| |

Received: 15 January 2021    Revised: 6 November 2021    Accepted: 7 November 2021

DOI: 10.1111/vop.12956

ORIGINAL REPORT

Comparison of the prevalence of Domestic Cat

Hepadnavirus in a population of cats with uveitis and in a
healthy blood donor cat population in the United Kingdom

Emily C. Jeanes1   | Michaela L. Wegg2   | Judy A. Mitchell3  | Simon L. Priestnall3  |

Lorraine Fleming2  | Charlotte Dawson1

1
Queen Mother Hospital for Animals,
Royal Veterinary College, North
Mymms, Hertfordshire, UK
2
Animal Health Trust. Centre for Small
Animal Studies, Newmarket, Suffolk,
UK
3
Royal Veterinary College, North
Mymms, Hertfordshire, UK
Correspondence
Emily C. Jeanes, Queen Mother
Hospital for Animals, Royal Veterinary
College, Hawkshead Lane, North
Mymms, Hertfordshire AL9 7TA, UK.
Email: ejeanes@rvc.ac.uk
Funding information
British Association of Veterinary
Ophthalmologists
Abstract
Objective: Domestic Cat Hepadnavirus (DCH) is a novel virus recently identified
in the domestic cat. Currently, little is known regarding its clinical significance.
The hepadnaviridae family includes the Hepatitis B Virus (HBV). Co-­infection of
HBV and Hepatitis C in humans increases the risk of uveitis. We aimed to deter-
mine whether DCH is present in the United Kingdom (UK) and whether DCH
warrants investigation as a potential cause of uveitis in cats.
Procedures: Clinical records from the Royal Veterinary College (RVC) and the
Animal Health Trust (AHT) were reviewed for feline cases diagnosed with en-
dogenous uveitis. A healthy control group was identified from cats presented to
the RVC as blood donors. DNA was extracted from stored blood samples using
commercially available kits. Polymerase chain reaction assays were performed
to confirm the presence of feline DNA and to detect the presence of DCH DNA
using previously described protocols.
Results: Blood samples were available from 65 cats with endogenous uveitis and
43 healthy control cats. Two blood samples from cats with endogenous uveitis
tested positive for the presence of DCH DNA. DCH DNA was not detected in the
control group. There was no statistically significant difference between the preva-
lence of DCH between the groups.
Conclusions: Domestic Cat Hepadnavirus is present in the UK. This study failed
to demonstrate a conclusive link between DCH and uveitis in cats, although fur-
ther studies to investigate an association with other feline diseases are warranted.

KEYWORDS
cats, Domestic Cat Hepadnavirus, eye, hepadnavirus, uveitis

including infectious agents, neoplasia, immune-­mediated

1  |  I N T RO DU CT ION disease, and idiopathic.2 Known infectious agents include
feline leukemia virus (FeLV),3,4 feline immunodeficiency
Feline uveitis is a common ocular problem.1 Many en- virus (FIV),5,6 feline coronavirus (FCoV)/feline infectious
dogenous causes of feline uveitis have been described, peritonitis (FIP),4,7 Bartonella henselae,8,9  Toxoplasma

© 2021 American College of Veterinary Ophthalmologists

Veterinary Ophthalmology. 2022;25:165–172.  wileyonlinelibrary.com/journal/vop   |  165

 |
166       JEANES et al.
gondii,10,11 Blastomyces dermatitides,12 Histoplasma cap-
sulatum,13 Cryptococcus neoformans,14,15 Coccidioides im-
mitis,16 and Coccidioides posadasii.16 However, in many
cases of feline endogenous uveitis, no underlying cause
can be identified.17 It is possible that an as-­yet-­unidentified
infectious cause may be present in those cases.
A novel hepadnavirus was recently identified in an
abdominal large cell lymphoma sample from a domes-
tic cat in Australia18 and has been named Domestic Cat
Hepadnavirus (DCH). Currently, little is known regarding
the clinical significance of this virus. The hepadnaviridae
family includes the Hepatitis B virus (HBV).19 In the orig-
inal study, testing of stored blood samples found that 2/63
(3.2%) of cats which were not infected with feline immu-
nodeficiency virus (FIV) tested positive for DCH, while
6/60 (10%) of cats infected with FIV tested positive for
DCH.18 This mirrors the higher incidence of HBV infec-
tion found in human patients with human immunodefi-
ciency virus (HIV).20,21 A study in Italy found that 42/390
(10.8%) of banked feline serum samples were positive for
DCH, with a higher prevalence found in samples that had
been submitted due to suspicion of an infectious disease
process (31/174  samples, 17.8%), compared to 11/216
(5.1%) in samples submitted for pre-­surgical evaluation or
due to suspicion of a metabolic or neoplastic disease.22 A
recent study in Malaysia identified DCH infection in 31
out of 253 cats (12.3%).23 DCH has also been shown to be
associated with chronic hepatitis and hepatocellular carci-
noma, similar to HBV in humans.24
Hepatitis B Virus infection alone in humans has not
been shown to cause uveitis.25,26 However, co-­infection
of HBV and Hepatitis C in humans has been shown to
increase the risk of uveitis above that of a control group,
or patients infected with Hepatitis C alone.25  There are
several methods by which infection with a hepadnavirus
could cause uveitis. HBV has been detected in the aque-
ous humor in infected patients,27 and so if a similar viral
distribution is seen in the cat, uveitis could occur as a di-
rect immune response. Furthermore, infection with HBV
has been linked to a variety of autoimmune diseases in
humans.28 Antigen mimicry has been hypothesized as a
mechanism whereby viral infection can induce autoim-
mune disease.29 Homology between HBV DNA and my-
elin basic protein has been suggested as a mechanism
for development of immune-­mediated disease follow-
ing infection.30 Anti-­proliferating cell nuclear antigen
(PCNA) autoantibodies show preferential binding of the
C-­terminal of PCNA in humans with chronic HBV infec-
tion.31 Rheumatoid arthritis has been well-­established as
a manifestation of HBV infection in up to 35% of cases
and is thought to occur due to development of immune
complexes.32  Th17 cell involvement has previously been
demonstrated in the eyes of cats with idiopathic uveitis,
suggesting an immune-­mediated component of the dis-
ease,33 which could theoretically be stimulated by DCH
infection by one of these mechanisms.
This study aimed to elucidate whether DCH is present
in cats in the United Kingdom (UK) and whether it war-
rants investigation as a potential cause of feline uveitis.
2  |  MATERIALS AND METHO D S
This was a retrospective study including feline uveitis
cases from the Royal Veterinary College (RVC) and the
Animal Health Trust (AHT), and a control group from the
RVC. Both these institutions maintain tissue banks. When
blood tests are performed on clinical cases that present to
their referral hospitals, any excess blood is stored for use in
future research. Client consent for this is routinely estab-
lished using the hospital consent forms prior to investiga-
tions at both centers. Blood samples from historical cases
(taken between 2005 and 2018) and control cases (taken
between 2013 and 2018) were included in this study.
Clinical records were reviewed to identify cats diag-
nosed with endogenous uveitis by a board-­certified vet-
erinary ophthalmologist or resident in training, on the
basis of clinical signs consistent with uveitis (including
but not limited to aqueous flare, keratic precipitates, iridal
hyperemia, episcleral hyperemia, corneal edema, mio-
sis, ocular hypotony). Of these cats, cases where a blood
sample was archived in the institution's tissue bank were
included in the study. The majority of patients presented
primarily to the ophthalmology service at the institution.
Some cases were presented to other services (eg, internal
medicine, oncology) if the uveitis was secondary to a sys-
temic condition and were included after advice was sought
from the ophthalmology service regarding diagnosis and
management of the eye. Routine ophthalmic examina-
tion included assessment of Schirmer tear test readings
(MSD Animal Health), menace responses, dazzle reflexes,
pupillary light reflexes, tonometry (TonoVet, iCare), slit
lamp examination (Kowa SL-­17, Kowa Medical), and in-
direct ophthalmoscopy (Keeler Vantage Plus Indirect
Ophthalmoscope, Keeler Ltd). A typical investigation
for endogenous uveitis included ophthalmic examina-
tion, physical examination, hematology, biochemistry,
infectious disease testing (most commonly FIV, FeLV
(FASTest FeLV-­FIV Combination Test, Vet Lab Supplies
Ltd)), Toxoplasma (serology for IgG/IgM by indirect im-
munofluorescence assay [IFA], Biobest Laboratories), and
Feline Coronavirus (serology by IFA, polymerase chain
reaction (PCR) using a previously published technique,
and alpha-­1 glycoprotein, all done by Glasgow Veterinary
Diagnostics), and imaging of the thorax and abdomen
(typically CT of thorax and abdomen at the RVC and
JEANES et al.      |  167

thoracic radiography and abdominal ultrasonography at

Natonek-­Wiśniewska, 200936
the AHT). Other infectious disease testing performed in

Aghazadeh et al. (2018)18

some patients included Bartonella spp. (PCR, Langford
Laboratories), Anaplasma phagocytophilum and Borrelia
burgdorferi (Snap4Dx, Idexx Laboratories), Cryptococcus
(latex agglutination, Idexx Laboratories), Neospora (serol-
Reference ogy by immunofluorescence assay, Biobest Laboratories),
and Mycoplasma spp, (M. haemofelis, M. haemominutum,
M. turicensis, PCR, Langford Laboratories). The Snap4Dx
test is not licensed for use in the cat, but its use has been

1 min, 62°C for 1 min, 72°C

previously described.35  There was often variation in the
15 s, 55°C for 15 s, 72°C for

for 1 min), 72°C for 15 min

95°C for 1 min, 35× (95°C for

95°C for 3 min, 28× (94°C for

extent of investigation performed between different cases.
10 s), 72°C for 5 min

This may have been due to the clinical presentation (eg,

Thermal program

neoplasia may be considered unlikely in a very young cat)

or due to owner wishes and finances. Alternatively, if the
cat was already known to be affected by a disease that can
cause uveitis (eg, lymphoma or FIV), then investigation
for other possible causes of uveitis may not be considered
a high priority. Cases of uveitis with a known exogenous
cause (such as trauma) were excluded from the study, as
Amplicon Size

were cases where the uveitis had been judged by the clini-
(base pairs of

cian to be secondary to cataract development. Cases which

were diagnosed with an infectious cause of the uveitis,
DNA)

or with neoplasia were included within the study, as the

230

286

current data indicate a likely interplay between DCH and

other infectious diseases and neoplasia. For cases where
concentration

reaction (μM)

investigative bloodwork (eg, hematology and biochemis-

used in 50 μL

try) was performed, values that fell within the reference

range for the laboratory of that institution were judged to
Primer

0.3 μM
0.3 μM

0.4 μM
0.4 μM

be normal and values outside of that reference range were

recorded as abnormal. For interpretation of serology, the
laboratory guidelines were generally used to determine
5'-­atctcagccttagcaggagtacac−3'
5'-­tggatcggagaattgcgtatgcga−3'
5'-­ctagaatggctacatgggttag−3'
5'-­gtgctctgataaccgtatgctc−3'

whether a result was judged to be positive, negative, or in-

Abbreviations: DCH, Domestic Cat Hepadnavirus; PCR, polymerase chain reaction.

conclusive. However, since serology results must be inter-

preted in light of the history and clinical signs, the decision
of the clinician in charge was taken as the final diagnosis.
T A B L E 1   Primers and polymerase chain reaction programs

Similarly, due to the complexity of many clinical cases, the

Sequence

diagnosis that had been recorded by the clinician in charge

of the case was taken as the final diagnosis.
Healthy control animals were identified from a popula-
tion of cats presented to the RVC for participation in their
Primer

Hgap-­R
Hgap-­F

blood donor program. Cats were between one and 10 years

R2
F3

of age, over 3.5 kg, fully vaccinated with no history of travel

abroad, and with no known health problems and not re-
ceiving any medication. These cats had a physical exam-
PCR with specific primers for

PCR with specific primers for

ination performed by a veterinary surgeon with no specific

Feline cytochrome b

training in veterinary ophthalmology. A specific ophthal-

mological examination was not performed on these cases.
Routine testing included hematology, biochemistry, FIV,
and FeLV (FASTest FeLV-­FIV Combination Test, Vet Lab
Supplies Ltd), and Mycoplasma (M.  haemofelis, M.  hae-
DCH
Assay

mominutum, M.  turicensis, PCR, Langford Laboratories).

When analyzing these results, values that fell within the
 |
168       JEANES et al.
reference range for the laboratory of that institution were
judged to be normal and values outside of that reference
range were recorded as abnormal. The decision of the clini-
cian in charge of the case was used for interpreting whether
values outside of the reference range were clinically signifi-
cant. Cases for which full infectious disease testing results
were available and which had a blood sample archived in
the tissue bank were included in the study.
DNA was extracted using commercially available kits
(DNeasy Blood and Tissue Kit, QIAGEN) for whole blood
samples, and QIAamp cador Pathogen Mini Kit (INDICAL
BIOSCIENCE GmBH) for serum blood samples following
the manufacturer's protocol as previously described in the
literature.18,22
Polymerase chain reaction assays were run on all sam-
ples using primers specific to DCH, following the previ-
ously described protocol (Table 1).18 PCR assays were run
on all samples to confirm the presence of feline reference
gene (cytochrome b) DNA, using a previously described
protocol (Table 1).35 Samples which were negative for the
reference gene were excluded from analysis. A plasmid
construct of the virus containing the hepadnaviral PCR
gene target (created from the DCH genome sequence on
the GenBank data base, Thermo Fisher Scientific) was
used as a positive control. A dilution series of the plasmid
confirmed that the PCR was able to detect the plasmid at
2676.31 copies/mL concentration.
polymerase chain reaction reactions were performed
using BiolineMyTaq HotStart polymerase based on the
manufacturer's recommended protocol and previously
described techniques (Table  1).18,36 For each reaction,
1 μL template DNA was added to 25 μL MyTaqTM HS Mix
(Bioline), 22 μL double-­distilled water, and 1 μL each of
the forward and reverse primers.
Descriptive statistics were used to analyze the sex, age,
and breed of the affected and control populations using
Microsoft Excel (Microsoft) and spss Statistics (IBM). For
age data, the Shapiro-­Wilk test was used to define whether
the data were normally distributed.
Chi-­squared analysis was used to assess for a statisti-
cally significant difference between the proportions of
animals' positive for DCH in the affected and the control
groups. A p-­value of less than .05 was considered statisti-
cally significant.
Ethics approval for this project was granted (RVC URN
M2018 0146; AHT 10-­2019E).
3  |  R E S U LTS
3.1  |  Affected cases
Review of the clinical records to find cats diagnosed with
endogenous uveitis revealed 71 cats with blood samples
available in the tissue banks. Due to the absence of detect-
able feline DNA indicating poor sample quality, six sam-
ples were excluded from the analysis, leaving 65 samples
of adequate quality. The archive from the RVC provided
46/65 (71%) of the blood samples, and 19/65 (29%) were
from the AHT’s archive. Of these 65 cats, 7/65 (11%) were
male entire, 35/65 (54%) were male neutered, 3/65 (5%)
were female entire, and 20/65 (31%) were female neu-
tered. The median age was 9 years (range, from 16 weeks
to 20 years and 2 months). There was a bimodal distribu-
tion of the ages, with the most frequent age of diagnosis
being either less than 2 years old, or 8–­13 years old. The
most common breed was the Domestic Shorthair (45/65,
69%), followed by the Domestic Longhair (9/65, 14%),
Maine Coon (4/65, 6%), Bengal or Bengal Cross (2/65,
3%), Sphinx (2/65, 3%), Ragdoll or Ragdoll Cross (1/65,
2%), Persian (1/65, 2%), and British Shorthair (1/65, 2%).
A diagnosis for the etiology of uveitis was made in
37/65 (57%) of cases. An infectious cause was diagnosed
in 17/65 (26%) of cases, a neoplastic cause in 15/65 (23%)
of cases, and a systemic cause (ie, any disease process
not classified as infectious or neoplastic) in 7/65 (11%) of
cases. No cause of uveitis could be identified in 27/65 cases
(42%), which were assumed to be idiopathic. The most
common infectious cause found was FIP (10/65 15%), and
the most common neoplastic cause was lymphoma (6/65,
9%). Further breakdown of the diagnoses is summarized
in Table 2.
Hematology was performed on 60/65 cats (92%), and
biochemistry was performed on 62/65 cats (95%). In 4
cats, the hematology and biochemistry results were not
available for analysis as they had not been uploaded to the
practice computer system. Of the hematological samples
available, in 18/56 (32%) cats, all the results were within
the laboratory reference ranges. The remaining 38/56
(68%) cats showed values outside the laboratory reference
ranges. Of the biochemistry samples available, in 15/58
(26%) cats, all the results were within the laboratory ref-
erence ranges. The remaining 43/58 (74%) cats showed
values outside of the laboratory reference ranges. Further
information regarding the hematology and biochemistry
results is available in the Tables S1 and S2.
Infectious disease testing was performed in 49/65
(75%) of affected cats. This included FIV serology (45/65,
69%), FeLV antigen testing (44/65, 68%), Toxoplasma se-
rology (34/65, 52%), FCoV serology or PCR (28/65, 43%),
Bartonella PCR (8/65, 12%), Snap4Dx (Idexx Laboratories)
(Anaplasma phagocytophilum and Borrelia burgdorferi)
(2/65, 3%), Cryptococcus latex agglutination testing (2/65,
3%), Neospora serology (1/65, 2%), and Mycoplasma PCR
(M.  haemofelis, M.  haemominutum, M.  turicensis) (1/65,
2%).
Urinalysis was performed in 24/65 (37%) of cats,
and urine culture and sensitivity in 10/70 (14%) of cats.
JEANES et al.      |  169

T A B L E 2   Diagnoses made of the etiology of uveitis for the cats

Of the uveitis cases, 2/65 (3%) had a positive result on
in the uveitis group
DCH PCR testing.
Number of The first case was an 8-­year-­old male neutered
Diagnosis cats Domestic Shorthair Cat who presented for investigation
Idiopathic 27/65 (42%) of uveitis; non-­ocular clinical signs included a reduced
Infectious 17/65 (26%) appetite on admission. This cat was diagnosed with a
FIP 10/17 (59%)a large granular lymphoma and also tested positive for
FIV 3/17 (18%)
FIV. FeLV testing was negative. The second case was
a 10-­year-­old female neutered Domestic Shorthair Cat
Toxoplasmosis 2/17 (12%)
presented following acute trauma. The cat had sustained
FeLV 2/17 (12%)
a degloving and skin avulsion injury to the right pelvic
Neoplastic 15/65 (23%) limb, rib fractures, and pulmonary contusions. Due to
Lymphoma 6/15 (40%) the severe tissue trauma, she developed SIRS, with com-
Pulmonary neoplasia (not further identified) 4/15 (27%) plications including anemia, hypotension, hyperbiliru-
Mast cell tumor 1/15 (7%) binemia, hyperglycemia, and acute kidney injury. The
Hepatocellular carcinoma 1/15 (7%) cat experienced cardiopulmonary arrest and died while
Hemangiosarcoma 1/15 (7%) in hospital. Infectious disease testing was not performed
on this patient.
Esophageal tumor 1/15 (7%)
Trigeminal nerve root tumor 1/15 (7%)
Systemic 7/65 (11%)
3.2  |  Control cases
Hepatitis 1/7 (14%)
Meningoencephatitis 1/7 (14%) Blood samples were available from 43  healthy cats. Of
Hyperlipidemia 1/7 (14%) these, 28/43 (65%) were male neutered, 14/43 (33%) were
Abscess on the hind paw 1/7 (14%) female neutered, and the sex of one cat was unknown.
Neutrophilic cholangitis 1/7 (14%) The median age was 3 years and 4 months (range from
Endocarditis 1/7 (14%) 1  year 2  months to 8  years). The most common breed
was the Domestic Shorthair (30/43, 70%), followed by
Systemic Inflammatory Response Syndrome 1/7 (14%)
the Maine Coon (6/43, 14%), Domestic Longhair (5/43,
Abbreviations: FeLV, feline leukemia virus; FIP, feline infectious peritonitis;
12%), British Shorthair (1/43, 2%), and British Longhair
FIV, feline immunodeficiency virus.
a (1/43, 2%).
7 of the FIP diagnoses were confirmed post-­mortem, the others were
diagnosed based on consistent clinical findings and laboratory results. All control cases had hematology and biochemistry
performed, which did not reveal any clinically significant
abnormalities. All control cases had infectious disease
Urinalysis was unremarkable in 15/24 (62%) cases and had testing for FIV, FeLV, and Mycoplasma performed. All of
non-­specific abnormalities that were not considered clini- the control cats tested negative for FIV and FeLV. Two of
cally significant by the clinician in 9/24 (38%) cases. Urine the control cats tested positive for Mycoplasma haemom-
culture did not reveal any bacterial growth in 9/10 cases, inutum and were excluded from the blood donor program.
and the urine culture result was not available in 1 case. None of the control cases had a positive PCR result for
Of the affected cats, 55/65 (85%) had imaging per- DCH.
formed. This included abdominal ultrasonography (33/55, Comparison of the prevalence of DCH between control
60%), thoracic radiography (32/55, 58%), computed tomog- and uveitis cases:
raphy (CT) of the thorax (9/55, 16%), CT of the abdomen Chi-­squared analysis did not reveal any significant dif-
(8/55, 15%), ocular ultrasonography (6/55, 11%), abdomi- ference in proportion of positive results of DCH PCR be-
nal radiography (5/55, 10%), MRI of the head (5/55, 10%), tween the affected cases and the control cases (p = .25).
echocardiography (4/55, 7%), CT of the head (3/55, 5%),
and thoracic ultrasonography (2/55, 4%). Imaging aided
achievement of a diagnosis in 26/65 (40%) of patients. 4  |  DISC USSION
Of the 15 cats diagnosed with neoplastic lesions, imaging
helped reach a diagnosis in 14 cases (93%). Imaging was The finding of two cats that tested positive for DCH DNA
also helpful for reaching a diagnosis of 8/10 cases of FIP shows that this virus is present in the UK cat popula-
(80%), endocarditis (1/65), and systemic inflammatory re- tion. Neither of the two affected cats were known to have
sponse syndrome (SIRS; 1/65). a history of travel abroad, although the clinical records
 |
170       JEANES et al.
did not completely exclude a travel history. DCH was
initially identified in Australia,18 and more recent studies
have identified different strains of the virus in Italy and
Malaysia.22,23 Together, these data suggest that the virus
may have a widespread distribution.
Our results did not show any statistically significant
difference in DCH infection between cats affected by
uveitis and healthy control cats. While it was intrigu-
ing that both cats that tested positive for DCH were in
the group affected by uveitis, due to the small numbers
involved in this study it is possible that this is only by
chance. Furthermore, both cats had other underlying
clinical conditions which could cause uveitis (FIV and
lymphoma in one cat, and SIRS in the other cat). We
therefore cannot conclude that DCH infection was a
cause of uveitis, although further work is necessary to
definitively exclude DCH infection as a causative agent
in feline uveitis.
Ideally, an age-­matched control group selected ran-
domly from the general population would have been used.
However, since cats presenting to referral veterinary hos-
pitals are usually systemically ill, it was not possible to
obtain blood samples from randomly selected clinically
healthy individuals. Cats presenting for assessment to our
blood donation program were therefore used as the con-
trol group. Only cats believed by the owners to be free of
infectious diseases would have been presented for consid-
eration, so it is likely that this control group would have
a lower incidence of disease (such as FIV or FeLV) than
a group randomly selected from the general population.
There is thought to be some interplay between DCH and
FIV, since DCH infection is more common in cats infected
with FIV,18 and a similar relationship has been shown be-
tween HBV infection and HIV in humans.20,21 If a control
group were randomly selected from the general popula-
tion, it is likely that a small proportion would be infected
with FIV despite not showing clinical signs, which could
increase the probability of DCH being detected in the con-
trol group. Using a control group free of FIV may have
made it less likely that DCH would be detected in the con-
trol group. If a statistically significant difference between
DCH infection had been found between the uveitis and
control groups, it is possible this could have been related to
the higher FIV prevalence in the uveitis group compared
to the control group. Due to the inclusion criteria for this
program, these cats were also relatively young (<10 years)
and large (>3.5  kg), and so were not the perfect control
group for this study. However, this was the best control
group available.
For this study, blood samples that had been stored in a
tissue bank were used. This allowed the use of historical
cases which increased the number of samples that could
be accessed, thus increasing the power of the study. This
method has been used in previous studies looking at DCH
prevalence.18,22 One downside of this study design is that
blood samples were only stored if excess blood was taken
during the investigation, so many cases that would have
been suitable for inclusion in the study did not have blood
stored in the tissue banks or had to be excluded due to
inadequate preservation of DNA. Our study also had the
usual limitations of a retrospective study, such as data
not always being recorded in sufficient detail for analysis.
There was wide variation in the degree of investigation
performed for each cat, depending on the presentation
and clinical signs of the patient, as well as the wishes of
the owner. This variation made detailed comparison be-
tween individual cats challenging.
The prevalence of DCH found in this study is lower
than that identified in previous studies.18,22,23 This could
reflect the geographic distribution of the disease. It could
also have been influenced by the study design. Quantitative
PCR (as used by Lanave et al, 2019) is more sensitive to
low viral copy numbers than the conventional PCR used
in this study, which could explain the higher prevalence
(10.8%) found in their study compared to the lower prev-
alence (1.9%) found here.22,37 Further work could include
comparing the results found with conventional PCR to
quantitative PCR. The use of a control group of healthy
cats presented for a blood donor program may have also
reduced the chance of identifying cats affected with DCH
by selecting for healthy individuals.
It would be interesting to be able to compare the re-
sults of PCR for DCH on blood samples with PCR for DCH
on samples of aqueous humor from the same patients.
Cytopathology of aqueous humor has been reported to be
a useful part of a uveitis investigation, primarily for iden-
tification of lymphoma.38 However, PCR for infectious
diseases can also be performed on aqueous humor.38 In
humans, HBV has been detected in the aqueous humor
in infected patients.27 It would be interesting to know
whether DCH can be detected in the aqueous humor,
and to see whether PCR results from the aqueous humor
correlate with PCR results from blood samples. Aqueous
humor samples are not routinely stored, so this analysis
was not possible as part of our study. However, further
work could include analysis of aqueous humor samples as
part of a prospective study.
Many of the cats in the uveitis group had parameters
in their hematological and biochemical analysis that
were outside of the reference range. In a heterogeneous
population, multiple underlying processes could be
causing these changes, with marked variation between
individuals. However, the majority of the hematological
changes were non-­specific, such as anemia which can
be secondary to chronic disease39 or changes consistent
with either a stress leukogram (increased neutrophils
JEANES et al.
and monocytes and decreased lymphocytes and eosin-
ophils) or an inflammatory leukogram (neutrophilia
and the presence of toxic neutrophils or a left shift on
blood smear examination). An infectious cause of uve-
itis was diagnosed in 17/65 (26%) of uveitis cases, with
the most common infectious disease being FIP (10/65,
15%). While not always diagnostic, imaging allowed
a diagnosis of the underlying cause of uveitis to be
achieved in many patients, particularly in those affected
by neoplasia or FIP, where either a mass or granuloma-
tous changes, lymphadenopathy, and effusions could be
demonstrated.
5  |  CO N C LUSION
This study is the first to show evidence that DCH is
present in the UK. However, in this study, DCH was
not detected more frequently in a population of cats
with uveitis when compared to a healthy blood donor
population.
ACKNOWLEDGMENT
This research was funded by a grant from the British
Association of Veterinary Ophthalmologists.
CONFLICTS OF INTEREST
The authors have no conflicts of interest to declare.
ORCID
Emily C. Jeanes  https://orcid.org/0000-0003-0806-5442
Michaela L. Wegg  https://orcid.
org/0000-0001-8308-5596
Charlotte Dawson  https://orcid.
org/0000-0001-9974-1244
REFERENCES
1. Powell CC, Lappin MR. Causes of feline uveitis. Compend
Contin Educ Vet. 2001;23:128-­141.
2. Maggs DJ. Feline uveitis an “intraocular lymphadenopathy”. J
Feline Med Surg. 2009;11:167-­182.
3. Brightman AH. Ocular disease in FeLV positive cats: 11 cases
(1981–­1986). J Am Vet Med Assoc. 1991;198:1049-­1051.
4. Peiffer RL, Wilcock BP. Histopathologic study of uve-
itis in cats: 139 cases (1978–­1988). J Am Vet Med Assoc.
1991;198:135-­138.
5. English RV. Intraocular disease associated with feline im-
munodeficiency virus infection in cats. J Am Vet Med Assoc.
1990;196:1116-­1119.
6. Loesenbeck G, Drommer W, Egberink HF, et al.
Immunohistochemical findings in eyes of cats serologically pos-
itive for immunodeficiency virus (FIV). Zentralbl Veterinarmed
[B]. 1996;43:305-­311.
7. Hartmann K. Feline infectious peritonitis. Vet Clin Small Anim
Pract. 2005;35:39-­79.
     |  171
8. Lappin MR, Black JC. Bartonella spp. Infection as a possible
cause of uveitis in a cat. J Am Vet Med Assoc. 1999;214:1205-­1207.
9. Lappin MR, Jensen W, Kordick DL, et al. Bartonella species
antibodies and DNA in aqueous humour of cats. J Feline Med
Surg. 2000;2:61-­68.
10. Davidson MG. Toxoplasmosis. Vet Clin North Am Small Anim
Pract. 2000;30:1051-­1062.
11. Lappin MR, Roberts SM, Davidson MG, et al. Enzyme-­linked
immunosorbent assays for the detection of Toxoplasma gondii-­
specific antibodies and antigens in the aqueous humor of cats.
J Am Vet Med Assoc. 1992;201:1010-­1016.
12. Nasisse MP, van Ee RT, Wright B. Ocular changes in a cat
with disseminated blastomycosis. J Am Vet Med Assoc.
1985;187:629-­631.
13. Gwin RM, Makley TA Jr, Wynam M, et al. Multifocal oc-
ular histoplasmosis in a dog and cat. J Am Vet Med Assoc.
1980;176:638-­642.
14. Wilkinson G. Feline cryptococcosis: a review and seven case re-
ports. J Small Anim Pract. 1979;20:749-­768.
15. Malik R, Wignet DI, Muir DB, et al. Cryptococcosis in cats: clin-
ical and mycological assessment of 29 cases and evaluation of
treatment using orally administered fluconazole. J Vet Mycol.
1992;30:133-­144.
16. Tofflemire K, Betbeze C. Three cases of feline ocular coccidi-
odomycosis: presentation, clinical features, diagnosis and treat-
ment. Vet Ophthalmol. 2010;13:166-­172.
17. Jinks MR, English RV, Gilger BC. Causes of endogenous uve-
itis in cats presented to referral clinics in North Carolina. Vet
Ophthalmol. 2016;19:30-­37.
18. Aghazadeh M, Shi M, Barrs VR, et al. A novel hepadnavi-
rus identified in an immunocompromised domestic cat in
Australia. Viruses. 2018;10:269-­274.
19. Revill PA, Tu T, Netter HJ, Yuen LKW, Locarnini SA, Littlejohn
M. The evolution and clinical impact of hepatitis B virus ge-
nome diversity. Nat Rev Gastroenterol Hepatol. 2020;17:618-­634.
20. Lisco A, Vanpouille C, Margolis L. Coinfecting viruses as deter-
minants of HIV disease. Curr HIV/AIDS Rep. 2009;6:5-­12.
21. McGovern BH. The epidemiology, natural history and preven-
tion of hepatitis B: Implications of HIV coinfection. Antivir
Ther. 2007;12:H3-­H13.
22. Lanave G, Capozza P, Diakoudi G, et al. Identification of hepad-
navirus in the sera of cats. Nat Sci Rep. 2019;9:10668.
23. Anapuanandam K, Selvarajah GT, Choy MMK, et al. Molecular
detection and characterization of Domestic Cat Hepadnavirus
(DCH) from blood and liver tissues of cats in Malaysia. BMC Vet
Res. 2021;17:9. 10.1186/s1291​7-­020-­02700​-­0
24. Pesavento PA, Jackson K, Hampson TSTTB, Munday JS,
Barrs VR, Beatty JA. A novel hepadnavirus is associated with
chronic hepatitis and hepatocellular carcinoma in cats. Viruses.
2019;11(10):969.
25. Tien P-­T, Lin C-­J, Tsai Y-­Y, et al. Relationship between uve-
itis, different types of viral hepatitis, and liver cirrhosis. A
12-­year nationwide population-­based cohort study. Retina.
2016;36:2391-­2398.
26. Murray PI, Waite J, Rahi AHS, Tedder RS. Acute anterior
uveitis and hepatitis B virus infection. Br J Ophthalmol.
1984;68:595-­597.
27. Koksal I, Cetinkaya K, Aker F. Hepatitis B surface antigen in
tears and aqueous humor. A comparative study of serum hepa-
titis B surface antigen levels. Ophthalmologica. 1992;204:19-­22.
 |
172       JEANES et al.
28. Maya R, Gershwin ME, Shoenfeld Y. Hepatitis B virus
(HBV) and autoimmune disease. Clin Rev Allergy Immunol.
2008;34:85-­102.
29. Bach J-­F. Infections and autoimmune diseases. J Autoimmun.
2005;25:74-­80.
30. Fujinami RS, Oldstone MB. Molecular mimicry as a mechanism
for virus-­induced autoimmunity. Immunol Res. 1989;8:3-­15.
31. Hzu TC, Tsay GJ, Chen TY, Liu YC, Tzang BS. Anti-­PCNA
autoantibodies preferentially recognize C-­terminal of PCNA
in patients with chronic hepatitis B virus infection. Clin Exp
Immunol. 2006;144:110-­116.
32. Csepregi A, Nemesanszky E, Rojkovich B, Poor G. Rheumatoid
arthritis and hepatitis B virus: evaluating the pathogenic link. J
Rheumatol. 2001;28:474-­477.
33. Crossfield L, Fortuna L, Carling R, et al. Immunohistochemical
characterization of feline lymphoplasmacytic anterior uveitis.
Vet Ophthalmol. 2018;22:206-­212.
34. Gut M, Leutenegger CM, Huber JB, Pedersen NC, Lutz H.
One-­tube fluorogenic reverse transcription-­polymerase chain
reaction for the quantification of feline coronaviruses. J Virol
Methods. 1999;77:37-­46.
35. Lappin MR, Chandrashekar R, Stillman B, Liu J, Mather TN.
Evidence of Anaplasma phagocytophilum and Borrelia burgdor-
feri infection in cats after exposure to wild-­caught adult Ixodes
scapularis. J Vet Diagn Inform. 2015;27:522-­525.
36. Natonek-­Wiśniewska M. Species identification of feline
DNA based on analysis of cytochrome B. Ann Anim Sci.
2009;9:379-­383.
37. Xia Z, Johansson ML, Gao Y, et al. Conventional versus real-­
time quantitative PCR for rare species detection. Ecol Evol.
2018;8:11799-­11807.
38. Linn-­Pearl RN, Powell RM, Newman HA, Gould DJ. Validity of
aqueocentesis as a component of anterior uveitis investigation
in dogs and cats. Vet Ophthalmol. 2015;18:326-­334.
39. https://eclin​path.com. Last accessed January 13, 2021 at 12:57.
SUPPORTING INFORMATION
Additional supporting information may be found in the
online version of the article at the publisher’s website.
How to cite this article: Jeanes EC, Wegg ML,
Mitchell JA, Priestnall SL, Fleming L, Dawson C.
Comparison of the prevalence of Domestic Cat
Hepadnavirus in a population of cats with uveitis and
in a healthy blood donor cat population in the United
Kingdom. Vet Ophthalmol. 2022;25:165–­172. https://
doi.org/10.1111/vop.12956