201227 박사학위논문 서슬아 수정

Thesis for the Degree of Doctor of Philosophy
Thymus vulgaris L. ameliorated atopic dermatitis

symptoms through controlling of histamine release
Seul A Seo
Graduate School of Biotechnology

Kyung Hee University
Seoul, Korea
February, 2021
Seul A Seo
Graduate School of Biotechnology

Kyung Hee University
Seoul, Korea
February, 2021
by
Seul A Seo
Advised by
Prof. Tae - Hoo Yi, O.M.D., Ph.D.
Submitted to the Graduate School of Biotechnology and the Faculty of the

Graduate School of Kyung Hee University in the partial fulfillment of
the requirements for degree of Doctor of Philosophy
Dissertation Committee :
Chairman Yeon Ju Kim
Tong Ho Kang
Se Chan Kang
Eunson Hwang
Tae-Hoo Yi
Contents
List of Table.........................................................................................................................
List of Figure.....................................................................................................................
Abbreviations...................................................................................................................vii
Abstracts.............................................................................................................................
Ⅰ. Introduction.........................................................................................................
1. Thymus vulgaris L.......................................................................................................1
2. Atopic dermatitis.........................................................................................................8
2.1. Definition of atopic dermatitis................................................................................9
2.2. Causes of atopic dermatitis.....................................................................................9
2.3. Symptoms of atopic dermatitis.............................................................................10
2.4. Pathogenesis of atopic dermatitis.........................................................................11
2.4.1. Imbalance of Th1/Th2 immune response.......................................................
2.4.2. Skin barrier dysfunction.................................................................................
2.5. Itching in atopic dermatitis...................................................................................15
2.5.1. Role of histamine in itching...........................................................................
2.5.2. Psychological stress and itching.....................................................................
3. Mechanism of atopic dermatitis...............................................................................24
3.1. Mast cells activation.............................................................................................24
i
3.2. Keratinocytes activation.......................................................................................28
4. Therapeutic agent of atopic dermatitis and allergic response................................31
4.1. Ketotifen fumarate...............................................................................................32
4.2. Tacrolimus...........................................................................................................33
4.3. Natural products-derived therapeurics..................................................................36
5. Purpose of this study.................................................................................................39
Ⅱ. Materials and Methods ............................................................................................41
1. Materials....................................................................................................................41
2. Sample preparation...................................................................................................42
3. HPLC analysis...........................................................................................................44
4. In vitro study..............................................................................................................45
4.1. Cell culture...........................................................................................................45
4.2. Sample treatment..................................................................................................45
4.3. Measurement of cell viability...............................................................................46
4.4. Measurement of NO production...........................................................................46
4.5. β-hexosaminidase release assay............................................................................47
4.6. Histamine release assay........................................................................................47
4.7. Measurement of intracellular calcium..................................................................48
4.8. Enzyme-linked immunosorbent assay (ELISA)....................................................48
4.9. Reverse transcription-polymerase chain reaction (RT-PCR).................................49
4.10. Western blot analysis.........................................................................................51

ii
5. In vivo study...............................................................................................................52
5.1. Experimental animals...........................................................................................52
5.2. Induction of AD-like skin lesion and topical application......................................52
5.3. Evaluation of AD-like skin symptoms..................................................................53
5.4. Measurement of physiological skin alteration......................................................55
5.4.1. Video scope...................................................................................................55
5.4.2. High resolution ultrasound............................................................................55
5.4.3. Hydration......................................................................................................56
5.4.4. TEWL............................................................................................................56
5.4.5. Erythema.......................................................................................................57
5.5. Evaluation of scratching behavior........................................................................57
5.6. Measurement of serum IgE level..........................................................................57
5.7. Histopathological analysis....................................................................................58
6. Statistical analysis.....................................................................................................59
Ⅲ. Results.......................................................................................................................60
1. The identification of active components from T. vulgaris.......................................60
2. The effects of T. vulgaris on atopic dermatitis and histamine related allergic
response: An in vitro study........................................................................................64
2.1. Effects of T. vulgaris on atopic dermatitis related inflammation in LPS-induced
Raw 264.7 cells.......................................................................................................64
iii
2.1.1. Cell viability..................................................................................................64
2.1.2. NO production...............................................................................................65
2.2. Effects of T. vulgaris on histamine related allergic response in DNP-IgE/BSA-
stimulated RBL-2H3 cells.....................................................................................67
2.2.1. Cell viability..................................................................................................67
2.2.2. β-hexosaminidase release..............................................................................68
2.2.3. Histamine release..........................................................................................69
2.2.4. Intracellular calcium levels............................................................................71
2.2.5. Signaling pathways in histamine release........................................................73
2.2.5.1. CRHR1 and CRHR2 expression.............................................................73
2.2.5.2. phosphorylation of PLCγ........................................................................75
2.2.5.3. phosphorylation of IP3R.........................................................................77
2.2.5.4. calcium channel protein expressions.......................................................79
2.3. Effect of T. vulgaris on atopic dermatitis related inflammation in TNF-α/IFN-γ-
stimulated HaCaT cells.........................................................................................81
2.3.1. Cell viability..................................................................................................81
2.3.2. Chemokine production..................................................................................82
2.3.3. mRNA expression of pro-inflammatory cytokine and
chemokines......................................................................................................84
2.3.4. Signaling pathways in pro-inflammatory cytokine and
iv
chemokines......................................................................................................86
2.3.4.1. MAPKs activation..................................................................................86
2.3.4.2. NFκB and STAT1 activation..................................................................88
3. The effects of T. vulgaris on atopic dermatitis and histamine related allergic
response: An in vivo study........................................................................................91
3.1. Morphological characteristics...............................................................................91
3.1.1. Body weight..................................................................................................91
3.1.2. Spleen weight................................................................................................93
3.1.3. Skin morphology...........................................................................................95
3.2. Physiological characteristics................................................................................98
3.2.1. Skin density...................................................................................................98
3.2.2. Skin hydration.............................................................................................100
3.2.3. TEWL..........................................................................................................101
3.2.4. Erythema index............................................................................................102
3.3. Itching related characteristics.............................................................................104
3.3.1. Scratching behavior.....................................................................................104
3.3.2. Serum IgE level...........................................................................................106
3.3.3. β-hexosaminidase and histamine release......................................................108
3.4. Signaling pathways in atopic dermatitis symptoms............................................110
3.4.1. CRHR1 and CRHR2 expression..................................................................110
v
3.4.2. MAPKs activation.......................................................................................112
3.4.3. IκBα and NFκB activation...........................................................................114
3.4.4. Filaggrin expression....................................................................................116
3.5. Histological characteristics.................................................................................118
3.5.1. Epidermal thickness.....................................................................................118
3.5.2. Accumulation of mast cells..........................................................................120
Ⅳ. Discussion................................................................................................................122
Ⅴ. Conclusion................................................................................................................135
Ⅵ. References...............................................................................................................136
국 문 초 록 ......................................................................................................................137
vi
List of Table
Table 1. Previous studies of T. vulgaris on biological effects...............................................4
Table 2. Previous studies of components of T. vulgaris on biological effects.......................7
Table 3. Indication and side effect of therapeutic agents.....................................................35
Table 4. Previous studies on the effect of natural products in AD.......................................37
Table 5. Previous studies on the effect of natural products in allergic skin
inflammation.................................................................................................................38
Table 6. List of primers for RT-PCR...................................................................................50
Table 7. Symptoms of AD...................................................................................................54
Table 8. Active components of T. vulgaris..........................................................................63
vii
List of Figure
Figure 1. Acute and chronic phases in AD..........................................................................15
Figure 2. Biosynthesis and metabolism of histamine...........................................................18
Figure 3. Effects of histamine through H1 and H4 receptors in skin allergic
reaction.........................................................................................................................19
Figure 4. Mechanism of mast cells activation.....................................................................27
Figure 5. Mechanism of keratinocytes activation................................................................30
Figure 6. Preparation of T. vulgaris extract.........................................................................43
Figure 7. HPLC analysis of T. vulgaris and caffeic acid and rosmarinic acid
standard.........................................................................................................................61
Figure 8. Effects of T. vulgaris on cell viability and NO production in LPS-induced Raw
264.7 cells...............................................................................................................66
Figure 9. Effects of T. vulgaris on cell viability, β-hexosaminidase, and histamine release in
DNP-IgE/BSA-stimulated RBL-2H3 cells...............................................................70
Figure 10. Effects of T. vulgaris on intracellular calcium levels in DNP-IgE/BSA-stimulated
RBL-2H3 cells........................................................................................................72
Figure 11. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DNP-IgE/BSA-
stimulated RBL-2H3 cells.......................................................................................74
Figure 12. Effects of T. vulgaris on phosphorylation of PLCγ in DNP-IgE/BSA-stimulated
viii
RBL-2H3 cells........................................................................................................76
Figure 13. Effects of T. vulgaris on phosphorylation of IP3R in DNP-IgE/BSA-stimulated
RBL-2H3 cells........................................................................................................78
Figure 14. Effects of T. vulgaris on expression of calcium channel proteins in
DNP-IgE/BSA-stimulated RBL-2H3 cells...............................................................80
Figure 15. Effects of T. vulgaris on cell viability and chemokine production in TNF-α/IFN-
γ-stimulated HaCaT cells..............................................................................................83
Figure 16. Effects of T. vulgaris on mRNA expression of pro-inflammatory cytokines and
chemokines in TNF-α/IFN-γ-stimulated HaCaT cells..............................................85
Figure 17. Effects of T. vulgaris on activation of MAPKs in TNF-α/IFN-γ-stimulated HaCaT
cells.........................................................................................................................87
Figure 18. Effects of T. vulgaris on NFκB signaling pathway in TNF-α/IFN-γ-stimulated
HaCaT cells..................................................................................................................89
Figure 19. Effects of T. vulgaris on STAT1 signaling pathway in TNF-α/IFN-γ-stimulated
HaCaT cells..................................................................................................................90
Figure 20. Effects of T. vulgaris on body weight in DFE-induced NC/Nga mice................92
Figure 21. Effects of T. vulgaris on spleen weight in DFE-induced NC/Nga
mice.............................................................................................................................. 94
Figure 22. Effects of T. vulgaris on skin morphology in DFE-induced NC/Nga
ix
mice.............................................................................................................................. 96
Figure 23. Effects of T. vulgaris on skin density in DFE-induced NC/Nga
mice.............................................................................................................................. 99
Figure 24. Effects of T. vulgaris on skin hydration, TEWL, and EI in DFE-induced NC/Nga
mice......................................................................................................................103
Figure 25. Effects of T. vulgaris on scratching behavior in DFE-induced NC/Nga
mice............................................................................................................................105
Figure 26. Effects of T. vulgaris on serum IgE level in DFE-induced NC/Nga
mice............................................................................................................................107
Figure 27. Effects of T. vulgaris on β-hexosaminidase and histamine release in DFE-induced
NC/Nga mice.........................................................................................................109
Figure 28. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DFE-induced
NC/Nga mice.........................................................................................................111
Figure 29. Effects of T. vulgaris on activation of MAPKs in DFE-induced NC/Nga
mice............................................................................................................................113
Figure 30. Effects of T. vulgaris on IκBα and NFκB in DFE-induced NC/Nga
mice............................................................................................................................115
Figure 31. Effects of T. vulgaris on filaggrin expression in DFE-induced NC/Nga
mice............................................................................................................................117
x
Figure 32. Effects of T. vulgaris on epidermal thickness in DFE-induced NC/Nga
mice............................................................................................................................119
Figure 33. Effects of T. vulgaris on accumulation of mast cells in DFE-induced NC/Nga
mice......................................................................................................................121
Figure 34. Inhibitory effects of T. vulgaris on mast cells activation..................................125
Figure 35. Inhibitory effects of T. vulgaris on keratinocytes activation............................128
Abbreviations
T. vulgaris Thymus vulgaris L.
AD Atopic dermatitis
TARC/CCL17 Thymus- and activation-regulated chemokine/C-C motif chemokine
ligand 17
MDC/CCL22 Macrophage-derived chemokine/C-C motif chemokine ligand 22
RANTES/CCL5 Regulated on activation, normal T cell expressed and secreted/ C-C
motif chemokine ligand 5
IL-6 Interleukin 6
IL-8 Interleukin 8
MAPK Mitogen-activated protein kinase
CRHR1 Corticotropin releasing hormone receptor 1
CRHR2 Corticotropin releasing hormone receptor 2
xi
DFE Dermatophagoides farinae
IgE Immunoglobulin E
SC Stratum corneum
TEWL Transepidermal water loss
Abstracts

By Seul A Seo
Doctor of Philosophy in Science
Graduate School of Biotechnology, Kyung Hee University

Advised by Prof. Tae - Hoo Yi, O.M.D., Ph.D
Thymus vulgaris L., commonly known as thyme, is one of the aromatic herbs and has
been widely used worldwide. T. vulgaris has been reported to have antioxidant, anti-
inflammatory, and immunomodulatory activities, and particularly with regard to skin, anti-
photoaging and skin protective effects have been reported. However, there is no scientific
evidence about the inhibitory effects of T. vulgaris on AD. Thus, the present study was
performed to demonstrate the improving effects of T. vulgaris against AD symptoms.
The active components of T. vulgaris were detected by HPLC analysis. In the
in vitro study, the anti-atopic effects of T. vulgaris were examined in LPS-stimulated
xii
Raw264.7 cells, DNP-IgE/BSA-stimulated RBL-2H3 cells, and TNF-α/IFN-γ-stimulated
HaCaT cells using ELISA kits, RT-PCR, and western blotting. In the
in vivo study, the mitigating effects of T. vulgaris against AD were investigated by
measuring morphological and physiological changes, scratching behavior, AD symptoms
related protein expression, and histological changes in DFE-induced NC/Nga mice.
In the in vitro results, T. vulgaris significantly inhibited NO production in LPS-
stimulated Raw264.7 cells. It reduced the release of β-hexosaminidase and histamine via
regulation of calcium-related signaling pathway in DNP-IgE/BSA-stimulated RBL-2H3
cells. The production of TARC and MDC was remarkably suppressed by
T. vulgaris treatment in TNF-α/IFN-γ-stimulated HaCaT cells. Furthermore,
T. vulgaris influenced the decrease in mRNA expression of pro-inflammatory cytokine and
chemokines including IL-6, TARC, MDC, RANTES, and IL-8. It was shown to be due to the
modulation of MAPKs, STAT1, and NF-κB pathways. According to the in vivo results, it
was confirmed that topical application of T. vulgaris improves AD symptoms by reducing
the severity of dermatitis, TEWL, EI, scratching behavior, histamine release, epidermal
thickness, and infiltration of mast cells and elevating skin hydration and filaggrin
expression.
Taken together, this study revealed the ameliorating effects of T. vulgaris on AD-induced
in vitro and in vivo models. These findings suggest that T. vulgaris can be applied as a
xiii
natural product-derived therapeutic agent in the cosmetic and pharmaceutical industries, as
it attenuates itching by controlling histamine release, thereby improving symptoms of AD.
Keywords Thymus vulgaris L., atopic dermatitis, histamine, itching
xiv
Ⅰ. Introduction
1. Thymus vulgaris L.
Thymus vulgaris (T. vulgaris), commonly known as garden thyme, belong to the genus
Thymus (Lamiaceae family) and is native to Europe and Asia. It is highly aromatic, has
grey-green leaves, and blooms with purple or pink flowers in early summer.
T. vulgaris is considered to have high nutritional value because it is abundant in minerals
and vitamins that are beneficial to health. Vitamin A and vitamin C are abundant in
T. vulgaris, and vitamin B6 or pyridoxine, vitamin K, vitamin E, and folic acid are also
present. The health-promoting properties of T. vulgaris are known to be due to the
antioxidant and anti-inflammatory effects.
T. vulgaris is one of the most widely used spices in the world, characterized by having a
fragrant odor and a pungent taste. Because the flavor of T. vulgaris lasts for a long time, it
has an appetite-inducing effect and has been used in dishes such as soups, meat, pork
sausages, fish, and poultry dressings. T. vulgaris essential oil is used in aromatherapy, which
is known to be able to alleviate bites and stings, rheumatic aches, and pains. In addition, it
helps blood circulation to smooth the skin and is effective in acne treatment due to its
antibacterial activity.
T. vulgaris is one of the best known traditional medicines that has been applied in the
1
form of tea, ointment, tincture, syrup or steam inhalation. Since T. vulgaris is believed to be
effective in treating respiratory diseases such as dry coughs, asthma, and bronchitis, it has
been traditionally used for the treatment of these diseases. It is also known that vitamin C
present in T. vulgaris helps to improve immunity.
According to recent reports, it was verified that T. vulgaris essential oil and carvacrol, its
components, exert anti-inflammatory effects by allowing inhibition of inflammatory edema
and leukocyte migration. In oxLDL-Stimulated THP-1-Macrophages model,
T. vulgaris suppressed the production of proinflammatory mediators such as TNF-α, IL-1B,
and IL-6. It was revealed that T. vulgaris has a potential immunomodulatory role,
antioxidant activity, and a protective effect against plumbum (Pb) toxicity. In addtion,
antibacterial, antifungal, and neuroprotective effects of T. vulgaris have been reported.
Especially, in relation to the effect of T. vulgaris on skin, Sun et al. (2016) reported that
T. vulgaris is effective in improving skin wrinkles via inhibition of MAPK/AP-1 and
activation of NRF2-ARE antioxidant system. It was also demonstrated that
T. vulgaris and thymol, one of its active compounds, can reduce DNA damage induced by
UVA and UVB in NCTC 2544 cell line and protect skin against genotoxic damage caused by
UV radiation in an ex vivo human skin model. Moreover, study showed that T. vulgaris is
effective in the treatment of cutaneous leishmaniasis in balb/c mice. In relation to antifungal
2
activity, T. vulgaris essential oil and thymol has a therapeutic effect on experimentally
induced dermatomycoses in rats. However, few studies on skin inflammation have been
reported.
3
Table 1. Previous studies of T. vulgaris on biological effects
Reference
Biological effect Model
PMIDa
Antioxidant, UVB-irradiated NHDFs and UVB exposed hairless

27641753
Anti-aging mice
UVA and UVB-irradiated NCTC 2544 cell line 26338540
Skin protective UVA and UVB exposed human skin model (ex
27023828
vivo)
ear edema, carrageenan induced pleurisy, and
Anti-inflammatory 22919415
chemotaxis in vitro.
Anti-inflammatory oxLDL-Stimulated THP-1-Macrophages 22577523
Anti-leishmaniasis cutaneous leishmaniasis in balb/c mice. 19248657
Antimicrobial, Gram-negative bacteria (E. coli), gram-positive
antioxidant, bacteria (S. aureus and P. acnes), and fungi (C. 21979069
anti-inflammatory albicans and P. ovale), LPS-induced THP-1 cells
Immunomodulatory,
Lead (Pb)-intoxicated rats 31172438
antioxidant
Dermatomycoses induced rats 18651285
Antifungal
Fusarium oxysporum strains 28062283
Antibacterial Phytopathogen Allorhizobium vitis 29288304
Neuroprotective 5-fluorouracil (5-FLU) administered rats 31475590
PMIDa; PubMed identifier (PMID) is a unique number assigned to each PubMed record.
4
It was reported that T. vulgaris contains monoterpene phenols including thymol (10-
64%), p-cymene (9.1-22.2%), and carvacrol (0.4-20.6%). In addition, it also contains various
phenolic compound, such as rosmarinic acid, cymaroside, and caffeic acid.
Thymol is a major component of essential oils and is a naturally occurring phenol
monoterpene derivative of cymene and isomer of carvacrol. Many studies have been reported
on the biological effect of thymol, which has been shown to exert antioxidant effects through
the regulation of antioxidant enzymes such as superoxide dismutase (SOD) and glutathione
peroxidase (GPx), and to inhibit the production of elastase. In addition, it was demonstrated
that thymol has anti-inflammatory effects which act by reduction of LPS-stimulated
inflammation and edema and alleviate atopic dermatitis induced by Staphylococcus aureus
membrane vesicles. p-cymene is a monocyclic monoterpene which regulates the expression
of pro-inflammatory cytokines through suppression of MAPK and NF-B, thereby showing
anti-inflammatory activity. Also, it has antioxidant activity via reduction of lipid
peroxidation and nitrite content and enhancement of SOD and catalase activity.
Carvacrol has a positive effect on the reduction of interleukin (IL)-1β, IL-4, IL-8 and
malondialdehyde (MDA) and immunomodulatory effects against ovalbumin-induced asthma
in rats.
Studies have revealed that rosmarinic acid alleviates atopic dermatitis and inhibits
5
reactive oxygen and nitrogen species and suppresses hydrogen
peroxide-induced oxidative stress and inflammatory response in normal human dermal
fibroblasts via down-regulation of NF-κB transcriptional activity. Cynaroside, also known as
luteolin 7-O-glucoside, enhances the antioxidant and antiapoptotic ability in ARPE-19 cells
by promoting the expression of p-Akt and attenuates inflammation through regulation of the
PPARγ/Nrf2/NF-κB signaling pathway. Jeon et al. demonstrated the anti-inflammatory
effect of caffeic acid through down-regulation of chemokines. Moreover, caffeic acid has
been found to induce cutaneous wound healing and restore the antioxidant defense system.
6
Table 2. Previous studies of components of T. vulgaris on biological effects
Reference
Component Structure Biological effects
PMIDa
Antioxidant 10703468
Thymol Anti-atopic 29679854
25856703
p-Cymene Anti-inflammatory
22486037
Carvacrol
Immunomodulatory 31881223
Anti-atopic 19239556
Rosmarinic
acid
Cynaroside
Anti-allergic 26104582
Caffeic acid Wound healing 26929003
Anti-aging 22360712
7
2. Atopic dermatitis
Atopic dermatitis (AD) is one of the allergic skin disorders that is associated with the
immune system. It is accompanied by itching, erythema, cracked skin, and swelling. The
activation of keratinocytes is known as a major characteristics of AD. It results in the
production of pro-inflammatory cytokines which promote chronic and self-amplifying
immune activation. For this reason, keratinocytes play a pivotal role in accelerating and
maintaining inflammation in AD.
AD is known as an immediate type hypersensitivity reaction mediated by the mast cells.
Mast cells are key effectors in IgE-mediated immediate allergic disease such as asthma and
AD. Mast cells are distributed in various tissues and cause the release of various mediators
such as histamine and pro-inflammatory cytokines through degranulation. In particular,
histamine is related to immediate phase of allergic inflammation which presents as
symptoms such as vasodilatation, increased vascular permeability and tissue edema. The
activation of mast cell-derived factors contributes to itching and inflammation in AD skin.
8
2.1. Definition of atopic dermatitis
Atopic dermatitis (AD) is a chronic and relapsing inflammatory skin disorder,
accompanied by eczema, itching, edema, and skin thickening. AD is increasing in adults as
well as in children and is considered a major problem not only in developed countries but
also in developing countries. Therefore, AD is one of the serious diseases of modern society
which causes mental stress and worsens the quality of life. Although many studies on AD
have been conducted, the pathological and genetic mechanisms of AD are not fully
understood.
2.2. Causes of atopic dermatitis
The exact causes of AD are not known, but is thought to be a complex disease triggered
by interaction of several factors. Genetic factors are known to include mutations in the
filaggrin gene, which is related to the skin barrier and environmental factors, including
stimuli such as air pollution, chemicals, irregular sleep, and stress. It is also associated with
immunomodulatory abnormalities caused by the destruction of the balance of the Th1 / Th2
immune response.
9
2.3. Symptoms of atopic dermatitis
Diagnosis of AD is based on clinical features, requiring itchy skin and at least three of
the following: history of involvement of the skin creases, history of asthma or hay fever,
history of generally dry skin in the past year, onset in a child under two years of age, and
visible flexural dermatitis. Acute skin lesions include erythematous macules and papules,
which are related to excoriations and erosions. In the chronic phase, lichenification occurs
after scratching the skin for a long time.
Clinical manifestations of atopic dermatitis are very diverse, and are classified into
infant, pediatric, and adult types according to age. In infancy, skin lesions occur on the scalp
or face, especially presenting as acute eczema such as erythema, edema, and swelling, and
often worsen suddenly. In childhood, skin lesions tend to occur on the flexures and dorsal
aspects of the limbs. In adolescents and adults, lichenification is observed as a result of skin
fibrosis and increased collagen erosion in the flexure, head and neck.
10
2.4. Pathogenesis of atopic dermatitis
In normal skin, the Th1 and Th2 type immune responses are balanced to maintain
immunological homeostasis, and the skin barrier function is normally performed to protect
against external invasion. On the other hand, in AD skin, immunological homeostasis is
collapsed, resulting in an imbalance of immunity, and destruction of the skin barrier
increases invasion of external irritants and causes an inflammatory reaction.
2.4.1. Imbalance of Th1/Th2 immune response
The infiltration of T helper cells (Th cells) is characteristic of AD skin lesions.
According to function, these cells can be divided into T helper type 1 (Th1) cells and T
helper type 2 (Th2) cells, which can cause an inflammatory reaction of the skin depending
on the activity and duration of skin lesions.
In the AD skin lesions, there is a difference in the expression of cytokine depending on
the phase. In the acute phase, Th2 cells secrete cytokines, including IL-4, IL-5, and IL-13,
and this activates mast cells to promote the secretion of soluble mediators such as histamine.
It stimulates B cells to promote the production of IgE. Eczematous skin lesions are known to
be characteristic of the acute phase. On the other hand, in the chronic phase, the production
of Th1 cells is increased compared Th2, resulting in increased expression of IFN-γ, IL-12,
IL-5, and granulocyte-macrophage colony-stimulating factor (GM-CSF). The characteristics
11
of the chronic phase include lichenification of skin and tissue remodeling. Since AD is
accompanied by severe itching, the Th2 type immune response is converted into a Th0 type
immune response due to the wound caused by scratching the lesion site as the disease
progresses, resulting in chronic inflammation. Therefore, the response by Th2 cell activation
is characteristic of the acute phase, and the response by Th1 cells and/or Th0 cells activation
is characteristic of the chronic phase. This indicates that Th2 as well as Th1 play an
important role in inducing and maintaining skin inflammation in AD skin.
Recently, the role of Th17 cells related cytokines in the pathogenesis of AD has been
reported. In the lesions of AD, Th17 cells are infiltrated, leading to the expression of Th17
related cytokines such as IL-17 and IL-22. They are recognized as a critical factors because
they serve to mediate the onset and progression of AD.
2.4.2. Skin barrier dysfunction
The skin is the most external organ of the human body; it prevents water loss in the body
and acts as a barrier to protect against external stimuli such as irritants, allergens, and
pathogens. However, in AD skin, the functioning of the skin barrier is impaired, which is
recognized as one of the most important factors in the pathogenesis of AD. Damage to the
skin barrier increases transepidermal water loss (TEWL), causing a decrease in the moisture
content of the stratum corneum, resulting in dry, scaly, rough, dull, slightly wrinkled skin.
12
This is due to the mutations of structural proteins such as filaggrin in keratinocytes, which
increases protease activity or decreases the activity of protease inhibitor and also causes
abnormal lipid composition.
Filaggrin is one of the most important elements in forming the skin barrier, and is a
protein produced by the degradation of profilaggrin, a high molecular weight protein
constituting keratohyalin granules present in epidermal granule cells. Filaggrin acts to
aggregate keratin in keratinocytes, and when degraded, it turns into a natural moisturizing
factor such as free amino acids, urocanic acid, and pyrrolidone carboxylic acid, which
maintain moisture in the stratum corneum. In this way, the mutation of filaggrin gene, which
plays an important role in skin barrier function, not only causes abnormal keratinocyte
structure and skin barrier dysfunction, but also reduces the moisture content of the stratum
corneum and increases TEWL. This is responsible for causing dry skin in AD, which may
increase external irritation and worsen AD.
13
Figure 1. Acute and chronic phases of AD
14
2.5. Itching in atopic dermatitis
2.5.1. Role of histamine in itching
Histamine (2-[4-imidazolyl]-ethylamine) is a biogenic amine and is well known as a
crucial mediator of numerous biological reactions. Histamine is usually secreted from mast
cells and basophils, which are the main cellular sources of histamine and can store it in
specific granules. It has also been found that histamine is produced in T cells and
keratinocytes in response to stimulation, which cannot store histamine.
Histamine synthesized from the amino acid histidine by the histidine decarboxylase
(HDC) is stored in the secretory granules of both mast cells and basophils. Stimuli activate
these cells, and then stored histamine is released. It results in diverse biological effects
through the activation of four distinct receptors (H1R, H2R, H3R, and H4R). Histamine
receptors are classified as G protein coupled receptor and various functions of histamine are
attributed to these four pharmacologically distinct receptors. The activation of H1R by
histamine is known to cause cellular migration, nociception, vasodilatation, and
bronchoconstriction, and also involved in Th1- and Th2-type immune responses. H2R plays
a role in regulating gastric acid secretion, airway mucus production, and vascular
permeability. H3R plays an important role in neuro-inflammatory diseases by regulating the
15
release of histamine, serotonin, acetylcholine, and other
neurotransmitters. H4R is mainly expressed in immune cells such as leukocytes and mast
cells. Inflammation and pruritus were mediated by receptors that play an important role in
chronic allergic contact dermatitis. Mast cell activation by H4R regulates the inflammatory
cascade through the release of the several inflammatory mediators. In addition, H4R was
reported to affect chemotaxis in mast cells and eosinophils. Especially with regard to skin,
the activation of H1R affects most immediate hypersensitivity reactions such as erythema,
pruritus, and edema. In addition, H1R promotes the proliferation of keratinocytes and causes
periostin release in fibroblasts. It was reported that histamine is also involved in itch
sensation of sensory neuron through H1R and H4R.
16
Figure 2. Biosynthesis and metabolism of histamine
17
Figure 3. Effects of histamine through H1 and H4 receptors in skin allergic reaction.
18
Histamine is known to be involved in various biological reactions. In the central nervous
system, histamine dilates blood vessels, causing dizziness, headache, vomiting and
insomnia. In addition, vasodilation causes arrhythmia, hypotension, and shock symptoms in
the cardiovascular system. In relation to the stomach and intestine, abdominal pain, diarrhea
and abdominal swelling due to gastric acid secretion appear, and is involved in smooth
muscle contraction, causing menstrual pain and urination. In the respiratory system,
histamine increases mucous secretion and vascular permeability, resulting in rhinitis and
coughing.
Especially in relation to the skin, symptoms such as itching, facial flushing and urticaria
are caused by histamine through increased vascular permeability and pain-sensitive
disorder, stimulation of nerve fibers. Histamine plays an important role in inflammatory skin
disease; initial reddening of skin, plasma extravasation and the development of a weal
(tissue oedema) and a flare (wider spread erythema) are considered features of skin
inflammation by histamine. These reactions are often accompanied by itching. Histamine
released from mast cell granules induces inflammation, which is mostly associated with
immediate hypersensitivity. In addition to causing skin inflammation and itching, histamine
has also been reported to affect skin barrier function. Histamine inhibits epidermal
differentiation and disturbs skin barrier function by reducing the formation of tight junctions
19
and the expression of filaggrin, and promotes proliferation of keratinocytes, leading to
hyperkeratosis.
Allergy symptoms further stimulate the release of histamine, which in turn leads to the
deterioration of the disease such as AD. Itching is hallmark symptom of AD, which causes
an unpleasant sensation and a desire to scratch, aggravating the cutaneous symptoms.
Patients with AD usually experience itching and scratching, which triggers psychological
problems such as sleep disorders and depression. This has a significant impact on the quality
of a patient’s life. Although there are various substances that trigger itching, such as
cytokines and substance P, histamine is still recognized as a major pruritogen. It is
responsible for at least half of the symptoms and signs of allergic reactions in the skin. Since
mast cells are a major source of stored histamine, the improvement of allergy symptoms and
immune dysfunction depends on the regulation of histamine release from mast cell. Upon
stimulation by an allergen, histamine is released from mast cells through degranulation,
which causes the excitation of a subset of unmyelinated C-fibers, leading to itching.
20
2.5.2. Psychological stress and itching
Psychological stress is general phenomenon reported to have a significant effect on
immune function. It is known as a risk factor for immune related diseases such as AD. The
regulation of immune and nerve systems by psychological stress can affect itching, which
results in worsening the condition of inflammatory diseases. Thus, stress is a main
contributor to aggravate itching in a variety of itching-associated diseases. There is a stress-
itching-scratching cycle that stress can causes or aggravates itching, in turn leading to
scratching and further itching. This can worsen stress; indeed, itching is associated with
anxiety and stress sensitivity in patients with AD, causing high levels of anxiety and stress in
patients with chronic and severe itching. Patients with chronic itching react sensitively to
itching-scratches cycles, which can lead to an increase in stress levels, eventually
aggravating itching. This vicarious cycle results in continuous scratching, deterioration of
diseases, and impaired quality of life. The central and peripheral activation of the
hypothalamic-pituitary-adrenal (HPA) axis and sympathetic nervous system are involved
with the induction or deterioration of itching caused by stress. Mast cells, keratinocytes, and
nerves are affected by these systems, which promote the secretion of neuropeptides including
histamine, substance P, and itchy cytokines.
21
In response to stress, CRH can be secreted from keratinocytes and mast cells. In
keratinocytes, the release of many mediators associated with the pruritogenic pathway can be
caused by CRH. Furthermore, CRH induces the secretion of the mediators that activate mast
cells. When mast cells are activated, histamine and cytokines, characterized by inflammatory
and vasodilatory mediators, are secreted. This eventually leads to itching. Inflammation
induces a reduction in the threshold for itching stimuli, which results in peripheral itching
sensitization.
Many skin disorders, such as AD, are correlated with an increase in the number of
activated mast cells, which tend to be further exacerbated by stress. Thus, mast cells are
recognized as a key immune effectors in the stress response. Mast cells manifest various
receptors, which rapidly sense and respond to stress signals from environmental and
immunological factors. Under stress, the release of mediators such as β-hexosaminidase and
histamine in mast cells is promoted through degranulation. In particular, histamine induces
an increase in vascular permeability and stimulates the cutaneous sensory nerves, which in
turn causes itching. Excessive activation of mast cells has a detrimental effect that is
associated with the onset and severity of diseases such as allergy.
Similar to the central axis, the peripheral HPA axis exists in the skin. This plays a key
role in the response to psychological stress. CRH is a major component of the HPA axis, and
22
is important in controlling the response to stress. CRH is known to regulate the stress
response through the two receptors, CRHR1 and CRHR2. According to a recent study, it
has been demonstrated that CRHR1 acts as a positive regulator in mast cell degranulation
induced by stress. CRHR1 is mainly involved in the anxiogenic effect of CRH. In contrast,
CRHR2 serves to inhibit mast cell degranulation via calcium related signaling pathways.
CRHR2 is involved in reduced anxiety-like behaviors and stress sensitivity. Since CRH and
related peptide are activated by mast cells, it is believed that mast cells serve an important
function as a sensor of psychological stress. Therefore, the regulation of these receptors can
be targeted in treating immune disorders that is associated with stress and mast cell
hyperactivity such as allergic inflammation.
23
3. Mechanism of atopic dermatitis
3.1. Mast cell activation
Mast cells play a pivotal role in allergic inflammatory reactions because the number of
mast cells and activation of mast cells are increased in AD lesions. The stimulation of
antigen presenting cells differentiate Th2 cells, which promotes the production of IgE in B
cells. Subsequently, IgE binds to high affinity IgE receptor (FcεRI) present on the surface of
mast cells, which activates these cells. It induces degranulation and promotes production of
inflammatory cytokines resulting in an allergic reaction. In an allergic reaction, mast cells
secret a variety of biological mediators including preformed secretory granules (containing
β-hexosaminidase and histamine), cytokines, and chemokines. When mast cells are
activated, β-hexosaminidase and histamine present in pre-stored vesicles are released by the
fusion of granule and plasma membrane during the acute phase, resulting in the delayed
production and secretion of inflammatory cytokines.
For mast cell activation, mobilization of Ca 2+ is a key process. Ca 2+ plays an important
role as a secondary messenger in the mast cell signaling pathways that modulates a variety
of cellular responses. According to the intracellular calcium level, the exocytosis of the mast
cell granules and secretion of the inflammatory cytokines are regulated by the
Ca2+ influx from the extracellular space. Upon allergen-mediated stimulation, CRHR1 is
24
activated, but CRHR2 is suppressed. This stimulates phosphorylation of phospholipase Cγ
(PLCγ), leading to the generation of inositol 1,4,5-trisphosphate(IP3), which binds to IP3
receptors present in the endoplasmic reticulum (ER) to induce intracellular calcium release
from ER. The release of ER Ca 2+ mediated by IP3 causes the emptying of intracellular
Ca2+ stores, subsequently activating a Ca 2+ influx to refill intracellular stores through plasma
membrane channels.
Store-operated Ca 2+ entry (SOCE) is known as a major mechanism of Ca 2+ influx. For
SOCE, stromal interaction molecule 1 (STIM1) present in the ER membrane plays a crucial
role as an endogenous Ca 2+ sensor. It senses the low concentration of Ca 2+ in ER, and
subsequently forms a complex with calcium release-activated calcium channel protein 1
(Orai1). Orai1 is one of the store-operated channels and exists in plasma membrane that is
regulated by the level of Ca 2+ in ER stores. As store-operated channels, there is also
transient receptor potential canonical channel 1 (TRPC1) which is involved in the
Ca2+ influx. As a result, the increase of cytosolic Ca 2+ level leads to the fusion of preformed
granules with the plasma membrane. This rapidly induces the degranulation of mast cells via
Ca2+ mediated exocytosis and promotes the secretion of inflammatory mediators such as
histamine, β-hexosaminidase, proteases, proteoglycans, and lipid mediators, thereby leading
25
to allergic inflammatory responses. It is believed that keratinocytes can be affected by
activation of mast cells.
26
Figure 4. Mechanism of mast cells activation
27
3.2. Keratinocytes activation
Keratinocytes present in the epidermis play an important role in the pathogenesis of
inflammatory skin diseases such as AD. When keratinocytes are exposed to stimuli such as
TNF-α and IFN-γ, cytokines and chemokines including thymus- and activation regulated
chemokine (TARC/CCL17), macrophage-derived chemokine (MDC/CCL22), regulated on
activation, normal T-cell expressed and secreted (RANTES/CCL5), and interleukin 8
(IL-8/CXCL8) are abnormally expressed. As a result, they increase the infiltration of Th
cells into local lesions. In the keratinocytes of AD skin, a number of cytokines and
chemokines involved in the response of immune cells is generated, and as a result,
inflammation of the skin lesions is exacerbated. Thus, these mediators are considered as
conclusive modulators in the pathogenesis of AD. It has been found that the regulation of
inflammatory responses related to AD is influenced by nuclear factor-kappaB (NF-κB),
janus kinase (JAK)/signal transducer and activator of transcription (STAT), and mitogen-
activated protein kinase (MAPK).
TNF-α is known to be involved in the activation of diverse signaling pathway such as
NF-κB, ERK, JNK, and p38 MAP kinases. In the resting state, NF-κB, a key transcription
factor of the inflammatory response, binds to IκB in the cytoplasm. Under the stimulation,
the IKK complex is activated, and IκB is subsequently phosphorylated and degraded. The
28
free NF-κB is released and translocated into the nucleus, which is responsible for activating
the expression of various genes associated with pro-inflammatory cytokines and
chemokines. In addition, when keratinocytes are stimulated, the MAPK signaling pathway is
activated, to subsequently upregulate NF-κB, resulting in acceleration of proinflammatory
cytokines and chemokines expression.
IFN-γ is important in the regulation of the immune responses because it is characterized
by possessing immunomodulatory activity. In the IFN-γ signaling pathway, IFN-γ binds to
its receptor and induces the activation of JAK, and then phosphorylates STAT1. STAT1 is a
member of the STAT protein family and this phosphorylation has been found to play a
crucial role in IFN-γ mediated inflammatory responses. When STAT1 is phosphorylated, it
translocates from the cytoplasm into the nucleus and then promotes the transcription of
genes associated with inflammation such as MDC. Thus, it is regarded that STAT1 is a
significant regulator of the IFN-γ signaling pathway.
29
Figure 5. Mechanism of keratinocytes activation
30
4. Therapeutic agents of atopic dermatitis and allergic response
Ketotifen is a relatively selective, non-competitive histamine antagonist (H1R) and mast
cell stabilizer. Ketotifen inhibits the release of mediators from cells involved in
hypersensitivity reactions. Decreased chemotaxis and activation of eosinophils has also been
demonstrated. Ketotifen has been shown to have little systemic exposure following topical
ocular administration. In human conjunctival allergen challenge studies, ketotifen fumarate
was significantly more effective than placebo in preventing ocular itching associated with
allergic conjunctivitis. The action of ketotifen occurs rapidly with an effect seen within
minutes after administration. Several studies have examined the efficacy of topical
tacrolimus in adult patients. In a double-blind, placebo-controlled study, 215 patients with
moderate to severe atopic dermatitis were randomized to receive 0.03, 0.1, or 0.3 percent
tacrolimus, or vehicle, applied twice daily. Patients were evaluated at three weeks using
atopic dermatitis severity scores. The decrease in scores for the three groups was 67, 83, and
75 percent for the 0.03, 0.1, and 0.3 percent ointments, respectively. The vehicle group
showed a 22 percent decrease in severity scores. The only statistically significant side effect
in treatment versus vehicle groups was a sensation of local burning, but this effect resulted in
no increase in the dropout rate.
31
4.1. Ketotifen fumarate
Ketotifen, well known as mast cell stabilizer, is a second-generation non-competitive H1
antihistamine. The pharmacodynamic properties of ketotifen are many, because it is an
inhibitor of the release and/or activity of mast cell and basophil mediators, including
histamine, neutrophil, and eosinophil chemotactic factors, arachidonic acid metabolites,
prostaglandins, and leukotrienes. The ocular, nasal, and dermal responses to applied allergen
in sensitized patients are attenuated with use of ketotifen. Oral ketotifen has been used in
patients with asthma, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, chronic
urticaria, cold-induced urticaria, cholinergic urticaria, exercise-induced urticaria,
mastocytosis, and food allergy. For adults and older children with asthma or allergic
disease, the recommended dose of ketotifen is 1 mg twice daily. For young children 6
months to 3 years old, the recommended dose is 0.5 mg twice daily. Oral ketotifen is usually
well tolerated and relatively safe, with the most frequent side effect of sedation. This is seen
in approximately 10% to 20% of patients, especially at higher doses, but the effect decreases
within 1 to 2 weeks of use.3 Other rarer reactions include dizziness, dry mouth, nausea, and
headache, which have been reported in 1% to 2% of patients at initiation of therapy.
However, these side effects do not persist in patients on long-term treatment.
32
4.2. Tacrolimus
Tacrolimus is a calcineurin inhibitor and possess immunomodulatory and anti-
inflammatory properties. The mechanism of action of tacrolimus in allergic diseases
involves calcineurin inhibition, and downregulation of T-cell reactivity, IgE degranulation,
and its actions on mast cells, dendritic cells, basophils, eosinophils and inhibition of
transcription of proinflammatory cytokines.
Tacrolimus inhibits cytokine production following T cell activation and decreases Fc
epsilon RI expression on dendritic cells in the skin in atopic dermatitis. Tacrolimus targets
Ca2+-dependent protein phosphatase, calcineurin. The antigens bind to T-cell receptors which
result in increased production of Ca 2+. The increased intracellular Ca 2+ binds with calmodulin
and activate and phosphorylates nuclear factor of activated T Cells. The dephosphorylated
form of cytoplasmic NF-AT translocate from the cytosol into the nucleus and forms a
complex with the nuclear subunit of NF-AT, and can bind to the promoter region of several
cytokine genes and induce gene transcription. On the other hand, after penetrating the cell
membrane, tacrolimus binds to its intracellular receptor, the FK-binding protein complex and
blocks the function of the Ca 2+ and calmodulin-dependent phosphatase, calcineurin. This
interaction results in suppression of NF-AT-dependent cytokine gene transcription and
immunosuppression. Thus tacrolimus inhibits transcription of cytokines and suppresses T-
33
cell proliferation. Allergic diseases of the biological system comprise a spectrum of
diseases, with each condition being characterized by a complex immunopathology.
Tacrolimus is a potent immunomodulator that is effective in the treatment of various allergic
diseases by its pleiotropic immunosuppressive effects on the immune system.
34
Table 3. Indication and side effect of therapeutic agents
Therapeutic agent Indication Side effects
Allergic conjunctivitis
- Increased nosebleeds
Asthma
- Irritability
Ketotifen fumarate Atopic dermatitis
- Dry mouth
Chronic urticaria
- Drowsiness
Allergic rhinitis
Atopic dermatitis - Burning sensation

- Folliculitis
Contact Hypersensitivity
- Acne
Tacrolimus
Organ transplantation - Eczema herpeticum
- Herpes simplex infections
Ulcerative colitis
- Neurotoxicity
35
4.3. Natural products-derived therapeutics
Many studies have been performed on atopic dermatitis, but no complete treatment has
yet been found. Since atopic dermatitis is caused by various factors, different treatments may
be applied to each patient. The current therapeutics are known to have side effects if applied
chronically. However, natural products have fewer side effects and contain components with
various biological functions. For this reason, many studies have been conducted on the
effect of natural products for atopic dermatitis (Table 4 and 5).
36
Table 4. Previous studies on the effect of natural products in AD
Natural products Reference

Effect
(Korean name) PMIDa
Reduce histological manifestations of atopic skin

Saussurea lappa
lesions such as erosion, hyperplasia of the epidermis 24216625
(Mok-hyang)
and dermis, and inflammatory cell infiltration.
Suppress TNF-α/IFN-γ-induced production of TARC
and MDC in HaCaT cells by inhibiting MAPK
Hovenia dulcis
signaling and regulate immunoglobulin (Ig) E and
Thunb. 27696405
immunoglobulin G2a (IgG2a) levels in serum and
(Heot-gae-na-mu)
the expression of mRNA for Th1- and Th2-related
mediators in skin lesions.
Inhibited the expression of TNF-a, CCL17, IL-1b,
Moringa oleifera
and IL-6 mRNA, as well as that of MAPKs in
leaf 27744247
HaCaT keratinocytes in a concentration-dependent
(Moringa)
manner.
Patrinia scabiosifolia Attenuate the development of AD-like lesions by
Link increasing filaggrin expression and lowering IgE 28347830
(Ma-ta-ri) and inflammatory cytokine levels.
Regulate chemokine formation by inhibiting
Artemisia apiacea
activation of and ERK as well as the NF-κB
Hance 29932162
pathways and improve the skin p38 conditions in a
(Gae-sa-cheol-ssuk)
DNCB-induced AD-like mouse model
37
Table 5. Previous studies on the effect of natural products in allergic skin inflammation
Natural products Reference

Effect
(Korean name) PMIDa
The release of histamine from mast cells was

Pogostemon cablin
reduced by AEPC, and this suppressive effect was 26531835
(Patchouli)
associated with the regulation of calcium influx.
F-AFE suppressed the production of TNF-α and
Arctium lappa PGE2 in a dose-dependent manner. F-AFE inhibited
26707911
(U-eong) the phosphorylation of Lyn, Fyn and Syk, which are
involved in the FcεRI signaling pathway.
Zanthoxylum Zanthoxylum coreanum Nakai inhibited both the
coreanum Nakai IgE-antigen complex or PMA/A23187-induced β-
30618741
(Wang-cho-pi hexosaminidase release and IL-4 production dose-
-na-mu) dependently in RBL-2H3 mast cells.
P. santalinus extract inhibited β-hexosaminidase and
Pterocarpus
histamine release and reduced tumor necrosis
santalinus 30609435
factor-α, interleukin-4, and prostaglandin E2
(Ja-dan-hyang)
secretion.
Schizonepeta degranulation of RBL-2H3 cells was assessed by
tenuifolia measuring the release of β-hexosaminidase, which 29849717
(Hyeong-gae) was suppressed by ST at 10 μg/mL.
38
39
5. Purpose of this study
T. vulgaris is well known as one of the aromatic herbs that have been used worldwide
for the purpose of spices, cosmetics, and treatment due to its various effect. Antioxidant,
anti photoaging, and skin protection effects of T. vulgaris were reported, but no studies have
been reported on the inhibitory effect of T. vulgaris in atopic dermatitis models. Thus, this
study was conducted to investigate whether T. vulgaris is effective in improving atopic
dermatitis through the regulation of inflammatory response and histamine release.
In AD, steroids and immunosuppressive drug have been used for treatment. There are
many reports that long term use of steroids can cause serious side effects such as skin
atrophy, steroid-induced acne, and telangiectasia. Immunosuppressive drug has also been
reported to have adverse reactions including temporary skin irritation. As the number of
patients with AD continues to increase around the world, it is necessary to develop
alternative treatments that are safe with few side effects. Therefore, this study was conducted
to demonstrate the effect of T. vulgaris as a therapeutic agent of AD.
Anti-atopic and anti-allergic effects of T. vulgaris were studied in both in vitro and in
vivo AD models. In the in vitro study, the effects of T. vulgaris on mast cell degranulation
and expression of calcium related protein were investigated in DNP-IgE/BSA-stimulated
RBL-2H3 cells. Furthermore, the production of pro-inflammatory cytokines and
40
chemokines, as well as their signaling pathway including MAPKs, STAT1, and NF-κB, were
examined in TNF-α/IFN-γ-stimulated HaCaT cells. In the in vivo study, the effects of
T. vulgaris by topical application were examined following DFE treatment in NC/Nga mice
model. The clinical dermatitis severity scores, skin hydration, TEWL, scratching behavior,
serum IgE levels, histamine release, histological changes, and the expression of AD-related
protein markers were evaluated.
41
Ⅱ. Materials and Methods
1. Materials
The dried leaves of T. vulgaris was purchased from Mountain Rose Herbs Company
(Eugene, OR, USA) with USDA certificate. Dulbecco’s modified Eagle’s medium (DMEM),
Fetal bovine serum (FBS), antibiotics, and trypsin-EDTA were purchased from Gibco-BRL
(Grand Island, NY, USA). Enzyme-linked immunosorbent assay (ELISA) kits for
TARC/CCL17 and MDC/CCL22 were purchased from R&D systems (Human TARC/CCL17
Duoset ELISA kit, Human MDC/CCL22 Duoset ELISA kit; R&D systems, Inc.,
Minneapolis, MN, USA). Mouse IgE and histamine ELISA Kit were purchased from Abcam
(Cambridge, UK). Primary and secondary antibodies were obtained from Santa Cruz (Santa
Cruz, CA, USA), Cell signaling (Danvers, MA, USA), and Abcam (Cambridge, UK).
Rosmarinic acid, caffeic acid, lipopolysacaride (LPS), recombinant human TNF-α and IFN-
γ, Monoclonal Anti-dinitrophenyl antibody produced in mouse (Anti-DNP IgE), 3-(4,5-
Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and other reagents were
purchased from Sigma-Aldrich (St. Louis, MO, USA).
42
2. Sample preparation
Dried T. vulgaris (1.5 g) was extracted with ethanol (50%) in a ration of 1:10 (w/v) using
a digital orbital shaker, SHO-1D (Daihan, Korea) for 24 h at 24-25 ℃ three times. After 24 h
incubation, the extracts were filtered and evaporated under vacuum at 40 ℃; and yielded
17.8 % (w/v).
43
Figure 6. Preparation of T. vulgaris extract
44
3. HPLC analysis
The HPLC system (UltiMate 3000 LC system, Thermo Fisher and Voorhees Scientific
Inc., Sunnyvale, CA, USA) with a C18 column (4.6 x 250 mm, 5 μm; Hypersil GOLD,
Thermo Fisher Scientific Inc., Sunnyvale, CA, USA) was used to detect the polyphenolic
compounds of T. vulgaris. Other setting conditions were running samples in 50% methanol
at 1 mg/mL, a 10 μL sample was injected at a flow rate of 1 mL/min, and a detection
wavelength at 280 nm. The rosmarinic acid and caffeic acid standards were prepared in 50%
methanol with a range of concentrations (3.125 μg/mL to 100 μg/mL).
45
4. In vitro study
4.1. Cell culture
The murine macrophage RAW 264.7 cell line and rat basophilic leukemia RBL-2H3 cell
line were obtained from KCLB (Korea) and Human immortal keratinocyte HaCaT cell line
was obtained from ATCC (VA, USA). All cell lines were maintained in the incubator at 37℃
with humidified atmosphere containing with 5% of CO 2. Cells were cultivated in DMEM
media containing 10% heat-inactivated FBS and 1% antibiotics and antimycotic medication
using T-75 flask (Raw 264.7 cells) or 100 mm dishes (HaCaT cells and RBL-2H3 cells).
Then cells were seeded in 96 well (Raw 264.7, 1.0×10 5 cells/well; RBL-2H3,
1.0×104 cells/well) and 6 well (HaCaT, 1.0×10 6 cells/well; RBL-2H3, 5.0×10 5 cells/well) and
until the confluence reached to 80%.
4.2. Sample treatment
The cells were treated with various concentration (ranging from 1 to 100 µg/mL) of
T. vulgaris following sensitization. For Raw 264.7 cells, the cells were seeded at 96 well
then co-treated with T. vulgaris and stimulator after 24 h incubation. 1 µg/mL of LPS was
used as a stimulator and 1 µM of dexamethasone was used to a positive control. For HaCaT
cells, the cells were seeded at 6 well plate and were pretreated with
46
T. vulgaris for 30 min, and then stimulated with 10 ng/mL of TNF-α and IFN-γ for 30 min. 1
and 10 µg/mL of tacrolimus was used to a positive control. To analyze the section of
cytokines and chemokines, the cells were incubated 24 h after treatment. For RBL-2H3
cells, the cells were seeded at 6 well plate and were pretreated with
T. vulgaris for 30 min, and then stimulated with 100 μg/mL of compound48/80 for 30 min.
100 µM of cromolyn was used to a positive control.
4.3. Measurement of cell viability
MTT is a colorimetric assay used to measure cell viability. Specifically, viable cells
allow produce purple-colored formazan thereby it can be detected by spectrophotometer. At
the end of the incubation period, MTT reagent was added to adjust its concentration to 0.1
mg/mL. Next, the MTT treated cells were incubated for 3 h at 37°C in a
CO2 incubator, after which the medium was removed and 800 μL of DMSO was added to
dissolve the formazan crystals. Finally, the OD was read at 595nm using an ELISA reader
(Molecular Devices FilterMax F5; San Francisco. CA, USA).
4.4. Measurement of NO production
NO production of RAW 264.7 cells was measured using the Griess reagent system
(Promega, Fitchburg, WI, USA). The Cells were seeded in 96 well plate
(1.0×105 cells/well) and then incubated for 24h. Next, TV or LPS was treated and the
47
incubation was continued for an additional 24 h. 50 μL of a sulfanilamide solution and an 50
μL of N-(1-naphthyl)ethylenediamine dihydrochloride solution was then added to each well
and incubated for 10 min at room temperature in each process. Absorbance was recorded at
595 nm using a microplate reader.
4.5. β-hexosaminidase release assay
To investigate the suppressive effect of T. vulgaris on degranulation, a sign of type 1
immediate allergic response, secretion of β-hexosaminidase was analyzed. Following
suspension in 10% FBS-supplemented DMEM, RBL-2H3 cells were seeded in 96-well
plates at a density of 3×10 4 cells/well and incubated for 24 h. After washing twice with
siraganian buffer, cells were incubated with anti-DNP-IgE (50 ng/mL) for 24 h. IgE-
sensitized cells were treated various concentrations of T. vulgaris for 1 h at 37 ̊C. Then,
DNP-BSA was added to each well to reach a concentration of 100 ng/mL, and cells were
incubated for an additional 4 h under the same conditions. Afterwards, cells were placed in
an ice-bath for 10 min to terminate incubation. Supernatants were collected and 50 μL of
each sample was mixed with of substrate buffer (1 mM p-nitrophenyl-N-acetyl-β-D-
glucosamine in 0.1 M citrate buffer, pH 4.5). Following 1 h of incubation, reaction was
stopped with 200 μL/well stop solution (0.1 M Na 2CO3/NaHCO3, pH 10.0). Absorbance was
read at 405 nm using a microplate reader (Molecular Devices Co. Ltd., Sunnyvale, CA,
48
USA).
4.6. Histamine release assay
The release of histamine was quantified with commercial ELISA kit (Histamine ELISA
kit; Abcam, Cambridge, UK). After 2 h of sample treatment and stimulation, 1 mL of cell
culture supernatants were collected then the total concentration of histamine was measured
according to the manufacturer’s instruction.
4.7. Measurement of intracellular calcium
Fluo-3/AM (Invitrogen), a fluorescent indicator, was used to measure intracellular
calcium levels. RBL-2H3 cells were pre-incubated with Fluo-3/AM for 1 h, treated with
sample for 1 h, and then stimulated with DNP-HSA (100 ng/ml). The fluorescence intensity
was detected at an excitation wavelength of 485 nm and an emission wavelength of 535 nm
as previously described. Intracellular calcium levels were compared to those of non-
stimulated control cells, which were set at a value of one relative fluorescent unit.
4.8. Enzyme-linked immunosorbent assay (ELISA)
The Secretion of cytokines and chemokines were quantified with commercial ELISA kits
(Human CCL17/TARC Duoset ELISA Kit, Human CCL22/MDC Duoset ELISA Kit; R&D
systems, Inc., MN, USA). After 24 h of sample treatment and stimulation, 1 mL of cell
culture supernatants were collected then the total concentration of TARC/CCL17 and
49
MDC/CCL22 was measured according to the manufacturer’s instruction. The release of
histamine was quantified with commercial ELISA kit (Histamine ELISA kit; Abcam,
Cambridge, UK). After 30 min of sample treatment and stimulation, 1 mL of cell culture
supernatants were collected then the total concentration of histamine was measured
according to the manufacturer’s instruction.
4.9. Reverse transcription-polymerase chain reaction (RT-PCR)
Total cellular RNA was extracted from HaCaT cells using TRIzol (Invitrogen Co, Grnad
island, NT, US). RNA samples were quantified and a total of 4 μg of RNA was reverse
transcribed using 200 units of reverse-transcriptase and 0.5 μg/μL oligo-(dT)15 dimer
(Bioneer CO., Korea). The amplification was performed using a PCR premix (Bioneer CO.,
Korea). Primers for TARC/CCL17, MDC/CCL22, RANTES/CCL5, IL-6, and IL-8 were
described in Table 6. PCR was performed using a Veriti Thermal Cycler (Applied
Biosystems, Foster City, CA, USA, Table 6). PCR products were separated by 2.0% agarose
gel electrophoresis and visualized with ethidium bromide.
50
Table 6. List of primers for RT-PCR
Gene Sequence (5’-3’)
Forward 5΄- ACCACAGTCCATGCCATCAC -3΄,

GAPDH
Reverse 5΄-CCACCACCCTGTTGCTGTAC -3΄.
Forward 5΄ - CTCCTTCTCCACAAGCGCC -3΄
IL-6
Reverse 5΄ - GCCGAAGAGCCCTCAGGC -3΄
Forward 5΄ - TCAGTGCATAAAGACATACTCC -3΄
IL-8/CXCL8
Reverse 5΄ - TGGCATCTTCACTGATTCTTG -3΄
Forward 5΄ - ATGGCCCCACTGAAGATGCT -3΄
TARC/CCL17
Reverse 5΄ - TGAACACCAACGGTGGAGGT -3΄
Forward 5΄ - CCCCGTGCCGAGCACATCAAGGAGTATTT-3΄
RANTES/CCL5
Reverse 5΄ - CGTCCAGCCTGGGGAAGGTTTTTGTA -3΄
Forward 5΄ - AGGACAGAGCATGGCTCGCCTACAGA -3΄
MDC/CCL22
Reverse 5΄ - AATGGCAGGGAGGTAGGGCTCCTGA -3΄
51
4.10. Western blot analysis
The cells and skin tissues were extracted using RIPA buffer and the nucleoprotein and
cytoplasmic protein were separated using commercial kit (NE-PER nuclear and cytoplasmic
extraction reagents; Pierce). Next, cell and skin lysates were homogenized to yield
equivalent amounts of protein based on protein concentration measurements performed with
Bradford reagent (Bio-Rad, Hercules, CA, USA). Homogenized proteins were
electrophoresed by 10 to 15% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and
thereafter transferred from SDS-PAGE to a nitrocellulose membrane (Amersham Pharmacia
Biotech, Buckinghamshire, UK). Non-specific binding was blocked with 5% Bovine serum
albumin in TBST (50 mmol / 1 Tris-HCL, pH 7.5, 150 mmol / 1 NaCl, and 0.1% Tween 20)
for 1 h at room temperature followed by overnight incubation of membranes with primary
antibodies at 4°C. The membranes were then washed with TBST three times and incubated
with secondary antibody (Santa Cruz Biotechnology Inc., CA, USA) for 1 h at room
temperature. Finally, proteins were visualized using a chemiluminescence detection ECL
reagent (GE Healthcare Life science, PA, USA) and quantified with UVI-1D software,
(UVITEC, Warwickshire, UK).
52
5. In vivo study
5.1. Experimental animals
Six-week-old male NC/Nga mice (21-26 g) were obtained from Central Lab Animals,
Inc. (Seoul, Korea). The animals were randomly divided into five groups of five mice per
cage and housed in conditions of 22 ± 1°C, 60 ± 5% humidity, and 12-h light/dark cycles.
Animals were acclimatized for 2 week before starting the study. The experimental protocol
[KHUASP(SE)-17-014] was approved by the Institutional Animal Care and Use Committee
of Kyung Hee University.
5.2. Induction of AD-like skin lesion and topical application
Eight week-old male NC/Nga mice were exposed with Biostir-AD (Biostir, Kobe,
Japan), a hydrophilic petrolatum-based ointment-containing extract of house dust mite
(Dermatophagoides farinae), according to the manufacturer’s instructions. After removing
mice hair, 150 μL of 4% (w/v) sodium dodecyl sulfate (SDS) was applied to that dorsal
skin. After drying, DFE (100 mg/mouse/time) was applied two times per week for 3 weeks.
Twenty five mice were divided into five groups of five mice per cage: (a) Normal (distilled
water only); (b) Control (DFE + distilled water); (c) Tacrolimus 0.1% (DFE + tacrolimus
0.1% in distilled water); (d) T. vulgaris 0.1% (DFE + T. vulgaris 0.1% in distilled water);
and (e) T. vulgaris 1% (DFE + T. vulgaris 1% in distilled water). Samples were applied three
53
times per week for 3 weeks. In this experiment, tacrolimus 0.1% was used as a positive
control.
5.3. Evaluation of AD-like skin symptoms
The relative severity of AD was evaluated macroscopically according to the following
five symptoms: erythema, edema, erosion, dryness, and lichenification. The total dermatitis
severity score was defined as the sum of component scores (0, no symptoms; 1, mild; 2,
moderate; 3, severe). The range of dermatitis score is 0 to 15. The dermatitis scoring was
performed by a blind test during the experimental period.
54
Table 7. Symptoms of AD
Score 0 Score 1 Score 2 Score 3

Intensity
None Mild Moderate Severe
Erythema
Edema
Erosion
Dryness
Lichenification
55
5.4. Measurement of physiological skin alteration
During the experimental period, physiological alteration of dorsal skin of experimental
animals were measured using skin measurement instrument (Dermalab ® combo, Cortex
Technology, Denmark). Skin parameters including video scope, high resolution ultrasound,
hydration, TEWL, and erythema were measured using appropriate probe then all data was
analyzed by Dermalab skinlab software (Cortex Technology, Denmark).
5.4.1. Video scope
The videoscope probe is able to magnify and visualize the surface of the skin using
polarized or non-polarized white light as the light source.
5.4.2. High resolution ultrasound
Ultrasound skin imaging is based on measuring the acoustic response from the skin,
when an acoustic pulse is sent into the skin. The energy of the acoustic pulse is very low and
will not affect the skin or other tissue in any way. When the emitted acoustic pulse hits the
different structures of the skin, part of the pulse will be reflected and part of the pulse will
be transmitted further into the skin. The reflected signal will travel back and be picked up by
the ultrasound transducer. After processing, the cross-sectional image as visualized on the
screen represents an intensity (ampli-tude) analysis of these returned signals.
The intensity of the received signal refers to a color scale, where dark colors represent
56
areas with low reflection (i.e. none or small changes in density between the structures in the
skin) and bright colors represent areas with strong reflections (i.e. significant changes in
density between structures).
5.4.3. Hydration
The hydration probe provides information about the hydration state by measuring the
conducting properties of the very upper layers of the skin, when subjected to an alternating
voltage. Accordingly, the method is referred to as a conductance measurement and the
output is presented in the unit of micro-Siemens (μS).
5.4.4. TEWL
Water loss as measured by the SkinLab Combo is based on Nilsson’s Vapor Pressure
Gradient method, an open chamber method with minimal impact on the skin being examined
and, accordingly, very low bias to the reading.
Two sets of temperature/humidity sensors are mounted in a measurement chamber at
different heights above the skin surface. The measurement chamber is open to allow the skin
to “breathe” freely, and the evaporation rate follows Fick’s Law of Diffusion:
Rate = P x (c1 - c2) / T
where P = permeability coefficient of membrane, (c1 - c2) = concentration gradient, T =
thick-ness of membrane.
57
To obtain comparable and reproducible results when measuring transepidermal water
loss stand-ardized measurement procedures are strongly recommended. Guidelines have
been published by The Standardization Group of the European Society of Contact
Dermatitis.
5.4.5. Erythema
The measurement of erythema is based on an active color detecting chip. Illumination is
provided by two high intensity white LED´s. Erythema is the redness index of the skin. This
measures is used for the estimation of the level of redness (hemoglobin) in the skin. The
higher the value the more redness in the skin.
5.5. Evaluation of scratching behavior
To evaluate the effect of T. vulgaris on the scratching behavior, it was measured once a
week for 3 weeks . Each mouse in all groups was videotaped for 15 min with digital camera
placed on the top of the cages. The one scratching bout was defined as a series of scratching
movement by the hind paw.
5.6. Measurement of serum IgE level
After the experimental period, blood samples were obtained from mice then were
separated by centrifugation at 14,000 × g for 20 min at 4 ℃. The supernatants were collected
thereafter the total serum IgE were measured using a mouse IgE enzyme-linked
58
immunosorbent assay kit (BD Bioscience, CA, USA) according to manufacturer’s
instruction.
5.7. Histopathological analysis
After sacrifice, the back skin of each mouse was fixed in 4% paraformaldehyde for 24 h.
Next, the dorsal skin specimens were embedded in paraffin and sectioned at 5 μm.
Hematoxylin and eosin (H&E) staining was used to observe epidermal thickness. Toluidine
blue (TB) staining was used to measure the degree of mast cell infiltration. After H&E and
TB staining, all stained skin specimens were observed by light microscope.
59
6. Statistical analysis
The results were determined using the Statistical Analysis System (GraphPad Prism 5).
All experiments were carried out in triplicate. The values were expressed as means ±
standard deviation (SD). Statistical comparison between different treatments was determined
using one-way analysis of variance (ANOVA) followed by Duncan’s test. For statistical
analysis, Student’s test was used to compare individual treatments to the controls. The level
of statistical significance was set as follows: # and * p < 0.05, ## and ** p < 0.01, and ###
and *** p < 0.001.
60
Ⅲ. Results
1. The identification of active components from T. vulgaris
The active components of T. vulgaris were detected by HPLC analysis. As shown in the
chromatogram, caffeic acid was confirmed as the active component at 17.5 min by 0.4%
(Figure 7A). Also, rosmarinic acid was found as the active component at 42.8 min by 5.8%
(Figure 7B).
61
(A)
62
(B)
Figure 7. HPLC analysis of T. vulgaris and caffeic acid and rosmarinic acid standard.
As an active component of T. vulgaris, (A) caffeic acid and (B) rosmarinic acid were
detected.
63
Table 8. Active components of T. vulgaris
T. vulgaris
Name Caffeic acid Name Rosmarinic acid
Formula C 9H8O 4 Formula C18H16O8
Molecular weight 180.16 Molecular weight 360.32
Content 0.4% Content 5.8%
64
2. The Effects of T. vulgaris on atopic dermatitis and histamine related allergic
response: An in vitro study
2.1. Effects of T. vulgaris on atopic dermatitis related inflammation in LPS-stimulated
Raw 264.7 cells
2.1.1. Cell viability
To investigate the effect of T. vulgaris on cell viability in Raw 264.7 cells, MTT assay
was conducted. As shown in Figure 8A, cell viability was reduced in LPS-stimulated
Raw264.7 cells compared with non-stimulated cells. The cells treated with
T. vulgaris showed no cytotoxicity.
65
2.1.2. NO production
Excessive NO production was observed following LPS-stimulation. Compared to non-
stimulated condition, LPS treatment triggered NO production by 552.6% (Figure 8B).
However, at a concentration of 100 µg/mL, T. vulgaris treatment significantly attenuated the
LPS-induced overproduction of NO by 57.1% of that in only LPS-stimulated
cells.
66
(A)
(B)
Figure 8. Effects of T. vulgaris on cell viability and NO production in LPS-stimulated

Raw 264.7 cells.
(A) Cell viability was measured by MTT assay. (B) Nitric oxide production was determined
by NO assay. Dexamethasone was used as a positive control. All data are shown as the mean
± standard deviation of at least three independent experiments. # and * indicate significant
differences between non-stimulated control and LPS-stimulated control, respectively.
###p < 0.001, versus non-stimulated control. **p < 0.01 and ***p < 0.001, versus LPS-
67
stimulated control.
2.2. Effects of T. vulgaris on histamine related allergic response in DNP-IgE/BSA-
stimulated RBL-2H3 cells
To determine cytotoxic influences of T. vulgaris in DNP-IgE/BSA-stimulated RBL-2H3
cells, MTT assay was performed. After sensitization with DNP-IgE, cells were pretreated
with ketotifen fumarate salt and T. vulgaris, and then stimulated with DNP-BSA. Non-
stimulated cells were regarded as 100% viability. Compared with non-stimulated cells,
DNP-IgE/BSA-stimulated cells showed a slight decrease in viability. Both ketotifen
fumarate salt and T. vulgaris treatment induced no noticeable cytotoxicity compared to non-
stimulated conditions (Figure 9A).
68
2.2.2. β-hexosaminidase release
To evaluate the effect of T. vulgaris on mast cell degranulation, β-hexosaminidase assay
was conducted in DNP-IgE/BSA-stimulated RBL-2H3 cells. β-hexosaminidase release
increased up to 787.0% in DNP-IgE/BSA-stimulated cells compared to non-stimulated cells.
However, it was reduced by treatment with ketotifen fumarate salt and
T. vulgaris. T. vulgaris significantly inhibited β-hexosaminidase release in a dose-dependent
manner at 50, 100, and 250 μg/mL by 24.5%, 36.5%, and 52.7%, respectively (Figure 9B).
69
2.2.3. Histamine release
The release of histamine, which plays an important role in allergic reactions, was
measured in DNP-IgE/BSA-stimulated RBL-2H3 cells. Histamine release increased up to
533.5% in DNP-IgE/BSA-stimulated cells compared to non-stimulated cells. In contrast, it
was suppressed in ketotifen fumarate salt and T. vulgaris treated cells. T. vulgaris markedly
decreased the release of histamine in a dose-dependent manner at 100 and 250 μg/mL by
32.5% and 38.0%, respectively (Figure 9C). These results showed that
T. vulgaris has anti-allergic effect by inhibiting mast cell degranulation.
70
(A)
(B)
(C)
Figure 9. Effects of T. vulgaris on cell viability, β-hexosaminidase, and histamine

release in DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Cell viability, (B) β-hexosaminidase release, (C) Histamine release were determined.
Ketotifen fumarate and tacrolimus were used as a positive control. All data are shown as the
mean ± standard deviation of at least three independent experiments.
# and * indicate significant differences between non-stimulated control and DNP-IgE/BSA-
stimulated control, respectively. ###p < 0.001, versus non-stimulated control.
*p < 0.05, **p < 0.01, and ***p < 0.001, versus DNP-IgE/BSA-stimulated control.
71
72
2.2.4. Intracellular calcium levels
In mast cell degranulation, the change of intracellular calcium levels occur. The
increased calcium levels are essential in response to mast cell stimulation, which induces
granule-plasma membrane fusion, resulting in degranulation of mast cells. It leads to the
release of mediators such as β-hexosaminidase and histamine. Therefore, the inhibition of
intracellular calcium levels is important to suppress release of histamine. To determine the
mechanism by which T. vulgaris suppressed mast cell degranulation, intracellular calcium
levels were measured. The inhibitory effects of T. vulgaris on intracellular calcium release
were analyzed using the fluorescent indicator Fluo-3/AM. The intracellular calcium levels
were elevated by DNP-IgE/BSA-stimulation. However, treatment with T. vulgaris mitigated
the elevation of intracellular calcium levels at a concentration of 50, 100, and 250 μg/mL
(Figure 10).
73
Figure 10. Effects of T. vulgaris on intracellular calcium levels in DNP-IgE/BSA-
stimulated RBL-2H3 cells.
Intracellular calcium levels in DNP-IgE/BSA-stimulated RBL-2H3 cells. Ketotifen fumarate
and tacrolimus were used as a positive control. Intracellular calcium levels were compared to
those of untreated control cells, which were set at a value of one relative fluorescent unit. #
and * indicate significant differences between non-stimulated control and DNP-IgE/BSA-
stimulated control, respectively. ##p < 0.01 versus non-stimulated control. *p < 0.05 and
**p < 0.01, versus DNP-IgE/BSA-stimulated control.
74
2.2.5. Signaling pathways in histamine release
2.2.5.1. CRHR1 and CRHR2 expression
In mast cell degranulation, CRHR1 acts as a potentiator, while CRHR2 acts as an
inhibitor, resulting in histamine release. The effect of T. vulgaris on the expression of
CRHR1 and CRHR2 in DNP-IgE/BSA-stimulated RBL-2H3 cells was confirm by western
blot analysis. The stimulation of DNP-IgE/BSA augmented the expression of CRHR1, while
the expression of CRHR2 was suppressed in only DNP-IgE/BSA-stimulated cells. But, it
was altered by treatment with T. vulgaris. T. vulgaris decreased the expression of CRHR1 by
29.5% and induced the expression of CRHR2 up to 1246.5% at a concentration of 250
μg/mL, compared to only DNP-IgE/BSA-stimulated cells (Figure 11). These regulation
inhibits the mobilization of calcium, which in turn leads to a decrease in the release of
histamine.
75
(A)
(B)
Figure 11. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in

DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Protein expression of CRHR1 and CRHR2 in DNP-IgE/BSA-stimulated RBL-2H3 cells.
(B) Band intensities were quantified by densitometry, normalized to the level of β-actin and
calculated as a percentage of the basal response. All data are shown as the mean ± standard
deviation of at least three independent experiments. # and * indicate significant differences
between non-stimulated control and DNP-IgE/BSA-stimulated control, respectively.
#p < 0.05 and ##p < 0.01, versus non-stimulated control. *p < 0.05, **p < 0.01, and
***p < 0.001, versus DNP-IgE/BSA-stimulated control.
76
77
2.2.5.2. phosphorylation of PLCγ
Upon stimulation with DNP-IgE/BSA, PLCγ is activated through phosphorylation. The
phosphorylation of PLCγ generates IP3 which results in the release of intracellular calcium
from endoplasmic reticulum (ER). This causes mast cell degranulation, leading to an
increase in histamine release. To investigate the effect of T. vulgaris on phosphorylation of
PLCγ, RBL-2H3 cells were stimulated with DNP-IgE/BSA. The level of phosphorylated
PLCγ was up-regulated in cells that were only DNP-IgE/BSA-stimulated cells. However,
treatment with T. vulgaris inhibited the phosphorylation level of PLCγ by 81.2% at 50 μg/mL
(Figure 12). It was verified that the decrease in histamine release by
T. vulgaris is due to the reduction of calcium level through downregulation of PLCγ
phosphorylation.
78
(A)
(B)
Figure 12. Effects of T. vulgaris on phosphorylation of PLCγ in DNP-IgE/BSA-

(A) Protein expression of p-PLCγ and PLCγ in DNP-IgE/BSA-stimulated RBL-2H3 cells.
###p < 0.001, versus non-stimulated control. *p < 0.05 and ***p < 0.001, versus
DNP-IgE/BSA-stimulated control.
79
2.2.5.3. phosphorylation of IP3R
After the phosphorylation of PLCγ, IP3 is generated and then binds to its receptor, IP3R,
existed in ER membrane. When IP3R is phosphorylated, calcium release from ER is
induced. Consequently, this causes the influx of extracellular calcium, which increases the
release of histamine through exocytosis of mast cells. To investigate the effect of
T. vulgaris on phosphorylation of IP3R, RBL-2H3 cells were stimulated with
DNP-IgE/BSA. As shown in Figure 13, the level of phosphorylated IP3R was up-regulated
in cells that were only DNP-IgE/BSA-stimulated cells. However, treatment with
T. vulgaris inhibited the phosphorylation level of IP3R by 98.3% at a concentration of 100
μg/mL. This results showed that T. vulgaris affects the suppression of calcium depletion in
ER.
80
(A)
(B)
Figure 13. Effects of T. vulgaris on phosphorylation of IP3R in DNP-IgE/BSA-

(A) Protein expression of p-PLCγ and PLCγ in DNP-IgE/BSA-stimulated RBL-2H3 cells.
###p < 0.001, versus non-stimulated control. *p < 0.05 and ***p < 0.001, versus
DNP-IgE/BSA-stimulated control.
81
2.2.5.4. calcium channel protein expressions
The granulation of mast cell depends on the concentration of calcium released from ER.
After the release of calcium from ER, calcium channel proteins such as STIM1, Orai1, and
TRPC1 are activated. Due to this, the influx of extracellular calcium is elevated that
accelerates the release of histamine. Thus, the expression levels of STIM1, Orai1, and
TRPC1 were investigated. The stimulation with DNP-IgE/BSA increased the expression of
these proteins. In cells treated with T. vulgaris, the expressions of STIM1, Orai1, and
TRPC1 decreased by 20.8%, 69.0%, and 82.3% at 100 μg/mL, respectively (Figure 14).
These results indicated that T. vulgaris treatment blocks the extracellular calcium influx via
downregulation of calcium channel proteins, thereby reducing the release of histamine.
82
(A)
(B)
Figure 14. Effects of T. vulgaris on expression of calcium channel proteins in

DNP-IgE/BSA-stimulated RBL-2H3 cells.
(A) Protein expression of STIM1, Orai1, TRPC1 in DNP-IgE/BSA-stimulated RBL-2H3
cells. (B) Band intensities were quantified by densitometry, normalized to the level of β-
actin. All data are shown as the mean ± standard deviation of at least three independent
experiments. # and * indicate significant differences between non-stimulated control and
DNP-IgE/BSA-stimulated control, respectively. ##p < 0.01 and ###p < 0.001, versus non-
stimulated control. *p < 0.05, **p < 0.01, and ***p < 0.001, versus DNP-IgE/BSA-
stimulated control.
83
2.3. Effect of T. vulgaris on atopic dermatitis related inflammation in TNF-
α/IFN-γ-stimulated HaCaT cells
The cytotoxicity of T. vulgaris was confirmed by MTT assay in TNF-α/IFN-γ-stimulated
HaCaT cells. Cells were pretreated with T. vulgaris (10 and 100 μg/mL) and tacrolimus (1
and 10 μg/mL), and then stimulated with 10 ng/mL of TNF- α/IFN-γ. Non-stimulated cells
were regarded as 100% viability. Compared with non-stimulated cells, TNF-α/IFN-γ-
stimulated cells showed a slight decrease in viability. Both T. vulgaris and tacrolimus
treatment induced no noticeable cytotoxicity compared to only TNF-α/IFN-γ-stimulated
conditions (Figure 15A).
84
2.3.2. Chemokine production
The production of TARC/CCL17 and MDC/CCL22 was affected by T. vulgaris
treatment in TNF-α/IFN-γ-stimulated HaCaT cells. When cells were stimulated by
TNF-α/IFN-γ with no other pretreatment, the production of TARC/CCL17 and MDC/CCL22
was increased by 781.4% and 885.6%, respectively, compared to non-stimulated cells.
However, tacrolimus and T. vulgaris treated cell showed suppressed TARC/CCL17
production by 35.5% at 10 μg/mL of tacrolimus and by 89.0% at 100 μg/mL of
T. vulgaris, respectively, compared to those of only TNF-α/IFN-γ-stimulated cells. The
production of MDC/CCL22 also decreased by 41.5% at 1 μg/mL of tacrolimus and by 64.5%
at 100 μg/mL of T. vulgaris, respectively, compared with those of only TNF-α/IFN-γ-
stimulated cells. As a result, T. vulgaris treatment showed stronger inhibitory effect on
TARC/CCL17 and MDC/CCL22 production than tacrolimus treatment (Figure 15B and C).
85
(A)
(B) (C)
Figure 15. Effects of T. vulgaris on cell viability and chemokines production in

TNF-α/IFN-γ-stimulated HaCaT cells.
(A) Cell viability was measured using MTT assay. (B) TARC/CCL17 production, (C)
MDC/CCL22 production were determined by using ELISA kit. All data are shown as the
mean ± standard deviation of at least three independent experiments. # and * indicate
significant differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. ###p < 0.001, versus non-stimulated control. *p < 0.05, **p < 0.01, and
***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
86
2.3.3. mRNA expression of pro-inflammatory cytokine and chemokines
As shown in Figure 16, pro-inflammatory cytokine (IL-6) and chemokines
(TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8) mRNA expressions were
increased after stimulation with TNF-α/IFN-γ. The mRNA expression levels of
IL-6, TARC/CCL17, MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8 increased by
345.0%, 144.1%, 174.9%, 372.8%, and 201.2% in only TNF-α/IFN-γ-stimulated cells,
respectively, compared with the non-stimulated cells. Importantly,
T. vulgaris and tacrolimus markedly reduced those overexpression levels. Treatment with
T. vulgaris at 100 μg/mL decreased the mRNA expression levels of IL-6, TARC/CCL17,
MDC/CCL22, RANTES/CCL5, and IL-8/CXCL8 by 30.6%, 35.1%, 38.0%, 63.0%, and
30.9%, respectively, compared with only TNF-α/IFN-γ-stimulated cells.
87
(A)
(B)
Figure 16. Effects of T. vulgaris on mRNA expression of pro-inflammatory cytokines

and chemokines in TNF-α/IFN-γ-stimulated HaCaT cells.
(A) mRNA expression of IL-6, TARC, MDC, RANTES, and IL-8 in TNF-α/IFN-γ-
stimulated HaCaT cells. (B) An equimolar quantity of mRNA was quantified compared to
GAPDH. Tacrolimus was used as a positive control. All data are shown as the mean ±
standard deviation of at least three independent experiments. # and * indicate significant
differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. #p < 0.05, ##p < 0.01, and ###p < 0.001, versus non-stimulated control.
88
*p < 0.05, **p < 0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
89
2.3.4. Signaling pathways in pro-inflammatory cytokine and chemokines
2.3.4.1. MAPKs activation
TNF-α/IFN-γ activated MAPK signaling pathways resulting in overexpression of pro-
inflammatory cytokines. The activation was examined by detecting the phosphorylation
level of MAPKs by western blot analysis. TNF-α/IFN-γ treatment triggered the
phosphorylation of p-38, JNK, and ERK by 125.5%, 171.4%, and 130.4%, respectively.
However, it was reversed by treatment of tacrolimus and T. vulgaris that they suppressed
this phosphorylation. T. vulgaris treatment at concentration of 100 μg/mL significantly
inhibited the phosphorylation of p-38 and JNK by 46.8% and 39.5%, respectively (Figure
17).
90
(A)
(B)
Figure 17. Effects of T. vulgaris on activation of MAPKs in TNF-α/IFN-γ-stimulated

HaCaT cells.
(A) Protein expression of p-p38, p38, p-JNK, JNK, p-ERK, and ERK in TNF-α/IFN-γ-
stimulated HaCaT cells. (B) Band intensities were quantified by densitometry, normalized to
the level of β-actin, and calculated as a percentage of the basal response. All data are shown
as the mean ± standard deviation of at least three independent experiments. # and * indicate
significant differences between non-stimulated control and TNF-α/IFN-γ-stimulated control,
respectively. #p < 0.05 and ##p < 0.01, versus non-stimulated control. *p < 0.05, **p <
91
0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
2.3.4.2. NFκB and STAT1 activation
Inflammators increase the expression of IκB kinase (IKK) complex with three subunits
(IKKα, IKKβ, and IKKγ) leads to phosphorylation and degradation of the IκBα. The
phosphorylated IκBα binds to NF-κB. This complex moves into nucleus and activates
inflammatory genes. At the same time, STAT1 responses to stimuli and can lead to
overexpression of inflammatory and immune response genes.
As predicted, TNF-α/IFN-γ treatment triggered IKKα/β, IκB, NF-κB, and STAT1
phosphorylation as shown in Figure 18, 19. The phosphorylation of IKKα/β, IκB, NF-κB,
and STAT1 was overexpressed by 272.9%, 131.3%, 164.7%, and 129.0%, respectively, in
only TNF-α/IFN-γ stimulated cells, compared with non-stimulated cells. However, it was
reversed by treatment of tacrolimus and T. vulgaris. At a concentration of 100 μg/mL,
T. vulgaris significantly decreased the phosphorylation levels of IKKα/β, IκB, NF-κB, and
STAT1 by 39.0%, 71.3%, 39.3%, and 72.7%, respectively, compared with only TNF-α/IFN-
γ stimulated cells. Therefore, the results suggest that T. vulgaris can diminish the production
of inflammatory cytokines and chemokines via regulation these signaling pathways.
92
(A)
(B)
Figure 18. Effects of T. vulgaris on NFκB signaling pathway in TNF-α/IFN-γ-stimulated

HaCaT cells.
(A) Protein expression of p-IKKα/β, IKKα/β, p-IκBα, IκBα, p-NFκB, and NFκB in
TNF-α/IFN-γ-stimulated HaCaT cells. (B) Band intensities were quantified by densitometry,
normalized to the level of β-actin. All data are shown as the mean ± standard deviation. #
and * indicate significant differences between non-stimulated control and TNF-α/IFN-γ-
stimulated control, respectively. #p < 0.05 and ##p < 0.01, versus non-stimulated control.
93
*p < 0.05, **p < 0.01, and ***p < 0.001, versus TNF-α/IFN-γ -stimulated control.
(A)
(B)
Figure 19. Effects of T. vulgaris on STAT1 signaling pathway in TNF-α/IFN-γ-

stimulated HaCaT cells.
(A) Protein expression of p-STAT1 and STAT1 in TNF-α/IFN-γ-stimulated HaCaT cells.
between non-stimulated control and TNF-α/IFN-γ-stimulated control, respectively. #p <
0.05, versus non-stimulated control. *p < 0.05 and **p < 0.01, versus TNF-α/IFN-γ -
stimulated control.
94
95
3. The Effects of T. vulgaris on atopic dermatitis and histamine related allergic
response: An in vivo study
3.1. Morphological characteristics
3.1.1. Body weight
AD skin lesions were treated with tacrolimus and T. vulgaris. Compared to normal
group, no noticeable changes in the body weight were observed in the other group. In
addition, no abnormal symptoms were recorded in all groups, indicating that the tested
samples ensure safety, without toxicity or adverse effects (Figure 20).
96
Figure 20. Effects of T. vulgaris on body weight in DFE-induced NC/Nga mice.
NC/Nga mice exposed to DFE and treated with tacrolimus and T. vulgaris during 3 weeks.
Body weight was measured during 3 weeks.
97
3.1.2. Spleen weight
AD induces a variety of responses in the immune system leading to increase the weight
of immune organs such as spleen. As expected, the weight of spleen was significantly
increased by 202.7% than that of the normal group. However, it was reduced by topical
application of tacrolimus and T. vulgaris. The average weight of tacrolimus-applied mice’s
spleen was decreased by 34.4% compared to that of the DFE-applied control group. In the
groups treated with T. vulgaris at 0.1% and 1%, the weight of spleen was significantly
decreased by 22.5% and 27.7%, respectively, compared to the control group (Figure 21).
98
Figure 21. Effects of T. vulgaris on spleen weight in DFE-induced NC/Nga mice.
Spleen weight in AD-induced mice. Values shown are the mean ± standard deviation. # and
* indicate significant differences between normal group and control group, respectively.
###p < 0.001, versus normal group. **p < 0.01 and ***p < 0.001, versus control group.
99
3.1.3. Skin morphology
The severity of dermatitis was determined according to the sums of the scores for each
symptoms once a week for 3 weeks. In DFE-induced mice, skin symptoms such as
erythema, edema, erosion, dryness, and lichenification were observed. After 3 weeks, the
DFE topical applied mice have all typical characteristics of atopic dermatitis disease as listed
above with maximum dermatitis score 9.0 ± 1.7. Topical application of tacrolimus and
T. vulgaris significantly improved the AD-like skin symptoms (Figure 22A). Among three
groups tacrolimus 0.1%, T. vulgaris 0.1%, and T. vulgaris 1%, the T. vulgaris 0.1% group
was the most effective sample in decreasing dermatitis symptoms in AD-induced mice skin
(Figure 22B).
100
(A)
101
102
(B)
Figure 22. Effects of T. vulgaris on skin morphology in DFE-induced NC/Nga mice.

(A) Clinical picture of DFE-induced AD-like lesions. (B) Dermatitis score. (G). The number
of mast cells. Five groups: Normal group, Control group (DFE treatment), PC group (DFE
treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%),
T. vulgaris 1% group (DFE treatment + T. vulgaris 1%). Values shown are the mean ±
standard deviation of at least three independent experiments. # and * indicate significant
differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. *p < 0.05, **p < 0.01, and ***p <
0.001, versus control group.
103
3.2. Physiological characteristics
3.2.1. Skin density
To investigate the effects of T. vulgaris on skin density in DFE-induced NC/Nga mice,
living mice were applied to Dermalab combo skin measurement instrument using ultra sonic
flow probe. The skin density is visualized as green and yellow-colored graphics using
Dermalab combo skinlab software. As shown in Figure 23, DFE-induced control group
exhibited impaired skin density compared to non-treated normal group. However, treatment
of T. vulgaris recovered the abnormal loss of skin density.
104
(A)
(B)
Figure 23. Effects of T. vulgaris on skin density in DFE-induced NC/Nga mice.

(A) The levels of collagen and dermal thickness were determined using Dermalab Combo
(Cortex Technology, DK). (B) Relative density was measured.). Five groups: Normal group,
Control group (DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%),
T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE
treatment + T. vulgaris 1%). Values shown are the mean ± standard deviation of at least
three independent experiments. # and * indicate significant differences between normal
group and control group, respectively. ###p < 0.001, versus normal group. **p < 0.01,
versus control group.
105
106
3.2.2. Skin hydration
AD causes skin dryness by reducing strantum corneum (SC) hydration. At the end of 3
weeks, SC hydration was diminished by 78.3% in the control group than that of the normal
group. These physiological changes were improved by topical application of tacrolimus and
T. vulgaris. SC hydration was significantly enhanced by over 300% for all topical
application including tacrolimus, T. vulgaris 0.1%, and T. vulgaris 1% (Figure 24A).
107
3.2.3. TEWL
AD causes skin dryness by increasing TEWL. At the end of 3 weeks, TEWL was
elevated by 371.9%. These physiological changes were improved by topical application of
tacrolimus and T. vulgaris. The TEWL was decreased from 56.7%-64.1% by treatment of all
topical solution (Figure 24B).
108
3.2.4. EI
It is known that EI is increased in AD. At the end of 3 weeks, EI was increased up to
1510.8% in the control group. These increased EI was improved by topical application of
tacrolimus and T. vulgaris. EI was reduced by treatment of all topical solution (Figure 24C).
109
(A) (B)
(C)
Figure 24. Effects of T. vulgaris on skin hydration, TEWL, and EI in DFE-induced

NC/Nga mice.
(A) SC hydration, (B) TEWL, and (C) EI were determined using Dermalab Combo (Cortex
Technology, DK). Five groups: Normal group, Control group (DFE treatment), PC group
(DFE treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group (DFE treatment + T. vulgaris
0.1%), T. vulgaris 1% group (DFE treatment + T. vulgaris 1%). Values shown are the mean
± standard deviation. # and * indicate significant differences between normal group and
control group, respectively. ###p < 0.001, versus normal group. ***p < 0.001, versus
110
control group.
3.3. Itching related characteristics
3.3.1. Scratching behavior
During the experimental period, the number of scratches was assessed to verify
inhibitory effect of T. vulgaris on itching associated with AD. In the control group, topical
application of DFE led to a significant increase in the number of scratches 32 times higher
than that of the normal group. After topical application of tacrolimus and
T. vulgaris for 3 weeks, the number of scratches was remarkably reduced by 8.9 times for
tacrolimus group, by 6.5 times for the T. vulgaris 0.1% group, and by 3.4 times for the
T. vulgaris 1% group than that of the control group (Figure 25).
111
Figure 25. Effects of T. vulgaris on scratching behavior in DFE-induced NC/Nga mice.
Scratching behavior in DFE-induced NC/Nga mice. Five groups: Normal group, Control
group (DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%),
T. vulgaris 0.1% group (DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE
treatment + T. vulgaris 1%). Values shown are the mean ± standard deviation. # and *
indicate significant differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. *p < 0.05, **p < 0.01, and ***p <
112
3.3.2. Serum IgE level
In the control group, serum IgE level was increased by 3832.9% compared with the
normal group. This serum IgE level was significantly reduced in the groups treated with
tacrolimus and T.vulgaris. Both T.vulgaris 0.1% and T.vulgaris 1% groups inhibited IgE by
75.6% and 91.4%, respectively, compared with the control group. These inhibitory effects of
T.vulgaris were more effective than that of the tacrolimus 0.1% group (Figure 26).
113
Figure 26. Effects of T. vulgaris on serum IgE level in DFE-induced NC/Nga mice.
Serum IgE level in DFE-induced NC/Nga mice. Five groups: Normal group, Control group
(DFE treatment), PC group (DFE treatment + Tacrolimus 0.1%), T. vulgaris 0.1% group
(DFE treatment + T. vulgaris 0.1%), T. vulgaris 1% group (DFE treatment + T. vulgaris
1%). Values shown are the mean ± standard deviation. # and * indicate significant
differences between normal group and control group, respectively.
###p < 0.001, versus normal group. **p < 0.01 and ***p < 0.001, versus control group.
114
3.3.3. β-hexosaminidase and histamine release
In the control group, serum β-hexosaminidase level was increased up to 134.9%
compared with the normal group. This serum β-hexosaminidase level was significantly
reduced in the groups treated with tacrolimus and T.vulgaris. Both T.vulgaris 0.1% and
T.vulgaris 1% groups inhibited β-hexosaminidase by 15.3% and 21.4%, respectively,
compared with the control group (Figure 27A).
In the control group, serum histamine level was increased up to 274.1% compared with
the normal group. In tacrolimus and T.vulgaris treated group, serum histamine levels were
markedly diminished. Both T.vulgaris 0.1% and T.vulgaris 1% groups inhibited histamine
release by 72.4% and 53.7%, respectively, compared with the control group (Figure 27B).
115
(A)
(B)
Figure 27. Effects of T. vulgaris on β-hexosaminidase and histamine release in DFE-

induced NC/Nga mice.
β-hexosaminidase and histamine release in DFE-induced NC/Nga mice. Values shown are
the mean ± standard deviation. # and * indicate significant differences between normal group
and control group, respectively. ###p < 0.001, versus normal group. *p < 0.05 and ***p <
116
117
3.4. Proteins expression
3.4.1. CRHR1 and CRHR2 expression
The effect of T. vulgaris on expression of CRHR1 and CRHR2 in DFE- induced NC/Nga
mice was confirm by western blot analysis. The expression of CRHR1 was increased by DFE
treatment, whereas the expression of CRHR2 was suppressed in only DFE-induced NC/Nga
mice. It was reversed by treatment with T. vulgaris. Compared to only DFE-induced NC/Nga
mice, treatment with 1% T. vulgaris reduced the expression of CRHR1 by 54.9% and
induced the expression of CRHR2 up to 249.3% (Figure 28).
118
(A)
(B)
Figure 28. Effects of T. vulgaris on expression of CRHR1 and CRHR2 in DFE-induced

NC/Nga mice.
(A) Protein expression of CRHR1 and CRHR2 in AD-induced mice skin. (B) Band
intensities were quantified by densitometry, normalized to the level of β-actin and calculated
as a percentage of the basal response. Values shown are the mean ± standard deviation. # and
* indicate significant differences between normal group and control group, respectively.
##p < 0.01 and ###p < 0.001, versus normal group. * p < 0.05, **p < 0.01, and ***p <
119
3.4.2. MAPKs activation
The expression levels of p-p38 and p-ERK were elevated in the control group by 269.0%
and 140.7%, respectively, than those of the normal group. Topical application of tacrolimus
and T. vulgaris induced downregulation of p-p38 and p-ERK expression. In the
T. vulgaris 1% group, the expression levels of p-p38 and p-ERK were reduced by 52.6% and
29.9%, respectively, than those of the control group (Figure 29).
120
(A)
(B)
Figure 29. Effects of T. vulgaris on activation of MAPKs in DFE-induced NC/Nga mice.

(A) Protein expression of MAPKs in AD-induced mice skin. (B) Band intensities were
quantified by densitometry, normalized to the level of β-actin and calculated as a percentage
of the basal response. Values shown are the mean ± standard deviation. # and * indicate
significant differences between normal group and control group, respectively.
##p < 0.01, versus normal group. *p < 0.05, **p < 0.01, and ***p < 0.001, versus control
group.
121
122
3.4.3. IκBα and NFκB activation
The expression levels of NF-κB and p-IκBα were elevated in the control group by 116.9%
and 1065.4%, respectively, than those of the normal group. On the other hand, the expression
of IκBα was significantly decreased by 60.9%. Topical application of tacrolimus and
T. vulgaris induced downregulation of p-IκBα expression and upregulation of IκBα
expression. In the T. vulgaris 1% group, the expression levels of p-IκBα were reduced by
77.7% and the expression level of IκBα was enhanced by 176.3% than those of the control
group (Figure 30).
123
(A)
(B) (C)
Figure 30. Effects of T. vulgaris on IκBα and NFκB in DFE-induced NC/Nga mice.
(A) Protein expression of IκBα and NFκB in AD-induced mice skin. (B) Band intensities
were quantified by densitometry, normalized to the level of β-actin and calculated as a
percentage of the basal response. Values shown are the mean ± standard deviation. # and *
indicate significant differences between normal group and control group, respectively.
#p < 0.05 and ###p < 0.001, versus normal group. * p < 0.05 and **p < 0.01, versus control
group.
124
3.4.4. Filaggrin expression
Filaggrin plays an important role in skin barrier function. In AD, it is characterized by a
decrease in filaggrin expression. Therefore, in this study, the effect of
T. vulgaris on the expression of filaggrin was investigated. Compared with the normal
group, the expression of filaggrin was diminished by 44.9% in the control group. Topical
application of tacrolimus and T. vulgaris upregulated filaggrin expression by 93.1-133.0%
compared with the control group (Figure 31).
125
(A)
(B)
Figure 31. Effects of T. vulgaris on filaggrin expression in DFE-induced NC/Nga mice.

(A) Protein expression of filaggrin in AD-induced mice skin. (B) Band intensities were
quantified by densitometry, normalized to the level of β-actin and calculated as a percentage
of the basal response. Values shown are the mean ± standard deviation. # and * indicate
significant differences between normal group and control group, respectively.
###p < 0.001, versus normal group. ***p < 0.001, versus control group.
126
3.5. Histological analysis
3.5.1. Epidermal thickness
The epidermal thickness in the control group was significantly increased by 712.7%
compared with the normal group. Treatment with tacrolimus, T. vulgaris 0.1%, and 1%
decreased the epidermal thickness by 44.5%, 70.0%, and 59.1%, respectively, compared with
that of the control group. Moreover, the epidermal thickness in the
T. vulgaris 0.1% group was thinner than that of the tacrolimus 0.1% group and superficial as
that of the normal group (Figure 32).
127
(A)
(B)
Figure 32. Effects of T. vulgaris on epidermal thickness in DFE-induced NC/Nga mice.

The dorsal skin’s histopathological features revealed by HE staining. Values shown are the
mean ± standard deviation. # and * indicate significant differences between normal group
and control group, respectively. ###p < 0.001, versus normal group. **p < 0.01 and
128
***p < 0.001, versus control group.
129
3.5.2. Accumulation of mast cells
Skin-infiltrating inflammatory cells, containing mast cells, eosinophils, Langerhans
cells, and CD4+ lymphocytes expressing skin colonization antigen, play a crucial role in the
initiation and exacerbation of inflammation in AD. To investigate the effect of
T. vulgaris on accumulation of mast cells, TB staining was performed. While the number of
mast cells in the control group increased compared to the normal group, this was reduced by
treatment with tacrolimus, T. vulgaris 0.1%, and 1% (Figure 33).
130
(A)
(B)
Figure 33. Effects of T. vulgaris on accumulation of mast cells in DFE-induced NC/Nga

mice.
The the number of mast cells revealed by TB staining. Values shown are the mean ±
standard deviation. # and * indicate significant differences between normal group and
control group, respectively. ##p < 0.01, versus normal group. *p < 0.05 and **p < 0.01,
versus control group.
131
Ⅳ. Discussion
AD is a chronic inflammatory skin disease that persists without complete recovery or
repeatedly recurs even in both childhood and adulthood. AD pathogenic mechanism can be
related with the exposure to environmental or chemical agents or abnormal genetic and
immunologic processes. However, the exact causes and treatment of AD have not fully
understood yet. For decades, many patients with AD have been using topical corticosteroids
or topical calcineurin inhibitors, but they are reported to have side effects. Long-term use of
topical corticosteroids can trigger skin atrophy, acne, and telangiectasia. Tacrolimus, a
calcineurin inhibitor, can cause side effects such as burning sensation and nephrotoxicity.
Thus, the development of natural product derived treatments that have few side effects to
substitute them is drawing attention.
T. vulgaris, commonly known as thyme, is an aromatic evergreen herb used as cosmetic,
spice and medicine. Several studies showed that T. vulgaris has a variety of beneficial
effects including antioxidant, antimicrobial, and anti-inflammatory activities. This
biological effects are known to be influenced by various components such as rosmarinic
acid, caffeic acid, and thymol. Although anti-inflammatory effects of
T. vulgaris are well known, the effects on AD have not been reported. Thus, this study was
132
conducted to reveal the anti-atopic effect of T. vulgaris in AD-induced in vitro and in vivo
models.
Macrophages are associated with immune response and control NO and pro-
inflammatory cytokines, which are regarded as pro-inflammatory mediators. Upon LPS
stimulation, excessive NO production was shown in Raw 264.7 cells. However, compared
with only LPS-stimulated cells, it was reversed by treatment of T. vulgaris at a concentration
of 100 μg/mL (Figure 8).
In allergic reactions, mast cells are considered as the main effector cells. They express
FcεRI, the high-affinity IgE receptor, on the surface and stimulated by allergen. When mast
cells are activated by cross-linking of membrane-bound IgE with FcεRI, the granules
present in them are degranulated, releasing vast amounts of stored mediators including β-
hexosaminidase, histamine, and proteases. Therefore, β-hexosaminidase and histamine are
recognized as markers for mast cell degranulation. These mediators are associated with the
regulation of inflammatory reactions in other immune-related cells including keratinocytes
and lymphocytes. In DNP-IgE/BSA-stimulated RBL-2H3 cells, the inhibitory effect of
T. vulgaris on mast cell degranulation was examined. It reduced mast cell degranulation by
suppressing the release of β-hexosaminidase and histamine (Figure 9).
133
The intracellular calcium levels play an important role in mast cell degranulation.
Ca2+ is a vital factor in degranulation of mast cells, which controls the fusion of preformed
secretory granules and plasma membranes and affects the release of mediators. The
activation of mast cells mediated by IgE results in an increase in intracellular calcium
levels. Under stimulation, PLCγ, major signaling enzyme, is activated by phosphorylation
which generates IP3 and diacylglycerol. IP3 bins to its receptor in ER that causes the
intracellular calcium release from ER stores. And then, the reduced calcium concentration in
ER is sensed by STIM1. It promotes the influx of calcium from extracellular space through
calcium channel proteins such as Orai1 and TRPC1. Consequently, the concentration of
cytosolic calcium is elevated, which leads to the fusion of preformed granules and plasma
membrane. It triggers the release of mediators such as β-hexosaminidase and histamine by
mast cell degranulation. In this study, it was verified that T. vulgaris significantly reduced
the intracellular calcium levels in a dose-dependent manner, compared with only
DNP-IgE/BSA-stimulated cells (Figure 10). This is due to the decrease in the
phosphorylation of PLCγ and IP3R by T. vulgaris treatment (Figure 12 and Figure 13).
Also, the lower expression of calcium channel proteins such as STIM1, Orai1, and TRPC1
was observed in T. vulgaris treated cells (Figure 14). These results suggest that
134
T. vulgaris suppresses exocytosis of mast cell granules by regulating the signaling pathway
associated with calcium, and consequently reduces the release of histamine.
135
Figure 34. Inhibitory effects of T. vulgaris on mast cells activation
136
In the present study, TNF-α/ IFN-γ mixture was used to stimulate keratinocytes. The
keratinocyte activation is a hallmark of the development of AD in acute and chronic phases.
AD is a skin disease in which Th2 immune response is activated. It is known that Th2
immune response is closely related to the increased expression of chemokines such as
TARC/CCL17 and MDC/CCL22. Th2 type cytokines are recruited by the secretion of these
chemokines. In patients with AD, serum levels of TARC/CCL17 and MDC/CCL22 are
elevated which are correlate with severity of AD. In the early stage of AD, increased
eosinophil and cytotoxic granules are found to associate with RANTES which is over
secreted by TNF-α and IFN-γ -induced keratinocytes. This suggests that these chemokines
can be used as markers to exhibit the severity of the disease. In the present study, data
showed that treatment of T. vulgaris remarkably reduced the production of TARC/CCL17
and MDC/CCL22 compared with those of only TNF-α/IFN-γ-stimulated HaCaT cells
(Figure 15). Moreover, it was verified that mRNA expression levels of inflammation-related
cytokine and chemokines, including IL-6, TARC/CCL17, MDC/CCL22, RANTES/CCL5,
and IL-8/CXCL8 were downregulated by treatment of T. vulgaris (Figure 16).
In AD processes, transcription factor NF-κB plays very important roles due to their
direct target genes coding for many pro-inflammatory cytokines. In AD-induced
inflammatory responses, due to activating the IκB kinase, the IκBs are degraded resulting in
137
the releasing of NF-κB from their inactive form in cytoplasm. NF-κB then moves to the
nucleus and binds affinity to target genes. In 2008, Sun et al. found that blockade of ERK
and p38 MAPK inhibited the nuclear translocation of phosphorylated NF-κB p65. Similar to
NF-κB, STAT1 is phosphorylated and moved into the nucleus under stimulation. It
facilitates gene transcription of factors such as MDC. Therefore, the activation of NF-κB and
STAT1 is critically involved in the regulation of inflammation. As shown in Figure 17,
T. vulgaris downregulated the phosphorylation of MAPKs induced by TNF-α/IFN-γ
stimulation. In addition, it was showed that the phosphorylation levels of IKKα/β, IκB, NF-
κB were suppressed by treatment of T. vulgaris (Figure 18). With regard to STAT1,
T. vulgaris reduced the phosphorylation of STAT1 (Figure 19). Thus, it was thought that the
reduction of pro-inflammatory cytokines and chemokines is due to regulation of these
signaling pathways. Based on our in vitro data, T. vulgaris can be considered as an effective
NF-κB inhibitor with inhibition of MAPKs activation, the phosphorylation of IκBα and
STAT1. Our findings suggest that T. vulgaris treatment has a significant influence on the
improvement of AD in in vitro model.
138
Figure 35. Inhibitory effects of T. vulgaris on keratinocytes activation
139
Based on the in vitro data, further in vivo studies were performed to determine the effect
of T. vulgaris on AD symptoms in DFE-induced NC/Nga mice. In this study, DFE, a major
species of house dust mite, was used to induce AD. Previous studies have shown that
repeated application of DFE causes severe AD skin lesions by elevating chemokine levels.
As expected, DFE induced the typical AD symptoms including scratching, thick skin,
erythema, dryness, lichenification, and rash in NC/Nga mice. However, it was alleviated by
topical application of T. vulgaris. In the 0.1% and 1% T. vulgaris group, AD symptoms
including erythema, edema, erosion, dryness, and lichenification were significantly improved
(Figure 22). Also, both impaired skin density and increased EI were recovered by
T. vulgaris treatment (Figure 23 and Figure 24C). In histological analysis, the epidermal
thickness in the T. vulgaris 0.1% and 1% group was reduced compared with that of the
control group (Figure 32). This is thought to be due to the regulation of protein expressions
associated with inflammatory responses such as MAPKs, IκBα, and NFκB (Figure 29 and
Figure 30).
Itching leads to the disruption of skin barrier by causing scratching which is one of the
main symptoms in AD. It tends to become a vicious cycle by itching-scratching cycle,
causing severe lesions. It results in unbearable pain for patients with AD. Furthermore,
itching converts a Th2-predominant acute phase to a Th1-dominant chronic phase, which is
140
main characteristic of AD symptoms. Mast cell activation and mast cell-derived mediators
play a crucial role in pathophysiology of itching. The scratching behavior is associated with
many mediators including neuropeptides, histamines, proteinases, and cytokines. In
particular, histamine released from mast cells is known to have a significant contribution to
the induction of itching in AD. Also, infiltration of mast cells is observed in the epidermis
and dermis of AD skin lesions. In this study, it was demonstrated that topical application of
T. vulgaris remarkably diminished the number of scratches via inhibition of serum IgE, β-
hexosaminidase, and histamine compared with the control group (Figure 26 and Figure 27).
TB staining of the dorsal skin of mice showed lower accumulation of mast cells in the
groups treated with 0.1% and 1% T. vulgaris at two concentration, compared to the control
group (Figure 33). These results suggest that T. vulgaris suppresses allergic inflammation
via inhibition of mast cell degranulation and infiltration.
AD is involved with impaired skin barrier which affects the reduction of skin hydration
and acidification. Dry and base skin is regarded as the primary characteristics in AD. The
more skin hydration and acidification is badly changed, the more symptoms of AD are
worse. One way to protect the skin barrier from AD is moisturizing. In patient with AD, the
skin TEWL increases and hydration decreases. In a previous study, appropriate moisturizing
improves the discomfort associated with dryness, repairs the skin barrier, and reduces the
141
quantity and potency of pharmacological intervention. Studies shown that impaired skin
barrier can be recovered by promotion of filaggrin expression. Filaggrin, key proteins of the
epidermal keratinocytes, has a crucial structural and functional role in the epidermis and
homeostasis of the skin. In the present data, SC hydration levels were elevated and TEWL
levels were decreased in the groups treated with T. vulgaris 0.1% and 1% (Figure 24A and
24B). It is thought that the stimulation of filaggrin expression by topical application of
T. vulgaris resulting in these effect (Figure 31).
As the active components of T. vulgaris, caffeic acid and rosmarinic acid were identified
(Figure 7). There are several studies on the pharmacological effects of these components
related to skin inflammation. Zhang et al. reported that caffeic acid has anti-inflammatory
activities in both acute and chronic contact dermatitis models through reduction of cutaneous
TNF-α, IL-6, and IL-8 levels. In addition, oral administration of caffeic acid significantly
inhibited scratching behavior. Regarding the effects of rosmarinic acid on the skin, it was
demonstrated that rosmarinic acid attenuates AD by reducing IFN-γ and IL-4 production and
total serum IgE levels in 2,4-dinitrofluorobenzene-treated NC/Nga mice. These previous
studies indicate that the anti-atopic effect of T. vulgaris may be due to these components.
Therefore, it is considered that it would be worthwhile to confirm the synergistic effect
through combination of caffeic acid and rosmarinic acid on AD-induced models.
142
The patient with AD experience extreme psychological stress due to the vicious cycle of
scratching-itching. It lowers the patient’s quality of life. Psychological stress is recognized
as a risk factor in immune-related diseases because it has a significant impact on immune
function. According to previous study, both CRHR1 and CRHR2 are critical regulator of
mast cell degranulation and stress-related disorders. CRHR1 is a positive modulator of
stress-induced mast cell degranulation. On the contrary, CRHR2 is a negative modulator of
mast cell degranulation in the acute response to immunological and psychological stress. In
this study, it was verified that T. vulgaris suppresses the expression of CRHR1 while
elevating the expression of CRHR2 in DNP-IgE/BSA-stimulated RBL-2H3 cells (Figure
11). This inhibited mast cell degranulation, resulting in reduced histamine release which is
responsible for itching. These findings provide a clue to the effect of
T. vulgaris on relieving psychological stress in patient with AD. Therefore, further studies
are needed to confirm the anti-stress effect of T. vulgaris, and it is considered that it can be
applied to various fields.
In the present study, ketotifen, known as mast cell stabilizer, and tacrolimus, known as a
calcineurin inhibitor, were used as a positive control in in vitro assay. Ketotifen is widely
applied in the treatment of allergic diseases including urticaria, asthma, and allergic
conjunctivitis. It not only exhibits anti-allergic effect by antagonizing H1R, but also has the
143
property of stabilizing the mast cells. Baba et al. reported that ketotifen inhibited the process
of exocytosis. It results in the reduction histamine release from mast cells. Tacrolimus has
immunomodulatory and anti-inflammatory effect. Tacrolimus binds to its receptor and
inhibits the action of calcium/calmodulin-dependent protein phosphatase, calcineurin. This
blocks the dephosphorylation of NFAT and consequently suppresses the transcription of
inflammatory cytokines. As shown in Figure 9B and 9C, ketotifen reduced the release of β-
hexosaminidase and histamine at a concentration of 100 μM. Also, it was showed that
decreased release of β-hexosaminidase and histamine in cells treated with 10 ng/mL (12.17
nM) of tacrolimus. These effects were contributed by regulation of calcium related signaling
pathway (Figure 10-14). The ability of tacrolimus to inhibit calcineurin is well known, but
there are few studies on the suppression effect of mast cell activation in
in vitro model. Therefore, the results of this study are considered to be valuable. Compared
to ketotifen, tacrolimus indicated its effect at about 8,000 times lower concentration.
Although tacrolimus has this advantages, it is very expensive. These single chemical-based
therapeutic agents have side effects and cost problems, which can be burdensome to
patients. Thus, this study is thought to be meaningful because it has confirmed that
T. vulgaris can substitute these therapeutic agents.
144
Overall, this study demonstrated the mitigating effect of T. vulgaris in AD-induced in
vitro and in vivo models. These results suggest that T. vulgaris is valuable as an ingredient
for alleviating AD symptoms. Traditionally, thyme oil has been used a lot, but several
studies reported that it is irritating to the skin. In order to overcome this limitation, 50%
ethanol extract was used in this study, and safety was proved through
in vitro and in vivo results. Since T. vulgaris is a natural-derived product, it can be a new
therapeutic agent with fewer side effects compared to steroids and immunosuppressive drug
which have been frequently used as a treatment for AD. Therefore, it will have a
considerable value in cosmetic and pharmaceutical industries.
145
Ⅴ. Conclusion
The present study was conducted to investigate the anti-atopic effects of
T. vulgaris on AD-induced in vitro and in vivo models.
The results could be concluded as follows:
First, T. vulgaris treatment significantly inhibited β-hexosaminidase and histamine
release by controlling the calcium related signaling pathway in DNP-IgE/BSA-stimulated
RBL-2H3 cells.
Second, T. vulgaris remarkably suppressed the production of pro-inflammatory cytokine
and chemokines via regulation of MAPKs, STAT1, and NFκB pathway in TNF-α/IFN-γ-
stimulated HaCaT cells.
Third, topical application of T. vulgaris improved physiological, histopathological
alterations, and scratching behavior in DFE-treated NC/Nga mice. It increased SC
hydration, filaggrin expression and reduced TEWL, EI, scratching behavior, total serum IgE
level, and histamine release.
Based on the present results, it was demonstrated that T. vulgaris is effective in
ameliorating AD symptoms. Therefore, it can be a new candidate for alleviating AD
symptoms in cosmetic and pharmaceutical industries.
146
Ⅵ. References
1. M. Sokovi1, J. Glamoclija, A. 2iri1, and D. Kataranovski. Antifungal Activity of the

Essential oil of Thymus vulgaris L. and Thymol on Experimentally Induced
Dermatomycoses. Drug Development and Industrial Pharmacy. 2008; 34:1388-
1393.
147
Abstracts in Korean
국문초록
히스타민 분비 조절을 통한 타임(Thymus vulgaris L.)의

아토피 피부염 증상 개선 효과
서슬아
경희대학교 대학원
생명공학원
지도교수 이 태 후
일반적으로 백리향으로 알려진 타임은 아로마 허브 중 하나로 전 세계적으로 사용되고
있다. 타임은 항산화, 항염 및 면역조절 활성이 있는 것으로 보고되었으며, 특히 피부와
관련하여 광노화 억제 및 피부 보호 효과에 대해 보고되었다. 그러나 타임의 아토피 피부염
억제 효과에 대해서는 과학적으로 검증된 바 없다. 따라서 본 연구는 타임의 아토피 피부염
증상 개선 효과를 검증하기 위하여 수행되었다.
타임의 활성 성분은 HPLC 분석법에 의해 확인되었다. In vitro 연구에서는 ELISA
kits, RT-PCR 및 western blot법을 통하여 LPS로 자극된 Raw264.7 세포주, DNP-IgE/BSA
로 자극된 RBL-2H3 세포주 및 TNF-α/IFN-γ로 자극된 HaCaT 세포주에서 타임의 아토피
피부염 억제 효과가 확인되었다. In vivo 연구에서는 집먼지 진드기로 아토피 피부염이
유도된 NC/Nga 동물에서 형태학적 및 생리학적 변화, 긁는 행동, AD 증상과 관련된
단백질 발현 및 조직학적 변화를 측정하여 타임의 아토피 피부염 개선 효과를 확인하였
다.
148
In vitro 실험 결과, 타임이 LPS로 자극된 Raw264.7 세포주에서 NO 생성량을
유의적으로 억제시켰다. DNP-IgE/BSA로 자극된 RBL-2H3 세포주에서는 타임이 칼슘
관련 경로의 조절을 통하여 베타헥소사미니다제 및 히스타민 분비를 감소시키는 것을
확인하였다. TNF-α/IFN-γ로 자극된 HaCaT 세포주에서 타임에 의해 TARC 및 MDC의
생성이 현저하게 억제되었다. 게다가, 타임이 IL-6, TARC, MDC, RANTES 및 IL-8과 같은
염증성 사이토카인 및 케모카인의 유전자 발현의 감소에 영향을 미치는 것을
확인하였으며 이는 MAPKs, STAT1 및 NF-κB 경로의 조절에 의한 것으로 나타났다. In
vivo 결과에 따르면, 타임의 국소 도포에 의해 피부염의 중증도, 경피수분손실량, 홍반량,
긁는 행동, 히스타민 분비, 표피 두께 및 비만세포 침윤이 감소된 반면 피부 수분도 및
filaggrin의 발현은 증가되어 아토피 피부염 증상이 개선되는 것을 확인하였다.
종합적으로 본 연구는 아토피 피부염이 유도된 in vitro 및 in vivo 모델에서 타임의
아토피 피부염 개선 효과를 검증하였다. 이러한 결과는 타임이 히스타민 분비를 조절하여
가려움증을 완화시킴으로써 아토피 피부염 증상 개선에 효과가 있음을 나타내므로 화장품
및 의약품 산업에서 천연물 유래의 소재로서 활용될 수 있음을 시사한다.
149

201227 박사학위논문 서슬아 수정

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

201227 박사학위논문 서슬아 수정

Uploaded by

Copyright:

Available Formats

Thesis for the Degree of Doctor of Philosophy

Thymus vulgaris L. ameliorated atopic dermatitis

Graduate School of Biotechnology

Graduate School of Biotechnology

Submitted to the Graduate School of Biotechnology and the Faculty of the

Chairman Yeon Ju Kim

1. Thymus vulgaris L.......................................................................................................1

2.1. Definition of atopic dermatitis................................................................................9

2.2. Causes of atopic dermatitis.....................................................................................9

2.3. Symptoms of atopic dermatitis.............................................................................10

2.4. Pathogenesis of atopic dermatitis.........................................................................11

2.4.1. Imbalance of Th1/Th2 immune response.......................................................

2.4.2. Skin barrier dysfunction.................................................................................

2.5. Itching in atopic dermatitis...................................................................................15

2.5.1. Role of histamine in itching...........................................................................

2.5.2. Psychological stress and itching.....................................................................

3. Mechanism of atopic dermatitis...............................................................................24

3.1. Mast cells activation.............................................................................................24

4. Therapeutic agent of atopic dermatitis and allergic response................................31

4.1. Ketotifen fumarate...............................................................................................32

4.3. Natural products-derived therapeurics..................................................................36

5. Purpose of this study.................................................................................................39

Ⅱ. Materials and Methods ............................................................................................41

4.1. Cell culture...........................................................................................................45

4.2. Sample treatment..................................................................................................45

4.3. Measurement of cell viability...............................................................................46

4.4. Measurement of NO production...........................................................................46

4.5. β-hexosaminidase release assay............................................................................47

4.6. Histamine release assay........................................................................................47

4.7. Measurement of intracellular calcium..................................................................48

4.8. Enzyme-linked immunosorbent assay (ELISA)....................................................48

4.9. Reverse transcription-polymerase chain reaction (RT-PCR).................................49

4.10. Western blot analysis.........................................................................................51

5.1. Experimental animals...........................................................................................52

5.2. Induction of AD-like skin lesion and topical application......................................52

5.3. Evaluation of AD-like skin symptoms..................................................................53

5.4. Measurement of physiological skin alteration......................................................55

5.4.1. Video scope...................................................................................................55

5.4.2. High resolution ultrasound............................................................................55

5.5. Evaluation of scratching behavior........................................................................57

5.6. Measurement of serum IgE level..........................................................................57

5.7. Histopathological analysis....................................................................................58

1. The identification of active components from T. vulgaris.......................................60

2. The effects of T. vulgaris on atopic dermatitis and histamine related allergic

response: An in vitro study........................................................................................64

2.1. Effects of T. vulgaris on atopic dermatitis related inflammation in LPS-induced

Raw 264.7 cells.......................................................................................................64

2.2. Effects of T. vulgaris on histamine related allergic response in DNP-IgE/BSA-

stimulated RBL-2H3 cells.....................................................................................67

2.2.1. Cell viability..................................................................................................67

2.2.2. β-hexosaminidase release..............................................................................68

2.2.3. Histamine release..........................................................................................69

2.2.4. Intracellular calcium levels............................................................................71

2.2.5. Signaling pathways in histamine release........................................................73

2.2.5.1. CRHR1 and CRHR2 expression.............................................................73

2.2.5.2. phosphorylation of PLCγ........................................................................75

2.2.5.3. phosphorylation of IP3R.........................................................................77

2.2.5.4. calcium channel protein expressions.......................................................79

2.3. Effect of T. vulgaris on atopic dermatitis related inflammation in TNF-α/IFN-γ-

stimulated HaCaT cells.........................................................................................81

2.3.1. Cell viability..................................................................................................81

2.3.2. Chemokine production..................................................................................82

2.3.3. mRNA expression of pro-inflammatory cytokine and

2.3.4. Signaling pathways in pro-inflammatory cytokine and