Aquaculture 535 (2021) 736282

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Excessive lithium of water induced a toxic effect on kidney via oxidative

damage and inflammation in carp
Hongyuan Jing 1, Qirui Zhang 1, Xue-jiao Gao *
College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, People’s Republic of China

A R T I C L E I N F O A B S T R A C T

Keywords: Lithium (Li) is ingested by the animal body and will be distributed throughout the body fluid environment. The
Lithium model of carp with lithium exposing was established to study the effects of Li on oxidative damage and in­
Carp flammatory response to kidneys. The histological analysis showed that the kidney inherent structure of the Li
Oxidative stress
poisoning group was destroyed and the inflammatory cells were infiltrated. The blood analysis showed that Li
Inflammation
MAPKs pathway
content in the poisoning group was higher and the ROS level in the kidney tissue significantly increased; Li
significantly inhibited the expression of GSK-3β and TSC2 in the kidney but increased the expression of TOR at
the mRNA level. Under Li stimulation, MDA level increased, SOD/CAT/GSH-Px activities decreased; pro-
inflammatory factors significantly increased in the poisoning group. The expression of IL-10 significantly
decreased in the poisoning group compared with the control group. The expression of each protein was
consistent with the mRNA level. Li inhibits the antioxidant level and enhances oxidative damage. qPCR analysis
shows that the significant expression of anti-inflammatory factors was significantly inhibited, and over-
expression of pro-inflammatory factors stimulated inflammatory response. Besides, Li aggravated the phos­
phorylation of p38, ERK, and JNK in a dose-dependent manner. All the results confirmed that excess Li causes
oxidative damage to promote the occurrence of inflammatory reactions in the carp kidney.

1. Introduction accumulation in the body, it will affect neurotrophic factors, neuro­

Lithium (Li) does have a very high industrial value (Barnes and
Gorin, 2011), but when it is randomly discarded in the environment, it
contaminates the soil and contaminates water sources, resulting in
excessive intake of Li in animals and even humans, which inevitably
causes a poisoning reaction. Due to its lively nature, Li exists in the form
of compounds in nature. The Li content in natural river water is low
(average 3 μg/L). With the widespread use of lithium batteries in
modern society, the disposal of waste batteries is improper, and the
increase of Li content in the water has become a potential hidden
danger, which has an impact on the growth of aquatic animals. Li is
ingested by the animal body and will be distributed throughout the body
fluid environment. At present, research has not proved that Li is an
essential trace element for animal organisms, but Li has been proved to
be a potentially toxic metal (McKnight et al., 2012). After excessive
transmitters, oxidative metabolism, and apoptosis (Casado et al., 1989;
Ostadhadi et al., 2018). Studies have shown that Li can increase the
production of cytokines, enhance tumor necrosis factor-mediated cyto­
toxicity, cause inflammation in the body, and can affect liver, lung,
endocrine glands, gastrointestinal tract, heart, and kidneys (Sahin et al.,
2006; Malhotra and Dhawan, 2008; Vijayta et al., 2008).
Carp has a strong ability to survive, can withstand harsh environ­
ments, and has a strong ability to reproduce. One-one, carp also has a
high medicinal value (Tidwell and Allan, 2001; Xu et al., 2014). The
kidney is the main endocrine and metabolic organ of the carp, which
excretes metabolic waste and regulates acid-base balance. Li relies
mainly on the kidneys for excretion (Dhawan et al., 1987; Freeman and
Freeman, 2006). Long-term exposure of carp to waters with excessive Li
content will cause the kidney’s load to increase when the Li content in
the fish increases (Oktem et al., 2005). Studies have shown that Li can

Abbreviations: CAT, Catalase; ERKs, Extracellular regulated protein kinases; GSH-Px, Glutathione peroxidase; GSK-3β, Glycogen synthase kinase 3β; IL, Inter­
leukin; JNKs, c-Jun N-terminal kinase; Li, Lithium; MAPKs, Mitogen-activated protein kinase; ROS, Reactive oxygen species; SOD, Superoxide dismutase; TOR, Target
of rapamycin; TSC2, Tuberous sclerosis complex 2; TGF-β, Transforming growth factor-β.
* Corresponding author.
E-mail address: xuejiaogao@126.com (X.-j. Gao).
1
Both authors contributed to this work equally.

https://doi.org/10.1016/j.aquaculture.2020.736282
Received 2 November 2020; Received in revised form 10 December 2020; Accepted 13 December 2020
Available online 15 December 2020
0044-8486/© 2020 Elsevier B.V. All rights reserved.
H. Jing et al.
Table 1
The primer sequence.
Target gene Primer sequence Forward (5′ -3′ )
GSK-3β GGCAGTAAAGTGACCACAG
TSC2 CTGCCGTACACCAATCC
TOR CGTCACATCACGCCCTTCA
TNF-α CTCAGAGTCTATGGGAAGCA
IL-1β TGACAGCCTCCTCTTCTT
IL-6 CAGCAGAATGGGGGAGTTATC
GAPDH GTAAGCAATGCCTCCT
β-actin CCGTGACATCAAGGAGAA
Fig. 1. Determination of Li content in blood and carp kidney tissue under Li
stimulation. Li content in blood of the control group and Li poisoning group.
Right: Li content in kidney tissues of the control group and Li poisoning group.
CG, Control group: The carp were fed with a basal diet in water without Li. LiG,
Lithium poisoning group: A fish tank was added with Li in water and fed with a
basic diet. Data are presented as the means ± SD. (n = 10 per group). * shows a
significant difference from the control group. **P < 0.01 vs control group.
cause a decrease in glomerular filtration rate, and Li reabsorption
mainly occurs in the proximal tubule, and excessive accumulation in the
collection tube may affect renal excretory function (Chang and Ho,
2020; Du et al., 2020; Vervaet et al., 2020).
Reactive oxygen species (ROS) are produced by aerobic organisms.
The ROS produced by the body’s normal metabolism can participate in
immune and signaling processes. When excess free radicals cannot be
metabolized by antioxidant enzymes, lipid peroxidation and protein
oxidation are often induced (Xing et al., 2019; Zhang et al., 2019; Shah
et al., 2020). ROS participates in physiological processes, induces
inflammation, and stimulates the production of large amounts of cyto­
kines (Barrio et al., 2020). ROS is regulated by antioxidants. Common
antioxidant enzymes include catalase (CAT), superoxide dismutase
(SOD), and glutathione peroxidase (GSH-Px). Many studies have shown
that ROS is regulated by the mammalian target of rapamycin (TOR)
signaling (Niles and Powers, 2014). TOR signal is negatively regulated
by tuberous sclerosis complex 2 (TSC2) (Inoki et al., 2006), and
glycogen synthase kinase 3β (GSK-3β) plays a crucial role in TSC2 / TOR
signal transmission. In previous studies, Li was able to activate the TSC2
/ TOR signaling by inhibiting GSK-3β (Liu et al., 2017).
The serious reaction caused by oxidative stress is mainly reflected in
the inflammatory factors. Representative pro-inflammatory cytokines
include tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β, and IL-
6, etc. The anti-inflammatory factors are represented by IL-10. mitogen-
2
Aquaculture 535 (2021) 736282
Primer sequence Reverse (5′ -3′ ) Accession number
AAGTAACGCAGACGAACAA NM_131381.1
CTGCGTGCTCTGAAACTG NM_001328401.1
TCAGCACCCAACGGCAC NM_001077211.2
CCAGGTAAATGGCGTTG JF957372
TCCACCTTCTCCCAATC KC008576
CTCGCAGAGTCTTGACATCCTT KC535507.1
CCATCAACGGTCTTCTGT NM_001115114.1
CCATACCCAGGAAGGAA AF057040.1
activated protein kinase (MAPKs) include three subgroups of p38 MAPK,
extracellular regulated protein kinases (ERKs), and c-Jun N-terminal
kinase (JNKs). The MAPK signal transduction pathway plays an
important role in regulating cell growth, differentiation, inflammation,
and other physiological or pathological processes, and plays a key role in
the regulation of gene expression and biological functional activities (Xu
et al., 2016a; Xu et al., 2016b). In this experiment, a model of fish in
vitro Li infection was established to study the effects of high concen­
trations of Li on carps in the body of water, and the effects of Li on
oxidative damage and inflammatory response to kidneys were
emphasized.
2. Materials and methods
2.1. Animals and treatment
20 carp (>2 years, weight 250 ± 50 g) were harvested from the carp
farm, kept in the laboratory aquarium, maintained at 23 ± 0.5 ◦ C, pH
7.3 ± 0.1, dissolved oxygen higher than 9 mg / L (Gao et al., 2019).
Replace one-third of the water in the aquarium every day. Experiments
were conducted according to guidelines issued by the National Institutes
of Health for the care and use of laboratory animals. All experimental
procedures were approved by the Institutional Animal Care and Use
Committee of Northeast Agricultural University. The carp were divided
into two groups of 10 each, 1) Control group (CG): The carp were fed
with a basal diet in water without Li. 2) Li poisoning group (LiG): A fish
tank was added with Li (20 mg/L) in water, and fed with a basic diet.
After 30 days, the carp were anesthetized with chloroformate containing
NaHCO3, and kidney tissues were immediately collected for further
analysis.
2.2. Detection of lithium concentration in blood and kidney tissue
2 mL of fish blood was collected by puncturing the tail artery and
centrifuged at 3500r for 15 min, and the upper serum was collected.
10% homogenate was prepared from fish kidney tissue, centrifuged at
3500r for 15 min, and the supernatant was taken. Tested at Wuhan
University People’s Hospital. The instrument used was VITROS 350
automatic biochemical analyzer, VITROS Chemistry Products Calibrator
Kit 1 (colorimetric method). The principle is that Li in serum can interact
with crown ether azo dye − 1, 4, 8, 11-tetraoxohexadecyl) specifically
binds to shift the absorption peak of the dye. The Li-ion concentration in
the sample is directly proportional to the absorbance to calculate the
lithium-ion concentration.
2.3. Histological analysis
Hematoxylin and eosin (HE staining) were performed according to
routine protocols (Guo et al., 2016). The fish kidney tissue was fixed in a
10% formaldehyde solution, trimmed, transparent with xylene, and
embedded and sliced. The sections were subjected to xylene dewaxing,
alcohol to water, hematoxylin staining, and eosin staining. Observed by
optical microscopy and imaged. * shows a significant difference from the
H. Jing et al. Aquaculture 535 (2021) 736282

Fig. 2. The effect of Li on the morphology of carp kidney tissues. (A-B) HE staining of the control carp kidney tissues in CG. (C-D) HE staining of carp kidney tissue in
Li poisoning group (LiG).

control group. **P < 0.01 vs control group.
2.4. Cell culture
The fish kidney cells (CIK) line are from the Yangtze River Fisheries
Research Institute (YFI) of the Chinese Academy of Fishery Sciences
(Wuhan, China). Maintained at 28 ◦ C in a CO2-free environment and
cultured in M199 medium supplemented with 100 U/mL penicillin and
100 mg/mL streptomycin (Invitrogen, USA). Cells were cultured in a
basal medium containing 9 mmol / L Li for 48 h. Cells were then
collected for gene expression analysis.
2.5. Analysis of ROS
The kidney tissues were homogenized and centrifuged. Supernatants
of tissues and cells were extracted for protein concentration detection
for subsequent calculations. Strictly follow the instructions. After sam­
ple processing, the supernatant was mixed with 2′ , 7′ -dichloro­
fluorescein yellow diacetate probe on a 96-well plate, and incubated
with a fluorescent labeler in the dark. The fluorescence intensity was
measured under the conditions of an excitation wavelength of 500 nm
and an emission wavelength of 525 nm. According to the kit manufac­
turer’s instructions (Nanjing Jiancheng Biotechnology Co., Ltd., China),
the fluorescence intensity of 1 mg protein is used to represent ROS
intensity.
2.6. Evaluation of antioxidant effects
The kidney tissues were homogenized and centrifuged. The super­
natant was extracted for sample testing. SOD activity was measured
using the xanthine oxidation method. The CAT activity was detected
using a visible light method. Detect GSH-Px activity based on the prin­
ciple that GSH-Px can catalyze reduced glutathione (GSH) to produce
oxidized glutathione (GSSG). The photometric value was measured at
the corresponding wavelength. The ability of MDA to bind to thio­
barbituric acid (TBA) was used to detect MDA activity. Measure the
photometric value at the corresponding wavelength. All the operations
were strictly in accordance with the manufacturer’s instructions.

3
H. Jing et al. Aquaculture 535 (2021) 736282

Fig. 3. Effects of Li on oxidative stress and antioxidants in carp kidney tissues. (A) Expression of ROS in Li-treated and the control groups. (B) MDA activity in Li-
treated and the control groups. (C) The activity of CAT in the Li treatment group and the control group. (D) The activity of GPx in the Li treatment group and the
control group. (E) The activity of SOD in the Li treatment group and the control group. CG, Control group: The carp were fed with a basal diet in water without Li.
LiG, Lithium poisoning group: A fish tank was added with Li in water and fed with a basic diet. Data are presented as the means ± SD. (n = 10 per group). * shows a
significant difference from the control group. **P < 0.01 vs control group.

Fig. 4. Effect of Li on mRNA levels of GSK-3β / TSC2 / TOR in carp kidney tissues. (A) Expression of GSK-3β in Li-treated and control groups. (B) Expression of TSC2
in Li-treated and control groups. (C) Expression of TOR in Li treatment group and the control group. CG, Control group: The carp were fed with a basal diet in water
without Li. LiG, Lithium poisoning group: A fish tank was added with Li in water and fed with a basic diet. Data are presented as the means ± SD. (n = 10 per group).
* shows a significant difference from the control group. **P < 0.01 vs control group.

4
H. Jing et al. Aquaculture 535 (2021) 736282

Fig. 5. Effect of Li on the expression of inflammatory factors in carp kidney tissues. (A) Expression of TNF-α. (B) Expression of IL-1β. (C) IL − 6 Expression. (D)
Expression of TGF-β. (E) Expression of IL-10. CG, Control group: The carp were fed with a basal diet in water without Li. LiG, Lithium poisoning group: A fish tank
was added with Li in water and fed with a basic diet. Data are presented as the means ± SD. (n = 10 per group). * shows a significant difference from the control
group. **P < 0.01 vs control group.

2.7. Enzyme-linked immunosorbent assay (ELISA) detection of 20 s, 72 ◦ C, 20 s, 40 cycles; one cycle of the melting curve phase. GAPDH
inflammatory factors was used as a control. The result is expressed as 2-ΔΔCt.

10% tissue homogenate was prepared from carp kidney tissue for
2.9. Western blot analysis
examination and cell culture supernatant for testing. BioLegend’s ELISA
MAX ™ Deluxe Set detection kit was used to detect the expression of
The tissue and cells are homogenized to extract proteins. Protein
TNF-α, IL-1β, IL-6, and IL-10. The ELISA Kit is a sandwich enzyme-linked
concentration was determined using a BCA protein assay kit. The protein
immunosorbent assay in which monoclonal antibodies are coated on 96-
lysate was subjected to 10% SDS-PAGE using a Tris-HCl precast gel and
well plates one day in advance. After cleaning the next day, add the
then transferred to a polyvinylidene fluoride (PVDF) membrane. The
standard and test sample to the wells. Detection antibodies are then
membrane was immersed in 5% skim milk and then incubated with
added to form a double antibody sandwich. Then add horseradish
primary antibodies to p38, ERK, JNK, p-p38, p-ERK, and p-JNK (Wan­
peroxidase and a coloring solution, and finally add a stop solution, and
leibio Co., Ltd., Liaoning, China) overnight at 4 ◦ C. After using the
measure the absorbance at 450 nm.
appropriate HRP-conjugated goat anti-rabbit IgG secondary antibody
(1:3000, Santa Cruz Biotechnology, USA). The blot was detected using
2.8. Quantitative real-time polymerase chain reaction (qPCR)
an enhanced chemiluminescence detection system. Beta-actin was used
as an internal reference to load proteins in equal amounts.
The fish kidney tissues were ground in liquid nitrogen, and RNA from
cells and tissues was extracted using the TRIzol method. After testing the
concentration and purity of the RNA, they were reverse transcribed into 2.10. Statistical analyses
cDNA using HiScript IIQ RT SuperMix (Roche, Basel, Switzerland) for
qPCR (+gDNA wiper). Primers that amplify specific genes were The SPSS software package (ver. 13 for Windows; SPSS Inc., Chicago,
designed using Primer 5.0 software. The specific primers used in this IL, USA) was used for statistical analyses of the data. All values are
study are shown in Table 1. qPCR was carried out using the SYBR expressed as the means ± SD. Significance was determined by a one-way
fluorescence method, and the reaction system was 20 μl. The cycle pa­ ANOVA using a significance level. * shows a significant difference from
rameters were carried out at 95 ◦ C for 5 min, 1 cycle; 95 ◦ C, 10 s, 55 ◦ C, the control group. **P < 0.01 vs control group.

5
H. Jing et al.
Fig. 6. Effect of Li on the MAPK signaling pathway. Results of protein phos­
phorylation of p38 MAPK / ERK / JNK in Li treatment group and control group.
CG, Control group: The carp were fed with a basal diet in water without Li. LiG,
Lithium poisoning group: A fish tank was added with Li in water and fed with a
basic diet.
3. Results
3.1. In vivo
3.1.1. Li concentration in blood and tissues
The test results showed that the Li concentration in the blood of the
fish in the Li poisoning group was higher than that in the control group
(p < 0.05). Li enters the carp body through the digestive tract or the skin
surface. The kidney is the main metabolic organ and the main metabolic
pathway of Li. Excessive Li stimulation causes the Li concentration in the
kidney tissue to be significantly higher than that in the unstimulated
group (p < 0.05). The results are shown in the Fig. 1.
3.1.2. Histological change of kidney
The kidney is the main excretory organ of fish. It consists of many
6
Aquaculture 535 (2021) 736282
nephrons. Each nephron can be divided into two parts: the renal
corpuscle and the renal tubule. The renal corpuscle is divided into the
renal capsule and the glomerulus. Li is mainly deposited in the renal
tubules, affecting the function of the kidney and destroying the structure
of the kidney. As shown in Fig. 2, the intrinsic structure of the kidney
section of the Li poisoning group was destroyed, and a large amount of
inflammatory cell infiltration was observed.
3.1.3. ROS, MDA level, and antioxidant activity in the kidney
ROS are formed by aerobic organisms and maintain a dynamic bal­
ance in normal animal organisms. In the Li-treated group, accumulation
was observed, and the ROS level in the kidney tissue of the Li poisoning
group was significantly increased (p < 0.05), The result is shown in
Fig. 3 (A). Free radicals act on lipids to produce malondialdehyde
(MDA), and as shown in Fig. 3 (B), the MDA level is increased under Li
stimulation (p < 0.05). The level of oxidative damage in the tissue is
regulated by antioxidants. Under Li stimulation, SOD, CAT, and GSH-Px
activities are significantly reduced (p < 0.05). The results are shown in
Fig. 3 (C–F). Li can directly promote the increase of ROS, and can also
reduce the activity of antioxidants and increase oxidative damage.
3.1.4. Effects of Li on mRNA expression of GSK-3β, TSC2, and TOR in the
kidney
Compared with the control group, the mRNA expression of GSK-3β in
the Li poisoning group was inhibited, and the difference was significant.
The expression of TSC2, which is positively regulated with GSK-3β at the
mRNA level, also showed the same results, as shown in Fig. 4 (A-B).
Under Li stimulation, the expression of TSC2 was suppressed and the
difference was significant. TSC2 negative feedback regulates the
expression of TOR, which is consistent with the results. The expression
of TOR at the mRNA level in the Li poisoning group is significantly
higher than that in the control group. The results are shown in Fig. 4 (C).
3.1.5. Levels of inflammatory factors in the kidney
Some inflammatory factors were detected by double-antibody
sandwich enzyme-linked immunosorbent assay. Compared with the
control group, the expression levels of TNF-α, IL-1β, and IL-6 in the Li
poisoning group were significantly increased, as shown in Fig. 5 (A-C).
The expression of transforming growth factor-β (TGF-β) and IL-10 were
opposite to that of pro-inflammatory factors. The expressions of TGF-β
and IL-10 in the Li poisoning group were significantly lower than those
in the control group. The results are shown in Fig. 5 (D-E).
3.1.6. Li activates the MAPK pathway
Inflammatory factors can activate the MAPK pathway, and p38
MAPK, JNK, and ERK are the three subgroups of the MAPK pathway. We
used Western blot analysis to analyze the phosphorylation of p38 MAPK,
JNK, and ERK. The results are shown in Fig. 6. The phosphorylation of
p38 MAPK, JNK, and ERK marks the activation of the MAPK pathway
and stimulates the regulation of the body’s inflammatory response.
3.2. In vitro
3.2.1. GSK-3β / TSC2 / TOR expression and antioxidant enzyme activity
in cells
Using the kidney cells of the fish, the effects of Li on the GSK-3β /
TSC2 / TOR regulatory system were investigated, and the expression of
antioxidants was also detected. The effect of Li on the GSK-3β / TSC2 /
TOR regulatory system in cells is consistent with in vivo experiments.
Both the expression of GSK-3β and TSC2 at the mRNA level is sup­
pressed, while the expression of TOR at the mRNA level is promoted, and
the difference is significant. The results are shown in Fig. 7 (A-C). The
vitality of antioxidants SOD, CAT, and GSH-Px was also inhibited under
Li stimulation. Compared with the control group, the difference was
significant, as shown in Fig. 7 (D-F).Figure 7
H. Jing et al.
Fig. 7. The effect of Li on intracellular GSK-3β / TSC2 / TOR at the mRNA level and the effect of antioxidant enzymes. (A) The expression of GSK-3β. (B) The
expression of TSC2. (C) TOR expression. (D) CAT activity. (E) GPx activity. (F) SOD activity. CG, Control group: The cell was cultured without Li. LiG, Lithium
poisoning group: The cell was cultured with Li. Data are presented as the means ± SD. (n = 10 per group). * shows a significant difference from the control group.
**P < 0.01 vs control group.
3.2.2. Oxidative damage stimulated by Li in cells
ROS is one of the important detection indexes of oxidative damage.
Stain with a fluorescent dye and analyze with a fluorescent microscope,
with the intensity of fluorescence representing the intensity of ROS. As
shown in Fig. 8 (A), compared with the control group, the intensity of
ROS in the Li poisoning group was significantly higher. MDA is the final
oxidation product of the lipid peroxidation reaction, and the result is
shown in Fig. 8 (B). Under excessive Li treatment, MDA levels were
significantly higher than in the control group.
3.2.3. Li stimulates intracellular inflammatory factors and activates the
MAPK pathway
Oxidative damage stimulates the inflammatory response and induces
the secretion of inflammatory factors. The expression of inflammatory
factors TNF-α, IL-1β, and IL-6 at the mRNA level was investigated by
qPCR, and the expression of inflammatory factors was detected by
ELISA. The results are shown in Fig. 9 (A-B). Under Li stimulation, the
expression of pro-inflammatory factors was significantly higher than
that in the control group. The experimental results at the cellular level
are consistent with the tissue results. Overexpression of pro-
inflammatory factors aggravates inflammation and stimulates the
regulation of inflammatory responses. In addition, we analyzed the
phosphorylation of p38, ERK, and JNK by Western blotting and found
that Li stimulus phosphorylates MAPKs.
7
Aquaculture 535 (2021) 736282
4. Discussion
The kidney is an important excretory organ of the bony fish, and the
excretion function is completed by the filtration of the renal corpuscle
and the absorption and secretion of the renal tubule (McCampbell et al.,
2015; Bates et al., 2018). The nutrients and some monovalent ions
required by the general body are reabsorbed by the renal tubules
through the active transportation process of energy consumption. The
proximal tubule is the longest segment of the fish tubule. Li is reab­
sorbed in the proximal tubule and partially deposited in the renal tubule.
As the level of accumulation increases, the kidney function is affected
(Finley Patrick, 2016; Jing et al., 2020a, 2020b). The results of the
sectioning showed that the structure of the kidney in the Li poisoning
group was destroyed, and a large number of inflammatory cells infil­
trated in the gap.
Renal tubular cells are rich in mitochondria, and Li stimulates the
mitochondrial secretion of ROS in the renal tubule (Mezni et al., 2017).
Reactive oxygen free radicals have high activity and strong oxidation
reaction ability, and can attack the macromolecular substances they
encounter by oxidation to cause peroxidation. Deformation, causing the
destruction of cell structure and function, leading to damage to the body
tissues and organ degeneration (Brownlee, 2005). On the one hand, free
radicals can destroy diseased cells, on the other hand, they attack white
blood cells, resulting in a large release of lysosomal enzymes, further
killing or killing tissue cells, causing inflammation. ROS is inherent in
life, but the body has a regulatory system. Antioxidants neutralize ROS
H. Jing et al.
Fig. 8. Effect of Li on intracellular oxidative damage. (A) The intensity of ROS in Li-treated and control groups. (B) The activity of MDA. CG, Control group: The cell
was cultured without Li. LiG, Lithium poisoning group: The cell was cultured with Li. Data are presented as the means ± SD. (n = 10 per group). * shows a significant
difference from the control group. **P < 0.01 vs control group.
and prevent oxidative damage (Song et al., 2010). GSK-3β can regulate a
variety of physiological processes, and studies have shown that Li reg­
ulates oxidative stress by inhibiting GSK-3β (Niles and Powers, 2014; Liu
et al., 2017). GSK-3β inhibits antioxidant enzyme activity by regulating
the TSC2 / TOR signal regulation system. In this experiment, the effect of
Li on GSK-3β / TSC2 / TOR is consistent with the antioxidant enzyme
inhibition and oxidative damage indicators That is, Li stimulates the
occurrence of oxidative damage and induces an inflammatory response.
Inflammation is a defense response of the body to stimulation.
Excessive secretion of inflammatory cytokines is an important indicator
of the occurrence of inflammatory reactions (Yang et al., 2020). Among
many inflammatory cytokines, TNF-α, IL-1β, IL-6, IL-10, TGF-β, and so
on play a major role. Among them, TNF-α is the earliest and most
important inflammatory mediator, which can activate neutrophils and
lymphocytes, regulate their tissue metabolic activity, and promote the
synthesis and release of other cytokines. IL-6 can induce B cell differ­
entiation and antibody production, and induce T cell activation, pro­
liferation, and differentiation, participate in the body’s immune
response, and is an initiator of inflammatory reactions. TGF-β is a group
of factors that regulate cell growth and differentiation (Jing et al., 2020).
It can regulate IL-6 gene transcription, promote IL-6 production, and
also affect other inflammatory factors (Bastin et al., 2020; Kang et al.,
8
Aquaculture 535 (2021) 736282
2020). In addition, the experiment also explored the anti-inflammatory
factor IL-10. Under Li stimulation, the expression of anti-inflammatory
factor was suppressed, and the expression of IL-10 was significantly
lower (Xie et al., 2020). Based on the investigation of mRNA and protein
levels, the expression of pro-inflammatory factors increased signifi­
cantly under Li stimulation, while anti-inflammatory factors were
suppressed.
Inflammatory factors activate the MAPK pathway, with TNF-α being
most apparent (Gao et al., 2019). After stimulating cells, TNF-α can act
on three subgroups of P38 MAPK, ERK, and JNK. P38 MAPK mainly
mediates inflammation, apoptosis, and some cytokines (Barrio et al.,
2020). Activation of ERK affects various growth factor receptors. With
the transcription of nutrient-related factor receptors, the JNK pathway
affects the transcription of some cytokines and mediates apoptosis (Li
et al., 2019). Under the stimulation of Li, the expression of MAPKs was
higher at the mRNA level, and the analysis of its phosphorylation
confirmed the activation of the MAPK signaling pathway.
At the present, Li has no known biological uses, but has been widely
used in industrial production, such as lithium batteries, air conditioning
humectants, ceramic products, and the like (Soodabeh and Mohammad,
2013). However, the use of lithium batteries in modern life is increasing,
and its handling has become a major problem. Improper handling can
H. Jing et al. Aquaculture 535 (2021) 736282

Fig. 9. Effect of Li on intracellular MAPK signaling pathway and the effect of inflammatory factors on protein and mRNA levels. (A) Protein phosphorylation results
of p38 / ERK/ JNK in Li-treated group and control group. (B) Expression of TNF-α / IL-1β / IL-6 at the mRNA level. (C) Expression of TNF-α / IL-1β / IL-6 at the
protein level (p < 0.05). CG, Control group: The cell was cultured without Li. LiG, Lithium poisoning group: The cell was cultured with Li. Data are presented as the
means ± SD. (n = 10 per group). * shows a significant difference from the control group. **P < 0.01 vs control group.

cause environmental pollution and increase the Li content in soil and
water sources. The results show that when the Li concentration in the
water environment is too high, it will have a serious impact on the carp
kidney, cause oxidative damage to the kidney, promote the over­
expression of inflammatory factors, and stimulate the occurrence of
inflammatory reactions.
Declaration of Competing Interest
We declare that we have no financial and personal relationships with
other people or organizations that can inappropriately influence our
work, there is no professional or other personal interest of any nature or
kind in any product, service and/or company.
The authors claim that none of the material in the paper has been
published or is under consideration for publication elsewhere. All of
authors have read the manuscript and have agreed to submit it in its
current form for consideration for publication in “Aquaculture”.
References
Barnes, J., Gorin, Y., 2011. Myofibroblast differentiation during fibrosis: role of NAD(P)H
oxidases. Kidney Int. 79, 944–956.
Barrio, L., Román-García, S., Díaz-Mora, E., Risco, A., Jiménez-Saiz, R., Carrasco, Y.R.,
Cuenda, A., 2020. B cell development and T-dependent antibody response are
regulated by p38γ and p38δ. Front Cell Dev Biol 8, 189. https://doi.org/10.3389/
fcell.2020.00189.
Bastin, A.R., Sadeghi, A., Abolhassani, M., Doustimotlagh, A.H., 2020. Malvidin Prevents
Lipopolysaccharide-Induced Oxidative Stress and Inflammation in Human Peripheral
Blood Mononuclear Cells, 72, pp. 1504–1514.
Bates, T., Naumann, U., Hoppe, B., Englert, C., 2018. Kidney regeneration in fish. Int. J.
Dev. Biol. 62, 419–429.
Brownlee, M., 2005. The pathobiology of diabetic complications - a unifying mechanism.
Diabetes 54, 1615–1625.
Casado, M., Aragón, M.C., Gimémez, C., 1989. Determination of monoamines in rat brain
regions after chronic administration of lithium. Neurochem. Res. 14, 905–908.
Chang, C.W.L., Ho, C.S.H., 2020. Lithium use in a patient with bipolar disorder and end-
stage kidney disease on hemodialysis: a case report. Front Psychiatry 11, 6. https://
doi.org/10.3389/fpsyt.2020.00006.
Dhawan, D., Mehta, J., Mehta, M., Kumar, R., Chopra, J., Sharma, R., 1987. Effect of
lithium ingestion on digestive and absorptive function of rat intestine. Digestion 36,
84–90.
Du, Y., Qian, Y., Tang, X., Guo, Y., Chen, S., Jiang, M., Yang, B., Cao, W., Huang, S.,
Zhang, A., Jia, Z., Zhang, Y., 2020. Chloroquine attenuates lithium-induced NDI and

9
H. Jing et al.
proliferation of renal collecting duct cells. Am. J. Physiol. Renal Physiol. 318,
F1199–F1209.
Finley Patrick, R., 2016. Drug interactions with Lithium: an update. Clin. Pharmacokinet.
55, 925–941.
Freeman, M., Freeman, S., 2006. Lithium: clinical considerations in internal medicine.
Am. J. Med. 119, 478–481.
Gao, X., Tang, B., Liang, H., Yi, L., Wei, Z., 2019. Selenium deficiency inhibits micRNA-
146a to promote ROS-induced inflammation via regulation of the MAPK pathway in
the head kidney of carp. Fish Shell. Immunol. 91, 284–292.
Guo, Y., Wang, L., Ma, R., Mu, Q., Yu, N., Zhang, Y., Tang, Y., Li, Y., Jiang, G., Zhao, D.,
Mo, F., Gao, S., Yang, M., Kan, F., Ma, Q., Fu, M., Zhang, D., 2016. JiangTang XiaoKe
granule attenuates cathepsin K expression and improves IGF-1 expression in the
bone of high fat diet induced KK-ay diabetic mice. Life Sci. 148, 24–30.
Inoki, K., Ouyang, H., Zhu, T., Lindvall, C., Wang, Y., Zhang, X., Yang, Q., Bennett, C.,
Harada, Y., Stankunas, K., Wang, C.Y., He, X., MacDougald, O.A., You, M.,
Williams, B.O., Guan, K.L., 2006. TSC2 integrates Wnt and energy signals via a
coordinated phosphorylation by AMPK and GSK3 to regulate cell growth. Cell 126,
955–968.
Jing, H., Wang, S., Wang, Y., Shen, N., Gao, X.J., 2020a. Environmental contaminant
ammonia triggers epithelial-to-mesenchymal transition-mediated jejunal fibrosis
with the disassembly of epithelial cell-cell contacts in chicken. Sci. Total Environ.
726, 138686.
Jing, H., Zhang, Q., Li, S., Gao, X.J., 2020b. Pb exposure triggers MAPK-dependent
inflammation by activating oxidative stress and miRNA-155 expression in carp head
kidney. Fish Shellfish Immunol 106, 219–227.
Kang, S., Narazaki, M., Metwally, H., Kishimoto, T., 2020. Correction: historical
overview of the interleukin-6 family cytokine. J. Exp. Med. 217 (5).
Li, Y., Jiang, W., Niu, Q., Sun, Y., Ding, C., 2019. eIF2α-CHOP-BCl-2/JNK and IRE1α-
XBP1/JNK signaling promote apoptosis and inflammation and support the
proliferation of Newcastle disease virus. Cell Death Dis. 10, 891.
Liu, D., Gao, L., Zhang, Z., Tao, S., Pang, Q., Li, A., Deng, H., Yu, H., 2017. Lithium
promotes the production of reactive oxygen species via GSK-3β/TSC2/TOR signaling
in the gill of zebrafish (Danio rerio). Chemosphere 195, 854–863.
Malhotra, A., Dhawan, D.K., 2008. Zinc improves antioxidative enzymes in red blood
cells and hematology in lithium-treated rats. Nutr. Res. 28, 43–50.
McCampbell, K., Springer, K., Wingert, R., 2015. Atlas of cellular dynamics during
zebrafish adult kidney regeneration. Stem Cells Int. 2015, 547636.
McKnight, R., Adida, M., Budge, K., Stockton, S., Goodwin, G., Geddes, J., 2012. Lithium
toxicity profile: a systematic review and meta-analysis. Lancet (London, England)
379, 721–728.
Mezni, A., Aoua, H., Khazri, O., Limam, F., Aouani, E., 2017. Lithium induced oxidative
damage and inflammation in the rat’s heart: protective effect of grape seed and skin
extract. Biomed. Pharmacother. 95, 1103–1111.
Niles, B.J., Powers, T., 2014. TOR complex 2–Ypk1 signaling regulates actin polarization
via reactive oxygen species. Mol. Biol. Cell 25, 3962.
Oktem, F., Ozguner, F., Sulak, O., Olgar, E., Akturk, O., Yilmaz, H.R., Altuntas, I., 2005.
Lithium-induced renal toxicity in rats: protection by a novel antioxidant caffeic acid
phenethyl ester. Mol. Cell. Biochem. 277, 109–115.
Ostadhadi, S., Norouzi-Javidan, A., Nikoui, V., Zolfaghari, S., Moradi, A., Dehpour, A.R.,
2018. Nitric oxide involvement in additive antidepressant-like effect of agmatine and
lithium in mice forced swim test. Psychiatry Res. 266, 262–268.
10
Aquaculture 535 (2021) 736282
Sahin, O., Sulak, O., Yavuz, Y., Uz, E., Eren, I., Ramazan Yilmaz, H., Ali Malas, M.,
Altuntas, I., Songur, A., 2006. Lithium-induced lung toxicity in rats: the effect of
caffeic acid phenethyl ester (CAPE). Pathology 38, 58–62.
Shah, S.W.A., Chen, J., Han, Q., Xu, Y., Ishfaq, M., Teng, X., 2020. Ammonia inhalation
impaired immune function and mitochondrial integrity in the broilers bursa of
fabricius: implication of oxidative stress and apoptosis. Ecotoxicol. Environ. Saf. 190,
110078.
Song, H., Cha, M.J., Song, B.W., Kim, I.K., Chang, W., Lim, S., Choi, E.J., Ham, O., Lee, S.
Y., Chung, N., 2010. Reactive oxygen species inhibit adhesion of mesenchymal stem
cells implanted into ischemic myocardium via interference of focal adhesion
complex. Stem Cells 28, 555–563.
Soodabeh, S., Mohammad, A., 2013. Concerns on the growing use of Lithium: the pros
and cons. Iran Red Crescent Med J 15, 629–632.
Tidwell, J., Allan, G., 2001. Fish as food: aquaculture’s contribution. Ecological and
economic impacts and contributions of fish farming and capture fisheries. EMBO
Rep. 2, 958–963.
Vervaet, B.A., Nast, C.C., Jayasumana, C., Schreurs, G., Roels, F., Herath, C., Kojc, N.,
Samaee, V., Rodrigo, S., Gowrishankar, S., 2020. Chronic interstitial nephritis in
agricultural communities is a toxin-induced proximal tubular nephropathy. Kidney
Int. 97, 350–369.
Vijayta, Dani, Chadha, Punita, Bhalla, Devinder, Kumar, Dhawan, 2008. Zinc modulates
lithium-induced hepatotoxicity in rats. Liver Int. 28 (4), 558–565.
Xie, X., Yang, X., Wu, J., Ma, J., Wang, M., 2020. Trib1 contributes to recovery from
ischemia/reperfusion-induced acute kidney injury by regulating the polarization of
renal macrophages. Front. Immunol. 11, 473.
Xing, H., Peng, M., Li, Z., Chen, J., Zhang, H., Teng, X., 2019. Ammonia inhalation-
mediated mir-202-5p leads to cardiac autophagy through PTEN/AKT/mTOR
pathway. Chemosphere 235, 858–866.
Xu, P., Zhang, X., Wang, X., Li, J., Liu, G., Kuang, Y., Xu, J., Zheng, X., Ren, L., Wang, G.,
Zhang, Y., Huo, L., Zhao, Z., Cao, D., Lu, C., Li, C., Zhou, Y., Liu, Z., Fan, Z., Shan, G.,
Li, X., Wu, S., Song, L., Hou, G., Jiang, Y., Jeney, Z., Yu, D., Wang, L., Shao, C.,
Song, L., Sun, J., Ji, P., Wang, J., Li, Q., Xu, L., Sun, F., Feng, J., Wang, C., Wang, S.,
Wang, B., Li, Y., Zhu, Y., Xue, W., Zhao, L., Wang, J., Gu, Y., Lv, W., Wu, K., Xiao, J.,
Wu, J., Zhang, Z., Yu, J., Sun, X., 2014. Genome sequence and genetic diversity of
the common carp, Cyprinus carpio. Nat. Genet. 46, 1212–1219.
Xu, J., Feng, L., Jiang, W.-D., Wu, P., Liu, Y., Jiang, J., Kuang, S.-Y., Tang, L., Tang, W.-
N., Zhang, Y.-A., Zhou, X.-Q., 2016a. Effects of dietary protein levels on the disease
resistance, immune function and physical barrier function in the gill of grass carp
(Ctenopharyngodon idella) after challenged with Flavobacterium columnare. Fish &
Shell. Immunol. 57, 1–16.
Xu, J., Wu, P., Jiang, W.-D., Liu, Y., Jiang, J., Kuang, S.-Y., Tang, L., Tang, W.-N.,
Zhang, Y.-A., Zhou, X.-Q., Feng, L., 2016b. Optimal dietary protein level improved
growth, disease resistance, intestinal immune and physical barrier function of young
grass carp (Ctenopharyngodon idella). Fish Shell. Immunol. 55, 64–87.
Yang, J., Zhou, Y., Shi, J., 2020. Cordycepin protects against acute pancreatitis by
modulating NF-κB and NLRP3 inflammasome activation via AMPK. Life Ences 251,
117645.
Zhang, Q., Zheng, S., Wang, S., Wang, W., Xing, H., Xu, S., 2019. Chlorpyrifos induced
oxidative stress to promote apoptosis and autophagy through the regulation of miR-
19a-AMPK axis in common carp. Fish Shell. Immunol. 93, 1093–1099.