Th17 cells related cytokines in the pathogenesis of AD has been
reported. In the lesions of AD, Th17 cells are infiltrated, leading to the expression of Th17
related cytokines such as IL-17 and IL-22. They are recognized as a critical factors because
they serve to mediate the onset and progression of AD [26].
2.4.2. Skin barrier dysfunction
The skin is the most external organ of the human body; it prevents water loss in the body
and acts as a barrier to protect against external stimuli such as irritants, allergens, and
pathogens. However, in AD skin, the functioning of the skin barrier is impaired, which is
recognized as one of the most important factors in the pathogenesis of AD. Damage to the
skin barrier increases transepidermal water loss (TEWL), causing a decrease in the moisture
content of the stratum corneum, resulting in dry, scaly, rough, dull, slightly wrinkled skin.
12
This is due to the mutations of structural proteins such as filaggrin in keratinocytes, which
increases protease activity or decreases the activity of protease inhibitor and also causes
abnormal lipid composition [22, 27].
Filaggrin is one of the most important elements in forming the skin barrier, and is a
protein produced by the degradation of profilaggrin, a high molecular weight protein
constituting keratohyalin granules present in epidermal granule cells. Filaggrin acts to
aggregate keratin in keratinocytes, and when degraded, it turns into a natural moisturizing
factor such as free amino acids, urocanic acid, and pyrrolidone carboxylic acid, which
maintain moisture in the stratum corneum. In this way, the mutation of filaggrin gene, which
plays an important role in skin barrier function, not only causes abnormal keratinocyte
structure and skin barrier dysfunction, but also reduces the moisture content of the stratum
corneum and increases TEWL. This is responsible for causing dry skin in AD, which may
increase external irritation and worsen AD [24, 28, 29].
13
Figure 1. Acute and chronic phases of AD
14
2.5. Itching in atopic dermatitis
2.5.1. Role of histamine in itching
Histamine (2-[4-imidazolyl]-ethylamine) is a biogenic amine and is well known as a
crucial mediator of numerous biological reactions. Histamine is usually secreted from mast
cells and basophils, which are the main cellular sources of histamine and can store it in
specific granules. It has also been found that histamine is produced in T cells and
keratinocytes in response to stimulation, which cannot store histamine [27, 30].
Histamine synthesized from the amino acid histidine by the histidine decarboxylase
(HDC) is stored in the secretory granules of both mast cells and basophils. Stimuli activate
these cells, and then stored histamine is released [31]. It results in diverse biological effects
through the activation of four distinct receptors (H1R, H2R, H3R, and H4R). Histamine
receptors are classified as G protein coupled receptor and various functions of histamine are
attributed to these four pharmacologically distinct receptors. The activation of H1R by
histamine is known to cause cellular migration, nociception, vasodilatation, and
bronchoconstriction, and also involved in Th1- and Th2-type immune responses. H2R plays
a role in regulating gastric acid secretion, airway mucus production, and vascular
permeability. H3R plays an important role in neuro-inflammatory diseases by regulating the
15
release of histamine, serotonin, acetylcholine, and other
neurotransmitters. H4R is mainly expressed in immune cells such as leukocytes and mast
cells. Inflammation and pruritus were mediated by receptors that play an important role in
chronic allergic contact dermatitis. Mast cell activation by H4R regulates the inflammatory
cascade through the release of the several inflammatory mediators. In addition, H4R was
reported to affect chemotaxis in mast cells and eosinophils [32, 33]. Especially with regard
to skin, the activation of H1R affects most immediate hypersensitivity reactions such as
erythema, pruritus, and edema. In addition, H1R promotes the proliferation of keratinocytes
and causes periostin release in fibroblasts. It was reported that histamine is also involved in
itch sensation of sensory neuron through H1R and H4R [33, 34].
16
Figure 2. Biosynthesis and metabolism of histamine
17
Figure 3. Effects of histamine through H1 and H4 receptors in skin allergic reaction.
18
Histamine is known to be involved in various biological reactions. In the central nervous
system, histamine dilates blood vessels, causing dizziness, headache, vomiting and
insomnia. In addition, vasodilation causes arrhythmia, hypotension, and shock symptoms in
the cardiovascular system. In relation to the stomach and intestine, abdominal pain, diarrhea
and abdominal swelling due to gastric acid secretion appear, and is involved in smooth
muscle contraction, causing menstrual pain and urination. In the respiratory system,
histamine increases mucous secretion and vascular permeability, resulting in rhinitis and
coughing [33].
Especially in relation to the skin, symptoms such as itching, facial flushing and urticaria
are caused by histamine through increased vascular permeability and pain-sensitive
disorder, stimulation of nerve fibers. Histamine plays an important role in inflammatory skin
disease; initial reddening of skin, plasma extravasation and the development of a weal
(tissue oedema) and a flare (wider spread erythema) are considered features of skin
inflammation by histamine [32, 35, 36]. These reactions are often accompanied by itching.
Histamine released from mast cell granules induces inflammation, which is mostly
associated with immediate hypersensitivity. In addition to causing skin inflammation and
itching, histamine has also been reported to affect skin barrier function.
Histamine inhibits epidermal differentiation and disturbs skin barrier function by reducing
19
the formation of tight junctions and the expression of filaggrin, and promotes proliferation
of keratinocytes, leading to hyperkeratosis [27].
Allergy symptoms further stimulate the release of histamine, which in turn leads to the
deterioration of the disease such as AD. Itching is hallmark symptom of AD, which causes
an unpleasant sensation and a desire to scratch, aggravating the cutaneous symptoms.
Patients with AD usually experience itching and scratching, which triggers psychological
problems such as sleep disorders and depression. This has a significant impact on the quality
of a patient’s life. Although there are various substances that trigger itching, such as
cytokines and substance P, histamine is still recognized as a major pruritogen. It is
responsible for at least half of the symptoms and signs of allergic reactions in the skin. Since
mast cells are a major source of stored histamine, the improvement of allergy symptoms and
immune dysfunction depends on the regulation of histamine release from mast cell [37].
Upon stimulation by an allergen, histamine is released from mast cells through
degranulation, which causes the excitation of a subset of unmyelinated C-fibers, leading to
itching [38].
20
2.5.2. Psychological stress and itching
Psychological stress is general phenomenon reported to have a significant effect on
immune function. It is known as a risk factor for immune related diseases such as AD. The
regulation of immune and nerve systems by psychological stress can affect itching, which
results in worsening the condition of inflammatory diseases. Thus, stress is a main
contributor to aggravate itching in a variety of itching-associated diseases [39]. There is a
stress-itching-scratching cycle that stress can causes or aggravates itching, in turn leading to
scratching and further itching. This can worsen stress; indeed, itching is associated with
anxiety and stress sensitivity in patients with AD, causing high levels of anxiety and stress in
patients with chronic and severe itching. Patients with chronic itching react sensitively to
itching-scratches cycles, which can lead to an increase in stress levels, eventually
aggravating itching. This vicarious cycle results in continuous scratching, deterioration of
diseases, and impaired quality of life [40]. The central and peripheral activation of the
hypothalamic-pituitary-adrenal (HPA) axis and sympathetic nervous system are involved
with the induction or deterioration of itching caused by stress. Mast cells, keratinocytes, and
nerves are affected by these systems, which promote the secretion of neuropeptides including
histamine, substance P, and itchy cytokines [41].
21
In response to stress, CRH can be secreted from keratinocytes and mast cells. In
keratinocytes, the release of many mediators associated with the pruritogenic pathway can be
caused by CRH. Furthermore, CRH induces the secretion of the mediators that activate mast
cells. When mast cells are activated, histamine and cytokines, characterized by inflammatory
and vasodilatory mediators, are secreted. This eventually leads to itching. Inflammation
induces a reduction in the threshold for itching stimuli, which results in peripheral itching
sensitization [42].
Many skin disorders, such as AD, are correlated with an increase in the number of
activated mast cells, which tend to be further exacerbated by stress. Thus, mast cells are
recognized as a key immune effectors in the stress response. Mast cells manifest various
receptors, which rapidly sense and respond to stress signals from environmental and
immunological factors. Under stress, the release of mediators such as β-hexosaminidase and
histamine in mast cells is promoted through degranulation. In particular, histamine induces
an increase in vascular permeability and stimulates the cutaneous sensory nerves, which in
turn causes itching. Excessive activation of mast cells has a detrimental effect that is
associated with the onset and severity of diseases such as allergy [43].
Similar to the central axis, the peripheral HPA axis exists in the skin. This plays a key
role in the response to psychological stress. CRH is a major component of the HPA axis, and
22
is important in controlling the response to stress. CRH is known to regulate the stress
response through the two receptors, CRHR1 and CRHR2 [42]. According to a recent study,
it has been demonstrated that CRHR1 acts as a positive regulator in mast cell degranulation
induced by stress. CRHR1 is mainly involved in the anxiogenic effect of CRH. In contrast,
CRHR2 serves to inhibit mast cell degranulation via calcium related signaling pathways.
CRHR2 is involved in reduced anxiety-like behaviors and stress sensitivity. Since CRH and
related peptide are activated by mast cells, it is believed that mast cells serve an important
function as a sensor of psychological stress. Therefore, the regulation of these receptors can
be targeted in treating immune disorders that is associated with stress and mast cell
hyperactivity such as allergic inflammation [39].
23
3. Mechanism of atopic dermatitis
3.1. Mast cell activation
Mast cells play a pivotal role in allergic inflammatory reactions because the number of
mast cells and activation of mast cells are increased in AD lesions. The stimulation of
antigen presenting cells differentiate Th2 cells, which promotes the production of IgE in B
cells. Subsequently, IgE binds to high affinity IgE receptor (FcεRI) present on the surface of
mast cells, which activates these cells. It induces degranulation and promotes production of
inflammatory cytokines resulting in an allergic reaction [44, 45]. In an allergic reaction,
mast cells secret a variety of biological mediators including preformed secretory granules
(containing β-hexosaminidase and histamine), cytokines, and chemokines. When mast cells
are activated, β-hexosaminidase and histamine present in pre-stored vesicles are released by
the fusion of granule and plasma membrane during the acute phase, resulting in the delayed
production and secretion of inflammatory cytokines [46].
For mast cell activation, mobilization of Ca 2+ is a key process. Ca 2+ plays an important
role as a secondary messenger in the mast cell signaling pathways that modulates a variety
of cellular responses. According to the intracellular calcium level, the exocytosis of the mast
cell granules and secretion of the inflammatory cytokines are regulated by the
Ca2+ influx from the extracellular space [47]. Upon allergen-mediated stimulation, CRHR1 is
24
activated, but CRHR2 is suppressed. This stimulates phosphorylation of phospholipase Cγ
(PLCγ), leading to the generation of inositol 1,4,5-trisphosphate(IP3), which binds to IP3
receptors present in the endoplasmic reticulum (ER) to induce intracellular calcium release
from ER. The release of ER Ca 2+ mediated by IP3 causes the emptying of intracellular
Ca2+ stores, subsequently activating a Ca 2+ influx to refill intracellular stores through plasma
membrane channels [49].
Store-operated Ca 2+ entry (SOCE) is known as a major mechanism of Ca 2+ influx. For
SOCE, stromal interaction molecule 1 (STIM1) present in the ER membrane plays a crucial
role as an endogenous Ca 2+ sensor. It senses the low concentration of Ca 2+ in ER, and
subsequently forms a complex with calcium release-activated calcium channel protein 1
(Orai1) [50]. Orai1 is one of the store-operated channels and exists in plasma membrane that
is regulated by the level of Ca 2+ in ER stores. As store-operated channels, there is also
transient receptor potential canonical channel 1 (TRPC1) which is involved in the
Ca2+ influx. As a result, the increase of cytosolic Ca 2+ level leads to the fusion of preformed
granules with the plasma membrane. This rapidly induces the degranulation of mast cells via
Ca2+ mediated exocytosis and promotes the secretion of inflammatory mediators such as
histamine, β-hexosaminidase, proteases, proteoglycans, and lipid mediators, thereby leading
25
to allergic inflammatory responses. It is believed that keratinocytes can be affected by
activation of mast cells [51].
26
Figure 4. Mechanism of mast cells activation
27
3.2. Inflammatory response in keratinocytes
Keratinocytes present in the epidermis play an important role in the pathogenesis of
inflammatory skin diseases such as AD. When keratinocytes are exposed to stimuli such as
TNF-α and IFN-γ, cytokines and chemokines including thymus- and activation regulated
chemokine (TARC/CCL17), macrophage-derived chemokine (MDC/CCL22), regulated on
activation, normal T-cell expressed and secreted (RANTES/CCL5), and interleukin 8
(IL-8/CXCL8) are abnormally expressed. As a result, they increase the infiltration of Th
cells into local lesions. In the keratinocytes of AD skin, a number of cytokines and
chemokines involved in the response of immune cells is generated, and as a result,
inflammation of the skin lesions is exacerbated. Thus, these mediators are considered as
conclusive modulators in the pathogenesis of AD [52]. It has been found that the regulation
of inflammatory responses related to AD is influenced by nuclear factor-kappaB (NF-κB),
janus kinase (JAK)/signal transducer and activator of transcription (STAT), and mitogen-
activated protein kinase (MAPK) [16].
TNF-α is known to be involved in the activation of diverse signaling pathway such as
NF-κB, ERK, JNK, and p38 MAP kinases [53]. In the resting state, NF-κB, a key
transcription factor of the inflammatory response, binds to IκB in the cytoplasm [54]. Under
the stimulation, the IKK complex is activated, and IκB is subsequently phosphorylated and
28
degraded. The free NF-κB is released and translocated into the nucleus, which is responsible
for activating the expression of various genes associated with pro-inflammatory cytokines
and chemokines. In addition, when keratinocytes are stimulated, the MAPK signaling
pathway is activated, to subsequently upregulate NF-κB, resulting in acceleration of
proinflammatory cytokines and chemokines expression [16].
IFN-γ is important in the regulation of the immune responses because it is characterized
by possessing immunomodulatory activity. In the IFN-γ signaling pathway, IFN-γ binds to
its receptor and induces the activation of JAK, and then phosphorylates STAT1 [55]. STAT1
is a member of the STAT protein family and this phosphorylation has been found to play a
crucial role in IFN-γ mediated inflammatory responses. When STAT1 is phosphorylated, it
translocates from the cytoplasm into the nucleus and then promotes the transcription of
genes associated with inflammation such as MDC. Thus, it is regarded that STAT1 is a
significant regulator of the IFN-γ signaling pathway [56, 57].
29
Figure 5. Mechanism of inflammatory response in keratinocytes
30
4. Therapeutic agents of atopic dermatitis and allergic response
Treatment of AD can be divided according to the severity of the disease, and there are
skin moisturizers, topical corticosteroids, immunosuppressive drugs, and antihistamines as
therapeutic agents. In basic therapy for AD treatment, skin moisturizers are used to restore
the impaired skin barrier function. Topical corticosteroids exhibit therapeutic effects through
anti-inflammatory actions. Long-term use of topical corticosteroids can cause side effects
such as skin atrophy, steroid-induced acne, and telangiectasia [58, 59]. Topical calcineurin
inhibitors are a second-generation anti-inflammatory drug and well known to suppress
calcineurin-dependent T-cell activation. This causes reduction of the production of pro-
inflammatory cytokines and mediators associated with AD. As the most common adverse
reactions, there are stinging and burning. In addition, antihistamines have been tried for the
purpose of relieving itching of AD. It has been also reported to have side effects such as
sedation, stinging, and burning [58].
In particular, ketotifen fumarate is frequently used for the treatment of symptoms such as
allergic conjunctivitis, asthma, atopic dermatitis, gastric mucosal injury, chronic urticaria,
and allergic rhinitis [60, 61, 62]. However, it has been reported to exhibit side effects
including headache, increased nosebleeds, irritability, dry mouth, and drowsiness [61, 62,
64]. In the case of tacrolimus, it is applied to atopic dermatitis [65], lupus nephritis [66],
31
organ transplantation [67], and ulcerative colitis [68]. Adverse reactions of tacrolimus
include burning sensation, pruritus, erythema, and neurotoxicity [59]. Due to these side
effects, interest in the development of therapeutic agents with safety is increasing.
32
4.1. Ketotifen fumarate
Ketotifen fumarate is a second-generation non-competitive H1 antihistamine. It is also
well known as mast cell stabilizer which suppresses the release of mast cell mediators such
as histamine, prostaglandins, and arachidonic acid metabolites [63]. For this reason,
ketotifen fumarate has been applied to dermatologic disorders in which mediators derived
from mast cells are recognized as a crucial factor [70]. According to previous study,
ketotifen fumarate counteracts the plasma membrane deformation caused by exocytosis. The
mast cell-stabilizing properties is due to this effect [63].
33
4.2. Tacrolimus
Tacrolimus has been reported to have an immunomodulatory and anti-inflammatory
effects. It is well known as an inhibitor targeting calcineurin, a calcium-dependent protein
phosphatase. When antigens bind to T-cell receptors, the concentration of intracellular
calcium increases. The elevated calcium binds to calmodulin, resulting in the activation of
NFAT. Then the gene transcription of pro-inflammatory cytokines such as IL-2 is promoted.
Tacrolimus binds to its receptor and blocks the function of calcineurin. This inhibits the
transport of NFAT to the nucleus, which in turn down-regulates of NFAT-dependent
cytokine gene transcription and has an immunosuppressive effect [71, 72].
34
Table 3. Indication and side effects of therapeutic agents
Therapeutic agent Indication Side effects
Allergic conjunctivitis
- Headache
Asthma
- Increased nosebleeds
Atopic dermatitis
Ketotifen fumarate - Irritability
Gastric mucosal injury
- Dry mouth
Chronic urticaria
- Drowsiness
Allergic rhinitis
Atopic dermatitis
- Burning sensation
Lupus nephritis - Pruritus
Tacrolimus
Organ transplantation - Erythema
- Neurotoxicity
Ulcerative colitis
35
4.3. Natural products-derived therapeutics
Many studies have been performed on atopic dermatitis, but no complete treatment has
yet been found. Since atopic dermatitis is caused by various factors, different treatments may
be applied to each patient. The current therapeutics are known to have side effects if applied
chronically. However, natural products have few side effects and contain components with
various biological functions. For this reason, many studies have been conducted on the
effects of natural products for atopic dermatitis (Table 4 and 5).
It was reported that natural products such as Saussurea lappa (Mok-hyang), Hovenia
dulcis Thunb. (Heot-gae-na-mu), Moringa oleifera leaf (Moringa), and Artemisia apiacea
Hance (Gae-sa-cheol-ssuk) had a mitigating effects against AD through down-regulation of
pro-inflammatory cytokines and chemokines such as TARC and MDC. Also, Cha
et al. reported the inhibitory effect of Patrinia scabiosifolia Link (Ma-ta-ri) on the
development of AD-like lesions which was contributed by an increase in filaggrin expression
and a decrease in IgE and inflammatory cytokine levels.
Several studies demonstrated the anti-allergic effect of natural products.
According to previous studies, Pogostemon cablin (Patchouli) showed potential to alleviate
mast cell-mediated allergic inflammation, which was associated with the modulation of
calcium influx. In addition, Arctium lappa (U-eong), Zanthoxylum coreanum Nakai (Wang-
36
cho-pi-na-mu), Pterocarpus santalinus (Ja-dan-hyang), Pterocarpus santalinus (Ja-dan-
hyang) exerted the inhibitory effect on mast cell degranulation resulting in a reduction in the
release of mediators such as β-hexosaminidase and histamine.
37
Table 4. Previous studies on the effect of natural products in AD
Natural products Reference

Effect
(Korean name) PMIDa
Reduce histological manifestations of atopic skin

Saussurea lappa
lesions such as erosion, hyperplasia of the epidermis 24216625
(Mok-hyang)
and dermis, and inflammatory cell infiltration.
Suppress TNF-α/IFN-γ-induced production of TARC
and MDC in HaCaT cells by inhibiting MAPK
Hovenia dulcis
signaling and regulate immunoglobulin (Ig) E and
Thunb. 27696405
immunoglobulin G2a (IgG2a) levels in serum and
(Heot-gae-na-mu)
the expression of mRNA for Th1- and Th2-related
mediators in skin lesions.
Inhibited the expression of TNF-a, CCL17, IL-1b,
Moringa oleifera
and IL-6 mRNA, as well as that of MAPKs in
leaf 27744247
HaCaT keratinocytes in a concentration-dependent
(Moringa)
manner.
Patrinia scabiosifolia Attenuate the development of AD-like lesions by
Link increasing filaggrin expression and lowering IgE 28347830
(Ma-ta-ri) and inflammatory cytokine levels.
Regulate chemokine formation by inhibiting
Artemisia apiacea
activation of and ERK as well as the NF-κB
Hance 29932162
pathways and improve the skin p38 conditions in a
(Gae-sa-cheol-ssuk)
DNCB-induced AD-like mouse model
38
Table 5. Previous studies on the effect of natural products in allergic skin inflammation
Natural products Reference

Effect
(Korean name) PMIDa
The release of histamine from mast cells was

Pogostemon cablin
reduced by AEPC, and this suppressive effect was 26531835
(Patchouli)
associated with the regulation of calcium influx.
F-AFE suppressed the production of TNF-α and
Arctium lappa PGE2 in a dose-dependent manner. F-AFE inhibited
26707911
(U-eong) the phosphorylation of Lyn, Fyn and Syk, which are
involved in the FcεRI signaling pathway.
Zanthoxylum Zanthoxylum coreanum Nakai inhibited both the
coreanum Nakai IgE-antigen complex or PMA/A23187-induced β-
30618741
(Wang-cho-pi hexosaminidase release and IL-4 production dose-
-na-mu) dependently in RBL-2H3 mast cells.
P. santalinus extract inhibited β-hexosaminidase and
Pterocarpus
histamine release and reduced tumor necrosis
santalinus 30609435
factor-α, interleukin-4, and prostaglandin E2
(Ja-dan-hyang)
secretion.
Schizonepeta Degranulation of RBL-2H3 cells was assessed by
tenuifolia measuring the release of β-hexosaminidase, which 29849717
(Hyeong-gae) was suppressed by ST at 10 μg/mL.
39
40
5. Purpose of this study
T. vulgaris is well known as one of the aromatic herbs that have been used worldwide
for the purpose of spices, cosmetics, and treatment due to its various effect [2]. Antioxidant,
anti-photoaging [12], and skin protection [13] effects of T. vulgaris were reported, but no
studies have been reported on the inhibitory effect of T. vulgaris in atopic dermatitis
models. Thus, this study was conducted to investigate whether T. vulgaris is effective in
improving atopic dermatitis through the regulation of inflammatory response and histamine
release.
In AD, steroids and immunosuppressive drug have been used for treatment. There are
many reports that long term use of steroids can cause serious side effects such as skin
atrophy, steroid-induced acne, and telangiectasia. Immunosuppressive drug has also been
reported to have adverse reactions including temporary skin irritation [58, 59]. As the
number of patients with AD continues to increase around the world, it is necessary to
develop alternative treatments that are safe with few side effects. Therefore, this study was
conducted to demonstrate the effect of T. vulgaris as a therapeutic agent of AD.
Anti-atopic and anti-allergic effects of T. vulgaris were studied in both in vitro and in
vivo AD-induced models. In the in vitro study, the inhibitory effects of T. vulgaris on mast
cell degranulation and expression of calcium related protein were investigated in
41
DNP-IgE/BSA-stimulated RBL-2H3 cells. Furthermore, the production of pro-inflammatory
cytokines and chemokines, as well as their signaling pathway including MAPKs, STAT1,
and NF-κB, were examined in TNF-α/IFN-γ-stimulated HaCaT cells. In the
in vivo study, the effects of T. vulgaris by topical application were examined following DFE
treatment in NC/Nga mice model. The clinical dermatitis severity scores, skin hydration,
TEWL, scratching behavior, serum IgE levels, histamine release, histological changes, and
the expression of AD-related protein markers were evaluated.
42
Ⅱ. Materials and Methods
1. Materials
The dried leaves of T. vulgaris was purchased from Mountain Rose Herbs Company
(Eugene, OR, USA) with USDA certificate. Dulbecco’s modified Eagle’s medium (DMEM),
Fetal bovine serum (FBS), antibiotics, and trypsin-EDTA were purchased from Gibco-BRL
(Grand Island, NY, USA). Enzyme-linked immunosorbent assay (ELISA) kits for
TARC/CCL17 and MDC/CCL22 were purchased from R&D systems (Human TARC/CCL17
Duoset ELISA kit, Human MDC/CCL22 Duoset ELISA kit; R&D systems, Inc.,
Minneapolis, MN, USA). Mouse IgE and histamine ELISA Kit were purchased from Abcam
(Cambridge, UK). Primary and secondary antibodies were obtained from Santa Cruz (Santa
Cruz, CA, USA), Cell signaling (Danvers, MA, USA), and Abcam (Cambridge, UK).
Rosmarinic acid, caffeic acid, lipopolysacaride (LPS), recombinant human TNF-α and IFN-
γ, Monoclonal Anti-dinitrophenyl antibody produced in mouse (Anti-DNP IgE), 3-(4,5-
Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and other reagents were
purchased from Sigma-Aldrich (St. Louis, MO, USA).
43
2. Sample preparation
Dried T. vulgaris (1.5 g) was extracted with ethanol (50%) in a ration of 1:10 (w/v) using
a digital orbital shaker, SHO-1D (Daihan, Korea) for 24 h at 24-25 ℃ three times. After 24 h
incubation, the extracts were filtered and evaporated under vacuum at 40 ℃; and yielded
17.8 % (w/v).
44
Figure 6. Preparation of T. vulgaris extract
45
3. HPLC analysis
The HPLC system (UltiMate 3000 LC system, Thermo Fisher and Voorhees Scientific
Inc., Sunnyvale, CA, USA) with a C18 column (4.6 x 250 mm, 5 μm; Hypersil GOLD,
Thermo Fisher Scientific Inc., Sunnyvale, CA, USA) was used to detect the polyphenolic
compounds of T. vulgaris. Other setting conditions were running samples in 50% methanol
at 1 mg/mL, a 10 μL sample was injected at a flow rate of 1 mL/min, and a detection
wavelength at 280 nm. The rosmarinic acid and caffeic acid standards were prepared in 50%
methanol with a range of concentrations (3.125 μg/mL to 100 μg/mL).
46
4. In vitro study
4.1. Cell culture
The murine macrophage RAW 264.7 cell line was obtained from KCLB (Korea). The rat
basophilic leukemia RBL-2H3 cell line and Human immortal keratinocyte HaCaT cell line
were obtained from ATCC (VA, USA). All cell lines were maintained in the incubator at
37℃ with humidified atmosphere containing with 5% of CO 2. Cells were cultivated in
DMEM media containing 10% heat-inactivated FBS and 1% antibiotics and antimycotic
medication using T-75 flask (Raw 264.7 cells) or 100 mm dishes (RBL-2H3 cells and HaCaT
cells). Then cells were seeded in 96 well (Raw 264.7, 1.0×10 5 cells/well; RBL-2H3,
3.0×104 cells/well) and 6 well (HaCaT, 1.0×10 6 cells/well; RBL-2H3, 1.0×10 6 cells/well) and
until the confluence reached to 80%.
4.2. Sample treatment
The cells were treated with various concentration (ranging from 1 to 250 µg/mL) of
T. vulgaris following sensitization. For Raw 264.7 cells, the cells were seeded at 96 well
then co-treated with T. vulgaris and stimulator after 24 h incubation. 1 µg/mL of LPS was
used as a stimulator and 1 µM of dexamethasone was used to a positive control. For RBL-
2H3 cells, the cells were seeded at 96 well plate and 6 well plate. And then cells were
47
sensitized with 50 ng/mL of DNP-IgE. After sensitization, cells were pretreated with
T. vulgaris for 1 h then stimulated with 100 ng/mL of DNP-BSA for 4 h. 100 µM of
ketotifen fumarate and 10 ng/mL of tacrolimus were used to a positive control. For HaCaT
cells, the cells were seeded at 6 well plate and were pretreated with
T. vulgaris for 30 min, and then stimulated with 10 ng/mL of TNF-α and IFN-γ for 30 min. 1
and 10 µg/mL of tacrolimus were used to a positive control. To analyze the secretion of
cytokines and chemokines, the cells were incubated 24 h after treatment.
4.3. Measurement of cell viability
MTT is a colorimetric assay used to measure cell viability. Specifically, viable cells
allow produce purple-colored formazan thereby it can be detected by spectrophotometer. At
the end of the incubation period, MTT reagent was added to adjust its concentration to 0.1
mg/mL. Next, the MTT treated cells were incubated for 3 h at 37°C in a
CO2 incubator, after which the medium was removed and 800 μL of DMSO was added to
dissolve the formazan crystals. Finally, the OD was read at 595nm using a FilterMax F5
microplate reader (Molecular Devices, San Francisco, USA).
4.4. Measurement of NO production
NO production of RAW 264.7 cells was measured using the Griess reagent system
(Promega, Fitchburg, WI, USA). The cells were seeded in 96 well plate
48
(1.0×105 cells/well) and then incubated for 24 h. Next, T. vulgaris or LPS was treated and
the incubation was continued for an additional 24 h. A mixture of sulfanilamide solution and
N-(1-naphthyl) ethylenediamine dihydrochloride solution (1:1 v/v) was added to each well
and incubated for 10 min at room temperature. Absorbance was recorded at 595 nm using a
FilterMax F5 microplate reader (Molecular Devices, San Francisco, USA).
4.5. β-hexosaminidase release assay
To investigate the inhibitory effect of T. vulgaris on degranulation , β-hexosaminidase
release was analyzed. RBL-2H3 cells were seeded in 96-well plates at a density of
3×104 cells/well and incubated for 24 h. After washing twice with siraganian buffer, cells
were incubated with anti-DNP-IgE (50 ng/mL) for 24 h. Next, IgE-sensitized cells were
treated various concentrations of T. vulgaris for 1 h at 37 ̊C. Then, cells were stimulated with
100 ng/mL of DNP-BSA and then incubated for an additional 4 h under the same conditions.
After incubation, cells were placed in the ice for 10 min to terminate the reaction. 50 μL of
supernatants were collected and mixed with of substrate buffer (1 mM p-nitrophenyl-N-
acetyl-β-D-glucosamine in 0.1 M citrate buffer, pH 4.5). Following 1 h of incubation,
reaction was stopped with 200 μL/well stop solution (0.1 M Na 2CO3/NaHCO3, pH 10.0).
Absorbance was read at 405 nm using a FilterMax F5 microplate reader (Molecular Devices,
San Francisco, USA).
49
4.6. Histamine release assay
The release of histamine was quantified with commercial ELISA kit (Histamine ELISA
kit; Abcam, Cambridge, UK). After 2 h of sample treatment and stimulation, cell culture
supernatants were collected then the total concentration of histamine was measured
according to the manufacturer’s instruction.
4.7. Measurement of intracellular calcium
To determine intracellular calcium levels, Fluo-3/AM (Invitrogen), a fluorescent
indicator, was used. RBL-2H3 cells were pre-incubated with Fluo-3/AM for 1 h then treated
with sample for 1 h. After incubation, cells were stimulated with 100 ng/mL of DNP-BSA.
The fluorescence intensity was detected at an excitation wavelength of 485 nm and an
emission wavelength of 535 nm. Intracellular calcium levels were compared with those of
non-stimulated cells, which were set at a value of one relative fluorescent unit.
4.8. Enzyme-linked immunosorbent assay (ELISA)
The secretion of cytokines and chemokines were quantified with commercial ELISA kits
(Human CCL17/TARC Duoset ELISA Kit, Human CCL22/MDC Duoset ELISA Kit; R&D
systems, Inc., MN, USA). After 24 h of sample treatment and stimulation, cell culture
supernatants were collected then the total concentration of TARC/CCL17 and MDC/CCL22
50
was measured according to the manufacturer’s instruction.
4.9. Reverse transcription-polymerase chain reaction (RT-PCR)
Total cellular RNA was extracted from HaCaT cells using TRIzol (Invitrogen Co, Grnad
island, NT, US). RNA samples were quantified and a total of 4 μg of RNA was reverse
transcribed using 200 units of reverse-transcriptase and 0.5 μg/μL oligo-(dT)15 dimer
(Bioneer CO., Korea). The amplification was performed using a PCR premix (Bioneer CO.,
Korea). Primers for IL-6, TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8 were
described in Table 6. PCR was performed using a Veriti Thermal Cycler (Applied
Biosystems, Foster City, CA, USA, Table 6). PCR products were separated by 2.0% agarose
gel electrophoresis and visualized with ethidium bromide.
51
Table 6. List of primers for RT-PCR
Gene Sequence (5’-3’)
Forward 5΄- ACCACAGTCCATGCCATCAC -3΄,

GAPDH
Reverse 5΄-CCACCACCCTGTTGCTGTAC -3΄.
Forward 5΄ - CTCCTTCTCCACAAGCGCC -3΄
IL-6
Reverse 5΄ - GCCGAAGAGCCCTCAGGC -3΄
Forward 5΄ - ATGGCCCCACTGAAGATGCT -3΄
TARC/CCL17
Reverse 5΄ - TGAACACCAACGGTGGAGGT -3΄
Forward 5΄ - AGGACAGAGCATGGCTCGCCTACAGA -3΄
MDC/CCL22
Reverse 5΄ - AATGGCAGGGAGGTAGGGCTCCTGA -3΄
Forward 5΄ - CCCCGTGCCGAGCACATCAAGGAGTATTT-3΄
RANTES/CCL5
Reverse 5΄ - CGTCCAGCCTGGGGAAGGTTTTTGTA -3΄
Forward 5΄ - TCAGTGCATAAAGACATACTCC -3΄
IL-8/CXCL8
Reverse 5΄ - TGGCATCTTCACTGATTCTTG -3΄
52
4.10. Western blot analysis
The cells and skin tissues were extracted using RIPA buffer. Next, cell and skin lysates
were homogenized to yield equivalent amounts of protein based on protein concentration
measurements performed with Bradford reagent (Bio-Rad, Hercules, CA, USA).
Homogenized proteins were electrophoresed by 10 to 15% sodium dodecyl sulfate-
polyacrylamide gel (SDS-PAGE) and thereafter transferred from SDS-PAGE to a
nitrocellulose membrane (Amersham Pharmacia Biotech, Buckinghamshire, UK). Non-
specific binding was blocked with 5% Bovine serum albumin in TBST (50 mmol / 1 Tris-
HCL, pH 7.5, 150 mmol / 1 NaCl, and 0.1% Tween 20) for 1 h at room temperature followed
by overnight incubation of membranes with primary antibodies at 4°C. The membranes were
then washed with TBST three times and incubated with secondary antibody (Santa Cruz
Biotechnology Inc., CA, USA) for 1 h at room temperature. Finally, proteins were visualized
using a chemiluminescence detection ECL reagent (GE Healthcare Life science, PA, USA)
and quantified with UVI-1D software, (UVITEC, Warwickshire, UK).
53
5. In vivo study
5.1. Experimental animals
Six-week-old male NC/Nga mice (21-26 g) were obtained from Central Lab Animals,
Inc. (Seoul, Korea). The animals were randomly divided into five groups of five mice per
cage and housed in conditions of 22 ± 1°C, 60 ± 5% humidity, and 12-h light/dark cycles.
Animals were acclimatized for 2 week before starting the study. The experimental protocol
[KHUASP(SE)-17-014] was approved by the Institutional Animal Care and Use Committee
of Kyung Hee University.
5.2. Induction of AD skin lesion and topical application
Eight week-old male NC/Nga mice were exposed with Biostir-AD (Biostir, Kobe,
Japan), a hydrophilic petrolatum-based ointment-containing extract of house dust mite
(Dermatophagoides farinae), according to the manufacturer’s instructions. After removing
mice hair, 150 μL of 4% (w/v) sodium dodecyl sulfate (SDS) was applied to that dorsal
skin. After drying, DFE (100 mg/mouse/time) was applied two times per week for 3 weeks.
Twenty five mice were divided into five groups of five mice per cage: (a) Normal (distilled
water only); (b) Control (DFE + distilled water); (c) Tacrolimus 0.1% (DFE + tacrolimus
0.1% in distilled water); (d) T. vulgaris 0.1% (DFE + T. vulgaris 0.1% in distilled water);
and (e) T. vulgaris 1% (DFE + T. vulgaris 1% in distilled water). Samples were applied three
54
times per week for 3 weeks. In this experiment, tacrolimus 0.1% was used as a positive
control.
5.3. Evaluation of AD skin symptoms
The relative severity of AD was evaluated macroscopically according to the following
five symptoms: erythema, edema, erosion, dryness, and lichenification. The total dermatitis
severity score was defined as the sum of component scores (0, no symptoms; 1, mild; 2,
moderate; 3, severe). The range of dermatitis score is 0 to 15. The dermatitis scoring was
performed by a blind test during the experimental period.
55
Table 7. Symptom indices depending on the severity of AD
Score 0 Score 1 Score 2 Score 3

Intensity
None Mild Moderate Severe
Erythema1
Edema1
Erosion1
Dryness2
Lichenification
1
1) ATOPY INSIDE [Website]. Accessed January 4, 2021, Retrieved from

https://www.atopy-inside.co.kr/symptoms-of-atopic-dermatitis
2) Warwick Friendly Society [Website]. Accessed January 4, 2021, Retrieved from
https://warwickfriendlysociety.com.au/eczema/
56
5.4. Measurement of physiological skin alteration
During the experimental period, physiological alteration of dorsal skin of experimental
animals were measured using skin measurement instrument (Dermalab ® combo, Cortex
Technology, Denmark). Skin parameters including video scope, high resolution ultrasound,
hydration, TEWL, and erythema were measured according to the manufacturer’s instruction
using appropriate probe. All data was analyzed by Dermalab skinlab software (Cortex
Technology, Denmark).
5.4.1. Video scope
The videoscope probe was able to enlarge and visualize the surface of the skin using
polarized or non-polarized white light as the light source.
5.4.2. High resolution ultrasound
Based on the acoustic response from the skin, ultrasound skin imaging is measured, when
an acoustic pulse is sent into the skin. The color scale was indicated by the intensity of the
received signal. Dark colors represent areas with low reflection (i.e. none or small changes in
density between the structures in the skin) and bright colors represent areas with strong
reflections (i.e. significant changes in density between structures).
5.4.3. Hydration
The hydration state was measured using a hydration probe, which was confirmed by
57
measurement of conducting characteristics of the very upper layers of the skin. The output
was provied in the unit of micro-Siemens (μS).
5.4.4. TEWL
The estimation of water loss was based on Nilsson’s Vapor Pressure Gradient method, an
open chamber method with minimal impact on the skin [73]. Two sets of
temperature/humidity sensors are mounted in a measurement chamber at different heights
above the skin surface. The measurement chamber is open to allow the skin to “breathe”
freely, and the evaporation rate follows Fick’s Law of Diffusion:
Rate = P x (c1 - c2) / T
where P = permeability coefficient of membrane, (c1 - c2) = concentration gradient, T =
thickness of membrane.
5.4.5. Erythema
Erythema is an index indicating the redness of the skin. Based on an active color
detecting chip, erythema was measured. The higher the value the more redness in the skin.
5.5. Evaluation of scratching behavior
To evaluate the effect of T. vulgaris on the scratching behavior, it was measured once a
week for 3 weeks . Each mouse in all groups was videotaped for 15 min with digital camera
placed on the top of the cages. The one scratching bout was defined as a series of scratching
58
movement by the hind paw.
5.6. Measurement of serum IgE level
After the experimental period, blood samples were obtained from mice then were
separated by centrifugation at 14,000 × g for 20 min at 4 ℃. The supernatants were collected
thereafter the total serum IgE were measured using a mouse IgE enzyme-linked
immunosorbent assay kit (BD Bioscience, CA, USA) according to manufacturer’s
instruction.
5.7. Histopathological analysis
After sacrifice, the back skin of each mouse was fixed in 4% paraformaldehyde for 24 h.
Next, the dorsal skin specimens were embedded in paraffin and sectioned at 5 μm.
Hematoxylin and eosin (H&E) staining was used to observe epidermal thickness. Toluidine
blue (TB) staining was used to measure the degree of mast cell infiltration. After H&E and
TB staining, all stained skin specimens were observed by light microscope.
59
6. Statistical analysis
The results were determined using the Statistical Analysis System (GraphPad Prism 5).
All experiments were carried out in triplicate. Data were expressed as means ± standard
deviation (SD). One-way analysis of variance (ANOVA) was used for a statistical
comparison between different treatments. Student’s t-tests were used to compare individual
treatments to the controls. The level of statistical significance was set as follows: # and *
p < 0.05, ## and ** p < 0.01, and ### and *** p < 0.001.
60
Ⅲ. Results
1. The identification of active components from T. vulgaris
The active components of T. vulgaris were detected by HPLC analysis. As shown in the
chromatogram, caffeic acid was confirmed as the active component at 17.5 min by 0.4%
(Figure 7A). Also, rosmarinic acid was found as the active component at 42.8 min by 5.8%
(Figure 7B).
61
(A)
(B)
Figure 7. HPLC analysis of T. vulgaris, caffeic acid, and rosmarinic acid standard.
As an active component of T. vulgaris, (A) caffeic acid and (B) rosmarinic acid were
detected.
62
63
Table 8. Active components of T. vulgaris
T. vulgaris
Name Caffeic acid Name Rosmarinic acid
Formula C 9H8O 4 Formula C18H16O8
Molecular weight 180.16 Molecular weight 360.32
Content 0.4% Content 5.8%
64
2. Effects of T. vulgaris on atopic dermatitis and histamine response: in vitro
2.1. Effects of T. vulgaris on atopic dermatitis inflammation in Raw 264.7 cells
2.1.1. Cell viability
To investigate the effect of T. vulgaris on cell viability in Raw 264.7 cells, MTT assay
was conducted. As shown in Figure 8A, cell viability was reduced in LPS-stimulated
Raw264.7 cells compared with non-stimulated cells. The cells treated with
T. vulgaris showed no cytotoxicity.
65
2.1.2. NO production
Excessive NO production was observed following LPS-stimulation. Compared to non-
stimulated condition, LPS treatment triggered NO production by 552.6% (Figure 8B).
However, at a concentration of 100 µg/mL, T. vulgaris treatment significantly attenuated the
LPS-induced overproduction of NO by 57.1% of that in only LPS-stimulated
cells.
66
(A)
(B)
Figure 8. Effects of T. vulgaris on cell viability and NO production in LPS-stimulated

Raw 264.7 cells.
(A) Cell viability was measured by MTT assay. (B) Nitric oxide production was determined
by NO assay. Dexamethasone was used as a positive control. All data are shown as the mean
± standard deviation of at least three independent experiments. # and * indicate significant
differences between non-stimulated control and LPS-stimulated control, respectively.
###p < 0.001, versus non-stimulated control. **p < 0.01 and ***p < 0.001, versus LPS-
67
stimulated control.
2.2. Effects of T. vulgaris on histamine related allergic response in RBL-2H3 cells
To determine cytotoxic influences of T. vulgaris in DNP-IgE/BSA-stimulated RBL-2H3
cells, MTT assay was performed. After sensitization with DNP-IgE, cells were pretreated
with ketotifen fumarate, tacrolimus, and T. vulgaris, and then stimulated with DNP-
BSA. Non-stimulated cells were regarded as 100% viability. Compared with non-stimulated
cells, DNP-IgE/BSA-stimulated cells showed a slight decrease in viability. Treatment with
ketotifen fumarate, tacrolimus, and T. vulgaris induced no noticeable cytotoxicity compared
to non-stimulated conditions (Figure 9A).
68
2.2.2. β-hexosaminidase release
To evaluate the effect of T. vulgaris on mast cell degranulation, β-hexosaminidase assay
was conducted in DNP-IgE/BSA-stimulated RBL-2H3 cells. β-hexosaminidase release
increased up to 787.0% in DNP-IgE/BSA-stimulated cells compared to non-stimulated cells.
However, treatment with ketotifen fumarate, tacrolimus, and T. vulgaris reduced the release
of β-hexosaminidase. T. vulgaris significantly inhibited β-hexosaminidase release in a dose-
dependent manner at 50, 100, and 250 μg/mL by 24.5%, 36.5%, and 52.7%, respectively
(Figure 9B).
69
2.2.3. Histamine release
The release of histamine, which plays an important role in allergic reactions [17], was
measured in DNP-IgE/BSA-stimulated RBL-2H3 cells. Histamine release increased up to
533.5% in DNP-IgE/BSA-stimulated cells compared to non-stimulated cells. In contrast, it
was suppressed in the cells treated with ketotifen fumarate, tacrolimus, and
T. vulgaris. T. vulgaris markedly decreased the release of histamine in a dose-dependent
manner at 100 and 250 μg/mL by 32.5% and 38.0%, respectively (Figure 9C). These results
showed that T. vulgaris has anti-allergic effect by inhibiting mast cell degranulation.
70
(A)
(B)
(C)
Figure 9. Effects of T. vulgaris on cell viability, β-hexosaminidase, and histamine

release in DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Cell viability, (B) β-hexosaminidase release, (C) Histamine release were determined.
Ketotifen fumarate and tacrolimus were used as a positive control. All data are shown as the
mean ± standard deviation of at least three independent experiments.
# and * indicate significant differences between non-stimulated control and DNP-IgE/BSA-
stimulated control, respectively. ###p < 0.001, versus non-stimulated control.
*p < 0.05, **p < 0.01, and ***p < 0.001, versus DNP-IgE/BSA-stimulated control.
71
2.2.4. Intracellular calcium levels
In mast cell degranulation, the change of intracellular calcium levels occur. The
increased calcium levels are essential in response to mast cell stimulation, which induces
granule-plasma membrane fusion, resulting in degranulation of mast cells. It leads to the
release of mediators such as β-hexosaminidase and histamine [74]. Therefore, the inhibition
of intracellular calcium levels is important to suppress release of histamine. To determine
the mechanism by which T. vulgaris suppressed mast cell degranulation, intracellular calcium
levels were measured. The inhibitory effects of ketotifen fumarate, tacrolimus, and
T. vulgaris on intracellular calcium release were analyzed using the fluorescent indicator
Fluo-3/AM. Although the intracellular calcium levels were increased by
DNP-IgE/BSA-stimulation, treatment with ketotifen fumarate, tacrolimus, and
T. vulgaris significantly suppressed intracellular calcium levels compared to only DNP-
IgE/BSA-stimulated cells. In particular, T. vulgaris impeded the elevation of intracellular
calcium levels at a concentration of 50, 100, and 250 μg/mL, which was more effective than
those of ketotifen fumarate and tacrolimus (Figure 10).
72
Figure 10. Effects of T. vulgaris on intracellular calcium levels in DNP-IgE/BSA-
stimulated RBL-2H3 cells.
Intracellular calcium levels in DNP-IgE/BSA-stimulated RBL-2H3 cells. Ketotifen fumarate
and tacrolimus were used as a positive control. Intracellular calcium levels were compared to
those of non-stimulated control cells, which were set at a value of one relative fluorescent
unit. # and * indicate significant differences between non-stimulated control and
DNP-IgE/BSA-stimulated control, respectively. ##p < 0.01 versus non-stimulated control.
*p < 0.05 and **p < 0.01, versus DNP-IgE/BSA-stimulated control.
73
2.2.5. Signaling pathways in histamine release
2.2.5.1. CRHR1 and CRHR2 expression
In mast cell degranulation, CRHR1 acts as a potentiator, while CRHR2 acts as an
inhibitor, resulting in histamine release [39]. The effect of T. vulgaris on the expression of
CRHR1 and CRHR2 was confirm by western blot analysis. The stimulation of DNP-IgE/BSA
augmented the expression of CRHR1, while the expression of CRHR2 was suppressed in
only DNP-IgE/BSA-stimulated cells. But, it was altered by treatment with
T. vulgaris. T. vulgaris decreased the expression of CRHR1 by 86.1% and enhanced the
expression of CRHR2 up to 138.8% at a concentration of 250 μg/mL, compared to only
DNP-IgE/BSA-stimulated cells (Figure 11). These regulation inhibits the mobilization of
calcium, which in turn leads to a decrease in the release of histamine.
74
(A)
(B)
Figure 11. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in

DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Protein expression of CRHR1 and CRHR2 in DNP-IgE/BSA-stimulated RBL-2H3 cells.
(B) Band intensities were quantified by densitometry, normalized to the level of β-actin and
calculated as a percentage of the basal response. All data are shown as the mean ± standard
deviation of at least three independent experiments. # and * indicate significant differences
between non-stimulated control and DNP-IgE/BSA-stimulated control, respectively.
#p < 0.05 and ##p < 0.01, versus non-stimulated control. *p < 0.05, **p < 0.01, and
***p < 0.001, versus DNP-IgE/BSA-stimulated control.
75
76
2.2.5.2. phosphorylation of PLCγ
Upon stimulation with DNP-IgE/BSA, PLCγ is activated through phosphorylation. The
phosphorylation of PLCγ generates IP3 which results in the release of intracellular calcium
from endoplasmic reticulum (ER). This causes mast cell degranulation, leading to an
increase in histamine release [75]. To investigate the effect of T. vulgaris on phosphorylation
of PLCγ, RBL-2H3 cells were stimulated with DNP-IgE/BSA. The level of phosphorylated
PLCγ was up-regulated in only DNP-IgE/BSA-stimulated cells. However, treatment with
T. vulgaris inhibited the phosphorylation level of PLCγ by 81.2% at 100 μg/mL which was
more effective than those of ketotifen fumarate and tacrolimus (Figure 12). It was verified
that the decrease in histamine release by T. vulgaris is due to the reduction of calcium level
through downregulation of PLCγ phosphorylation.
77
(A)
(B)
Figure 12. Effects of T. vulgaris on phosphorylation of PLCγ in DNP-IgE/BSA-

(A) Protein expression of p-PLCγ and PLCγ in DNP-IgE/BSA-stimulated RBL-2H3 cells.
###p < 0.001, versus non-stimulated control. *p < 0.05 and ***p < 0.001, versus
DNP-IgE/BSA-stimulated control.
78
2.2.5.3. phosphorylation of IP3R
After the phosphorylation of PLCγ, IP3 is generated and then binds to its receptor, IP3R,
existed in ER membrane. When IP3R is phosphorylated, calcium release from ER is
induced. Consequently, this causes the influx of extracellular calcium, which increases the
release of histamine through exocytosis of mast cells [76]. To investigate the effect of
T. vulgaris on phosphorylation of IP3R, RBL-2H3 cells were stimulated with
DNP-IgE/BSA. As shown in Figure 13, the level of phosphorylated IP3R was up-regulated
in only DNP-IgE/BSA-stimulated cells. However, treatment with T. vulgaris inhibited the
phosphorylation level of IP3R by 98.3% at a concentration of 250 μg/mL. This results
showed that T. vulgaris affects the suppression of calcium depletion in ER.
79
(A)
(B)
Figure 13. Effects of T. vulgaris on phosphorylation of IP3R in DNP-IgE/BSA-

(A) Protein expression of p-PLCγ and PLCγ in DNP-IgE/BSA-stimulated RBL-2H3 cells.
###p < 0.001, versus non-stimulated control. *p < 0.05 and ***p < 0.001, versus
DNP-IgE/BSA-stimulated control.
80
2.2.5.4. calcium channel protein expressions
The granulation of mast cell depends on the concentration of calcium released from ER.
After the release of calcium from ER, calcium channel proteins such as STIM1, Orai1, and
TRPC1 are activated. Due to this, the influx of extracellular calcium is elevated that
accelerates the release of histamine [74]. Thus, the expression levels of STIM1, Orai1, and
TRPC1 were investigated. The stimulation with DNP-IgE/BSA increased the expression of
these proteins. In cells treated with T. vulgaris, the expressions of STIM1, Orai1, and
TRPC1 decreased by 20.8%, 69.0%, and 82.3% at 250 μg/mL, respectively (Figure 14).
These results indicated that T. vulgaris treatment blocks the extracellular calcium influx via
downregulation of calcium channel proteins including STIM1, Orai1, and TRPC1, thereby
reducing the release of histamine.
81
(A)
(B)
Figure 14. Effects of T. vulgaris on expression of calcium channel proteins in

DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Protein expression of STIM1, Orai1, TRPC1 in DNP-IgE/BSA-stimulated RBL-2H3
cells. (B) Band intensities were quantified by densitometry, normalized to the level of β-
actin. All data are shown as the mean ± standard deviation of at least three independent
experiments. # and * indicate significant differences between non-stimulated control and
DNP-IgE/BSA-stimulated control, respectively. ##p < 0.01 and ###p < 0.001, versus non-
stimulated control. *p < 0.05, **p < 0.01, and ***p < 0.001, versus DNP-IgE/BSA-
stimulated control.
82
2.3. Effect of T. vulgaris on atopic dermatitis inflammation in HaCaT cells
The cytotoxicity of T. vulgaris was confirmed by MTT assay in TNF-α/IFN-γ-stimulated
HaCaT cells. Cells were pretreated with T. vulgaris (10 and 100 μg/mL) and tacrolimus (1
and 10 μg/mL), and then stimulated with 10 ng/mL of TNF- α/IFN-γ. Non-stimulated cells
were regarded as 100% viability. Compared with non-stimulated cells, TNF-α/IFN-γ-
stimulated cells showed a slight decrease in viability. Both T. vulgaris and tacrolimus
treatment induced no noticeable cytotoxicity compared to only TNF-α/IFN-γ-stimulated
conditions (Figure 15A).
83
2.3.2. Chemokine production
The production of TARC/CCL17 and MDC/CCL22 was affected by T. vulgaris
treatment in TNF-α/IFN-γ-stimulated HaCaT cells. When cells were stimulated by
TNF-α/IFN-γ with no other pretreatment, the production of TARC/CCL17 and MDC/CCL22
was increased by 781.4% and 885.6%, respectively, compared to non-stimulated cells.
However, tacrolimus and T. vulgaris treated cell showed suppressed TARC/CCL17
production by 35.5% at 10 μg/mL of tacrolimus and by 89.0% at 100 μg/mL of
T. vulgaris, respectively, compared to those of only TNF-α/IFN-γ-stimulated cells. The
production of MDC/CCL22 also decreased by 41.5% at 1 μg/mL of tacrolimus and by 64.5%
at 100 μg/mL of T. vulgaris, respectively, compared with those of only TNF-α/IFN-γ-
stimulated cells. As a result, T. vulgaris treatment showed stronger inhibitory effect on
TARC/CCL17 and MDC/CCL22 production than tacrolimus treatment (Figure 15B and C).
84
(A)
(B)
(C)
Figure 15. Effects of T. vulgaris on cell viability and chemokines production in

TNF-α/IFN-γ-stimulated HaCaT cells.
(A) Cell viability was measured using MTT assay. (B) TARC/CCL17 production, (C)
MDC/CCL22 production were determined by using ELISA kit. All data are shown as the
mean ± standard deviation of at least three independent experiments. # and * indicate
significant differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. ###p < 0.001, versus non-stimulated control. *p < 0.05, **p < 0.01, and
85
***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
86
2.3.3. mRNA expression of pro-inflammatory cytokines and chemokines
As shown in Figure 16, pro-inflammatory cytokine (IL-6) and chemokines
(TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8) mRNA expressions were
increased after stimulation with TNF-α/IFN-γ. The mRNA expression levels of
IL-6, TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8 increased by
345.0%, 144.1%, 174.9%, 372.8%, and 201.2% in only TNF-α/IFN-γ-stimulated cells,
respectively, compared with the non-stimulated cells. Importantly,
T. vulgaris and tacrolimus markedly reduced those overexpression levels. Treatment with
T. vulgaris at 100 μg/mL decreased the mRNA expression levels of IL-6, TARC/CCL17,
MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8 by 30.6%, 35.1%, 38.0%, 63.0%, and
30.9%, respectively, compared with only TNF-α/IFN-γ-stimulated cells.
87
(A)
(B)
Figure 16. Effects of T. vulgaris on mRNA expression of pro-inflammatory cytokines

and chemokines in TNF-α/IFN-γ-stimulated HaCaT cells.
(A) mRNA expression of IL-6, TARC, MDC, RANTES, and IL-8 in TNF-α/IFN-γ-
stimulated HaCaT cells. (B) An equimolar quantity of mRNA was quantified compared to
GAPDH. Tacrolimus was used as a positive control. All data are shown as the mean ±
standard deviation of at least three independent experiments. # and * indicate significant
differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. #p < 0.05, ##p < 0.01, and ###p < 0.001, versus non-stimulated control.
88
*p < 0.05, **p < 0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
89
2.3.4. Signaling pathways in inflammatory response
2.3.4.1. MAPKs activation
TNF-α/IFN-γ activated MAPK signaling pathways resulting in overexpression of pro-
inflammatory cytokines [16]. The activation was examined by detecting the phosphorylation
level of MAPKs by western blot analysis. TNF-α/IFN-γ treatment triggered the
phosphorylation of p-38, JNK, and ERK by 125.5%, 171.4%, and 130.4%, respectively.
However, it was reversed by treatment of tacrolimus and T. vulgaris that they suppressed
this phosphorylation. T. vulgaris treatment at concentration of 100 μg/mL significantly
inhibited the phosphorylation of p-38 and JNK by 46.8% and 39.5%, respectively (Figure
17).
90
(A)
(B)
Figure 17. Effects of T. vulgaris on activation of MAPKs in TNF-α/IFN-γ-stimulated

HaCaT cells.
(A) Protein expression of p-p38, p38, p-JNK, JNK, p-ERK, and ERK in TNF-α/IFN-γ-
stimulated HaCaT cells. (B) Band intensities were quantified by densitometry, normalized to
the level of β-actin, and calculated as a percentage of the basal response. All data are shown
as the mean ± standard deviation of at least three independent experiments. # and * indicate
significant differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. #p < 0.05 and ##p < 0.01, versus non-stimulated control. *p < 0.05, **p <
91
0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
2.3.4.2. NFκB and STAT1 activation
Inflammators increase the expression of IκB kinase (IKK) complex with three subunits
(IKKα, IKKβ, and IKKγ) leads to phosphorylation and degradation of the IκBα. The
phosphorylated IκBα binds to NF-κB. This complex moves into nucleus and activates
inflammatory genes [16]. At the same time, STAT1 responses to stimuli and can lead to
overexpression of inflammatory and immune response genes [52].
As predicted, TNF-α/IFN-γ treatment triggered IKKα/β, IκB, NF-κB, and STAT1
phosphorylation as shown in Figure 18 and 19. The phosphorylation of IKKα/β, IκB, NF-
κB, and STAT1 was overexpressed by 272.9%, 131.3%, 164.7%, and 129.0%, respectively,
in only TNF-α/IFN-γ stimulated cells, compared with non-stimulated cells. However, it was
reversed by treatment of tacrolimus and T. vulgaris. At a concentration of 100 μg/mL,
T. vulgaris significantly decreased the phosphorylation levels of IKKα/β, IκB, NF-κB, and
STAT1 by 39.0%, 71.3%, 39.3%, and 72.7%, respectively, compared with only TNF-α/IFN-
γ stimulated cells. Therefore, the results suggest that T. vulgaris can diminish the production
of inflammatory cytokines and chemokines via regulation these signaling pathways.
92
(A)
(B)
Figure 18. Effects of T. vulgaris on NFκB signaling pathway in TNF-α/IFN-γ-stimulated

HaCaT cells.
(A) Protein expression of p-IKKα/β, IKKα/β, p-IκBα, IκBα, p-NFκB, and NFκB in
TNF-α/IFN-γ-stimulated HaCaT cells. (B) Band intensities were quantified by densitometry,
normalized to the level of β-actin. All data are shown as the mean ± standard deviation. #
and * indicate significant differences between non-stimulated control and TNF-α/IFN-γ-
stimulated control, respectively. #p < 0.05 and ##p < 0.01, versus non-stimulated control.
93
*p < 0.05, **p < 0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
(A)
(B)
Figure 19. Effects of T. vulgaris on STAT1 signaling pathway in TNF-α/IFN-γ-

stimulated HaCaT cells.
(A) Protein expression of p-STAT1 and STAT1 in TNF-α/IFN-γ-stimulated HaCaT cells.
between non-stimulated control and TNF-α/IFN-γ-stimulated control, respectively. #p <
0.05, versus non-stimulated control. *p < 0.05 and **p < 0.01, versus TNF-α/IFN-γ -
stimulated control.
94
95
3. Effects of T. vulgaris on atopic dermatitis and histamine response: in vivo
3.1. Morphological characteristics
3.1.1. Body weight
AD skin lesions were treated with tacrolimus and T. vulgaris. Compared to normal
group, no noticeable changes in the body weight were observed in the other group. In
addition, no abnormal symptoms were recorded in all groups, indicating that the tested
samples ensure safety, without toxicity or adverse effects (Figure 20).
96
Figure 20. Effects of T. vulgaris on body weight in DFE-induced NC/Nga mice.
NC/Nga mice exposed to DFE and treated with tacrolimus and T. vulgaris during 3 weeks.
Body weight was measured during 3 weeks.
97
3.1.2. Spleen weight
AD induces a variety of responses in the immune system leading to increase the weight
of immune organs such as spleen [77]. As expected, the weight of spleen was significantly
increased by 202.7% than that of the normal group. However, it was reduced by topical
application of tacrolimus and T. vulgaris. The average weight of tacrolimus-applied mice’s
spleen was decreased by 34.4% compared to that of the DFE-applied control group. In the
groups treated with T. vulgaris at 0.1% and 1%, the weight of spleen was significantly
decreased by 22.5% and 27.7%, respectively, compared to the control group (Figure 21).
98
Figure 21. Effects of T. vulgaris on spleen weight in DFE-induced NC/Nga mice.
Spleen weight in AD-induced mice. Values shown are the mean ± standard deviation. # and
* indicate significant differences between normal group and control group, respectively.
###p < 0.001, versus normal group. **p < 0.01 and ***p < 0.001, versus control group.
99
3.1.3. Skin morphology
The severity of dermatitis was determined according to the sums of the scores for each
symptoms once a week for 3 weeks. In DFE-induced mice, skin symptoms such as
erythema, edema, erosion, dryness, and lichenification were observed. After 3 weeks, the
DFE topical applied mice have all typical characteristics of atopic dermatitis disease as listed
above with maximum dermatitis score 9.0 ± 1.7. Topical application of tacrolimus and
T. vulgaris significantly improved the AD-like skin symptoms (Figure 22A). Among three
groups tacrolimus 0.1%, T. vulgaris 0.1%, and T. vulgaris 1%, the T. vulgaris 0.1% group
was the most effective sample in decreasing dermatitis symptoms in AD-induced mice skin
(Figure 22B).
100
(A)
101
102
(B)
Figure 22. Effects of T. vulgaris on skin morphology in DFE-induced NC/Nga mice.

(A) Clinical picture of DFE-induced AD-like lesions. (B) Dermatitis score. (G). The number
of mast cells. Five groups: Normal group, Control group (DFE treatment), PC group (DFE
treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%),
T. vulgaris 1% group (DFE treatment + T. vulgaris 1%). Values shown are the mean ±
standard deviation of at least three independent experiments. # and * indicate significant
differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. *p < 0.05, **p < 0.01, and ***p <
0.001, versus control group.
103
3.2. Physiological characteristics
3.2.1. Skin density
To confirm the effects of T. vulgaris on skin density in DFE-induced NC/Nga mice,
Dermalab combo skin measurement instrument used to estimate the skin density. The skin
density was visualized by green and yellow-colored graphics. As shown in Figure 23,
damaged skin density was showed in DFE-induced control group compared to the normal
group. However, the abnormal loss of skin density was improved by topical application of
T. vulgaris.
104
(A)
(B)
Figure 23. Effects of T. vulgaris on skin density in DFE-induced NC/Nga mice.

(A) The levels of collagen and dermal thickness were determined using Dermalab Combo
(Cortex Technology, DK). (B) Relative density was measured.). Five groups: Normal group,
Control group (DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%),
T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE
treatment + T. vulgaris 1%). Values shown are the mean ± standard deviation of at least
three independent experiments. # and * indicate significant differences between normal
group and control group, respectively. ###p < 0.001, versus normal group. **p < 0.01,
versus control group.
105
106
3.2.2. Skin hydration
AD causes skin dryness by reducing strantum corneum (SC) hydration [77]. At the end
of 3 weeks, SC hydration was diminished by 78.3% in the control group than that of the
normal group. These physiological changes were improved by topical application of
tacrolimus and T. vulgaris. SC hydration was significantly enhanced by over 300% for all
topical application including tacrolimus, T. vulgaris 0.1%, and T. vulgaris 1% (Figure 24A).
107
3.2.3. TEWL
AD causes skin dryness by increasing TEWL [16]. At the end of 3 weeks, TEWL was
elevated by 371.9% in the control group than that of the normal group. However, this was
improved by topical application of tacrolimus and T. vulgaris. In the T. vulgaris 0.1% and 1%
group, TEWL decreased by 58.1% and 62.8%, respectively, compared to the control group
(Figure 24B). In particular, T. vulgaris 1% group reduced TEWL more effectively than the
tacrolimus 0.1% group.
108
3.2.4. Erythema index
The increased erythema index is well known as one of the symptoms of AD [16]. At the
end of 3 weeks, erythema index was increased by 1510.8% in the control group, compared
with the normal group. This increased erythema index was improved by topical application
of tacrolimus and 0.1% and 1% T. vulgaris. Treatment with T. vulgaris 0.1% and 1%
reduced erythema index by 56.7% and 63.1%, respectively, compared to that of the control
group (Figure 24C).
109
(A) (B)
(C)
Figure 24. Effects of T. vulgaris on skin hydration, TEWL, and erythema index in DFE-
induced NC/Nga mice.
(A) SC hydration, (B) TEWL, and (C) erythema index were determined using Dermalab
Combo (Cortex Technology, DK). Five groups: Normal group, Control group (DFE
treatment), PC group (DFE treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group (DFE
treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE treatment + T. vulgaris 1%).
Values shown are the mean ± standard deviation. # and * indicate significant differences
between normal group and control group, respectively. ###p < 0.001, versus normal group.
110
***p < 0.001, versus control group.
3.3. Itching related characteristics
3.3.1. Scratching behavior
During the experimental period, the number of scratches was assessed to verify
inhibitory effect of T. vulgaris on itching associated with AD. In the control group, topical
application of DFE led to a significant increase in the number of scratches 32 times higher
than that of the normal group. After topical application of tacrolimus and
T. vulgaris for 3 weeks, the number of scratches was remarkably reduced by 8.9 times for
tacrolimus group, by 6.5 times for the T. vulgaris 0.1% group, and by 3.4 times for the
T. vulgaris 1% group than that of the control group (Figure 25).
111
Figure 25. Effects of T. vulgaris on scratching behavior in DFE-induced NC/Nga mice.
Scratching behavior in DFE-induced NC/Nga mice. Five groups: Normal group, Control
group (DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%),
T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE
treatment + T. vulgaris 1%). Values shown are the mean ± standard deviation. # and *
indicate significant differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. *p < 0.05, **p < 0.01, and ***p <
112
3.3.2. Serum IgE level
In the control group, serum IgE level was increased up to 1850.3% compared with the
normal group. This increased serum IgE level was significantly reduced in the groups treated
with tacrolimus and T.vulgaris. Both T.vulgaris 0.1% and T.vulgaris 1% groups inhibited IgE
level by 61.8% and 89.5%, respectively, compared with the control group. This inhibitory
effect of T.vulgaris 1% group was more effective than that of the tacrolimus 0.1% group
(Figure 26).
113
Figure 26. Effects of T. vulgaris on serum IgE level in DFE-induced NC/Nga mice.
Serum IgE level in DFE-induced NC/Nga mice. Five groups: Normal group, Control group
(DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group
(DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE treatment + T. vulgaris
1%). Values shown are the mean ± standard deviation. # and * indicate significant
differences between normal group and control group, respectively.
###p < 0.001, versus normal group. **p < 0.01 and ***p < 0.001, versus control group.
114
3.3.3. β-hexosaminidase and histamine release
In the control group, serum β-hexosaminidase level was increased up to 134.9%
compared with the normal group. This increased serum β-hexosaminidase level was
significantly reduced in the groups treated with tacrolimus and T.vulgaris. Both T.vulgaris
0.1% and T.vulgaris 1% groups inhibited β-hexosaminidase by 15.3% and 21.4%,
respectively, compared with the control group (Figure 27A).
Compared with the normal group, serum histamine level was increased up to 274.1% in
the control group. In tacrolimus and T.vulgaris treated group, serum histamine levels were
markedly diminished. Both T.vulgaris 0.1% and T.vulgaris 1% groups inhibited histamine
release by 35.3% and 53.7%, respectively, compared with the control group (Figure 27B).
115
(A)
(B)
Figure 27. Effects of T. vulgaris on β-hexosaminidase and histamine release in DFE-

induced NC/Nga mice.
β-hexosaminidase and histamine release in DFE-induced NC/Nga mice. Values shown are
the mean ± standard deviation. # and * indicate significant differences between normal group
and control group, respectively. ###p < 0.001, versus normal group. *p < 0.05 and ***p <
116
117
3.4. Signaling pathways related atopic dermatitis symptoms
3.4.1. CRHR1 and CRHR2 expression
The effect of T. vulgaris on expression of CRHR1 and CRHR2 in DFE- induced NC/Nga
mice was confirm by western blot analysis. The expression of CRHR1 was increased by DFE
treatment, whereas the expression of CRHR2 was suppressed in only DFE-induced NC/Nga
mice. This was reversed by treatment with T. vulgaris. Compared to only DFE-induced
NC/Nga mice, treatment with 1% T. vulgaris reduced the expression of CRHR1 by 54.9%
and induced the expression of CRHR2 up to 249.3% (Figure 28).
118
(A)
(B)
Figure 28. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DFE-induced

NC/Nga mice.
(A) Protein expression of CRHR1 and CRHR2 in AD-induced mice skin. (B) Band
intensities were quantified by densitometry, normalized to the level of β-actin and calculated
as a percentage of the basal response. Values shown are the mean ± standard deviation. # and
* indicate significant differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. * p < 0.05, **p < 0.01, and ***p <
119
3.4.2. MAPKs activation
The expression levels of p-p38 and p-ERK were elevated in the control group by 238.1%
and 134.8%, respectively, than those of the normal group. Topical application of tacrolimus
and T. vulgaris induced down-regulation of p-p38 and p-ERK expression. In the
T. vulgaris 1% group, the expression levels of p-p38 and p-ERK were reduced by 77.7% and
41.9%, respectively, than those of the control group (Figure 29).
120
(A)
(B)
Figure 29. Effects of T. vulgaris on activation of MAPKs in DFE-induced NC/Nga mice.

(A) Protein expression of MAPKs in AD-induced mice skin. (B) Band intensities were
quantified by densitometry, normalized to the level of β-actin and calculated as a percentage
of the basal response. Values shown are the mean ± standard deviation. # and * indicate
significant differences between normal group and control group, respectively.
##p < 0.01, versus normal group. *p < 0.05, **p < 0.01, and ***p < 0.001, versus control
group.
121
122
3.4.3. IκBα and NFκB activation
The expression levels of p-IκBα and NF-κB were elevated in the control group by 965.1%
and 154.9%, respectively, than those of the normal group. On the other hand, topical
application of tacrolimus and T. vulgaris down-regulated the expression of p-IκBα up-
regulated the expression of IκBα. In the T. vulgaris 1% group, the expression levels of p-
IκBα and NF- κB were reduced by 75.4% and 30.8%, respectively, than those of the control
group (Figure 30).
123
(A)
(B) (C)
Figure 30. Effects of T. vulgaris on IκBα and NFκB in DFE-induced NC/Nga mice.
(A) Protein expression of IκBα and NFκB in AD-induced mice skin. (B) Band intensities
were quantified by densitometry, normalized to the level of β-actin and calculated as a
percentage of the basal response. Values shown are the mean ± standard deviation. # and *
indicate significant differences between normal group and control group, respectively.
#p < 0.05 and ###p < 0.001, versus normal group. * p < 0.05 and **p < 0.01, versus control
group.
124
3.4.4. Filaggrin expression
Filaggrin plays an important role in skin barrier function. In AD, it is characterized by a
decrease in filaggrin expression [24]. Therefore, the effect of T. vulgaris on filaggrin was
investigated. Compared with the normal group, the expression of filaggrin was diminished
by 36.8% in the control group. However, in the groups treated with tacrolimus,
T. vulgaris 0.1% and 1%, filaggrin expression was elevated by 128.7%, 112.4%, and
137.6%, respectively, compared with the control group (Figure 31).
125
(A)
(B)
Figure 31. Effects of T. vulgaris on filaggrin expression in DFE-induced NC/Nga mice.

(A) Protein expression of filaggrin in AD-induced mice skin. (B) Band intensities were
quantified by densitometry, normalized to the level of β-actin and calculated as a percentage
of the basal response. Values shown are the mean ± standard deviation. # and * indicate
significant differences between normal group and control group, respectively.
###p < 0.001, versus normal group. ***p < 0.001, versus control group.
126
3.5. Histological characteristics
3.5.1. Epidermal thickness
The epidermal thickness in the control group was significantly increased by 712.7%
compared with the normal group. Treatment with tacrolimus, T. vulgaris 0.1%, and 1%
decreased the epidermal thickness by 44.5%, 70.0%, and 59.1%, respectively, compared with
that of the control group. The epidermal thickness in the T. vulgaris 0.1% and 1% group was
thinner than that of the tacrolimus 0.1% group (Figure 32).
127
(A)
(B)
Figure 32. Effects of T. vulgaris on epidermal thickness in DFE-induced NC/Nga mice.

The dorsal skin’s histopathological features revealed by HE staining. Values shown are the
mean ± standard deviation. # and * indicate significant differences between normal group
and control group, respectively. ###p < 0.001, versus normal group. **p < 0.01 and
128
***p < 0.001, versus control group.
129
3.5.2. Accumulation of mast cells
Skin-infiltrating inflammatory cells, containing mast cells, eosinophils, Langerhans
cells, and CD4+ lymphocytes expressing skin colonization antigen, play a crucial role in the
initiation and exacerbation of inflammation in AD [17]. To investigate the effect of
T. vulgaris on accumulation of mast cells, TB staining was performed. While the number of
mast cells in the control group increased compared to the normal group, this was reduced by
treatment with tacrolimus, T. vulgaris 0.1%, and 1% (Figure 33).
130
(A)
(B)
Figure 33. Effects of T. vulgaris on accumulation of mast cells in DFE-induced NC/Nga

mice.
The the number of mast cells revealed by TB staining. Values shown are the mean ±
standard deviation. # and * indicate significant differences between normal group and
control group, respectively. ##p < 0.01, versus normal group. *p < 0.05 and **p < 0.01,
versus control group.
131
Ⅳ. Discussion
AD is a chronic inflammatory skin disease that persists without complete recovery or
repeatedly recurs in both childhood and adulthood. The pathogenic mechanism of AD can be
related to the exposure to environmental or chemical agents or abnormal genetic and
immunologic processes [24]. However, the exact causes of and treatments for AD are not
yet fully understood. For decades, many patients with AD have used topical corticosteroids
or topical calcineurin inhibitors, but these can have side effects. Long-term use of topical
corticosteroids can trigger skin atrophy, acne, and telangiectasia. Tacrolimus, a calcineurin
inhibitor, can cause side effects, such as a burning sensation and neurotoxicity [59, 69].
Thus, the development of natural product-derived treatments with few side effects is
considerable interest.
T. vulgaris, commonly known as thyme, is an aromatic evergreen herb used as a
cosmetic, spice, and medicine. T. vulgaris has a variety of beneficial effects, including
antioxidant [12], antimicrobial [4], and anti-inflammatory activities [3]. These biological
effects are influenced by various components, such as rosmarinic acid, caffeic acid, and
thymol. Although the anti-inflammatory effects of T. vulgaris were well known, the effect on
AD has not been reported. Therefore, this study was conducted to reveal the anti-atopic
effect of T. vulgaris in AD-induced in vitro and in vivo models.
132
Macrophages are associated with the immune response and control NO and pro-
inflammatory cytokines, which are regarded as pro-inflammatory mediators [77]. In this
study, Raw 264.7 cells were treated with LPS that resulted in elevation of NO production.
However, compared with only LPS-treated cells, treatment with T. vulgaris significantly
reduced NO production at a concentration of 100 μg/mL (Figure 8).
In allergic reactions, mast cells are considered the main effector cells. They express
FcεRI, the high-affinity IgE receptor, on the surface which are stimulated by allergens.
When mast cells are activated by the cross-linking of membrane-bound IgE with FcεRI, the
granules present are degranulated, releasing vast amounts of stored mediators, including β-
hexosaminidase, histamine, and proteases. Therefore, β-hexosaminidase and histamine are
markers for mast cell degranulation. These mediators are associated with the regulation of
inflammatory reactions in other immune-related cells, including keratinocytes and
lymphocytes [45]. In DNP-IgE/BSA-stimulated RBL-2H3 cells, the inhibitory effect of
T. vulgaris on mast cell degranulation was examined. Mast cell degranulation was reduced
by suppressing the release of β-hexosaminidase and histamine (Figure 9).
The intracellular calcium levels play an important role in mast cell degranulation.
Ca2+ is a vital factor in degranulation of mast cells, which controls the fusion of preformed
secretory granules and plasma membranes and affects the release of mediators. The
133
activation of mast cells mediated by IgE results in an increase in intracellular calcium levels
[47]. Under stimulation, PLCγ, a major signaling enzyme, is activated by phosphorylation
which generates IP3 and diacylglycerol. IP3 binds to its receptor in the ER, which causes the
intracellular calcium release from ER stores. Then, the reduced calcium concentration in ER
is sensed by STIM1, which promotes the influx of calcium from the extracellular space
through calcium channel proteins such as Orai1 and TRPC1. Consequently, the concentration
of cytosolic calcium is elevated, which leads to the fusion of preformed granules and plasma
membrane. This triggers the release of mediators, such as β-hexosaminidase and histamine,
by mast cell degranulation [48]. In this study, T. vulgaris significantly reduced the
intracellular calcium levels in a dose-dependent manner, compared with only
DNP-IgE/BSA-stimulated cells (Figure 10). This is due to the decrease in the
phosphorylation of PLCγ and IP3R by T. vulgaris treatment (Figure 12 and 13).
Additionally, lower expression of calcium channel proteins, such as STIM1, Orai1, and
TRPC1, was observed in T. vulgaris-treated cells (Figure 14). These results suggest that
T. vulgaris suppresses the exocytosis of mast cell granules by regulating the signaling
pathway associated with calcium, and consequently reduces the release of histamine.
134
Figure 34. Inhibitory effects of T. vulgaris on mast cells activation
135
In the present study, TNF-α/IFN-γ mixture was used to stimulate keratinocytes.
Keratinocyte activation is a hallmark of the development of AD in acute and chronic phases.
AD is a skin disease in which the Th2 immune response is activated. The Th2 immune
response is closely related to the increased expression of chemokines, such as TARC/CCL17
and MDC/CCL22. Th2 type cytokines are recruited by the secretion of these chemokines. In
patients with AD, serum levels of TARC/CCL17 and MDC/CCL22 are elevated in
correlation with the severity of AD. In the early stage of AD, increased eosinophil and
cytotoxic granules are associated with RANTES, which is over-secreted by TNF-α and IFN-
γ-induced keratinocytes. This suggests that these chemokines can be used as markers to
demonstrate the severity of the disease [18]. In this study, results showed that treatment with
T. vulgaris remarkably reduced the production of TARC/CCL17 and MDC/CCL22 compared
to that of only TNF-α/IFN-γ-stimulated HaCaT cells (Figure 15). Moreover, it was verified
that mRNA expression levels of inflammation-related cytokine and chemokines, including
IL-6, TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8, were downregulated
by treatment with T. vulgaris (Figure 16).
In AD processes, transcription factor NF-κB plays very important roles due to its direct
target genes that code for many pro-inflammatory cytokines [78]. In AD-induced
inflammatory responses, due to activating the IκB kinase, IκBs are degraded, resulting in the
136
release of NF-κB from their inactive form in cytoplasm. NF-κB then moves to the nucleus
and binds to target genes. In 2008, Sun et al. found that the blockade of ERK and p38 MAPK
inhibited the nuclear translocation of phosphorylated NF-κB p65 [79]. Similar to NF-κB,
STAT1 was phosphorylated and moved into the nucleus under stimulation. This facilitates
the gene transcription of factors, such as MDC [56]. Therefore, the activation of NF-κB and
STAT1 is critically involved in the regulation of inflammation. As shown in Figure 17,
T. vulgaris downregulated the phosphorylation of MAPKs induced by TNF-α/IFN-γ
stimulation. In addition, it was shown that the phosphorylation levels of IKKα/β, IκB, and
NF-κB were suppressed by treatment with T. vulgaris (Figure 18). T. vulgaris reduced the
phosphorylation of STAT1 (Figure 19). Thus, the reduction of pro-inflammatory cytokines
and chemokines may be due to the regulation of these signaling pathways. Based on
in vitro results, T. vulgaris can be considered an effective NF-κB inhibitor with the
inhibition of MAPKs activation and the phosphorylation of IκBα and STAT1. These
findings suggest that T. vulgaris treatment has a significant influence on the improvement of
AD in an in vitro model.
137
Figure 35. Inhibitory effects of T. vulgaris on inflammatory response in keratinocytes
138
Based on the in vitro data, further in vivo studies were performed to determine the effect
of T. vulgaris on AD symptoms in DFE-induced NC/Nga mice. In this study, DFE, a major
species of house dust mite, was used to induce AD. Previous studies have shown that
repeated application of DFE causes severe AD skin lesions by elevating chemokine levels
[17]. As expected, DFE induced typical AD symptoms, including scratching, thick skin,
erythema, dryness, lichenification, and rash in NC/Nga mice. However, this was alleviated
by topical application of T. vulgaris. In the 0.1% and 1% T. vulgaris groups, AD symptoms,
including erythema, edema, erosion, dryness, and lichenification, were significantly
improved (Figure 22). In addition, both impaired skin density and increased erythema index
were recovered by T. vulgaris treatment (Figure 23 and 24C). In histological analysis, the
epidermal thickness in the T. vulgaris 0.1% and 1% groups was reduced compared to that of
the control group (Figure 32). This is thought to be due to the regulation of protein
expressions associated with inflammatory responses such as MAPKs, IκBα, and NFκB
(Figure 29 and 30).
Itching leads to the disruption of the skin barrier by causing scratching which is one of
the main symptoms in AD. This tends to become a vicious itching-scratching cycle, causing
severe lesions and resulting in unbearable pain for patients with AD. Furthermore, itching
converts a Th2-predominant acute phase to a Th1-dominant chronic phase, which is a main
139
characteristic of AD symptoms [40]. Mast cell activation and mast cell-derived mediators
play a crucial role in the pathophysiology of itching. Scratching behavior is associated with
many mediators including neuropeptides, histamines, proteinases, and cytokines. In
particular, histamine released from mast cells has a significant contribution to the induction
of itching in AD. Also, infiltration of mast cells occurs in the epidermis and dermis of AD
skin lesions [17]. In this study, topical application of T. vulgaris remarkably diminished the
number of scratches via the inhibition of serum IgE, β-hexosaminidase, and histamine
compared with the control group (Figure 26 and 27). TB staining of the dorsal skin of mice
showed lower accumulation of mast cells in the groups treated with 0.1% and 1%
T. vulgaris at two concentrations compared to the control group (Figure 33).
These results suggest that T. vulgaris suppresses allergic inflammation via the inhibition of
mast cell degranulation and infiltration.
AD is involved in impaired skin barrier, which affects the reduction of skin hydration
and acidification. Dry and alkaline skin are considered the primary characteristics in AD.
The less skin hydration level and acidification, the worse symptoms of AD. One way to
protect the skin barrier from AD is through moisturizing. In patients with AD, skin TEWL
increases and hydration decreases. Appropriate moisturizing improves the discomfort
associated with dryness, repairs the skin barrier, and reduces the quantity and potency of
140
pharmacological intervention. Impaired skin barrier can be recovered by the promotion of
filaggrin expression. Filaggrin, a key protein of epidermal keratinocytes, has a crucial
structural and functional role in the epidermis and homeostasis of skin [80]. In the present
study, SC hydration levels were elevated and TEWL levels were lowered in the groups
treated with T. vulgaris 0.1% and 1% (Figure 24A and 24B). The stimulation of filaggrin
expression by the topical application of T. vulgaris may cause these effect (Figure 31).
As the active components of T. vulgaris, caffeic acid and rosmarinic acid were identified
(Figure 7). Several studies have investigated the pharmacological effects of these
components in terms of skin inflammation. Zhang et al. reported that caffeic acid has anti-
inflammatory activities in both acute and chronic contact dermatitis models through the
reduction of cutaneous TNF-α, IL-6, and IL-8 levels [81]. In addition, the oral administration
of caffeic acid significantly inhibited scratching behavior [82]. Regarding the effects of
rosmarinic acid on skin, it was demonstrated that rosmarinic acid attenuates AD by reducing
IFN-γ and IL-4 production and total serum IgE levels in 2,4-dinitrofluorobenzene-treated
NC/Nga mice. These previous studies indicated that the anti-atopic effect of
T. vulgaris may be due to these components. Therefore, it would be worthwhile to confirm
the synergistic effect through combination of caffeic acid and rosmarinic acid on AD-
induced models.
141
Patients with AD experience extreme psychological stress due to the vicious cycle of
scratching-itching and their quality of life decrease. Psychological stress is recognized as a
risk factor in immune-related diseases because it has a significant impact on immune
function [40]. According to previous study, both CRHR1 and CRHR2 are critical regulators
of mast cell degranulation and stress-related disorders. CRHR1 is a positive modulator of
stress-induced mast cell degranulation. In contrast, CRHR2 is a negative modulator of mast
cell degranulation in the acute response to immunological and psychological stress [39]. In
this study, it was verified that T. vulgaris suppresses the expression of CRHR1 while
elevating the expression of CRHR2 in DNP-IgE/BSA-stimulated RBL-2H3 cells (Figure
11). This inhibited mast cell degranulation, resulting in reduced histamine release which is
responsible for itching. These findings provide a clue regarding the effects of
T. vulgaris on relieving psychological stress in patients with AD. Therefore, further studies
are needed to confirm the anti-stress effects of T. vulgaris, which can then be applied to
various fields.
In the present study, ketotifen fumarate, known as mast cell stabilizer, and tacrolimus,
known as a calcineurin inhibitor, were used as positive controls in an
in vitro assay. Ketotifen fumarate is widely applied in the treatment of allergic diseases,
including urticaria, asthma, and allergic conjunctivitis. It not only exhibits anti-allergic
142
effects by antagonizing H1R, but also stabilizes the mast cells. Baba
et al. reported that ketotifen fumarate inhibits exocytosis, resulting in the reduction of
histamine release from mast cells. Tacrolimus has immunomodulatory and anti-inflammatory
effect [63]. Tacrolimus binds to its receptor and inhibits the action of calcium/calmodulin-
dependent protein phosphatase, calcineurin. This blocks the dephosphorylation of NFAT
and, consequently, suppresses the transcription of inflammatory cytokines [72]. As shown in
Figure 9B and 9C, ketotifen fumarate reduced the release of β-hexosaminidase and histamine
at a concentration of 100 μM. Decreased release of β-hexosaminidase and histamine was
found in cells treated with 10 ng/mL (12.17 nM) of tacrolimus. These effects were
contributed by the regulation of calcium-related signaling pathway (Figure 10-14). The
ability of tacrolimus to inhibit calcineurin is well known, but there are few studies on the
suppression effect of mast cell activation in an in vitro model. Therefore, the results of this
study are considered to be valuable. Compared to ketotifen fumarate, tacrolimus indicated its
effect at an approximately 8,000-fold lower concentration. Although tacrolimus has this
advantage, it is very expensive. These single chemical-based therapeutic agents have side
effects and high costs, which can be burdensome to patients. Thus, this study is meaningful
because it confirmed that T. vulgaris is an appropriate substitute for these therapeutic
agents.
143
Overall, this study demonstrated the mitigating effect of T. vulgaris in AD-induced in
vitro and in vivo models. These results suggest that T. vulgaris is valuable as an ingredient
for alleviating AD symptoms. Traditionally, thyme oil is used to treat skin conditions, but
several studies have reported that it is irritating to skin. To overcome this limitation, 50%
ethanol extract was used in this study, and safety was proved through
in vitro and in vivo results. Since T. vulgaris is a natural-derived product, it can be
considered a new therapeutic agent with fewer side effects compared to steroids and
immunosuppressive drugs which are frequently used as treatments for AD. Therefore,
T. vulgaris will have considerable value in both cosmetic and pharmaceutical industries.
However, further studies are needed to verify the anti-atopic effect of
T. vulgaris in clinical trials.
144
Ⅴ. Conclusion
The present study was conducted to investigate the anti-atopic effects of
T. vulgaris on AD-induced in vitro and in vivo models.
The results could be concluded as follows:
First, T. vulgaris treatment significantly inhibited β-hexosaminidase and histamine
release by controlling the calcium related signaling pathway in DNP-IgE/BSA-stimulated
RBL-2H3 cells.
Second, T. vulgaris had a remarkable effect on suppression of the production of pro-
inflammatory cytokine and chemokines via regulation of MAPKs, STAT1, and NFκB
pathway in TNF-α/IFN-γ-stimulated HaCaT cells.
Third, topical application of T. vulgaris improved physiological, histopathological
alterations, and scratching behavior in DFE-treated NC/Nga mice. It increased SC
hydration, filaggrin expression and reduced TEWL, erythema, scratching behavior, total
serum IgE level, and histamine release.
Based on the present results, it was demonstrated that T. vulgaris is effective in
ameliorating AD symptoms. Therefore, it can be a new candidate for alleviating AD
symptoms in cosmetic and pharmaceutical industries. However, further studies are needed to
verify the anti-atopic effect of T. vulgaris in clinical trials.
145
Ⅵ. References
1. Hosseinzadeh S, Jafarikukhdan A, Hosseini A, Armand R. The application of
medicinal plants in traditional and modern medicine: a review of Thymus vulgaris.
International Journal of Clinical Medicine. 2015;6(09):635.
2. Dauqan EM and Abdullah A. Medicinal and functional values of thyme (Thymus
vulgaris L.) herb. Journal of Applied Biology & Biotechnology. 2017;5(2):17-22.
3. Fachini-Queiroz FC, Kummer R, Estevao-Silva CF, Carvalho MDDB, Cunha JM,
Grespan R, Bersani-Amado CA, Cuman RKN. Effects of thymol and carvacrol,
constituents of Thymus vulgaris L. essential oil, on the inflammatory response.
Evidence-Based Complementary and Alternative Medicine. 2012;2012:657026
4. Tsai ML, Lin CC, Lin WC, Yang CH. Antimicrobial, antioxidant, and anti-inflammatory
activities of essential oils from five selected herbs. Bioscience, biotechnology, and
biochemistry, 2011;75(10):1977-83
5. Hossain MB, Brunton NP, Martin-Diana AB, Barry-Ryan C. (2010). Application of
response surface methodology to optimize pressurized liquid extraction of antioxidant
compounds from sage (Salvia officinalis L.), basil (Ocimum basilicum L.) and thyme
(Thymus vulgaris L.). Food & function. 2010;1(3):269-77.
6. Ocaña A and Reglero, G. Effects of thyme extract oils (from Thymus vulgaris, Thymus
zygis, and Thymus hyemalis) on cytokine production and gene expression of oxLDL-
stimulated THP-1-macrophages. Journal of Obesity. 2012;2012:104706.
7. El-Boshy ME, Refaat B, Qasem AH, Khan A, Ghaith M, Almasmoum H, Mahbub A,
Almaimani RA. The remedial effect of Thymus vulgaris extract against lead toxicity-
146
induced oxidative stress, hepatorenal damage, immunosuppression, and hematological
disorders in rats. Environmental Science and Pollution Research. 2019;26(22):22736-
46.
8. Habbadi K, Meyer T, Vial L, Gaillard V, Benkirane R, Benbouazza A, Kerzaon I,
Achbani EH, Lavire C. Essential oils of Origanum compactum and Thymus vulgaris
exert a protective effect against the phytopathogen Allorhizobium vitis.
Environmental Science and Pollution Research. 2018;25(30):29943-52.
9. Soković M, Glamočlija J, Ćirić A, Kataranovski D, Marin PD, Vukojević J, Brkić D.
Antifungal activity of the essential oil of Thymus vulgaris L. and thymol on
experimentally induced dermatomycoses. Drug development and industrial
pharmacy. 2008;34(12):1388-93.
10. Divband K, Shokri H, Khosravi AR. Down-regulatory effect of Thymus vulgaris L. on
growth and Tri4 gene expression in Fusarium oxysporum strains. Microbial
pathogenesis. 2017;104:1-5.
11. Adefegha SA, Oyeleye SI, Akintemi A, Okeke BM, Oboh G. Thyme (Thymus vulgaris)
leaf extract modulates purinergic and cholinergic enzyme activities in the brain
homogenate of 5-fluorouracil administered rats. Drug and Chemical Toxicology.
2020;43(1):43-50.
12. Sun Z, Park SY, Hwang E, Zhang M, Seo SA, Lin P, Yi TH. Thymus vulgaris alleviates
UVB irradiation induced skin damage via inhibition of MAPK/AP ‐1 and activation of
Nrf2‐ARE antioxidant system. Journal of cellular and molecular medicine.
2017;21(2): 336-48.
147
13. Cornaghi L, Arnaboldi F, Calò R, Landoni F, Preis WFB, Marabini L, Donetti E. Effects
of uv rays and thymol/thymus vulgaris l. Extract in an ex vivo human skin model:
Morphological and genotoxicological assessment. Cells Tissues Organs. 2016;201(3):
180-92.
14. Gedikoğlu A, Sökmen M, Çivit A. Evaluation of Thymus vulgaris and Thymbra spicata
essential oils and plant extracts for chemical composition, antioxidant, and
antimicrobial properties. Food science & nutrition. 2019;7(5):1704-14.
15. Martins N, Barros L, Santos-Buelga C, Silva S, Henriques M, Ferreira IC. Decoction,

infusion and hydroalcoholic extract of cultivated thyme: Antioxidant and antibacterial
activities, and phenolic characterisation. Food chemistry. 2015;167:131-7.
16. Ngo HTT, Fang M, Hwang E, Kim Y, Park B, Seo SA, Do NQ, Nguyen QTN, Yi TH.
Inhibitory Effects of Urtica thunbergiana Ethanol Extract on Atopic Dermatitis-Induced
NC/Nga Mice. Antioxidants. 2020;9(3):197.
17. Jeong NH, Lee S, Choi JK, Choi YA, Kim MJ, Lee HS, Shin TY, Jang YH, Song KS,
Kim SH. Polyozellin alleviates atopic dermatitis-like inflammatory and pruritic
responses in activated keratinocytes and mast cells. Biomedicine &
Pharmacotherapy. 2020;122:109743.
18. Choi YA, Yu JH, Jung HD, Lee S, Park PH, Lee HS, Kwon TK, Shin TY, Lee SW, Rho
MC, Jang YH, Kim SH. Inhibitory effect of ethanol extract of Ampelopsis
brevipedunculata rhizomes on atopic dermatitis-like skin inflammation.
Journal of ethnopharmacology. 2019;238:111850.
19. Williams HC. Atopic dermatitis. New England Journal of Medicine.

2005;352(22):2314-24.
148
20. Ahn K, Kim BE, Kim J, Leung DY. Recent advances in atopic dermatitis.
Current Opinion in Immunology. 2020;66:14-21.
21. Boguniewicz M and Leung DY. Atopic dermatitis: a disease of altered skin barrier and
immune dysregulation. Immunological reviews. 2011;242(1):233-46.
22. Oyoshi M., He R, Kumar L, Yoon J, Geha RS. Cellular and molecular mechanisms in
atopic dermatitis. Advances in immunology. 2009;102:135-226.
23. Pastore S, Mascia F, Giustizieri ML, Giannetti A, Girolomoni G. Pathogenetic

mechanisms of atopic dermatitis. Archivum immunologiae et therapiae
experimentalis. 2000;48(6):497-504.
24. Avena-Woods C. Overview of atopic dermatitis. The American journal of managed

care. 2017;23(8 Suppl):S115-23.
25. Fujii M. Current understanding of pathophysiological mechanisms of atopic dermatitis:

interactions among skin barrier dysfunction, immune abnormalities and pruritus.
Biological and Pharmaceutical Bulletin. 2020;43(1):12-9.
26. Go HN, Lee SH, Cho HJ, Ahn JR, Kang MJ, Lee SY, Hong SJ. Effects of
chloromethylisothiazolinone/methylisothiazolinone (CMIT/MIT) on Th2/Th17-related
immune modulation in an atopic dermatitis mouse model. Scientific Reports.
2020;10(1):4099.
27. De Benedetto A, Yoshida T, Fridy S, Park JES, Kuo I, Beck LA. Histamine and skin
barrier: are histamine antagonists useful for the prevention or treatment of atopic
dermatitis?. Journal of clinical medicine. 2015;4(4):741-55.
28. Yamada K, Matsushita K, Wang J, Kanekura T. Topical glucose induces claudin-1 and
filaggrin expression in a mouse model of atopic dermatitis and in keratinocyte culture,
149
exerting anti-inflammatory effects by repairing skin barrier function.
Acta dermato-venereologica. 2018;98(1):19-25.
29. Lyons JJ, Milner JD, Stone KD.Atopic dermatitis in children: clinical features,
pathophysiology, and treatment. Immunology and Allergy Clinics. 2015;35(1):161-83.
30. Kabashima K, Nakashima C, Nonomura Y, Otsuka A, Cardamone C, Parente R, Feo

GD, Triggiani M. Biomarkers for evaluation of mast cell and basophil activation.
Immunological reviews. 2018;282(1):114-20.
31. Maintz L and Novak N. Histamine and histamine intolerance. The American journal of
clinical nutrition. 2007;85(5)1185-96.
32. Ohtsu H and Seike M. Histamine and histamine receptors in allergic dermatitis.
Handbook of experimental pharmacology.2017;241:333-45.
33. Thangam EB, Jemima EA, Singh H, Baig MS, Khan M, Mathias CB, Church MK,
Saluja, R. The role of histamine and histamine receptors in mast cell-mediated allergy
and inflammation: the hunt for new therapeutic targets. Frontiers in immunology.
2018;9:1873.
34. Ohsawa Y and Hirasawa N. The role of histamine H1 and H4 receptors in atopic
dermatitis: from basic research to clinical study. Allergology International.
2014;63(4):533-42.
35. Choi D, Kang W, Park T. Anti-Allergic and Anti-Inflammatory Effects of Undecane on

Mast Cells and Keratinocytes. Molecules. 2020;25(7):1554.
36. Branco ACCC, Yoshikawa FSY, Pietrobon AJ, Sato MN. Role of histamine in
modulating the immune response and inflammation. Mediators of inflammation.
2018;2018:9524075.
150
37. Shim WS and Oh U. Histamine-induced itch and its relationship with pain.
Molecular pain. 2008;4:29.
38. Shin JY, Che DN, Cho BO, Kang HJ, Kim J, Jang SI. Commiphora myrrha inhibits itch
associated histamine and IL 31 production in stimulated mast cells.
Experimental and therapeutic medicine. 2019;18(3):1914-20.
39. D’Costa S, Ayyadurai S, Gibson AJ, Mackey E, Rajput M, Sommerville LJ, Wilson N,
Li Y, Kubat E, Kumar A, Subramanian H, Bhargava A, Moeser AJ. Mast cell crf2
suppresses mast cell degranulation and limits the severity of anaphylaxis and stress-
induced intestinal permeability. The Journal of allergy and clinical
immunology. 2019;143(5):1865-77.
40. Golpanian RS, Kim HS, Yosipovitch G. Effects of stress on itch.

Clinical Therapeutics. 2020;42(5):745-56.
41. Smith SM and Vale WW. The role of the hypothalamic-pituitary-adrenal axis in
neuroendocrine responses to stress. Dialogues in clinical neuroscience. 2006;8(4):383-
95.
42. Lin TK, Zhong L, Santiago JL. Association between Stress and the HPA Axis in the
Atopic Dermatitis. International journal of molecular sciences. 2017;18(10):2131.
43. Donelan J, Boucher W, Papadopoulou N, Lytinas M, Papaliodis D, Dobner P,

Theoharides TC. Corticotropin-releasing hormone induces skin vascular permeability
through a neurotensin-dependent process. Proceedings of the National Academy of
Sciences of the United States of America. 2006;103(20):7759-64.
44. Park CH, Min SY, Yu HW, Kim K, Kim S, Lee HJ, Kim JH, Park YJ. Effects of
Apigenin on RBL-2H3, RAW264. 7, and HaCaT Cells: Anti-Allergic, Anti-
151
Inflammatory, and Skin-Protective Activities. International Journal of Molecular
Sciences. 2020;21(13):4620.
45. Amin K. The role of mast cells in allergic inflammation. Respiratory medicine.
2012;106(1):9-14.
46. Occhiuto CJ, Kammala AK, Yang C, Nellutla R, Garcia M, Gomez G, Subramanian H.
Store-operated calcium entry via STIM1 contributes to MRGPRX2 induced mast cell
functions. Frontiers in immunology. 2020;10:3143.
47. Ang WG, Church AM, Kulis M, Choi HW, Burks AW, Abraham SN. Mast cell
desensitization inhibits calcium flux and aberrantly remodels actin.
The Journal of clinical investigation. 2016;126(11):4103-18.
48. Holowka D, Wilkes M, Stefan C, Baird B. Roles for Ca2+ mobilization and its
regulation in mast cell functions: recent progress. Biochemical Society
Transactions. 2016;44(2):505-9.
49. Elsholz F, Harteneck C, Muller W, Friedland K. Calcium—a central regulator of

keratinocyte differentiation in health and disease. European Journal of
Dermatology. 2014;24(6):650-61.
50. Yan S, Chen W, Zhang Y, Li J, Chen X. Calcium release-activated calcium modulator 1

as a therapeutic target in allergic skin diseases. Life sciences. 2019;228:152-57.
51. Putney JW, Steinckwich-Besançon N, Numaga-Tomita T, Davis FM, Desai PN,

D'Agostin DM, S Wu, Bird GS. The functions of store-operated calcium channels.
Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. 2017;1864(6):900-6.
52. Lim HS, Seo CS, Jin SE, Yoo SR, Lee MY, Shin HK, Jeong SJ. Ma Huang tang
suppresses the production and expression of inflammatory Chemokines via
152
downregulating STAT1 phosphorylation in HaCaT Keratinocytes. Evidence-Based
Complementary and Alternative Medicine. 2016;2016:7831291.
53. Komine M, Kakinuma T, Kagami S, Hanakawa Y, Hashimoto K, Tamaki K. Mechanism

of thymus-and activation-regulated chemokine (TARC)/CCL17 production and its
modulation by roxithromycin. Journal of investigative dermatology. 2005;125(3):491-8.
54. Jung MR, Lee TH, Bang MH, Kim H, Son Y, Chung DK, Kim J. Suppression of
thymus-and activation-regulated chemokine (TARC/CCL17) production by 3-O-β-D-
glucopyanosylspinasterol via blocking NF-κB and STAT1 signaling pathways in TNF-α
and IFN-γ-induced HaCaT keratinocytes. Biochemical and biophysical research
communications. 2012;427(2):236-41.
55. Han SK, Song JY, Yun YS, Yi SY. Gamma irradiation-reduced IFN-gamma expression,
STAT1 signals, and cell-mediated immunity. Journal of biochemistry and molecular
biology. 2002;35(6):583-9.
56. Kang NJ, Koo DH, Kang GJ, Han SC, Lee BW, Koh YS, Hyun JW, Lee NH, Ko MH,
Kang HK, Yoo ES. Dieckol, a component of Ecklonia cava, suppresses the production
of MDC/CCL22 via down-regulating STAT1 pathway in interferon-γ stimulated HaCaT
human keratinocytes. Biomolecules & therapeutics. 2015;23(3):238-44.
57. Ju SM, Song HY, Lee SJ, Seo WY, Sin DH, Goh AR, Kang YH, Kang IJ, Won MH, Yi
JS, Kwon DJ, Bae YS, Choi SY, Kwon DJ. Suppression of thymus-and activation-
regulated chemokine (TARC/CCL17) production by 1, 2, 3, 4, 6-penta-O-galloyl-β-d-
glucose via blockade of NF-κB and STAT1 activation in the HaCaT cells.
Biochemical and biophysical research communications. 2009;387(1):115-20.
58. Eichenfield LF, Tom WL, Berger TG, Krol A, Paller AS, Schwarzenberger K, Bergman
JN, Chamlin SL, Cohen DE, Cooper KD, Cordoro KM, Davis DM, Feldman SR, Hanifin
153
JM, Margolis DJ, Silverman RA, Simpson EL, Williams HC, Elmets CA, Block J,
Harrod CG, Begolka WS, Sidbury R. Guidelines of care for the management of atopic
dermatitis: section 2. Management and treatment of atopic dermatitis with topical
therapies. Journal of the American Academy of Dermatology. 2014;71(1):116-32.
59. Saeki H, Nakahara T, Tanaka A, Kabashima K, Sugaya M, Murota H, Ebihara T,

Kataoka Y, Aihara M, Etoh T, Katoh N. Clinical practice guidelines for the
management of atopic dermatitis 2016. The Journal of dermatology. 2016;43(10):1117-
45.
60. Eliakim R, Karmeli F, Rachmilewitz D. Ketotifen—old drug, new indication: Reduction

of gastric mucosal injury. Scandinavian journal of gastroenterology. 1993;28(3):202-4.
61. Patel D, Sarala N, Datti NP. Topical olopatadine hydrochloride versus ketotifen
fumarate for allergic conjunctivitis. Journal of ophthalmic & vision
research. 2018;13(2):119-123.
62. Jagdis A, Berlin N, Barron C, Giruparajah M., Leader N, Maclachlan S, Sussman GL.
Effect of ketotifen premedication on adverse reactions during peanut oral
immunotherapy. Allergy, Asthma & Clinical Immunology. 2014;10(1):36.
63. Baba A, Tachi M, Ejima Y, Endo Y, Toyama H, Matsubara M, Saito K, Yamauchi M,

Miura C, Kazama I. Anti-allergic drugs tranilast and ketotifen dose-dependently exert
mast cell-stabilizing properties. Cellular Physiology and Biochemistry. 2016;38(1):15-
27.
64. Paquette D, Rothe MJ. Unapproved dermatologic indications for H2 receptor

antagonists, cromolyn sodium, and ketotifen. Clinics in dermatology. 2000;18(1):103-
11.
154
65. Martins JC, Martins C, Aoki V, Gois AF, Ishii HA, da Silva EMK. Topical tacrolimus
for atopic dermatitis. Cochrane Database of Systematic Reviews.
2015;2015(7):CD009864.
66. Singh JA, Hossain A, Kotb A, Wells GA. Comparative effectiveness of

immunosuppressive drugs and corticosteroids for lupus nephritis: a systematic review
and network meta-analysis. Systematic reviews. 2016;5(1):155.
67. Haddad E, McAlister V, Renouf E, Malthaner R, Kjaer MS, Gluud LL. Cyclosporin
versus tacrolimus for liver transplanted patients. Cochrane Database of systematic
reviews. 2006;(4):CD005161.
68. Baumgart DC, MacDonald JK, Feagan B. Tacrolimus (FK506) for induction of
remission in refractory ulcerative colitis. Cochrane Database of Systematic
Reviews. 2008;(3):CD007216.
69. O'Donnell MM, Williams JP, Weinrieb R, Denysenko L. Catatonic mutism after liver
transplant rapidly reversed with lorazepam. General hospital psychiatry.
2007;29(3):280-1.
70. Gallant‐Behm CL, Hildebrand KA, Hart DA. The mast cell stabilizer ketotifen prevents
development of excessive skin wound contraction and fibrosis in red Duroc pigs.
Wound Repair and Regeneration. 2008;16(2):226-33.
71. Rustin MHA. The safety of tacrolimus ointment for the treatment of atopic dermatitis: a
review. British Journal of Dermatology. 2007;157(5):861-73.
72. Mayba JN, Gooderham MJ. Review of atopic dermatitis and topical therapies.
Journal of Cutaneous Medicine and Surgery. 2017;21(3):227-36.
155
73. Nilsson GE. Measurement of water exchange through skin. Medical and Biological
Engineering and Computing. 1977;15.3:209-18.
74. Dhakal H, Lee S, Kim EN, Choi JK, Kim MJ, Kang J, Choi YA, Baek MC, Lee B, Lee
HS, Shin TY, Jeong GS, Shin TY. Gomisin M2 inhibits mast cell-mediated allergic
inflammation via attenuation of FcεRI-mediated Lyn and Fyn activation and
intracellular calcium levels. Frontiers in pharmacology. 2019;10:869.
75. Ding Y, Che D, Li C, Cao J, Wang J, Ma P, Zhao T, An H, Zhang T. Quercetin inhibits

Mrgprx2-induced pseudo-allergic reaction via PLCγ-IP3R related Ca2+ fluctuations.
International immunopharmacology. 2019;66:185-97.
76. Oka T, Sato K, Hori M, Ozaki H, Karaki H. Xestospongin C, a novel blocker of IP3
receptor, attenuates the increase in cytosolic calcium level and degranulation that is
induced by antigen in RBL ‐2H3 mast cells. British journal of pharmacology.
2002;135(8):1959-66.
77. Ngo HT, Hwang E, Kang H, Park B, Seo SA, Yi TH. Anti-inflammatory Effects of
Achillea millefolium on Atopic Dermatitis-Like Skin Lesions in NC/Nga Mice.
The American Journal of Chinese Medicine. 2020;48(5):1121-40.
78. Kolmus K, Tavernier J, Gerlo S. β2-Adrenergic receptors in immunity and

inflammation: stressing NF-κB. Brain, behavior, and immunity. 2015;45:297-310.
79. Sun J, Ramnath RD, Zhi L, Tamizhselvi R, Bhatia M. Substance P enhances NF-κB
transactivation and chemokine response in murine macrophages via ERK1/2 and p38
MAPK signaling pathways. American Journal of Physiology-Cell
Physiology. 2008;294(6):C1586-96.
80. Cabanillas B and Novak N. Atopic dermatitis and filaggrin. Current opinion in
immunology. 2016;42:1-8.
156
81. Zhang M, Zhou J, Wang L, Li B, Guo J, Guan X, Han Q, Zhang H. Caffeic acid reduces
cutaneous tumor necrosis factor alpha (TNF-α), IL-6 and IL-1β levels and ameliorates
skin edema in acute and chronic model of cutaneous inflammation in mice.
Biological and Pharmaceutical Bulletin. 2014;37(3):347-54.
82. Hossen MA, Inoue T, Shinmei Y, Minami K, Fujii Y, Kamei C. Caffeic acid inhibits
compound 48/80-induced allergic symptoms in mice. Biological and Pharmaceutical
Bulletin. 2006;29(1):64-6.
157
Abstracts in Korean
국문초록
히스타민 분비 조절을 통한 타임(Thymus vulgaris L.)의

아토피 피부염 증상 개선 효과
서슬아
경희대학교 대학원
생명공학원
지도교수 이 태 후
백리향으로 알려진 타임은 아로마 허브 중 하나로 전 세계적으로 사용되고 있다 .
타임은 항산화, 항염 및 면역조절 활성이 있는 것으로 보고되었으며, 특히 피부와 관련하여
광노화 억제 및 피부 보호 효과에 대해 보고되었다. 그러나 타임의 아토피 피부염 억제
효과에 대해서는 과학적으로 검증된 바 없다. 따라서 본 연구는 타임의 아토피 피부염 증상
개선 효과를 검증하기 위하여 수행되었다.
타임의 활성 성분은 HPLC 분석법에 의해 확인되었다. In vitro 연구에서는 ELISA
kits, RT-PCR 및 western blot법을 통하여 LPS로 자극된 Raw264.7 세포주, DNP-IgE/BSA
로 자극된 RBL-2H3 세포주 및 TNF-α/IFN-γ로 자극된 HaCaT 세포주에서 타임의 아토피
피부염 억제 효과가 확인되었다. In vivo 연구에서는 집먼지 진드기로 아토피 피부염이
유도된 NC/Nga 동물에서 형태학적 및 생리학적 변화, 긁는 행동, AD 증상과 관련된
단백질 발현 및 조직학적 변화를 측정하여 타임의 아토피 피부염 개선 효과를 확인하였
다.
158
In vitro 실험 결과, 타임이 LPS로 자극된 Raw264.7 세포주에서 NO 생성량을
유의적으로 억제시켰다. 250 μg/mL의 농도로 타임이 처리되었을 때 베타헥소사미니다제
및 히스타민의 분비가 각각 52.7% 및 38.0% 감소되었다. 이는 칼슘 관련 경로의 조절에
의한 것으로 확인되었다. 게다가, TNF-α/IFN-γ로 자극된 HaCaT 세포주와 비교하여 타임은
100 μg/mL의 농도에서 TARC와 MDC의 생성을 각각 35.5% 및 64.5% 억제시켰다. 또한,
타임이 MAPKs, STAT1 및 NF-κB 경로의 조절을 통해 IL-6, TARC, MDC, RANTES 및
IL-8과 같은 염증성 사이토카인 및 케모카인의 유전자 발현의 감소에 영향을 미치는 것을
확인하였다.
In vivo 실험 결과 타임의 국소 도포가 아토피 증상을 개선하는 것을 확인하였다 .
타임은 피부염의 중증도, 경피수분손실량, 홍반 지수의 감소를 초래하였다. 게다가, 타임에
의해 긁는 횟수가 유의적으로 감소되었다. 이는 혈청 IgE 및 히스타민 분비의 억제에 의해
영향을 받았다. 조직학적 분석 결과는 타임이 비만 세포의 침윤 뿐만 아니라 표피 두께의
감소에도 관여한다는 것을 나타내었다. 반면에 DFE에 의해 악화된 피부치밀도와 수분량이
타임의 국소 도포에 의해 회복되었다.
종합적으로 본 연구는 아토피 피부염이 유도된 in vitro 및 in vivo 모델에서 타임의
아토피 피부염 개선 효과를 검증하였다. 이러한 결과는 타임이 히스타민 분비를 조절하여
가려움증을 완화시킴으로써 아토피 피부염 증상 개선에 효과가 있음을 나타내므로 화장품
및 의약품 산업에서 천연물 유래의 소재로서 활용될 수 있음을 시사한다.
159

210104 박사학위논문 서슬아 제본전

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

210104 박사학위논문 서슬아 제본전

Uploaded by

Copyright:

Available Formats

Thesis for the Degree of Doctor of Philosophy

Thymus vulgaris L. ameliorated atopic dermatitis

Graduate School of Biotechnology

Graduate School of Biotechnology

Submitted to the Graduate School of Biotechnology and the Faculty of the

Chairman Yeon Ju Kim

1. Thymus vulgaris L.......................................................................................................1

2.1. Epidemiology of atopic dermatitis..........................................................................9

2.2. Causes of atopic dermatitis.....................................................................................9

2.3. Diagnosis of atopic dermatitis based on clinical features......................................10

2.4. Pathogenesis of atopic dermatitis.........................................................................11

2.4.1. Imbalance of Th1/Th2 immune response.......................................................

2.4.2. Skin barrier dysfunction.................................................................................

2.5. Itching in atopic dermatitis...................................................................................15

2.5.1. Role of histamine in itching...........................................................................

2.5.2. Psychological stress and itching.....................................................................

3. Mechanism of atopic dermatitis...............................................................................24

3.1. Mast cells activation.............................................................................................24

4. Therapeutic agents of atopic dermatitis and allergic response...............................31

4.1. Ketotifen fumarate...............................................................................................33

4.3. Natural products-derived therapeurics..................................................................36

5. Purpose of this study.................................................................................................40

Ⅱ. Materials and Methods ............................................................................................42

4.1. Cell culture...........................................................................................................46

4.2. Sample treatment..................................................................................................46

4.3. Measurement of cell viability...............................................................................47

4.4. Measurement of NO production...........................................................................47

4.5. β-hexosaminidase release assay............................................................................48

4.6. Histamine release assay........................................................................................49

4.7. Measurement of intracellular calcium..................................................................49

4.8. Enzyme-linked immunosorbent assay (ELISA)....................................................49

4.9. Reverse transcription-polymerase chain reaction (RT-PCR).................................50

4.10. Western blot analysis.........................................................................................52

5.1. Experimental animals...........................................................................................53

5.2. Induction of AD-like skin lesion and topical application......................................53

5.3. Evaluation of AD-like skin symptoms..................................................................54

5.4. Measurement of physiological skin alteration......................................................56

5.4.1. Video scope...................................................................................................56

5.4.2. High resolution ultrasound............................................................................56

5.5. Evaluation of scratching behavior........................................................................57

5.6. Measurement of serum IgE level..........................................................................58

5.7. Histopathological analysis....................................................................................58

1. The identification of active components from T. vulgaris.......................................60

2. Effects of T. vulgaris on atopic dermatitis and histamine response: in vitro..........63

2.1. Effects of T. vulgaris on atopic dermatitis inflammation in Raw 264.7

2.1.1. Cell viability..................................................................................................63

2.2. Effects of T. vulgaris on histamine related allergic response in RBL-2H3

2.2.1. Cell viability..................................................................................................66

2.2.2. β-hexosaminidase release..............................................................................67

2.2.3. Histamine release..........................................................................................68

2.2.4. Intracellular calcium levels............................................................................70

2.2.5. Signaling pathways in histamine release........................................................72

2.2.5.1. CRHR1 and CRHR2 expression.............................................................72

2.2.5.2. phosphorylation of PLCγ........................................................................74

2.2.5.3. phosphorylation of IP3R.........................................................................76

2.2.5.4. calcium channel protein expressions.......................................................78

2.3. Effect of T. vulgaris on atopic dermatitis inflammation in HaCaT

2.3.1. Cell viability..................................................................................................80

2.3.2. Chemokines production.................................................................................81

2.3.3. mRNA expression of pro-inflammatory cytokines and

2.3.4. Signaling pathways in inflammatory response...............................................85

2.3.4.1. MAPKs activation..................................................................................85

3. Effects of T. vulgaris on atopic dermatitis and histamine response: in vivo...........90

3.1. Morphological characteristics...............................................................................90