Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649

Contents lists available at ScienceDirect

Comparative Immunology, Microbiology and

Infectious Diseases
journal homepage: www.elsevier.com/locate/cimid

Non-epidermidis coagulase-negative Staphylococcus isolated from farm

animals can inhibit the hemagglutinating activity of Newcastle disease
virus and bovine parainfluenza virus type 3
Miguel A. De la Rosa-Ramos a, b, Roberto Salcedo-Hernández b, Rosa E. Sarmiento-Silva c,
Ma G. Aguilera-Arreola d, María D. Alcántar-Curiel e, Gabriel Betanzos-Cabrera f,
Sandra Rodríguez-Mártinez g, Mario E. Cancino-Diaz g, *, Juan C. Cancino-Díaz h, *
a
Laboratorio de Brucelosis y Tuberculosis, Departamento de Microbiología e Inmunología, Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Universidad Nacional
Autónoma de México (UNAM), Ciudad de México, Mexico
b
Laboratorio de Microbiología Veterinaria, Departamento de Microbiología, Escuela Nacional de Ciencias Biológicas (ENCB), Instituto Politécnico Nacional (IPN),
Ciudad de México 11340, Mexico
c
Laboratorio de Virología, Departamento de Microbiología e Inmunología, Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Universidad Nacional Autónoma de
México (UNAM), Ciudad de México, Mexico
d
Laboratorio de Bacteriología Médica, Departamento de Microbiología, Escuela Nacional de Ciencias Biológicas (ENCB), Instituto Politécnico Nacional (IPN), Ciudad de
México 11340, Mexico
e
Unidad de Investigación en Medicina Experimental, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Ciudad de México 04510, Mexico
f
Área Académica de Nutrición y Toxicología Clínica, Instituto de Ciencias de la Salud, Universidad Autónoma del Estado de Hidalgo, Pachuca Hidalgo, Mexico
g
Laboratorio de Inmunidad Innata, Departamento de Inmunología, Escuela Nacional de Ciencias Biológicas (ENCB), Instituto Politécnico Nacional (IPN), Ciudad de
México 11340, Mexico
h
Laboratorio de Inmunomicrobiología, Departamento de Microbiología, Escuela Nacional de Ciencias Biológicas (ENCB), Instituto Politécnico Nacional (IPN), Ciudad de
México 11340, Mexico

A R T I C L E I N F O A B S T R A C T

Keywords: The Embp protein of Staphylococcus epidermidis inhibits the hemagglutination of the H1N1 influenza virus and
Staphylococcus protects birds from a viral respiratory infection. Several species of Coagulase-negative Staphylococcus (CoNS) are
NDV present in the respiratory cavity, particularly in nostrils. We hypothesize that non-epidermidis CoNS found in
BPI-3
animals can have the same function as observed in S. epidermidis. Thirty Non-epidermidis CoNS isolates were
Hemagglutination inhibition
obtained from poultry, sheep, goat, pig, and dairy cow nostrils. Haemagglutination inhibition (HI) activity was
Supernatant
assayed in bacteria-free supernatants from non-epidermidis CoNS against Newcastle disease virus (NDV) and
bovine parainfluenza virus type 3 (BPIV). In 13 of the 30 strains (43.3 %), bacteria-free supernatants showed HI
activity for NDV and BPIV-3. Staphylococcus xylosus supernatants from poultry (one isolate), sheep (two isolates),
goat (one isolate), and dairy cow (three isolates) had the highest frequency of HI activity on NDV and BPIV-3,
followed by Staphylococcus sp. supernatants from goat (one isolate), dairy cow (two isolates), and finally
Staphylococcus equorum, Staphylococcus chromogens and Staphylococcus gallinarum supernatants with single
isolation from poultry, pig and poultry, respectively. Nine isolates had the homologous gene to the embp gene of
S. epidermidis, and it was associated with HI activity in the studied viruses. By Pulsed-field gel electrophoresis,
S. xylosus isolates showed to be different clones and related to the origin of isolation and HI activity. These results
demonstrate that non-epidermidis CoNS supernatants from different animals and origins have the ability of HI on
NDV and BPIV-3, indicating that not only S. epidermidis has the same function.

1. Introduction where they colonize mucous membranes or the skin [1,2]. Within the
genus, a group called Coagulase-negative Staphylococcus (CoNS) con­
The genus Staphylococcus comprises humans and animal bacteria sists of a heterogeneous group of species that arises as a need to separate

* Corresponding authors at: Carpio y plan de Ayala s/n, Col. Santo Tomás, Alcaldía Miguel Hidalgo, Ciudad de México 11340, México.
E-mail addresses: mecancinod@gmail.com (M.E. Cancino-Diaz), jccancinodiaz@hotmail.com (J.C. Cancino-Díaz).

https://doi.org/10.1016/j.cimid.2021.101649
Received 18 August 2020; Received in revised form 25 March 2021; Accepted 30 March 2021
Available online 15 April 2021
0147-9571/© 2021 Elsevier Ltd. All rights reserved.
M.A. De la Rosa-Ramos et al.
them from Staphylococcus aureus clinically. Overall, CoNS have low
virulence, but they have medical and veterinary importance; some are
nosocomial infection agents or opportunistic agents [1,3]. For instance,
some species such as S. chromogens, S. epidermidis, S. xylosus, and
S. haemolyticus are associated with bovine mastitis, colonizers of pigs
isolated from humans as a microbial component [4–8].
The protective role of CoNS in the host is preventing pathogens from
colonizing either by competition for an ecological niche or as immu­
nomodulating activity [2,5]. Respiratory diseases occupy the first place
in farm animals’ health problems, mainly caused by viruses [9,10].
Paramyxoviruses are pleomorphic containing a monopartite,
single-stranded, negative-sense RNA genome and are usually trans­
mitted by airborne droplets or direct contact; their replication occurs in
the respiratory tract [11,12]. They are causative agents of respiratory
infections in mammals and birds [12,13].
Newcastle disease (ND) is caused by an Avulavirus, a genus of the
family Paramyxoviridae, capable of infecting around 200 hundred-bird
species. Its morbidity and mortality depend on host susceptibility and
virus strain [11,14]. BPIV-3 is a member of the Respirovirus genus of the
family Paramyxoviridae, and it is the causative agent of respiratory
bovine parainfluenza disease [12,15,16].
S. epidermidis has been reported as part of the microbiome in some
birds or pigs [17,18]. S. epidermidis has a protein called extracellular
matrix binding protein (Embp), this protein is secreted to the exterior
medium, and it is only found in S. epidermidis but not in S. aureus [19].
The Embp protein shows hemagglutination inhibition (HI) of the influ­
enza H1N1 virus and protects embryos from embryonated eggs previ­
ously inoculated with S. epidermidis supernatant that survived the
infection by influenza virus [2].
The exclusive HI activity of the virus in the respiratory tract by
S. epidermidis is unknown. We think that the non-epidermidis CoNS
community located in animals respiratory tract can have a similar effect
as observed in S. epidermidis. In this study, we determined the action of
non-epidermidis CoNS strains isolated from different animals on the
ability to cause HI activity of two viruses of veterinary importance to
explore new measures to reduce the prospect of viral infection.
2. Material and methods
2.1. Viral growth
The NDV-MLS, a naturally attenuated virus (non-recombinant)
derived from the LaSota strain, was grown in pathogen-free embryo­
nated chicken eggs (ALPES, Puebla, Mexico). 10-day-old embryos
inoculated in the allantoic cavity with 0.1 mL aliquot of viral culture
(103 PFU) were used and incubated at 37.5 ◦ C for 48 h in a humidifier.
The allantoic fluid samples were tested using hemagglutination and
hemagglutination inhibition assay with standard NDV-specific sera.
BPIV-3 was propagated in monolayers of cells MDBK (ATCC CCL22)
in Dulbecco’s Minimum Essential Media (DMEM) (Life Technologies, CA
USA), plus 10 % horse serum (ATCC 302041). From cell culture bottles
with 80 % confluent MDBK cells, the growth medium was removed, and
300 uL of BPIV-3 virus (103 pfu) were added, made up to a volume of 5
mL with 2 % medium, and it was incubated for 2–3 days until infection
of the cells was observed. The bottles were frozen at -75 ◦ C, thawed at
room temperature, and centrifuged at 1200 x g for 10 min. The super­
natant was recovered, and hemagglutination and hemagglutination in­
hibition tests were performed with standard BPIV-3-specific sera. In
both cases, hemagglutination assay was used as a method for tittering
the viruses. Virus aliquots were stored at − 70 ◦ C until use.
2.2. Bacterial isolation
Samples from backyard farms of sheep, goats, pigs, dairy cows, and
poultry located in the State of Morelos, State of Mexico, and Mexico City
were collected. The sampling from farms and animals was randomized
2
Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649
without replacement; each population number was considered [20].
Backyard farms of each locality were the same, and the animals were
subject to semi-stable conditions except poultry that remained in stable
conditions.
Samples were taken from nostrils by using a sterile swab and inoc­
ulated directly into sterile peptone water, and then transported to the
laboratory where samples were inoculated into mannitol salt agar
(DIBICO, Mexico City, Mexico) and 5 % sheep blood agar (DIBICO).
Mannitol-negative colonies were inoculated in 5 % sheep blood agar,
and the genus identification was made by MALDI-TOF mass
spectrophotometry.
2.3. Obtaining bacteria-free supernatant
An isolated bacterial colony was inoculated in 3 mL of trypticase soy
broth medium (TSB; DIBICO) and incubated at 37 ◦ C for 24 h. Subse­
quently, the bacterial culture was centrifuged at 12,000 x g for 15 min,
the supernatant was recovered and sterilized by filtration using 0.2 μ
nitrocellulose membranes. The Bradford method determined the total
protein in the supernatant using a hemoglobin standard curve to know
the concentration of total proteins in the supernatants.
2.4. Hemagglutination (HA) and hemagglutination inhibition (HI) assays
The hemagglutination (HA) and hemagglutination inhibition (HI)
assays were done in a round bottom 96 well plate (Sarstedt, EdoMex
Mexico). For HA assays, in the first column, 25 μL of virus infective
solution was mixed with 25 μL of sterile saline solution (NaCl 0.9 %),
then ten serial 1:2 dilutions were prepared. The plate was incubated at
37 ◦ C for 15 min, and 25 μL of 1 % chicken erythrocytes was added. Also,
25 μL of saline solution plus 25 μL of 1 % chicken erythrocytes were
prepared as a control.
For HI assay, 25 μL of saline solution and 25 μL of bacteria-free su­
pernatant (2.4 μg/μL of total protein) was added to the first well of the
plate, posteriorly ten serial dilutions 1:2 were done. After, 50 μL of NDV
virus (16 UHA) or BPIV-3 (8 UHA) were inoculated in each well and
incubated at 37 ◦ C for 15 min. After incubation time, 50 μL of 1 %
chicken erythrocytes was added to the plate and incubated again at 37
◦
C and observed at 15, 30, and 45 min of incubation.
As negative controls, a well with only 1 % chicken erythrocytes was
used to determine the formation time of the erythrocytes button,
another well with virus alone without 1 % chicken erythrocytes to
observe if the virus showed some effect, and a final well with trypticase
soy broth (TSB; DIBICO) and 1 % chicken erythrocytes to determine if
TSB can hemagglutinate erythrocytes. As a positive control for HA, a
well with a bacteria-free supernatant of S. epidermidis strain ATCC12228
(capable of inhibiting hemagglutination), containing 2.4 μg / μL of total
protein [2] with 1 % chicken erythrocytes was included.
2.5. Detection of the embp gene
Bacterial DNA was isolated from non-epidermidis CoNS, as described
by Catalanotti et al. (2005) [21]. The embp gene was amplified using the
primers embp-F (AGCGGTACAAATGTCAAT) and embp-R
(AGAAGTGCTCTAGCATCATCC). PCR amplifications were performed
using 1 μl of DNA template (100 ng), 1× buffer, 1 mM MgCl2, 5 mM of
each dNTPs, 1 U of Taq DNA polymerase (Invitrogen, CA USA), and 0.2
μM of each specific primer. PCR conditions were as follows: 30 cycles of
30 s at 92 ◦ C, 40 s at 60 ◦ C, and 30 s at 72 ◦ C. PCR products were
analyzed on 2 % agarose gels.
2.6. Pulsed-field gel electrophoresis (PFGE)
A PFGE protocol made the isolates genotyping for S. aureus described
by The Centre for Disease Control and Prevention, Atlanta, USA. Each
chromosomal DNA strain was extracted and digested with SmaI
M.A. De la Rosa-Ramos et al. Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649

restriction endonuclease (New England Biolabs, MA USA). Restriction Table 1

fragments were resolved in a CHEF GenePath System (Bio-Rad®, CA Species of non-epidermidis Coagulase-Negative Staphylococcus.
USA). Classification of the clones was based on Tenover criteria [22], Identified Origen Locality HI of 16 HI of 8 Presence
and the percentage of relatedness was determined by the Dice coefficient bacteria UH NDV UH embp gene*
[23]. Isolates with cut-off values of 85 % were considered as belonging (dil) VPI.3
(dil)
to the same clone.
Staphylococcus Poultry Mexico – – –
3. Results chromogenes city
Staphylococcus Poultry Morelos – – –
equorum
3.1. Non-epidermidis coagulase-negative Staphylococcus Staphylococcus Poultry Morelos – – –
equorum
Thirty non-epidermidis CoNS strains from backyard farms of sheep, Staphylococcus Poultry Morelos + (1:8) – –
equorum
goats, pigs, dairy cows, and poultry were isolated. Also, an isolated
Staphylococcus Poultry Morelos – – –
S. aureus from a dairy cow was not considered. Strains corresponded to equorum
S. xylosus (13/30, 43.33 %), S. chromogenes (5/30, 16.6 %), S. equorum Staphylococcus Poultry Morelos + (1:8) – þ
(5/30, 16.6 %), S. gallinarum (1/30, 3.33 %), and S. sciuri (1/30, 3.33 gallinarum
%), five strains (5/30 16.6 %) could not be identified until specie level. Staphylococcus Poultry Morelos + (1:8) – –
xylosus
Thus they were reported as Staphylococcus sp. The distribution was as Staphylococcus Sheep Morelos – – –
follows considering the origin of the strain: nine from sheep (Ovis aries), chromogenes
eight from a dairy cow (Bos taurus), seven from poultry (Gallus gallus), Staphylococcus Sheep Morelos – – –
five from goat (Capra hircus), and two from a pig (Sus domesticus) chromogenes
Staphylococcus Sheep Morelos
(Table 1). – – –
chromogenes
Staphylococcus Sheep Mexico – – –
3.2. HI assay of non-epidermidis CoNS supernatants equorum state
Staphylococcus Sheep Morelos – – –
From 30 non-epidermidis CoNS supernatants, 13 (43.3 %) showed HI sciur
Staphylococcus Sheep Mexico – –
activity in both viruses or at least one. An S. aureus supernatant isolated
þ
xylosus state
from dairy cow did not show HI for both viruses studied, and the Staphylococcus Sheep Mexico + (1:8) + (1:4) –
positive-control (S. epidermidis ATCC 12228 supernatant) showed HI in xylosus state
both viruses. Staphylococcus Sheep Mexico + (1:8) + (1:8) þ
xylosus state
In the case of NDV, 11 (36.6 %) non-epidermidis CoNS supernatants
Staphylococcus Sheep Morelos – – –
showed HI vs. NDV (16 UHA). Seven supernatants were from S. xylosus, xylosus
in which three strains were isolated from a dairy cow, two from sheep, Staphylococcus Goat Morelos + (1:8) + (1:4) þ
one from poultry, and one from goat. Two supernatants obtained from sp.
Staphylococcus sp. strains came from dairy cows and goats; a supernatant Staphylococcus Goat Morelos + (1:64) + (1:8) þ
xylosus
from S. gallinarum strain and S. equorum came from poultry (Table 1). Staphylococcus Goat Morelos – – –
In BPIV-3, 9 (30 %) non-epidermidis CoNS supernatants showed HI xylosus
vs. BPIV-3 (8 UHA); five supernatants were S. xylosus in which two Staphylococcus Goat Morelos – – –
strains were isolated from sheep, two from dairy cow and another from xylosus
Staphylococcus Goat Morelos
goat. Three supernatants were Staphylococcus sp. Two isolates were from – – –
xylosus
dairy cow and other from goat and finally, an S. chromogenes supernatant Staphylococcus Pig Morelos – + (1:4) þ
isolated from a pig (Table 1). chromogenes
From 30 non-epidermidis CoNS supernatants, seven supernatants Staphylococcus Pig Morelos – – –
(23.3 %) showed HI activity for both viruses, in which five supernatants xylosus
Staphylococcus Dairy Mexico
were S. xylosus and two supernatants were Staphylococcus sp. Moreover,
– – –
sp. cow state
four supernatants showed only HI on NDV and only two supernatants on Staphylococcus Dairy Mexico – + (1:4) –
BPIV-3 (Table 1). sp. cow state
Staphylococcus Dairy Mexico – – –
sp. cow state
3.3. Presence of homologous gene to the embp gene of Staphylococcus
Staphylococcus Dairy Mexico + (1:128) + (1:8) þ
epidermidis sp. cow state
Staphylococcus Dairy Mexico + (1:16) – +
In a previous study, the participation of the S. epidermidis Embp in HI xylosus cow state
assay on influenza virus was demonstrated [2]. Based on this observa­ Staphylococcus Dairy Mexico + (1:8) + (1:4) þ
xylosus cow state
tion, the presence of a homologous gene to the embp gene of Staphylococcus Dairy Mexico + (1:1024) + (1:4) þ
S. epidermidis in non-epidermidis CoNS isolated was detected by PCR. xylosus cow state
From 30 strains, 10 (33.3 %) showed the presence of a homologous Staphylococcus Dairy Mexico – – –
gene; these strains belong to six S. xylosus isolates, two Staphylococcus sp. aureusa cow state
Staphylococcus ATCC + (1:8) + (1:16)
isolates, S. crhomogenes, and S. gallinarum (one isolate per each; Table 1). þ
epidermidisb
Regarding the relationship between the presence of a homologous gene
a
of S. epidermidis and the HI activity, from 10 strains with the homologous Negative control.
b
gene, only one strain did not have HI activity corresponded to S. xylosus Positive control.
*
Detected by PCR.
isolated from sheep. The remaining nine strains, six showed the HI ac­
tivity for both viruses tested, and were S. xylosus (four strains) and
Staphylococcus sp. (two strains). The remaining three strains showed the
HI activity only on a virus as follows: one S. gallinarum strain and one
S. xylosus strain on NDV, and an S. chromogenes strain on BPIV-3

3
M.A. De la Rosa-Ramos et al.
(Table 1).
It is worth mentioning that four strains did not have a relationship
between the presence of embp gen and the HI activity. They were:
S. xylosus (two strains, one isolated from sheep with HI for both virus,
and the other isolated from poultry with HI only on NDV); an S. equorum
isolated from poultry with HI only on NDV and a Staphylococcus sp.
isolated from a dairy cow with HI only on BPIV-3.
3.4. Clonality of non-epidermidis CoNS isolates
PFGE was used to analyze the S. xylosus, S. equorum, and
S. chromogenes isolates clonality. For S. gallinarum and S. sciuri, only an
isolate was obtained, and no PFGE was performed, whereas Staphylo­
coccus sp. was analyzed by PFGE, but no positive results were obtained
with the restriction enzyme used.
For S. xylosus strains, it is shown that they are distributed in six
different clone groups (A–F), and a subclone of group B called B1.
Concerning the origin of S. xylosus isolates, we found that the poultry
from the State of Morelos had only the clone D with HI activity; simi­
larly, the pig had the same origin but having a different clone, the clone
C without HI activity, and for the sheep a single clone B without HI
activity. Goats from the same Morelos State had the clones B, E, and F,
where only the clone E showed HI activity. Looking at the State of
Mexico, the sheep clone A did not show HI activity. However, all sheep
subclones B1 showed HI activity, which is similar to that observed in a
dairy cow but with isolates belonging to clone B. Isolates from each
clonal group coincide with their HI activities and presence the homol­
ogous gene to the embp gene of S. epidermidis (Fig. 1). It suggests that
animals of the State of Mexico have a clone or subclone (B o B1
respectively) with the highest number of isolates with HI activity than
the animals of the State of Morelos, it possibly due to the greater variety
of S. xylosus clones.
In the case of S. equorum strains, three clones of the group (l-lll) were
distributed. Clones of group l and ll did not show HI activity. In clones of
group lll, only a poultry isolate from the State of Morelos showed HI
activity. Isolates of each group coincide with their HI activities and the
homologous gene presence to the embp gen of S. epidermidis (Fig. 2).
Fig. 1. Clonality of Staphylococcus xylosus isolates by PFGE. It was determined the clonal relation of 13 isolates of S. xylosus by Pulsed-field gel electrophoresis (PFGE)
using the Sma I restriction enzyme. Clones were determined according to the Tenover criterion and the Dice coefficient to determine the similitude, 90 %.
4
Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649
S. chromogenes strains were grouped into one and in two subclones:
1A and 1B. Only clone 1 isolated from a pig from the state of Morelos
showed HI activity. The isolates from each clonal group coincide with
their HI activities and the homologous gene presence to the embp gene of
S. epidermidis (Fig. 3).
4. Discussion
The nasal cavity of animals is an environment rich in microorgan­
isms, which stand out the genus Staphylococcus [1,6]. Temperature, the
season of the year, relative humidity, and the rate of air change directly
affect the presence and quantity of Staphylococcus strains found in the
environment [24]. One of the roles of microorganisms in the nasal cavity
is to prevent pathogen colonization. This work demonstrates that
non-epidermidis CoNS isolated from different animals have a role in the
HI activity on NDV and BPIV-3, similarly as S. epidermidis does on the
H1N1 influenza virus [2].
Non-epidermidis CoNS supernatants showed that S. xylosus, followed
by Staphylococcus sp., had the most significant HI activity on NDV and
BPIV-3. Most of the S. xylosus supernatants showed HI activity in both
viruses studied, suggesting that these bacteria have a protein or non-
protein molecule that recognizes and binds to a hemagglutinin
conserved region to inhibit the hemagglutination. There are currently
few studies on bacteria that inhabit the animals’ nostrils with HI activity
on NDV and BPIV-3 viruses. The most similar work to this study is that
reported by Chen et al. (2016) [2], where the S. epidermidis ATCC12228
supernatant (non-inhabitant of the nostrils) had HI activity on the H1N1
influenza virus. Escherichia coli inoculated in chicken embryos before
infection with NDV decreases viral replication and hemagglutination
titers of the virus, indicating an interaction between E. coli and NDV
[25]. In other work, the HI activity by bacteria of the genus Staphylo­
coccus on the rubella virus was reported. However, the compound or
participating compounds were not identified [26].
Non-epidermidis CoNS supernatants from poultry only showed HI
activity on the NDV virus, indicating host specificity for the virus; this
also suggests that the habitat of non-epidermidis CoNS is essential for
this phenotypic function. Moreover, this does not occur in the non-
M.A. De la Rosa-Ramos et al.
Fig. 2. Clonality of Staphylococcus equorum isolates by PFGE. It was determined the clonal relation of 5 isolates of S. equorum by Pulsed-field gel electrophoresis
(PFGE) using the Sma I restriction enzyme. Clones were determined according to Tenover criteria and the Dice coefficient to determine the similitude, 90 %.
Fig. 3. Clonality of Staphylococcus chromogenes isolates by PFGE. It was determined the clonal relation of 5 isolates of S. chromogenes by Pulsed-field gel electro­
phoresis (PFGE) using the Sma I restriction enzyme. Clones were determined according to the Tenover criterion and the Dice coefficient to determine the similitude,
90 %.
epidermidis CoNS supernatants from dairy cows, sheep, and goats since
these supernatants can have HI activity for both viruses. It is interesting
because we expected that these isolates had only HI activity on BPIV-3. It
suggests that dairy cow, goat, or sheep nostrils inhabited by non-
epidermidis CoNS have a more challenging environment with different
types of viruses that can contribute as interference agents. The adaptive
capacity of staphylococci to the environment is recognized [27].
The Embp protein of S. epidermidis participates in biofilm formation
[28], and recently it has also been involved in HI against the H1N1
influenza virus [2]. For this reason, we searched for the homologous
gene presence to the embp gene of S. epidermidis in non-epidermidis
CoNS. The isolates containing the homologous gene to the embp gene
of S. epidermidis suggests that a similar protein to Embp is probably
present in the non-epidermidis CoNS and that it could be involved in the
HI activity of the virus studied.
The isolates without the homologous gene to the embp gene suggest
that a different molecule to the Embp protein maybe be involved in the
HI activity. Another explanation could be that these isolates are different
clones, as was the case with S. xylosus, where two isolates with these
characteristics were different clones (clone A and D), and therefore the
different clonality affects a different embp gene sequence between these
isolated.
By using an embp gene probe for S. epidermidis, we analyzed by
BLAST the S. xylosus, S. chromogenes, and S. equorum genomes reported
in the NCBI database, no homologous genes were found, indicating an
absence of this gene in these bacteria. However, we cannot discard the
possibility that the non-epidermidis CoNS isolates could have a type of
homologous gene to the embp gene of S. epidermidis because staphylo­
cocci have an open pangenome and with high genetic variability be­
tween isolates [29]. Furthermore, we support this hypothesis by the
results of PFGE analysis in the isolated clone groups. This result
demonstrated that there is a genetic variation and clonality between
isolates from different animals, as was the case with S. xylosus species
5
Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649
that had a greater variety of clones. Besides, the PFGE analysis shows
that the region where the animals also live influences the isolates genetic
variation, indicating that not only the HI activity of an isolate depends
on each animal but also the region where the animal lives affect the
result [24] because different regions have their clonal population. It is
well known that staphylococcal isolates are highly clonal and dependent
on the region of isolation [30].
5. Conclusions
Non-epidermidis CoNS supernatants from different animals and or­
igins, have the ability of HI on NDV and BPIV-3 indicating that not only
S. epidermidis has the same function. This result suggests that staphylo­
cocci present in the animal nostrils contribute to the protection of
infection by NDV and BPIV-3; besides, this work may be helpful as a
background for future studies on bioassays of animal protection thera­
pies against infections of the upper respiratory tract.
Funding
This work was supported by grant 20201086SIP-Instituto Politécnico
Nacional.
Declaration of Competing Interest
The authors report no declarations of interest.
Acknowledgements
We are grateful to MVZ. María Grisel Anaya Santillán for technical
assistance, Mstra, en SIG, Elvia Lazo García for technical assistance. We
are grateful to BSc. Ma Dolores Jarillo-Quijada from the Facultad de
Medicina, Universidad Nacional Autónoma de México, for technical
M.A. De la Rosa-Ramos et al.
assistance with the PFGE analysis. Ma G. Aguilera-Arreola, M.E.
Cancino-Diaz, S. Rodríguez-Martínez, and J.C. Cancino-Diaz appreciate
the COFAA and EDI-IPN fellowships, and SNI− CONACyT.
References
[1] K. Becker, C. Heilmann, G. Peters, Coagulase-negative staphylococci, Clin.
Microbiol. Rev. 27 (2014) 870–926.
[2] H.W. Chen, P.F. Liu, Y.T. Liu, S. Kuo, X.Q. Zhang, R.T. Schooley, H. Rohde, R.
L. Gallo, C.M. Huang, Nasal commensal Staphylococcus epidermidis counteracts
influenza virus, Sci. Rep. 6 (2016) 27870.
[3] L. Phophi, I.M. Petzer, D.N. Qekwana, Antimicrobial resistance patterns and
biofilm formation of coagulase-negative Staphylococcus species isolated from
subclinical mastitis cow milk samples submitted to the Onderstepoort Milk
Laboratory, BMC Vet. Res. 15 (2019) 420.
[4] V. Piessens, E. Van Coillie, B. Verbist, K. Supré, G. Braem, A. Van Nuffel, L. De
Vuyst, M. Heyndrickx, S. De Vliegher, Distribution of coagulase-negative
Staphylococcus species from milk and environment of dairy cows differs between
herds, J. Dairy Sci. 94 (2011) 2933–2944.
[5] H. Derakhshani, J.C. Plaizier, J. De Buck, H.W. Barkema, E. Khafipour, Association
of bovine major histocompatibility complex (BoLA) gene polymorphism with
colostrum and milk microbiota of dairy cows during the first week of lactation,
Microbiome 6 (2018) 203.
[6] M.L. Strube, J.E. Hansen, S. Rasmussen, K. Pedersen, A detailed investigation of the
porcine skin and nose microbiome using universal and Staphylococcus specific
primers, Sci. Rep. 8 (2018) 12751.
[7] J.K. White, J.L. Nielsena, A.M. Madsenb, Microbial species and biodiversity in
settling dust within and between pig farms, Environ. Res. 171 (2019) 558–567.
[8] A. Wuytack, A. De Visscher, S. Piepers, F. Haesebrouck, S. De Vliegher, Fecal
non‑aureus Staphylococci are a potential cause of bovine intramammary infection,
Vet. Res. 51 (2020) 32.
[9] J.A. Ellis, The immunology of the bovine respiratory disease complex, Vet. Clin.
North Am. Food Anim. Pract. 17 (2001) 535–549.
[10] G.D. Snowder, L.D. Van Vleck, L.V. Cundiff, G.L. Bennett, M. Koohmaraie,
M. Dikeman, Bovine respiratory disease in feedlot cattle: phenotypic,
environmental, and genetic correlations with growth, carcass, and longissimus
muscle papalability traits, J. Anim. Sci. 85 (2007) 1885–1892.
[11] B.S. Seal, D.J. King, H.S. Sellers, The avian response to Newcastle disease virus,
Dev. Comp. Immunol. 24 (2000) 257–268.
[12] Y.M. Zhu, H.F. Shi, Y.R. Gao, J.Q. Xin, N.H. Liu, W.H. Xiang, X.G. Ren, J.K. Feng, L.
P. Zhao, F. Xue, Isolation and genetic characterization of bovine parainfluenza
virus type 3 from cattle in China, Vet. Microbiol. 149 (2010) 446–451.
[13] D. Figueroa-Chávez, J.C. Segura-Correa, L.J. García-Márquez, A. Pescador-Rubio,
A.G. Valdivia-Flores, Detection of antibodies and risk factors for infection with
bovine respiratory syncytial virus and parainfluenza virus 3 in dual-purpose farms
in Colima, Mexico, Trop. Anim. Health Prod. 44 (2012) 1417–1421.
[14] V.R. Brown, S.N. Bevins, A review of virulent Newcastle disease viruses in the
United States and the role of wild birds in viral persistence and spread, Vet. Res. 48
(2017) 68.
Comparative Immunology, Microbiology and Infectious Diseases 76 (2021) 101649
[15] J.E. Bailly, J.M. McAuliffe, M.H. Skiadopoulos, P.L. Collins, B.R. Murphy, Sequence
determination and molecular analysis of two strains of bovine parainfluenza virus
type 3 that are attenuated for primates, Virus Genes 20 (2000) 173–182.
[16] P.F. Horwood, J.L. Gravel, T.J. Mahony, Identification of two distinct bovine
parainfluenza virus type 3 genotypes, Trop. Anim. Health Prod. 89 (2008)
1643–1648.
[17] S.S. Whitehead, R.W. Leavitt, M.M. Jensen, Staphylococcosis of turkeys
Development of penicillin resistance in an interfering strain of Staphylococcus
epidermidis, Avian Dis. 37 (1993) 536–541.
[18] B.A. Lowe, B.A. Lowe, T.L. Marsh, N. Isaacs-Cosgrove, R.N. Kirkwood, M. Kiupel,
M.H. Mulks, Microbial communities in the tonsils of healthy pigs, Vet. Microbiol.
147 (2011) 346–357.
[19] N.N. Schommer, M. Christner, M. Hentschke, K. Ruckdeschel, M. Aepfelbacher,
H. Rohde, Staphylococcus epidermidis uses distinct mechanisms of biofilm formation
to interfere with phagocytosis and activation of mouse macrophage-like cells
774A.1, Infect. Immun. 79 (2011) 2267–2276.
[20] M. Thrusfield, Veterinary Epidemiology, Third edn., Blackwell Science, UK, 2005.
Ch:13, 15.
[21] P. Catalanotti, M. Lanza, A. Del Prete, M. Lucido, M.R. Catania, F. Gallè, D. Boggia,
B. Perfetto, F. Rossano, Slime-producing Staphylococcus epidermidis and S. aureus in
acute bacterial conjunctivitis in soft contact lens wearers, New Microbiol. 28
(2005) 345–354.
[22] F.C. Tenover, R.D. Arbeit, R.V. Goering, P.A. Mickelsen, B.E. Murray, D.H. Persing,
B. Swaminathan, Interpreting chromosomal DNA restriction patterns produced by
pulsed-field gel electrophoresis: criteria for bacterial strain typing, J. Clin.
Microbiol. 33 (1995) 2233–2239.
[23] L.R. Dice, Measures of the amount of ecologic association between species, Ecology
26 (1945) 297–302.
[24] A.M. Madsen, S. Moslehi-Jenabiana, M.Z. Islamb, M. Frankela, M. Spilakc, M.
W. Frederiksena, Concentrations of Staphylococcus species in indoor air as
associated with other bacteria, season, relative humidity, air change rate, and
S. aureus positive occupants, Environ. Res. 160 (2018) 282–291.
[25] A.B. El Tayeb, R.P. Hanson, Interactions between Escherichia coli and Newcastle
disease virus in chickens, Avian Dis. 46 (2002) 660–667.
[26] J.B. Campbell, M. Romach, M.L. Ellins, Rubella hemagglutination-inhibition test:
false-positive reactions in sera contaminated with bacteria, J. Clin. Microbiol. 4
(1976) 389–393.
[27] R.N. Zadoks, J.R. Middleton, S. McDougall, J. Katholm, Y.H. Schukken, Molecular
epidemiology of mastitis pathogens of dairy cattle and comparative relevance to
humans, J. Mammary Gland Biol. Neoplasia 16 (2011) 357–372.
[28] J.C. Linnes, H. Ma, J.D. Bryers, Giant extracellular matrix binding protein
expression in Staphylococcus epidermidis is regulated by biofilm formation and
osmotic pressure, Curr. Microbiol. 66 (2013) 627–633.
[29] S. Conlan, L.A. Mijares, NISC Comparative Sequencing Program, J. Becker, R.
W. Blakesley, G.G. Bouffard, S. Brooks, H. Coleman, J. Gupta, N. Gurson, et al.,
Staphylococcus epidermidis pan-genome sequence analysis reveals diversity of skin
commensal and hospital infection-associated isolates, Genome Biol. 13 (2012) R64.
[30] M. Sousa, N. Silva, G. Igrejas, R. Sargo, D. Benito, P. Gómez, C. Lozano,
V. Manageiro, C. Torres, M. Caniça, P. Poeta, Genetic diversity and antibiotic
resistance among coagulase-negative staphylococci recovered from birds of prey in
Portugal, Microb. Drug Resist. 22 (2016) 727–730.