The Commission on Higher Education incollaboration with the Philippine Normal University Teaching Guide for Senior High School GENERAL BIOLOGY 2 CORE SUBJECT This Teaching Guide was collaboratively developed and reviewed by educators from public and private schools, colleges, and universities. We encourage teachers and other education stekeheldors to ema! thei feedback, comments, and recommendations to the Commission on Higher Education, K to 12 Transition Program Management Unt - Senior High School Support Team at k12@ched.gowph. We value your feedback and recommendations‘Published by the Commission on Higher Education, 2016 ‘Chairperson: Patricia B.Liewanan, Ph.D. Cammrision on Higher Ech ation Kt 12 Trandton Program Management Unit (Office Actes: Ath Floor, Cammiaion an Higher Education, CP Garcia Ave, Diliman, Quazon City Telefax: (2) 481-0927 / E-mail Adcheas: K2@chedl gor ph ‘Consultants Tug rsoer a pevLoreo vr rie ure Notas UNverey University Present: Ester B. Ogene, Ph.D. VP for Academic: Ma, Antainete C. Montaslegre, PhD. Per Unverly Reston & Accent Renee. Dir, Ph.D. Ma. CyrthiaRose 8. Bautista, PhD., CHED Blonvenida F Nebres, $1, PhD, Ateneo ce Mania University CCatmela C. Oracion, PhD, Atsneo de Manila University Ninel. Alarcon, PhD, CHED Gareth Price, Shofield Hallas University Stuart Bevns, Ph.D, Sheffald Malm University Development Team Team Leader han Marcelo A, Duka Writers: Nell Andrew B.Bascos,Ph.D., Ma Genslewn O Dias, PhD., lan Kencich C Fentanil ‘This Touching Gude by bo PhD.,Ma. Carmina C. Manuel, Ph, Sharon Rose Commission on Higher Ecration MTabuge, PhD, Eugenia P Quien Je Tearsed und «Creative ‘Commons Atributon- Technical Eiters Annalee S Hadsal, PO. pec rmee aes an: Copy Reader Caroline H.Paeren Intemational Lease Th mane (ator Ma. Daniella Luise F Borreo route fear: Uasrator Ma, Daniels Louise ‘Share — ooy and etibue the Cover Artists Paelo KurbsN. Ton, RenenU. Orig utr ny mad ot forma ‘Ada — tenn arsorm, and bul upon tha moter Senior High School Support Team ‘re lesmr CHED, caro evoke (HizD toto TenationPreram Wansgenent Unit tse fad asons yeu regia Droste Ko Mik 8 Yeo Slower mm Home, Led er Sonor High School Supp Iewioaion— You rustone Gerson Mwai sper ces pron nko ‘helenae nd ict if changes ‘were made You ay dos nay ressornbe manne, tut oth ery Lead for Policy Advacacy and Communications vel M. mero Course Development Officer: vay that uggst the leer” ‘endorses you of yur use son Carlo P Femando, Danis Son D. Gonzalve SE eeprom Teacher Taning Oficars the msterl or commer! Ma. Thevess C. Carlos, Mylene E. Danes purses. . ‘Shared —Hfyou rac Monitoring and Evaluation Officer ‘tesform or buld upon Rober Actian N, Daulst, motel you mut Barbe yout svistative Ofcors ‘ontfoalone under th sme tone Ma, Leana Paula B.8at0, Kevin Ress. Nera, seers ‘Alison A Danao, Ayhen Lasse B. Dalena LGunConpound, re Overon iy arcana asTable of Contents Introduction Deped General Biology 2 Curriculum Guide Chapter 1: Genetics Lesson 4: Pedioree Analysis Lesson ex Linkage and Recombination Lesson odfications to Mendel Classic Ratios Lesson joleaular Structure of DNA, RNA, and Protsins Lesson INA Replication and Protein Synthesis Lesson 6: Genetic Enginesting Lesson 1scuss the Applications of Recombinant DNA ‘Chapter 2: Evolution and Origh of Biodiversity Lesson 8: History of Life on Earth Lesson }echanisms thet Produce Change in Populations. Lesson 10: Evolution and Origin of Biodiversity: Pattorns of Descent with Modification Lesson 11: Development of jolutonary Thought Lesson 12: Evidences of Evolution Lesson 12: infer Evolutionary Relationships of Organisms 13 w 24 30 36 49 70 81 8 92 102 ‘Chapter 3: Systematics Based on Evolutionary Relationships Lesson 14: Systematics Based on Evolutionary Relationships: “Tose of Life an Systematic. Lesson 15: Systematics Sased on Evelutionary Relationships: Taxonomy Lesson 16: Systomatice Sased on Evelutionary Relationships: Cladistics and Phylogeny 109 Ww 12 ‘Chaptor 4: Compare and Contrast Processes in Plants and Animals Lesson 17: Reproduction and Development Lesson 18: Nuition Lesson 19: Gas Exchange Lesson 20: Transport and Circulation Lesson 21: Regulation of Body Fluids Lesson 22: Immune Systems Lesson 23: Comical and Nervous Contal Lesson 24: Sensory and Motor Macharssms Lesson 25: Feedback Mechsrisms Colored Images Biographical Notes 136 158 190 19 20a 2a 22% 235 249 257Introduction SHS for SHS Framework 'As the Commission supports DepEd’ implementation of Senior High Schocl (SHS), it upholds the vision land mission of the Kto 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic Education Act of 2013, that “every graduate of basic education be an empowered individual, tough a program rooted on..the competence to engage in work and be productive, the ability to coexist in| fruitful harmony with local and global communities, the capability to engage in creative and citical thinking, and the capacity and willingness to transform others and onesel.” ‘To accomplish this, the Commision partnered with the Philippine Normal University (PNU) the National Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with appropriate methodologios and stratogies. Furthermore, the Commission believes that teachers are the most important partners in attzning this geal. Incorporated inthis Teaching Guide is 2 framework that wil quide them in creating lessons end assessment tools, suppor them in fociltating activities and questions, and assist them towards deeper Contont aroas and compotencios. Thus, ho introduction of the SHS fer SHS Framework. ‘Tho SHS for SHS Framework which stand for “Saysay- Husay Sail for Sonior High Schoo)” eat the core of thi book. The lessons, which combine high-quality contont with flaxible elomonts to accommodate diversiy of teachers and environments, promote these three fundamental concepts: ‘SAYSAY: MEANING HUSAY: MASTERY ‘SARILI: OWNERSHIP Vihy i this important? Hlowwil I deeply understand thie? What can I do with this? Through this Teaching Guide, ivan that developing mastery When teachers empower teachers will beable to feciitate goes beyond memorzation, _—_learnars to take ownership of. ‘an understanding of the value teachers should also sim for _—_theirlearning, they develop. ofthe lestone, foreach learner deep understanding of the independence and selt tw fully engage inthe content subjact matter where they lead direction, learning about beth on both the cognitive and learners to analyze and the subject matter and affective levels. synthesize knowledge. ‘themselves.About this Teaching Guide ‘The Philippines is frequently cited as among the top countries most at risk to disasters. While disasters can arise from man-made sources, the most inevitable ones come from natural phenomena. Even without scientific seruiny, every Filipino is familiar with the impacts of typhoons, earthquakes, volcanic srustions, and fies to everyiay fe anc to national evelopment. This makes learning about disaster Preparedness aligned with everyone's interests ‘This teaching guide for the Disaster Readinass and Risk Reduction RRR) subject of the Philippines K-12 Curriculum provides a lessar-by-lesson framework for educators to help learners attain te target compotancias and outcomes. The challenge with teaching a aubject Ike DRRRis is muli-dieciplinary ature, bringing together biological, geophysical, socio-cultural, political and economic factors, This in itselis an opportunity to make these various subject matters relevant to the lives of the people even if studying disasters loans toward the sciences. With the use of these teaching guides, the teacher willbe able to handle a diverse set of materals that will eich thei enisting knowledge on the naturel an Secial sciences. They wil slsa be able to engage learners ina number of hands-on activites that make se of mixed-media to maximize existing resaurees. And overall, lessons tackled in these guides encourage o two-way imeraction between the teachers and students that will uimately result to effective learning, Lessons of these teaching guides address the content standards identified by the Deparment of Education (DepEd). Some teaching guides may inelude multiple learning competencies 9s that may be more eficienty achieved when tackled together. This guide approaches learning about DRRR by fist Understanding the hazards that may then potentially lead to dleasters, ae a common confusion ares from distinguishing the concepts of "hazard and “disaster”. Each hazard type has ts own precautionary ‘measures and ideal responses to prevert disasters. Towards the end of the subject, learners wl focus (on applications to the community and the Philippine society Users ofthese guides should note that sciences and policies related to DRRR are aver evelving along with improvements and breakthroughs in data collection and tochnology; 0 i is expectod that reference materiale algo changa through time. It would be important for teachers of the subyact to continually update ary cited references in each guide to make sure thatthe lessons will also result to cutting-edge teaching. ‘Ac 2 big part of understanding disaster involves projecting future possibilities, the euecess of teaching the subject of Disaster Readiness and Rsk Reduction may not be immediately measurable and defintely not something anyone is looking forward to test. But while the countrys exposed to hazards that can alter the course of everyday life, bringing this subject to each classroom gives the people the power to take control of theirlives and of nation-Suilding in whatevar the situation they may ancounter in the fuure,‘This Teaching Guide is mapped and aligned tothe DepEd SHS Curiculum, designed to be high! Parts of the cable orssachors t contains classioom acth-tes and pecagogial notes, ond ntegeated with, Teaching Guide te eisocces al ofthese elements are presertedin the foaing pans: 1. Introduction + Highlight key concepts and dently the essontil questions + Show the bg picure + Connect and/cr review prerequisite knowedgs + Cleary communicate learning competencies and objectives + Motivate through applications and connections to real-life 2. Motivation ‘+ Give local examples and applications Engage in # game of movement activity | Provide s handsonslaboratory actvty + Connect to areal problem 3. Instruction/Delivery + Go a domonstationMlecure/simulaion/hands-on activity + Show stop-by-stop solutions to sample probleme «Gis applications of the theory + Connect to areas problem f apptcable 4, Practice + Dieeuss workad.out examples + Provide easy-medium-hard questions + Give time for hands-on unguided classroom work and discovery + Use formative assessment to give feedback 5. Enrichment + Provide additional examples and applications + Introduce extensions or generalisations of concepts + Engage in reflection questions + Encourage analysis hough higher order thinking prompts 6. Evaluation *+ Supply diverse question bank for wrtten work and exercises + Provide alternative formats for student work: writen homework, journal, portfolio, groupvindlvidal projects, studont-directed resoarch projectOn DepEd Functional Skills and CHED College Readiness Standards ‘As Higher Education Institutions HEI) welcome the graduates of On the other hand, the Commission declared the College the Senior High School program, itis of paramount importance to _-Readtness Standards thot consist ofthe combination of knowledge, align Functional Skils set by DepEd with the Colloge Readiness skils, and reflactve thinking necossary to panticipate and succeed Standards stated by CHED. without remediation -in entrysevel undergraduate courses in The DepEd articulated « set of 21% century sills that should be college ‘embedded in the SHS curriculum across various subjects and tracks. The alignment of bath standards, shown below is also presented in These skill are desired outcomes that Kto 12 graduates chould this Teaching Guide - prepares Senior High School graduates to the ppossoss in order to procoad to either Highor education, revised college curriculum which wl intially be implemented by AY employment, entrepreneurship, or middle-level skis development. 2018-2019. College Readiness Standards Foundational Skills DepEd Functional Skill Produce all forms oftexts (writen, oa, vu. digital sed on Soli gouring on Pippin wsperene ance ‘An understanding ofthe sof community, and natin Via an nfrmation racks, mealies, ee heking Application of ertical and creative thinkng and doing processes sndprotlemsching sil ctv fit andsal-ceacon {Competency in formulating idee/arguments logical, cinta and crating Clear apprecintion of one's esponsibity 9 a maleMOTIVATION (10 MINS) case Study Present these three cases using pictures: #960 Apicture of a color blindness test chart A picture of a family with male members picture or description of a woman Ask the learners ifthey could see a figure in Whe are bale breastfeeding a boby the picture and ask the class to recite aloud Ask the lanes if baldness occurs more in| Ask the leamers who among the men and. the flgure/ number. men or women. women are able to lactate or brezstfeed their Use a igh resolution figure (photograph or image projected on computor or LCD) to ensure the accuracy ofthe color blindnosstost Those that could see the figure are normal; those that cannot are colorblind. In most cases, the colorblind males outnumber the coloialind females, which are rare, I there are ne colorblind individuals in the class, the teacher will just have to mention as 2 ‘mater of fact that colorblind femalas are rare young, Be careful n conducting ths test to discourage teasing of actual colorblind learners. Emphaszo that colorblind individual are normal except that they could not cistinguish between red and green colors Misconception: Common misconception is that baldnoss occurs only in males, Emphasize that baldness does happen in women although the frequency is much lower ands therefore rae.INSTRUCTION (25 MINS) Sextinked traits Give the definition of an Xinked trait Explain why X-linked traits may accur mote frequently in one sex over the other In humans, males and females are represented by differant sex chromosomes Females have two X chromosomes in the nucleus of their cel, Males have one X chromosome and one drromosame in the nucleus oftheir cll Depending on whether the tit ie dominant or recessive, the ‘expression pattern of the trait differs in males and females Colerblineiness in humans as an example of sexcinked tat The alleles responsible for colorolindness is fourd on the X chromosome only The dominant alee is the normal allele; the recessive allale causes colorblindness Females nead two copies ofthe necessve allele, one fom ‘sech of the two X chromosomes, for the trait to be manifested. Il they only have one copy of the recessive allele, they have normal color vision. However, they are carriers forthe waitin that they may passiton to their offspring, Males only need one recessive allele in their sole X chromosome for the Wait to be expressed, Explain what happens to the expression patterns ifthe trait is Xelinked and dominant Use Table 2 as guide. Give the definition of a Yinked trait Explain why there i differance in expression between males and females for inked traits. Since the allele is found only inthe ¥ chromosome, and since only males have ¥- chromosomes, then only males will express the tat. Females CANNOT express Vlinkod traits) Hypervichotie pinnae aure 28 an example of a linked trait a male hos the alice responsible forthe wait, then his ¥ chromosome will possess that allele. Since he will pass on his ‘Y chromorome to his cone, then all his sons wil inherit the trait, and they, in tum, ean pass on the alls to their sone 3. Describe ether sex-related waite Sexcinfluenced trait Give the definition ‘+ Explain why trats maybe oxprossed differently borwoen 1+ Hormonal or physiclogies|lfferences between the sexes couse diferences of expression of certain genes ‘+ Baldness in humans as an example of a sexsnfuenced trait, See Table 1 how baldness s hypothesized to be oxprestad by a single par of alleles, with B ae the dominant allele forbaldness and b as the recessive oral allt Soximited trait ‘© Gite the definition ‘+ Explain why trats maybe limited to one sex only ‘+ Hermanal or physiological diferences between sexes ‘ay limit the expression of some ganas to one biological sexonly ‘+ Functional mammary glands as an example of a sex limted vait. Only females can express functional ‘mammary glands that produce mik immadiately aftor giving bith 1+ Note that baldness behaves ike a dominant tr in ‘males in that only one dominant allele is needed for bbaidhess to be expressed. On the other hand, the trait behaves ike a recessive tr in women in that they need booth dominant alleles to be present for baldness to be oxprested,PRACTICE (20 MINS) 1. Divide leamars into groups of four 2. Askeach group t0 answer a set of questions related to sex-related traits in humans. See sample questions ENRICHMENT ‘Asa homework, provide this narrative to tho class: ‘The last Emperor of Russia, Nicolas I, was mame to Empress Alexandra, and they had! five children, Glga, Tatiana, Mana, Anastasia, and Alexis, Alanis was the only one vino was aficted with hemophilia or the royal bleeding disease: all other members were normal ‘+ Research on this medical condition and determine the mode of inheritance, + fonly Princo Alexis was aficted with the disease, determine his gonotype, + What could be the genotypes of the Emperor and Empress? ‘+ Is it possible that exch daughter could have been 2 carrier? ‘Teacher tip: Hemophilia ean inked recessive tet Empress ‘Alston wes mostly eater of the walt XXL She nasa descendant of Queen Veter of he United Regd, wfc here ea probable case ‘The Emperor wat completly unaffected and herwore hac an XY genotype Based onthe _germtypes ofthe parents, Aleisha an XC ‘enotypa, wt the detective X chromosome cag {he ala forhamophis coming rom Na mothe Each daughte, nti, had» 50% proba of being a etre butthey could NEVER have boon sinceGeneral Biology 2 Eo Lesson 3: Modification to Mendel’s Classic Ratios LESSON OUTLINE Content Standard Introduction Communicating Learning Objectives and 5 ‘The leamers understand Non- Mendelian Modes of Inheritance Relevant Vocabulary Performance Standard ‘Motivation — Navrative 5 The learners shall be able to i a i Tnstruction Recall in Mendelian Ratios, Discussion 40 make a research paper/cate study/poster on a non-Mendetlan genetic trait fon Co-Daminance and Multiple Alleles Learning Competency : ‘The leamers shall be able to descibe some modifications to Mendel’ classic Practice Group Work: Non-Mendalian Traits in 40 ratios (gene interactions) (STEM_BIO11/12-Ila-b-3) - Humans, Plants, and Animals Specific Learning Outcomes ‘Materials [tthe and of the lesson, the learners will be able to: Pen and Peper + distinguish Mendian fram non-Mencilian modes of nhertance; and Resourees (i) Hug, WS, Curmings MLR, Spancr, CA. and Paling, MA. 2012. sents of Genet. 8° od. Bananin Cunmings (2) Roce, JB, Urry LA, Cain ML, Wasserman, SA, Minor, PY, and acto, 8.2012. Carpal Biology, 9" a. The Barjamin “Curmngs Pblshing Co. = @) Sharan, 197 Irerctrs gue for Biology, "ad By Camobel, Rose, Mitchel, Addean Weley Langman ne. + describe some cases of non-Mendelian genetic traitsINTRODUCTION (5 MINS) Communicating Learning Objectives 1 Cite the major learning objectives, which are as follows: |. distinguish Mendelian from non-Mendelian modes of inheritance 11, dascibe some cases of nor-Mendolian genetic traits Relevant Vocabulary 2. Present the folloing relovare vocabulary: |. Co-dominance - When two contrasting alleles are present in the same locus or trait (heterozygote genotype), then the phenotype expressed isa “blend” of the two extreme phenotypes. The two genes interact andthe offspring shows the affects of both alleles. Incomplete dominance - Whan two contrasting alleles are present in the same locus or wait heterozygote genotype. then both aleles are expressed in the same phenotype Multiple alleles - When there are more than two types of alleles fora given locus or tat, this wll esut in move than ‘wo kinds of phenotypes that may be expressed for that ait MOTIVATION (5 MINS) Narrative 1. Provide this narative to the class: 2, Alocal hospital has sent word to a family ofa possible mix up of ome of the children with ether familias when they were bor. ‘Teule out any possible mix up, the hospital obtained the blood ‘types of every individual in the family, induding the surviving maternal grondfether and paternal grandmother. The results ware at follows: Father: Type O Mother: Type A 1 child: Type O 24 child: Type A 3% child: Type B Maternal grandfather: Type AB Paternal grancimother: Type B 3. Based on the resuits, is there 9 possibilty that any one of the cildron isnot a bielegieal offering of the couple? To answer thie question, we must first undarstand how blood types, 2 non Mendelian traits inherited.INSTRUCTION (40 MINS) Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple Alleles 1. Let the leomer recall the Mendelian Ratios in STEM_BIO11/12-Ila-b-1 2, Discuss incomplete dominance. Define the tat. The heterozygote genotype is oxprossod asa dictint phenotype [a “blond” of tho two extzome phonotypes). In this casa, the phenotypic ratio is the same a5 the genotypic ratio |. Use snapdragon plants (Antirhinum majus) as exemple (see gure 1), A. RR-red flowers B. Rr—pinkflowors Crea white flowers 3. Discuss co-dominange, Define the trait. The heterozygote genotype is expressed as a distinct phenotype (hoth extreme phenotypes ane expressed atthe seme time). Sinlarto incomplete dominance, the phenotypic rato is the same as the genotypic ratio |._Use human MIN blood typing 2s an example A. MM ~ typo M B._MN~type MIN c.NN- ype N 4, Discuss multiple alleles. Define the trait. There are more than two types of alleles, and the relationship of each allele with aspect to others will determine the number of phenotypes that may be expressed. |. Use coat color in rabbits as example [see figure 2) A. Thete are four different types of alleles in rabbits: C [Agoutd, C*> (Chinchilla), C® (Himalayan), and ¢ (line), with the following dominance hierarehy: C> C>C'> € 8. The following genotypes wil have the corresponding phenotypes in coat color: i CC=Agous i. CO agouti fi. CON Agoutt . Co~ Agout vy CC Chinchilla ‘Teacher Tip: Reva the Mendelian ratios and enaire that the ‘etna ae fair with chem before thay coud roced with th econ. Emphasize tat incomplete daminanceand e: ‘omnancearesimler nthe her phe rotyple ratios flow ther genotype ratios However thoy frie the exprasion a the hearexyge ‘Src fn ceorinanc, te Peteaeygete ‘sprees both wxrar phenotypes in ‘ncompleteemnarce, he heteraygote is ‘epteied a0 “bled” of the wo oxen shurotyper°C Chinehila (0%e~ Chinchilla C= Himalayan Ce- Himalayan Ce~ Albino C. Use ABO blood typing in humans as example “There are three cltferent types of alales A for), B (or ") and O ori) ‘The fellowing genotypes will have the following blood types phenotypes}: Adtor MY) Type A AO (or) Type 2B (or Fi) Type 8 80 (or 9 Type 8 Aa (P) ~Type AB 200i) ype 5. Go back tothe Motivation narrative |The class will now answer the question/narrative provided dlving the Motivation pat. The teacher will osk frst the most probable genotypes ofall the members ofthe family as follows: Father: ype 0 - 00 Mother: Type A- AO. 1 child: Type © -00 24 child: ype AAO. 3° child: Type B 87 Maternal grandfather: Type AB-AB Paternal grandmother: Type 8 - 20 Possible mix-up? Yes, 3° eild ‘Teacher Tip: Notethatin the A8O sym heal ie racassne to both A and allele hte the A and Moles me condominants fone nate ood types © and AB can only have OO and AB perenpes,respecthely ‘ha ther mast be AD in ode to hove spring tat either Aor O. ‘Tha patnal aan dmettot mu beBO Ib ard to have an llepring ater ui blood type. Tha dchld cou ve been the esto mi Upbeat the Bale isnt preset in ether rent Misconception Eimphase ta blcod ying coud only be use to ‘dude dspovebiolog cl parentage, not to provePRACTICE (40 MINS) Divide lamers into groupe of four 2. Askeach group to answer a set of questions related to non- Mendelian modes of inheritance. Sae sample questions 1. In cattle, coat color is inherited in @ co-dominant fashion. Homozygous 8B! produces black coat, homozygous B76 produces white coat, and the heterozygous B’B* produces. roan coat, Give the phenotypic ratio of the offspring of the following erovses: A BIB'xB'B’ —_|ANSWER all black) B. BB x B® ANSWER all roan) C. BIB BIB! [ANSWER 253% Black: SON Roan: 25% white) D, 818x818 [ANSWER $0% Blaci: $0% Roan) E, BIB BH [ANSWER 50% Roan: 50% White) 2. In abypethetical plant 9 seated leaf margined plant, when crossed with a smooth laaf margined plant, produces offspring with wavy leaf margin, A, Identily the mode of inhertance. (ANSWER: Incomplete dominance) B. Two serrated plants, when crossed, will gue what type of offspring? (ANSWER: Serrated plants: the traits hhomozygoue, therefore producing offspring with the same phenotype as the parents) CC. Twowavy plante will produce what possible kinds of offspring? Give their ratios? (ANSWER: 25% serrated: '50% wavy: 25% smooth this is hybrid erase, hich wil give 81:24 ratio] Inguines pigs, coat color governed by four alleles that constitute 2 mutipe alli series, C (black), c* (sepia), (c72am), and c albino) with the folowing deminance hierarchy: C>e'>e°>e. Determine the phenotypic ratios of the progeny from the following crosses: ‘A. Cex Ce? (ANSWER: 75% blac: 25% sepia; the genotypes and their probabilies of eceurtence are: 25% CC, 25% CoS, 25% Ce, and 25% cFe, ging a phenotypic ratio of 75% black ancl 25% sepia) B. Cex ee (ANSWER: SD% black: 50% sepia; the genotypes and their probabilies of eceurtence are 25% CeE, 25% Ce, 25% cc, 25% cfc, giving a phenotypic ratio of 50% black and 50% sepia) ‘A man who's blood type B is married to 9 woman who is. blood type A. None of the man's parents isblood type O. ‘This couple has 4 childron withthe following blood ypes: B, AB, AB and O. Give the genotypes of the parents (ANSWER: Man: 80; Woman: AO; Both parents must have an Oallele in order to produce and offspring with blood type O with genotype OO}Rr Rr Incomplete dominance in snapdragens, Antirhinum majus. The ‘03s involving homazygote red flowers (RR) and hemazygote white flowers ir) will yiokd ahotorozygote (R) that exprosses 2 diferent phenotype, which pink flowers. The cross between pink- lowered Individuals will produce offsorings where the genotypic ratio also becomes the phanatypie ratio (25% red. 50% pink: 25% white (kipeciey Cx Agouti Chinchilla Himalayan Albino Coat colar in rabbits. The traits controlled b multiple alleles with the folowing dominance hierarchy: C (Agout) > C* (Chinchilla) > © Wimalayan) > ¢ (Albina)General Biology 2 Eo Lesson 4: Molecular Structure of DNA, RNA, and Proteins Content Standard LESSON OUTLINE ‘The learners understend Structures and Functions of DNA, RNA endl protains Tntroduetion Communicating Learning Objectives Performance Standard arenas eh = The learners shall be able to ‘Motivation Group Work 5 + build models of DNA, RNA and proteins . Tnstruction Discussion on the Molecular Stuctures 30 Learning Competency of DNA, RNA, and Proteins The leamers shall explain ow the structures of DNA, RNA and proteins are sm : : ; reloted to their functions (STEM_BIOTW/2-Ila-b-4) Practice Building Models of DNA 5 Enrichment Conversion to mRNA Tanscnpts 3 Specific Learning Outcomes : pect Evaluation” Identilcation of Biomolocule 10 At the and ofthe lasson, the leamers will be able to: + describe the building blocks of DNA, RNA and proteins; ‘identify the structural and funesional diferences between DNA and RNA and + explain the diferent levels of protein structure Represented by Given Chain Swuctures Materials Recyclable material for model construction; freely downloadable molecular medaling software ‘Resources Biochemistry textbooks; SwisePDB Viewer sofware {free download}; Protein Data Bank (yw .pab.ora)INTRODUCTION (5 MINS) ‘Teacher Tip: Communicating Learning Objectives reir and enor di 1. The leaming outcomes wil be presented as follows: DNA shouldbe presente to elas |. docetibe building blocks of DNA, RNA and Proteins. I. identify the structural and functional diferancos botweon DNA and RNA. I. discuss the cifferent levels of protein structure (primary, secondary, terary and quatemary) | explain howe protein structural features may influence thei functions 2. Ask learners if they have heard of the term "genes". Ask them what "genes” have they inharited from their parents, Sample answers: genes for dimples, straight hair ete MOTIVATION (5 MINS) ‘Teacher Tip: vide the clas into groups ef learners. Allow each group to enumerate the mest important pected Answer: 1. Divide the class into groups ofl Allow each group to the mestimponant — EeweadAma functions of DNA and proteins tat they can recall from thei previous grade level. GA PecciSLsle beliaen in gneeain, 2, Consolidate these ansers on the board ‘gene roduc (tater) Prot uncial produce; executes of allot ‘unetiore INSTRUCTION (30 MINS) 1, The building blocks of any nucleic acid are the nucleotides. 2, A nucleotide is composed of a phosphate group (with negative charges), @ sugar pottion and an Nebase, 3, The sugar in DNA is deoxyribose while the sugarin RNA is ribose. Explain the diference through a visual aid 4. DNA and RNAare polynucleotides. N-bases ate elther purines or pyrimidines. Purine bases 4a1e Adenine (A) and Guanine (6). Pyrimiines are Cytosine (0), Thymine (Tin DNA only) and Uracil (U, found only in RNA Specific base painngs occur m DNA. A pairs wth 7, G pelts with C DNA is double sanded while RNA is single sanded with Utaa! instead of Thymine7. Main Functions: |. DNA: repository ef genetic information; sequence of bases encodes the blueprint for fe processes RNA. information in the form of base sequence is transformed (transcribed) into mRNA, {RNA and fRNA, DNA is the template copied into RNA by base pairing, G with C; A with u. Il Protein: functional products of genes; oxeautes cellar functions 8. The four structural levels of proteins are: 1 Primary- sequence of amino acids in the polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or & pleated sheet Structure 3 Tertiany- coiling of the polypeptide, combining helices and sheet forms; 4 ‘Quaternary’ the astociation of two or more polypeptides in space Summary of important Physical Properties BIOMOLECULE DNA RNA PROTEIN Physical Property Complementary Base Pairs Phosphodiester bonds Single stranded but some bases can be complementary: hence, some portions may be double stranded acl ‘Aino NTTarminus ‘Amino INTTerminus Peptide Bond (ne letter symbol for each amino acid Functional Relevance [Allows each strand tosenve asa template {or replication and transcription [Essential for polynucleotide chain elongation For stability Nivogenaus base found only in RNA. ‘Start ofthe polypeptide chain End of the polypeptide chain Links amino acids tagether Classes a.non-polar. aliphatic or aromatic b. polar uncharged polar, charged: acidic and basic ‘Teacher Tip: Hf eamputersancnteet fais ar avaiable ‘truce for these Komolecules ae ual ‘molecular structure fies (pat) Fom sre Prten Data Ean (me poo ongh Focus onthe inpertare pars the structure tat provide the nacessry ysl propetes of DNA, RNA and potas Dus tha importance of thas physical features ‘or the iretons of DNA, RNA and protein, Emphasize that the DNA is negative charges on ‘the ouside de othe phosphate groups. ther ‘tablang factors in gONA shouldbe mmerione, Note: Fer ech dain of sino ace the rates ofeach amino atl. ie th one lata Spel fr each arr ac Te the ltr cosh ‘reach amino acd may ako be providedPRACTICE (5 MINS) Given the following coding sequence for DNA, provide the soquonce of the complementary (tomplate) sequance. Coding sequence 5" ATGCATAGATTAGGATATCCCAGATAG 3 Ansner) Complementary sequence 3° TACGTATCTAATCCTATAGGGTCTATC 5 ‘Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or pieces of colored papers to epresent the complementary bases: G with C; A with T. The DNA, backbone (phosphate, suga should be included ENRICHMENT (5 MINS) 1. Convert the given coding sequence into an mRNA transcript: Complementary Non-coding/ Template sequence 3’ TACGTATCTAATCCTATAGGGTCTATC §° nsner) Coding sequence ~ mRNA transcript 5° AUGCAUAGAUUAGGAUAUCCCAGAUAG 3° 2, Translate the given mRNA transcript into @ polypeptide sequence: Coding sequence ~ mRNA transerist 5 AUGCAUAGAUUAG GAUAUCCCAGAUAG 3° (ansier) Polypeptide sequence N-MetHs-Arg-Leu Gly Ty-Pro Ara-C ‘Teacher Tip: Bosure to rote theantiptal eantaon he ‘acing ad non coding avaceoJDNA. Elo the lative postion he ard ere ‘Teacher Tip: ‘The mRNA anscipt as aos the sare seqience es the coding sequence DNA, but the ‘hymns areroploeed ts Ura Show the eines how to ead the codon able “aah the lenmers the sng lee codes fr the amino actie(ag ryplopian Tipe) W) ‘skh eames to spel ther names sing the famns id codes (eg NEVL Aon Glu la we.EVALUATION (10 MINS) {Ak learners to Wentify the type of biomolecule represantad by a given chain structure: 1. DNA 2. RNA 3. Protein Example Template sequence 3 TAC___TCT___ CCTATAGGGTCT 5" 5°___CAUAGAUUA___UAU___AGA3) Leamers may be asked to identify the imporant structural features in these chain structures (features aa lstod in tho instrction/ delivery table). A similar exorcise of generating non-coding sequances (DNA), transcripts (RNA) and translated polypeptides may bo done to test the learners Understanding ofthe topic. ‘Teacher Tip: Toheipleamars practice the gurerationof complemereary sequences, eviahoet wth paral completed sequences maybe WedGeneral Biology 2 Lesson 5: DNA Replication and Protein Synthesis Content Standard ‘The learners understand Central Dogma of Molecular Biology Performance Standard The learners shall be able to ‘identify requirements, enzymes. and products in DNA Replication, transciption, and protein synthesis Learning Competency The learners should be able to diagram the steps in DNA replication, transcription, and protein syrthoris (STEM_BIO11/12-Ila-b-5) Specific Learning Outcomes At the end ofthe lasson, the leamers will be able to: ‘+ describe the requirements, proteins and enzymes in DNA replication + transctiption and translation; and ‘© diagram the steps inreplication, transcription and translation, LESSON OUTLINE Introduction Communicating Learning Objectives and 5 Review Motivation Inquiry 5 Instruction Discussion on DNA Repiication or DNA 20 Synthesis Practice Matching Type Game 10 ‘Bealuation —Take-home Activity 5 Materials oper, coloured pent Resources (1) Reece, JB, Ung LA, Cain MLL, Wasserman, $A, Minor, PY, and action, 3.2012. Carpal Biology, 9" a. The Barjarin “Ginmings blaring CoINTRODUCTION (5 MINS) 1. The learning objectives wil be communicated as follows A. Describe the requirements, proteins and enzymes in DNA replication transcription and translation B. Diagram the stope in replication, transcription and translation, . Explain what happens to a gene sequence that undergoes transcription and eventual translation inte protein 2, As the learners to rocall the significance of Mitosis. (Mitosis ie an equational call division that produces daughter clls which are identical or clones ofthe original, mother cell This ensures that every cell ofthe body has the same genetic content, ie. chromosome number. To make this possible, cells have te duplicate their genetic ‘material which is primarily DNA. MOTIVATION (5 MINS) “Ask learners to magine how many cells atypical mature human contains. Tel them that they all came from just one fertilized egg cell. zygote goes through millions of generations of cel divisions to become just the one person that a learner is. Even until now, calls ia an individual ate sill dividing, Ack learners what examples of tissues in their body are undergoing col division. (sample answers: skin; blood cells) 2, Also, ask learners to recall that in the previous topics on genetics, the phenotype isthe outside, visible charactaristic of an organism. Any phenotype (eg, red flowed is detly determined by proteins or enzymes funetioning in 9 metabolic pathway. Proteins are made by "turning on” specific portions of DNA that are callad genes, Particular equences of DNA are tranectibed to become RNAs. These ate than used to produce proteint ina process ealled translation. ‘Teacher Tip: Toheipleamars practice the gurerationof complemereary sequences, eviahoet wth paral completed sequences maybe WedINSTRUCTION (65 MINS) ‘Teacher Tip: 1. DNA replication or DNA synthesis. NA stands separate and sere astemplatesforthe Toinpurerspctinthe erertons luction of new DNA molecules. beep sd cetera ee igen omar farce sequences yb we [A The following ate features of replication: i. Semiconservative- the resulting DNA consists of ono old and one now stand ik Base pang is maintained; Adenine pars with Thymine, Guanine pas with Cytosine ii. New DNA molecules are produced inthe §'to "direction iv, Semidiscontinuous. The leading strond is synthesized in 9 continuous mamer (to 3) ‘wile the lagging strand is produced discontinuously in shor strotchos called Okazaki fragmonts 8B. In lagging strand synthesis, there is need fora primer terminus which is provided by an RNAmolecule. RNA is synthesized by a primase or BNA polymerase. The 30H ofthe RNAs where new DNA nucleotides are acked thus new DNA is bul in the 5'to 3 direction CC. Enaymes in replication are a follows: helicase; 2. gyrase; 3. SSB single strand binding protein; 4 primase oF RNA polymerae: 4. DNA polymerase and 5. DNA ligaseTranscription or RNA synthesis. DNA is unwound and one sand is used as template forthe Teacher ip: production of an RNA molecule. An RNA polymerase makes RNA in the 5203" dection. _Tohalpleaers practice the gerarationof Specific regions in the DNA called promoters allow the binding of ranscption factors which Teme sequences, crishost wih take possible the binding of RNA polymerase, Three majortypes of RNA are: messenger RTA completed svences ray be wed RNA (mRNA); transfer RNA (RNA) and ribosomal RNA RNA} ‘Translation or protein synthesis. This occurs in the ribosome, Basic ingredients are the various types of RNAS produced in ranserition and come proteins or enzymes. The mRNA contains triplets of bases called codons that specily an amine acid, eg. UUU-phe, Various {RNAs cerry amino acids from the cytoplasm to the actual ste of translation inthe ribosome, A {RNA has an anticacion that pair vith @ cadon in the mRNA. Different RNAs combine wth ribosomal proteins to make up the subunits of @ rboseme. A functional ibosonne has a small and a lorge subunit. Inbactera, transcription and translation may be simultaneous. In eukaryotic cells, mRNA, {RNA and RNA vavel fom the nucleus to the eytoplasm through the nuclear pores. RNAS ‘may undergo processing. Some unnecessary pats lke introns are removed. In eukaryotic mRNA, a5’ cop and 9 3' poly Atal aeadded, Coding regions of mRNA ar called exons, They specify functional protein productsbn the elongation process of translation, 2 Created ee Creckenec te ccon open cae een wwe wate sam erik N nibosome subunit. The serra etm nae dA \ process is summarized in the diagram above. To initiate transition, the small and the big subunits of the ribosome have 10 be separated. Initiation factors (IF) make this possible. They also prevent the premature reassociation of these subunits, The small subunit of the ribosome binds the mRNA and allows the entrance of a tRNA to the site bearing the frst amino acid, The big subunit then binds and together they orm an assembly ready forthe next amino acid in the A se of the ribosome ‘A stop codon signals the ‘end of translation. No amino acid correspond toa stop codon, Release ‘actors halt the process and! the polypeptide released, ORT Oo “The genetic code is the correspondence of the mRNA codons to amino acids. An amino adds specified by a codon with three code laters. The genetic code is shown as above.“The genetic code isthe correspondence of the mRNA codons to amino acids. An amino acid ie Teacher Tip: specified by a codon with three code letters, The genetic code is shown as follows: meets : : — 1 y joey ™ volo |e am we ff = er is - see Zi Cl oun cGa (A A s ap i & arf 4 ae} a= = aie AUG Met Mohan 18 Ze mn te ® =. SJ cun p oan | s eyo fs PRACTICE (5 MINS) 1. Matching Type Game: For each protein or enzyme or structure mentioned above, identity whether such is involved in rppheation,transeription or translation 2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA polymerase. EVALUATION (5 MINS) 1. Asan assignmant, ak the learners te make their own diagram of the stepe involved in DNA replication, transcription and translation or protein symthesis. (Note: Thelearners may choose 3 ‘vat of medium for presenting thesteps ofthe processes) Uaetlat crde Organi lamers into groupe and sk thet compote Point out the effect of the loss ofthe following: ENZYME EFFECT OF LOSS. DNA Polymerase | Ne repieston Helicases Decressed DNA replestion ‘etteiency Pepi No peptide bond formation sransierase ANA Polymorae0 No regeaion No transerstion Ficesomes No transiasonGeneral Biology 2 Lesson 6: Genetic Engineering Content Standard The leamers outline the steps in Recombinant DNA, Performance Standard The learners shall be able to + explain how genes may be modified and/or inserted in host cells! organisms, ‘Learning Competency The leamers should be able to outline the steps inyelvad in genetic engineering (STEM BION 1/124 a-b-6) Specific Learning Outcomes ‘At the end of the lassen, the learners wil be able to: + compare classical breading with madern genet engineering techniques, + enumerate the staps in molecular daning; ‘describe some methods to introduce DNA into cells: and ‘+ onplain the solaction and scresning of transformants / gonstically modified ‘organisms (GMOs) LESSON OUTLINE Intreduetion Communicating Learning Objectives and S Review Motivation Dec rable Trats 5 Instruction 35 ‘Practice Recitation 5 Enrichment Poster Making 5 Evaluation Assignment 5 ‘Materials Rooyclablematrilefer paper model of plume sito ape pane of| vaio colo Resources Biocheristy textbooks; online videos on genetic engineering and GMOsINTRODUCTION (5 MINS) Communicating Learning Objectives and Review ‘Teacher Tip: 1. The learning outcomes wil be presented and the overall ides on how organisms may be Make equ en of the revs lesonon modified wil be discussed, DNA replation and protein sythass 2. In order to survive, man has successfully domesticated solocted plants and animals. He has taken an active partin choosing desired traits of plants and animals. rats that were considered valuable (ie. high fruit yield; high milk production, etc) were sought out and propagated. The processes involved may inclide classical breeding practices such 9 Controlled pollination of plants, and the mating of animals with desitod traits. In today's ‘modern science, molecular biology techniques ara being employed inthe insortion and ‘expression of proteins indifferent organisms for various purposes. MOTIVATION (5 MINS) Pe eeai Group the ord’ and ab exch for Volunteers to enumerate plants and animals that have desirable or enhanced rats, pth anna eta ead lw 1. Ask foro plants and animals that have desirable or enhanced ‘group to dacs xaples of "eranced” animal! 2. sk learners to explain how each ofthe tats was introdiced or developed (i.e, classical brs brooding or recombinant DNA technology! ENHANCED TRAIT MODIFYING TECHNIQUE Kobo / Wagyu Beef [Beef with good fat | Classical broedng distribution) ‘Guapple (Large sized guove} Classical breeding Human hnsulin-producing bacteria Recombinant DNA Technology FlayrSavr (Delayed ripening tomatoes) Recombinant ONA Technology Macapune trait in coconuts Classical breedingINSTRUCTION (60 MINS) reaches Genetic Engineering Feures of common domesticated plrtsand 1 Classical breeding practices focus on the mating of organiams with desirable qualities, Seclirer ne see ina 2. Gonetic engineering involves the use of molecular techniques to modify the ais ofa target High cost of mediinw and ether avr cexganism. The modification of waits may involve: rok maybe menone. |. introduction of new tits into an organism enhancement of a present trait by increasing the expression ofthe desired gene I enhancement of a present trait by disrupting the inhibition of the desired genes! expression, 3. A general outline of recombinant DNA may be given as follows: |. cutting or cleavage of DNA by restriction enzymes (Es) selection of an appropriate vector vahicle which would propagate the recombinant DNA (9, circular plasmid in bacteria wth a foreign gene of interest) I, ligation (join together of the gone of interest (og, from animal] with the vactor (cut bacterial plasmid) IN, transfer of the recombinant plasmid into a host cell that would carry out replication to male huge copies of the recombined plasmic) V. selection process to screen which cals actually contain the gene of interest VI, sequencing of the gene to find out the primary structure ofthe protein 4, After outlining the key staps in recombinant DNA, the teacher can proceed to describe the \waye in which these plasmids may be introduced into host organisms. Biolisics, In this technique, a “gene gun” is used to fre DNA-coated pellets on plant tissues, Cells that survive the bombardment, and are able to take up the expression plasmid coated pellets and acquire the ablity to express the dasigned protein. Plasmid insertion by Heat Shack Treatment. Heat Shock Treatment is @ process used to transfer plasmid DNA into bacteria, The target cells are pre-treated before the procedure to Increase the pote sizes of their plasma membranes. This pretreatment (usually with CaC'2)is said to make the cells “competent” for accepting the plasmid DNA. After the cells are made mecompetent, they are incubated with the desired plarmid at about 4°C for about 30min. The plasmids concentrate near the cells during this time. Afterwatds, a “Heat Shock” i done on the plasmic-cell solution by incubating it a 42°C for 1 minute then back to 4°C for 2 minutes. ‘The rapid ise and drop of temperature beleved to incrasse and decrease the pore sizes in the membrane. The plasmid DNA near the membrane surface are taken into the cells by this process. The cells that took up the plasmids acquire new traits and are said to be: "wanefermed’ lectroperation. This technique follows a similar methodology as Heat Shock Treatmant, but, the expansion of the membrane pores ie done through an elaetric “shack”. This methed is commonly used fer insertion of genes into mammalian cell. Some methods to screen recombinant call ae 23 fellowes Selection of plasmid DNA containing coll: {A selection marker wthin the inserted plasmid DNA sequence allows the selection of “transformants”. Usualy,an antibiotic resistance gene (e.g. AMP ampicilin resistance gene) is Inchided inthe plasmid DNA. This allows only “wansformed” cells to survive in the presence (of the antibiotic (0.9. ampiciln). Plating the plasmid-oll solution on antibotic-containing ‘modia will elect for theso "ansformants" and only allow plasmid-containing calls to grow and propagate into colonies. Selection of transformed calls with the dosired gene asc Certain inserted genes within the placmide provide visible proof af thelr presence. Thess Rows gel eecrophores AGE alows the include the antibioticresstance genes that allow forthe selection ofthe transformed calle dertfeston of PCR produc and estmation of Litho the solution. Someinserted genes alo produce colored (e.g. chemmogenic proteins) er Tel sz Tiss done by runingermlecuar woninlece bere hae Aowtcem podaca og, GFP outlet cobnivcals wah need gee TR a serge sn. Irina 2th, yb, i oo epmenmuemern: See ee Ge Besactosdese Inc fat generates (blue) colored prod! nthe presence of Eo substrate. opropyB--1 togelectopyancide, or IFT), els reno wih these “empty” plas vl un Hue in th presoncoollPTG, hearin ofa gone mth ening ta dlerups thu saquence ofa glactoldse gna ad proven tha gonerton of tha eolomdproduct in the presonce of the substrate. Celle transformed with the disrupted B-galactosidace gene will remain “white” in the presence of IPTG. This “blue-white screening” protocol s thus able to screen for calls that were transformed vith the desired gene in the doning site PCR detection of plasmid DNA ‘Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed, Using PCR amplification. PCR reactions specific for the desired gene may be done using DNA from cells, Amplification of the expected product would confirm the presence of the gene Within the samples. PCR reactions speci for plasmid soquencos wil ako contirmd/identily the type of plasmid used forthe wansformation. Genetically Modified Organisms (GMOs) With the ability to insert gone sequences, comes tho possibilty of providing new traits for these target organisms. This has allowed the development of GMOs. Some of there genetic ‘modifications promise higher product yield for their targets. Thess include the Flavr-Savr Tomato and Bt-Comn, ‘The FlawnSave ("Flavor Savor") tomato was the fist genetically modified organism that was licensed for human consumption. The trait modified inthis tomato ist ripening process. A {gene for an enzyme that causes the degradation of pectin inthe cell walls Ge polygalacturonase) normaly softens the fruit asi ripens. In Flav Savr tomatoes, an inhibitor (Gc. antisonse RNA] disrupts tho expression of this gona, theroby dolaying tho softening of the fruit and extending the time it may be kept in storage and transported to markets Be-Corn was developed to incorporate the production of a toxin ie. Bt-endotoxin) from Bacills thuringensisin corn plant. Ths toxin results inthe death of pests that feed on these plants lke the com bever larvae, The toxin has baen show to be salective for Lepidoptera larvae and is non-texic to humans, mammals, fsh and birds. The selective toxicity of the toxia allows ts use in fooderopa, The introduction of the toxin isbelieved to increase erop production due to decreased losses from pest infestation. The same technology hos been applied in the Philippines forthe development of Bt Eggplant. a ‘Teacher Tip: Netethataniense RNA svands bind to mRNA This prevents thor expresioninto pres Note: Which ofthe techniques scussedcan be used ‘deiner GMOs were weed ina ceainfo0d prodier! rower: Aesring thatthe DNA itl intact nthe ‘mp testing fo specie marker ganas ‘eitestion plasms canbe sed detect he presence of tesa engineered plasms.Detpite the proposed benetite of GMOs, some people have raised their concerns regarding the consumption of these modified foods. While most of the products are tested for safety, concerns are raised for the possiblity of not being able to detect hazards that are present, but fare currently undstecteble by today’s curent technology Because of these istues, manufacturers are urged to provide labels that notify consumers of GMO presence in their products. While GMOs are believed to be safe when licensed by the food regulatory agencies, itis believed that the consumers must be provided with enough Information to make their own choices regarding their use. PRACTICE (5 MINS) ; ‘Teacher Tip: Recitation Bioinies may be more stable or plats dun to 1. Adkthe learners to diferentiate the various technologies for delivering genes into cells ‘heithch ell wal 2. Determine which tachnolagies are most appropriate for which cell yes. (Answers: Bilistcs for plants; Electroporation for mammalian cells; Heat shock for bacterial ells) ENRICHMENT (5 MINS) is ‘Teacher Tip: Poster Making 1. Learners may be asked to make a poster on the steps and other methods involved in Te may ako be han a an salve recombinant DNA, EVALUATION (5 MINS) Assignment 1. Give an assignment and allow leamers to research on the pros and cons of genetic engnesting. 2, Ask them for their opinion on the matter, and ask them to support these opinions with facts leamed in class. Be sure that issues of biosafaty are included in the discussion,General Biology 2 Lesson 7: Discuss the Applications of Recombinant DNA Content Standard ‘The laamars demonstrate an understanding of recombinant DNA and examples of products from Recombinant DNA Technology. Performance Standards The leamers shall be able to: © describe some techniques forthe expression of desired traits in target ‘oeganisms; and + search online databases for specific tats and source organisms Learning Competency The leamers should be able to discuss the applications of Recombinant DNA, Technology (STEM_BIO11/124Il ab-7) Specific Learning Outcomes: At the end ofthe lesson, the leamers will be able to: + give examples of products from recombinant DNA technology: + illustrate the use of databases to search genes for desited traits describe steps in PCR to amplify and datect a gane of interes; + identify the parts of an expression vector, ‘+ oxplainhow genos may be cloned and oxprossad LESSON OUTLINE Introduetion Communicating Learning Objectives 5 Motivation Thought Expan ment 5 Instruction Presentation of Recombinant ONA. 35 Practice Steps in PCR and Gene Cloning 5 Enrichment User of PCR and GMOs 5 Bvaluation Sample Exercise s ‘Materials Wrting materials, recyclable materials for models of plasmids, tape, pone: Rerources (1) Genbank, wrainebinim.nih.gov (2) Protein Data Bark, wearpdb.orgINTRODUCTION (5 MINS) Comuntetig Learning Objectives ‘The leaming objectives will be presented and the processes inthe Central Dogma of Molacular Biology will be reviewed! DNA (gene) = RNA (transcript) => Protein (trait) 2. Different organisms have different traits based on their genes (DNA sequences} For example, frags have antimicrobial peptides an their akin, Some jellyfish have proteins that allow them to glow inthe dark. Mutations in hemoglobin genes lead to anemia, 3. Based on the central dogma, if ranseription and translation of genes lead to some traits, then the incenion of certain genes in a given organism may provide itwith new waits. This ie the basis for the development of genetically modified organisms (GMOs). MOTIVATION (5 MINS) ‘Thought Experiment 1. The leamer may be given a group activity/ thought experiment for constructing a gonotically modified erganism/trait in a frut. "Designer Genes group work” |. AArtange the learners into groups of 3 or 4 |. Hove them identily 9 special trait e.g. large fru size) IIL, Have them idontily 2 source organism (o.g.jackftuit /langks) IV, Have them identily 2 target organism (.g. arails) V, Have them identify the modified / added tit e.g, langka-sized iis). VI. Have the laamars present their work to the rest of the class, and let the class dacide on the best proposal ‘Teacher Tip: Besure tosvessthatfor aunato add a uatto fn axgerom, the gue far the tit mat be ineated wit the target organ, are the Organism should have the necessary equipment” (ie. enzymes, materials ) to reduce the pron that vaults Ie the Yale oF ated phonctype. ‘Teacher Tip: ‘lsu the mis of the fle proposed “designer gores”bas2don the flowing care 1. Oviginalty ofthe sty (Hae anyon ‘Sone suse ofthe pe bor) 2. anu ofthe stucy How posses the proposed mosfieaon? Can the target, ‘igen support the proposed ra?) 3. PotentilAaplaions af the na epsom (What benafts would the recombirart ‘xgaiam provides soca?) Some exampies:Floodesitrt cn Delay pening tuteINSTRUCTION (35 MINS) Presentation of Recombinant DNA racer ‘helena cote see Tater the oerebe, the learners shoud now be aware that there are many diferent vas that cn Atta ara ona one ng be introduced to organisms to change their properties, The following table shows examples of database modified waite using doned gones and their applications: MANY: | antes in the GENE MODIFICATION RECIPIENT ‘APPLICATION. MODIFIED TRAIT ORGANISM (FIELD) database Ineulin Production insertion of Human! Bactoria (Medicine) Insulin Gene {production of Human FTopie has not {Topic is much Inaulia in Bactens {been studied extensively tudied Much Pest Resistance Incertion of Bttoxin {Com Maize Agriculture) [formation is gene Production of com Eligh chance plants with increased Eto discover oval waits / boxer CONS ! Low number { Dificultto research to { discover new fomato plant eure) Production of plants with fruits that have | dolayed ripening fruits, These fits will vive longer transpor time, {allowing thelr delivery to further locations (is. export deliveries) Disruption of a gene for a ripening enayme eg. polygalacturonaso) Delayed Ripening syed Ripening fenfy the Hinformation on the topicChymosin Production Ingertion of a gene fer | Bacterka chymosin Gndustry) Enhance large scale production of cchymosin, This enzyme serves asa substitute for rennet in the cosgulation of milk, Rennat has to be harvested from calves The lenge scale Production ofthis fengymein bacteria provides an abundant supply ofthis Important component for the cheese production industry. ‘Web based research: Search for these diferent traits and how they may be made useful. This involves the collection of gene sequences in accessible locations, such as databasos (e.g. Genbank (utew.nebi-rim.nbh.gov) ; Protsin Data Bank \wwewpdb org). These databases sore lke libraios that may be consulted when trying to find specific traits that belong te diferent organisms, For example, one would want to find out if any work has been done on spicersiks. The databases (e.g. Genbank:Nuclaotide database] may be searched for entios that contain information on "Spidors, and Sik” Result: 99615 enties. Tha results may be screened for more specific studies o.g. Malaysia, Spiders, and Sik- Rosult two entris)PCR Amplification Once 2 desired wait is chosen, information must be acquired for ether its detection or expression in 8 diven organism. 1. Detection “Teacher Tipe, Some rescarchors may ba interestodin determining ia gion ganoftraits available ina particular Manion hati ONA rp adonin ‘organism. If no previous research provides this information, researchers may test the DNA of vo, PCR actions do not use to many ‘oar enoynessch sss Giferenergenams forthe presence of these specfe genes Atechniue that alons the cetecton TPM eeynaaich aes a of specif eves in target organisms scaled PCR Saws ennsronde Thole ag ote sales mart Dpreide te alseprton ot FCRAvpINEKtan wan esi paid wat hula DNATpRESOSA Ha iN Sopot pola eeaona tho:mostable (heat resistant) DNA polymerase that builds single standad DNA strands unto Sermturation of he intr rane Hbond. Unwound DNA templates. PCR uses repeated cycle of incubation at diferent temperatures to promote the unwinding of the DNA template (~95°C); the annealing of @ primera ~20bp dligonuclectice sequence (recall RNA primers in DNA replication] onto the ssDNA template strand) (-54 -60°0; and the extension of the generated ssDNA strand through the binding of complementary bases to the tomplato strand (~72" C) The thermostability ofthe polymerase allows it to survive the repeated cycles of denaturation, annesling and extersion with itl loss of enzyme function, Each eyele of PCR doubles the amount ofthe taiget sequence. A typicel PCR experiment ses about 25 cycles of amplifiestion, This incrasses the onginal amount of the target sequence by 235 (\¢, -34 billion) times, {Gana dotaction by PCR involves the dosign of primers that would only bind to sequonces that are specific to target. For example, researchers would want to find outif gene X (e.g. the gene for insulin is available in a target organism jeg. a mouse, Mus musculus). Primers may be designed by looking atthe available sequences for gene X in the databases (2.g. all the genes for insulin in dliforent organisms; humans, pigs, cows, otc]. Tha different gone X sequances must be aligned compared to match areas of saquonce similarity onsorved sequences) and areas of sequence lssimlarty (nor-conserved sequences). Primers designed to have the same sequence as the conserved areas wil be specie for binding gene X sequences in all the taiget organiams. Prirs designed to have the same sequence as the non-conservad areas wll only be specific for the ‘organisms which match its sequence.Primers may be classified 2s forward or reverse primers. Forward primers are complementary and ‘Teacher Tipe bind to the reverse complementary (non-coding) sequence of the gene. Reverse primers are Lethe leamets recall the aipsalll eieeaton complementary and bind to the coding sequence of the gene ‘et the bound primers the tamplote BNA. zhe plementary ted id to Nee eeing seauiener, ofthe Temples eprsanted om lak tovahein he 2 3 evientatlon then to priware shoud bind rear the 3 er andthe primar woul be STEPSin PCR Amplification fapresniad 35 going at toigh Step 0: Undenatured Template ; Temp ~ 54°C; Template: doulsle stranded (ds) DNA strand. Complementary sequences are hald together by H-bonds 5’ AT GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 2" (Coding stn 3° T A CGCTACTCCTATACT GGGCTATCTATCTCCATAGATCTCTA 5" (Non-coding strand) Step 1: Template denturation ; Temp - 95°C: ‘Template: single stranded (s) DNA strands; ONA strands are separated: H-bonds between, complementary sequences ate broken 5’ AT GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 2" (Coding stn 3° T A CGCTACTCCTATACT GGGCTATCTATCTCCATAGATCTCTA 5" (Non-coding strand) Stop 2: Primor Anncaling ; Tomp ~ 54 *C {dependant on primer molting temperature); Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers and the target sequences, 5A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3" (Coding strand Direction of elongation — CCATAGATC (Reverse Primer) S'GCGATGAGG ¥ me Direction of elongation (Forward Primen) T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)Step 3: New DNA strand elongation ; Temp ~ 72°C; ‘The two new dsDNA strands are formed by the elongation ofthe generated ssDNA and the H-bonds. bbetwiaan the complamantary sequences on these naw strands and thair templates. Each of the new eDNA strands is made up of one old strand from the exgial template, and one new strand that was generated as.a reverse complement ofthe template. This i called somiconservatve replication of the sequence. Now Strand 4: 5'AT GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3" (Coding stand (old) 3 CGCTACTCCTATACTGGGCTATCTATCICCATAGATC-S (Reverse Primer) (new) Now Strand 2: 5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3' (Forward Primer) (new 3° A CGCTACTCCTATACT GGGCTATCTATCICCATAGATCTCTA 5" (Non-coding strand) (old) Stop 4: Ropoat stop 1 to 3 for N number of cycles (N is usually 35) PCR Results ‘The expacted product of PCR amplification wll depend on the sequences / postion at which the primer sequences bind, I the forward primer starts kincing at nucleotide 3 [coming from the Send) of 1 43op long gene, and the reverse primer binds at» position complementary to nucleotide 39 of the coding strand, then a 37bp product is expected per cycle of PCR, Now Strand 1: Nucleotide #3 Nucleotide #39 { Yippee Y AT GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3" (Coding strand) (ald) 3 CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC - 5' (Reverse Primer) now] ‘Teacher Tip sate hob he 2 ound of PER the ‘eu yrtheed DNA son can nubs ‘Sterpates Forth gvenexampl ner srond Spel agin gure 23 tae pong prot Repeated cb of PCR wil make is Fret the peonant ype of dale sanded Noe: Other you of ergaians fg, Yous, Namal Calls t=) may ao be “transformed {whic ite Th typ of DNA construe teed or retionof gones ino these orgasms vl vary eg Boor, Cosrids, et)Now Strand 2: Nucleotide #3 Nucleotide # 39 37 bp produet 5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3' (Forward Primer] new) 3°T A.C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5" (Non-coding strand! fol PCR Applications PCR may be used to detect the presence of a desited gene in an organism. Depending on the primer clesign, the expected product may represent only a specific region of the gene or the entire gene itself “The fist case is useful for detection ofthe gene, or the detection of organisms with that specific gene within a sample, The second ease is useful for the amplification of the emtte gene for eventual expression in other organiems. The direct amplifcatien/eepying of a full gone is par of the process fer “cloning” that gene. 2. Cloning and Expression Some genes provide economically, andindustnally important products (eg. insulin-coding genes; genes forcollagen degradation), In some cases, scientists would want to put these genes into ‘organisms for the expression oftheir products, One example would be the insertion of an insulin coding gene from the human genome into bacteria, Ths slows the “transformed” bacteria to now produce human inculin as a product Cenain types of bacteria are capable of this process since they are able to take genes within their cell ‘membranes for eventual expression. The genes are normally inthe form of aml citcular DNA, structures called plasmic. “The genet found in the inserted plasmid DNA sequence will be expressed a8 proteins that provide specific taits to the waneformed bacteria. The basie components of an expression plasmid are listed in the following table. The purpose of each of these is also provided. ‘Teacher Tip: ‘The mule cloning ste (MCS) may conexin sciences that may be i by erent reshction ‘naymes Sass how the use of to ration anaymes may coril he enentason ofthe inert gunn th plasms Nove: Forward and Reverse primate shoud not be complerontn.‘COMPONENT PURPOSE Promoter Muliple Cloning Site [Allows the controled expression of the desired gene in the presence ‘of an inducing agent (e.g. bete- galactosidase; heat treatment (~65" C) DNA sequence or pation forthe insertion ofthe desired gene, This seetion may contain sequences that will be eut by specific restriction andonucloases (cuts within the molocule) If both the amplified gone and the plasmid are cut with the same restriction enzyme, then complementary sequences will be generated foreach, allowing them to bind together or annesl. The desred gene s inserted into the multiple cloning site through this process, Reswietion ereymes cut ot speofie sequences, EcoRI Target Sequence: S'GAATIC 2 a CTTAAG t Digestion Reaction Undigested: Digested dsDNA: 8 GAATIC 2 S'GAATICY 3'CTTAAG 5’ S'CTTAAGS! t Ifthe desired cut sites are not found in the gene that needs to be Insorted; the soquonces can bo added by including the targot sequences in the primers used for PCR amplification‘COMPONENT Multiple Cloning Site Ineerted Gene Sequence ‘Antibiotic Resistance: Gene PURPOSE PCR Primers: 5° GCGATGAGG 3' (Forward Primer) 3° CCATAGATC 5' (Reverse Primer) Forward Primer + EcoRI target sequence: 5’ GAATTEGCGATGAGG 3 Reverse Primar + EcoRl target sequence: 3! CCATAGATCCTTAAG 5 Suceasell insertion of a gene allows the expression of ite protein product. This usually provides a specific trait to the "transformed! bactetia. For example, ifthe gene for Green Fluorescent Protein is placed within the expression plasmid, bacteria transformed with this plasmid will produco protein (GFP) that wil aliow tha bacterial colls/ colonies to gow green inthe dark Provides 2 way to screen a population of bacteria for those that took Lup the plasmid. For example, f an ampiciln resistance gene is encoded inthe plasmid, then only bacteria which took up the plasmid will be able to grow on mada with ampicilin, However, if the ampicillin resistance gene is eut and the gene i inserted here for cloning, then the cell will longer be resistant to ‘mpicilin, This isa way to select which among the colony of ells actually contain the inserted gene sequence. Bacterial cells whose ampiclin resistance gone have boon cut will dio in the presence (agar plate) of ampiclinPRACTICE (5 MINS) ‘Steps in PCR and Gene Cloning 1. Let learners give other hypothetically modified or genetically engineered plants and animals which cen be used for health, industry, agriculture and for the protection of the environment. ‘Ack learner to draw the parts of an expression vector. Using preces of paper, allow the learners to illustrate the steps in rastiction digestion and PCR ENRICHMENT (5 MINS) Uses of PCR and GMOs 1. Discuss how PCR may be used for the detection of disease causing pathogens ina population. For ‘example, it may be used to check fa patient has a dengue virus infection. This is done by using primers that aro spedific for complamentary DNA (DNA) sequences that corraspond to the dengue viuses. f PCR amplification occurs using cDNA from a pationt’s blood sample then the Patient likely has dengue viruses in hisher blood. 2. Discuss how the cloning and expression of certain genes allows for massive production of the sited product. For example, the cloning and expression of insulin in bacteria allows for the mass production ofthis necessary protein for use by diabetic pationts. Prior to insulin production in bbactera, insulin was harvested from other animals such as pigs ‘Teacher Tip: ‘Axspobt, lamar"aghnation coud be "etched, but caution theese that carain ‘thie pracbler sho! be followed and adered {onthe prostction of geneticaly media ‘igerisms Animal elias shouldbe taken coed ‘of ard huran cloning mist ever be conducted ‘Teacher Tip: Tryunng etter dase vexietion enemas: Ex shot, HlEVALUATION (5 MINS) Sample Exercise 1. Give learners» set of known Restetion Enayme (RE) cut sites: EcoRt amit 5° GAATTC 3 5’ GGATIC 3! 3° CTTAGG 5° 3 CTTAGG 5° DNA Sequence (69 bp long) 28 4” ‘ 4 5" ATGCATGGTACGTAGAGTTCCATGAATTESCCCCTATAGGGTAGCCGAGGATECTATGCCCGAATGTC 3) 3° TACGTACCATGCATCTCAAGGTACTIAAGCGGGGATATCCCATCGGCTECTAGGATACGGGCTTACAG 5° Expected Fragment sizes: With EcoR1 digestion :28 bp, 1 bp With BamHt digestion : 20 bp, 49 bp. With both EcoRt and BamH1: 20bp, 2p, and 21 bp3. Ask the learners to scan a double stranded DNA sequence to dotormine tho presance of theso cutsites. Allow them to provide the fragment sizes expected for using different combinations of the RE .on the given sequence. You may choose to gve the sequence as linear or circular DNA. Discuss how the fragment sizes wil vary ifthe target sequences in circular or lingar DNA, 4. A similar exercise may be done to locate areas where primer sequences can bind. The expected fragment sizes for PCR amplification using diferent primers can be tested Example Forward Primer 5'CATGGTACGTAG 3 Reverse Primer 3 GCTCTATACGGG 5 ‘Target Sequence: 4 Product Size: 62 -4 = 48bp «2 + 4 5" ATGCATGGTACGTAGAGTTCCATGATAGAGCCCCTATAGGGTAGCCGAGCGAGATATGCCOGAATGTC 3°3" TACGTACCATGCATCTCAAGGTACTATCTCGGGGATATCCCATCGGCTCGCTCTATACGGGCTTACAG 5° 6General Biology 2 Eo Lesson 8.1: History of Life on Earth pee The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY ONE pete SESE ere ese ime hissy sede ns Simi Atv 7 trotters oes ernerooe At the and ofthe lasson, the leamers will be able to: + identify the dates and sequence of the periods in the geologic time sesle; ‘+ identify the major events in each majo period, + describe the charactoristics of the major groups of organisms presont using a time period; + identify types of fossils; an describe causes of mass extinctionsINTRODUCTION (5 MINS) Communicate Learning Objectives Introduce the following objectives by esking volunteers to read them sloud 1. ean identity the dates and sequence of the geclogic time scale 2. can describe the characteristic featuras of major groups of organisms in each time poriod. MOTIVATION (10 MINS) Discussion: How Oldis the Earth? 1. Whatis the age of the Earth? ‘The leamers may give various answers from thousands to millions of years Some will give answers near to 46 billion years. Write all the answers on the beard and let them think of what tho ago of the Earths} 2, What was the Earth ike millon of years ago? ‘ak learners: "Have you seen the movies lee Age and The Land Before Time? How was the Earth presontod in movies such as these?” Basod from what you may havo road, describe the Earth milion of yoars ago. Tho following answers may ba given by learners: 1) covered with thick blanket of ice, (2) lots of volcanoes and high mountains, (3) large organisms roamed the land, (a) the atmosphere did not have high exygen content, (@)asteroics/ meteors frequently hit the surface, (5) the lands mover a lot arthe continents were a litle closer to each other, (6) Volaanic eruptions 7 a lite bit warmer, (6) plants were bigger, (9] humans were not yet around. Accapt all answars and ask them what are the possible conditions on the early Earth. Tho teacher may show a clip from any of the movies depicting ancient earth conditions} 3. When did’ man frst sppear on Earth? Learners may give answers such as millions to thousands years ago. Ask learners to choose the more probable dates and provide evidence for its accuracy They may enumerate the dliferent hominid spacies but ask them the approximate time when our species (modem humans) fst appeared. Tell them that humans dd not co-exist with dnosauss as what movies » Introduction ‘Where suds the Ea ago, wo at also uth ing the foal ecotd and mately be ‘hors action The Earth is oppronirataly 86 tilion years old nvary big ruber eenary ura cnt easy welate vith, expec the Spec time tame when we appeared. Comparing the Ears age to one calendar yar, events sch asthe exthezon of doses and ther detovery ofthe New Word by Colima would appear ‘lonely uch easier "Understaning the (Geol tne calvin in of ote ae fbce nthe wnversn™ ig dens (ey bewizanan the board of mana papa and poston the bow 2 The Earth #4 bilo yor ol 1 Ue onEawtharoue and 3 Sbilon years 292 + Over Earth's vasthetry, both orci and ‘entatrophe processes hove produced ‘comous changes Misconceptions: + Humantand irom exated onthe Eth at the sre te + Plas and animals on Earth have aaaye seed. + The Each 2 too bigto change. Teachers must comet the misconceptions errs ave abet he history of life cn Eachusually depict. Man could have frst appeared about 100 ~ 150 thousand yoars ago as shown by artefactual evidences in various sits. The human timeline is rather flenible and debatable- every time we know a specific date, a new discovery is announced and everything gets re- dated to fit the best estimates) 4, Distbute the 15 ~20 pictures to some volunteers. Ask each volurteer to post them along the length of the board based on what each thinks occured fret. 5. Let the other leamers check what have been posted. They can suggest a possible re arrangement ofthe pictures, {6 When everybody is satisfied with the lineup, tell them that they are going to watch a shor video. INSTRUCTION (20 MINS) Watch a there elo Geologie Time Scale thips://wmu.youtube.comwateh Four Ways to Understand the Earths Age.” (httpss//wnweyoutube.com/wateh' ‘FGsBspfreload=10 Tell everyone to listen anc watch attentively. Use the following questions to guide the leamers as they watch the video, What are the four ways mentionedin the flim? jofyRlec3Ve) Why isit hard to create a timeline of events chronicling Earths history? What are the divisions of the geologic time scale? Share in clas what you have learned from the video. ‘dk the learners to take a closer look at the timeline constructed on the boord, 6. Lot thom rearrange if ncostary) basod on what they learned from the video. lath ‘Teacher Tip: Ieehard for anne to understand guologie events tru the tne ave here ach vont ook pce ‘nllbe ear everthing a conneced in ayer {ie ame ent yor) les more rabvart 0 ‘Sehow ererying ural ina share ta soa" However tel them tha lot of tings on happen bnthespan ofa yout, ‘The teacher il pine 18-20 evr lreetaby nth icte, F necessary) tobe wed fr Ne (ian Refer othe Sample vert Let ‘ha pictures should be posta onthe Font board thot wll sve as year malin, Tl them hat {Heya nw the Ete haery nb rw ae, ‘Tatmake more teresing, tach te 12 month ithe yon Bak itensng suntony suc ‘Who would ke to have a biehdy ary wth ‘doesn? ‘ageing of Terms: ON lrget dion the geloicie {le sana hued horde of lion ‘Fyouc ago ye) + ERA dvison nan Ere thet fan ve pads Shite rained vise yore + Peindo: edison of gesagt Mary ae Shee ro move tan are hua ion ys + EPOCH the Snalees auton ofr gealege Aiseaechenctvn! by dae orem Tip: “The teacher ela ste eres to plot tr rida de by ide wih be goog erent Aste Inpbich nt ae wae you bon? Wa specie srenshoppened he dy you were orig the ‘log ane sa ‘Alternate Video: ‘ecto Tne See: Mr Eos, Eras, Paros anEpoca. tplmyoutab conus? ‘rralyaoveENRICHMENT (10 MINS) 1. Answer the following in your joumal |. The Earth has an incredibly long history. How does understanding of geologic time and the significant geologic events ofthe past impact your understanding of humans’ unique responsiblity and place on earth? |, How does understanding the past help us understand the present? I. Caleulate hew many ganerations of humans i would take for us to enist now [assume an average life span of 80 years) What must we humans do to ensure we are able to exist this long for many generations? 2. Forma dyad and discuss your answers EVALUATION (5 MINS) ‘Answer the Worksheet on Geologic Time Scale. Submit next meeting 2. My Life History: Create a timeline of events that happened to you since you wore born up to the present time. Choose only 20 events that you think are the most important. Be ready to present yourtimaline next meeting ASSIGNMENT: (5 MINS) ‘Make a table in your notebook of the geologic time seale (GTS) and include the felloving details; |. Major dvisions ofthe GTS |, Major events and characteristic organisms ‘Teacher Tip: Jouialing ie 8 good aebvigue te hab soma paste learners a pt denn tha thoughts rst ‘honshare whatever bey have writen wlth olunezers maybe tapped inadvance. ‘Tha best cup wl bs poste nthe oom, Alternate Activity: Tine Macline |." Look round your comming Make a nara ‘on how te place locked Hea seat yats 220 Sethe iil ae sevwral yor ayo fa year) fom nou Going Further: ine and space parity, the lluing actty canbe dore Und sanding Geologic Time (From: htps/wrejsqutexs eign les! Unde standing Geologie Timed 8 pe)General Biology 2 Lesson 8.2: History of Life on Earth Content Standard The leamers demonstrate understanding of the major events in the history of Ve on Earth. Performance Standards The leamers shall be able to + create & personal timeline and compare it withthe geologic time sca 1+ design a poster tracing evolutionary changes in @crop plant je.g., ce or com) that occurred through damestication Learning Competency The leamers describe general features of the history of life on Earth, including generally sccepted dates and sequence af the geologic time scale and chorocteistics STEM_BIO11/12:Ile-g8) Specific Learning Outcomes ‘At tho end of tho lassen, the learners wil bo able to: ‘identify the dates ard sequence of the periods in the geologe time scale; + identify the majoreventsin each major period, 1+ describe the characteristics of the major groups of organisms present during a time period, identify types of fossils; and describe causes of mass extinctions a LESSON OUTLINE - DAY TWO Tatroduetion Communiceting Learning Objectives S Motivation Discussion: How Old s the Earth? 5 Instruction Lecture of the Geologie Time Scale 20 ‘Enrichment The Antiropecene 20 ‘Baluation Gus 10 Materials ‘Veual sid on the goologle tre sale; 20 pnted pesos events! strucues/ organisms; computers and internet connection ‘All Resources listed atthe End of thie LessonINTRODUCTION (5 MINS) Communicating Learning Objectives ‘The lesson for today wil cover the folowing topics: 1, Major ovants in the Geologic Time Seale (GTS) 2. Cambrian Explosion MOTIVATION (5 MINS) Discussion: How Oldis the Earth? Discussion: How Old isthe Earth? As the following questions: 1. How oldie the Earth? 2. Whatie the biggest ime frame in the GTS? 3. Whatis the smallest time frame in the GTS? INSTRUCTION (20 MINS) Lecture of the Geologic Time Seale 1. Present a lecture discussion on the Geologie Time Scale 2, Tho following outine can guide the teacher in the discussion: |The Geological Timo Scalo (GTS) A. Four eras - Precambrian; Paleozoic, Mesozoic; Cenezoic B. Periods under the Paleozoic er Carboniferous, Permian C. Periods under the Mesozoic ora Tiiassc, Jurassic, Cretaceous D. Periods under the Cenozoic era - Tertiay and Quaternary Cambrian, Ordovician, Sian, Devorian, 1, Agein milions of years of each time period IL. Major events in the history of lite oa ‘Teacher Tip: ‘This eson prez oral th leson on GTS ‘Thalenmere wil understand batter the hightgh Faachtine bar nthe TS, ‘Teacher Tip: ‘Tha Geologie Tie Recon abut represent on ofthe major dvsons ofthe Earths Fistor, The time intrvaisare died ae ‘zeroed rom Helongast ta the shortest an ONS, ERAS. PERIODS ons EPOCHS. ich peed has an approsiatud tne fame a harsctrice by dntethn fenton events and ‘ongris.The Geologic time is divided into four large segments called Eons Hadean, Archean, Proterozoic and Phanerozoic. The Phanerozoic is divided into Eras: Paleozoic, Mesozoic, and Cenozoic. Extinction events and appearance of new life forms cherecterzed the divaions among Eres. Smaller divisions, called Periods, characterized by a single type of rock system, make up each Era Some Periods ar further divided into smaller time fame called Epochs. (From: hitp:/goo.g ITmory) “There isa mnemonics (memory device] to remember the Periods in exact orde (rom the earliest to the recent); jumps between periods and epochs Pregnant Pientiful Camels Ecrly Often ilng, sit Might Down Prevent Carefully, Portal Perhaps Rheumatisn! Their Joints Croal? ‘The teacher can also discuss CAMARIAN EXPLOSION. CAMBRIAN EXPLOSION is the belie that thore was 9 sudden apparent explosion of diversity in ile forms about 545 milion years go. The explosion created the complexity of mult-celled organisms in relatively short time frame of 5 to 10 million years. This explosion tise cteated most of the major extant animal groups today. “© Geologic Time Scale Permian / mae ‘Ordovician ‘Cambrian PRECAMBRIAN“The start of the Cambrian was characterized by the breaking up of supercontinent Gondwana into smaller land masses opening up new cerwironmental niches where organisms can colonize and specialize ENRICHMENT (20 MINS) ‘The Anthropocene 1. Present to the leamers 9 new proposed Epoch, the Anthropocene |. What are the evidences that suggest that we are entering/ have centered a new epoch? 0 2, This can be discussed ina small group ofS learners. How do scientists decide if new finding should be validated? EVALUATION (10 MINS) Gealogically speaking with reference to the entire history of the earth, the dinosaurs went extinct. ‘A. Shon aftor the formation of Earth BB. In the first ilion years of Earth history . In the most recent 2% of the history of Earth 1D. Before the fist fh formed Relative tothe percent oftime dominating the surface of Earth which organisms have the longest reign? Dinosaurs Plants Prokaryotes Eukaryotes Humans mooe> + The fellowing PowerPoint presontatins might ph oraanaing your ‘ecssen onthe eson fo goo aaa, fe goo g/L 2 Feigao ghykaser S fepiig00 31482270 Step goo aVCounss ‘Teacher Tip: ‘Aas the lamers toreseach fthew are evidences to suppor tat he “exploon”™ leas sudden and spontaneous as ts wet dese the fos recor ‘Thi # abo good ime to cece how new finnge can asc an extn body of knowledge Lette ser ead the flowing articles abeut a propo new epoch the ‘Arthropacene: 1 Haran rast has pushed Earth ino the Anspacene- tp “19000 ‘aggat 043716) 1 Wiha oshopacene and Are We init? pg. glimanv (0413/16) + Waleome to the Aretopocene hs iwmaamthropecar. ine 0413/16) 3. TheEarthis____years ol A. 6,000 46,000,000 . 4,600,000,000 D. Thetis no way toknow 4A, 100,000 years in the geolagichistory of Earth would be considered A. Immmensely ong [A drop in the bucket Hal of Earth's Hetory 8. c D. Anextremely signficant amount of time5, Understanding geologic time is significant because it helps us ‘A, Understand! humans impact on our environment Understand the evolution of organisms overtime Understand the possiblity for ie on other planets Understand the process of evolution 8. «. o. E, All of tho above ASSIGNMENT. What are fossils? How are they formed? List down the types of fosals and given examples, How do we measure the age of fossils? What are mass extinctions? How many mass extinctions events happened in the GTS? 6. Which organism frst dominated Eanh? A, Dinosaurs Insects Plants Fish Bacteria mone Answer Key: ‘Arewar wid dacuson mast began by the wach ‘Teacher Tip: Soo to htet everyone ht a dear understanding ofthe geologic ime scale ‘There's raed to remember llth aves asch pave,General Biology 2 Lesson 8.3: History of Life on Earth Content Standard “he leamers demonstrate understanding ofthe major events inthe history of LESSON OUTLINE - DAY THREE We on Eath ineroduetion ”Comimuniceting Lewning Objectwes ‘Performance Standards: 2 a ‘The leamers shal bo able to Motivation Questons on Dinosaurs 5 + crete perscaltinatne and compar itwith he gecoaic time scale 39d asucion typos of Fomia a + design a poster tracing evolutionary changes in a crop plant f.g, ice or com) that occurred through domestication Materials {Vs on the gel ake 20 pid pic. vei? tearing Competency ‘ocun/opat computers ad ere conection The leamers deserve geraal features ofthe hstry of fe on Earth, including "Resources generally accepted detes and sequence ofthe geologic time sale and {rfaarn igi Scoree 3 ed 208, Calo: Par haractenishes STEM. BIOT4/ 12g) Benjarn Cummings pp 5035. (2 Resce, J LAUny MLC, Weer, PY Mori, Reson Specific Learning Outcomes CampbeiBclogy ed. 201 nowt Paxuon Eaton ne pe At the end ofthe lesson, the learners wil beable to: foam, (3 Russa), SLWolg PEHoce Cun, BMC Milan. Bhiogy: be Dynamic Sean, 2008. Calf: Brock/Cole CENGAGE Leaning. pp. + identify tho major events in each major period, 98 jonal Resources listed at the End ofthis Lesson ‘+ identify the datos ard soquonce of the poriods in the goologéc time scale; ‘+ describe the charactaristic of the major groups of organisms present na during a time period, + identify types of fossils; and + describe causes of mast extinctions.INTRODUCTION (5 MINS) ‘The lesson for today vill evar the fellowing topte 1 2 3. The types of fois (ays fossils are formed and how fossils’ ages are determined ‘Mase extinctions- causes and frequency in the GTS MOTIVATION (5 MINS) 2. 3 4 Where did scientist discover the frst dinosaurs? Who coined the term dinosaurs? How id the discovery of dinosaurs make scientists become more interested in the geologic record? How can fossils be used as evidence for the evolution of living forms? INSTRUCTION (50 MINS) 1 ‘The teacher wil poston the board examples of fossils and let the learners identify the type. FOSSILS are evidencas of organisms that lived in the past. They can be actual remains like bones, teeth, shells, leaves, seeds, spores or traces of past activities such as animal burrows, nests and dinosaur footprints or even the ripples created on 2 prehistoric shore In exceptional preservation, fine details such 93 origina color and individual muscle fers are retained, features often visible in electron microscopes. Ths is referred to as the "Medusa offect." (From: http /awnw.bbc.co.ul/nature/fossil/Lagorstto} ‘Teacher Tip: Anataratve couldbe show ac rom th moe Justi Pak or Juric onl ‘he following sites prove infomation about Fest exp teachotacholalccom/acholstieneen/ maganraneconcavoaassteSW. PONEREONTFOSSLS 201 Dour aaded omnsng heap ancharcedlanring comisbjoesy/

You might also like

• The Subtle Art of Not Giving a F*ck: A Counterintuitive Approach to Living a Good Life

  

  From Everand

  The Subtle Art of Not Giving a F*ck: A Counterintuitive Approach to Living a Good Life

  Mark Manson

  Rating: 4 out of 5 stars

  4/5 (5794)
• The Gifts of Imperfection: Let Go of Who You Think You're Supposed to Be and Embrace Who You Are

  

  From Everand

  The Gifts of Imperfection: Let Go of Who You Think You're Supposed to Be and Embrace Who You Are

  Brené Brown

  Rating: 4 out of 5 stars

  4/5 (1090)
• Never Split the Difference: Negotiating As If Your Life Depended On It

  

  From Everand

  Never Split the Difference: Negotiating As If Your Life Depended On It

  Chris Voss

  Rating: 4.5 out of 5 stars

  4.5/5 (838)
• • Magazines
  • Podcasts
  • Sheet music
• Principles: Life and Work

  

  From Everand

  Principles: Life and Work

  Ray Dalio

  Rating: 4 out of 5 stars

  4/5 (599)
• The Glass Castle: A Memoir

  

  From Everand

  The Glass Castle: A Memoir

  Jeannette Walls

  Rating: 4.5 out of 5 stars

  4.5/5 (1713)
• Hidden Figures: The American Dream and the Untold Story of the Black Women Mathematicians Who Helped Win the Space Race

  

  From Everand

  Hidden Figures: The American Dream and the Untold Story of the Black Women Mathematicians Who Helped Win the Space Race

  Margot Lee Shetterly

  Rating: 4 out of 5 stars

  4/5 (895)
• Sing, Unburied, Sing: A Novel

  

  From Everand

  Sing, Unburied, Sing: A Novel

  Jesmyn Ward

  Rating: 4 out of 5 stars

  4/5 (1103)
• Grit: The Power of Passion and Perseverance

  

  From Everand

  Grit: The Power of Passion and Perseverance

  Angela Duckworth

  Rating: 4 out of 5 stars

  4/5 (588)
• Shoe Dog: A Memoir by the Creator of Nike

  

  From Everand

  Shoe Dog: A Memoir by the Creator of Nike

  Phil Knight

  Rating: 4.5 out of 5 stars

  4.5/5 (537)
• The Perks of Being a Wallflower

  

  From Everand

  The Perks of Being a Wallflower

  Stephen Chbosky

  Rating: 4.5 out of 5 stars

  4.5/5 (2104)
• The Hard Thing About Hard Things: Building a Business When There Are No Easy Answers

  

  From Everand

  The Hard Thing About Hard Things: Building a Business When There Are No Easy Answers

  Ben Horowitz

  Rating: 4.5 out of 5 stars

  4.5/5 (345)
• Elon Musk: Tesla, SpaceX, and the Quest for a Fantastic Future

  

  From Everand

  Elon Musk: Tesla, SpaceX, and the Quest for a Fantastic Future

  Ashlee Vance

  Rating: 4.5 out of 5 stars

  4.5/5 (474)
• Bad Feminist: Essays

  

  From Everand

  Bad Feminist: Essays

  Roxane Gay

  Rating: 4 out of 5 stars

  4/5 (1016)
• Her Body and Other Parties: Stories

  

  From Everand

  Her Body and Other Parties: Stories

  Carmen Maria Machado

  Rating: 4 out of 5 stars

  4/5 (821)
• The Outsider: A Novel

  

  From Everand

  The Outsider: A Novel

  Stephen King

  Rating: 4 out of 5 stars

  4/5 (1839)
• The Sympathizer: A Novel (Pulitzer Prize for Fiction)

  

  From Everand

  The Sympathizer: A Novel (Pulitzer Prize for Fiction)

  Viet Thanh Nguyen

  Rating: 4.5 out of 5 stars

  4.5/5 (121)
• The Emperor of All Maladies: A Biography of Cancer

  

  From Everand

  The Emperor of All Maladies: A Biography of Cancer

  Siddhartha Mukherjee

  Rating: 4.5 out of 5 stars

  4.5/5 (271)
• Angela's Ashes: A Memoir

  

  From Everand

  Angela's Ashes: A Memoir

  Frank McCourt

  Rating: 4.5 out of 5 stars

  4.5/5 (440)
• Brooklyn: A Novel

  

  From Everand

  Brooklyn: A Novel

  Colm Toibin

  Rating: 3.5 out of 5 stars

  3.5/5 (1937)
• The Little Book of Hygge: Danish Secrets to Happy Living

  

  From Everand

  The Little Book of Hygge: Danish Secrets to Happy Living

  Meik Wiking

  Rating: 3.5 out of 5 stars

  3.5/5 (400)
• The World Is Flat 3.0: A Brief History of the Twenty-first Century

  

  From Everand

  The World Is Flat 3.0: A Brief History of the Twenty-first Century

  Thomas L. Friedman

  Rating: 3.5 out of 5 stars

  3.5/5 (2259)
• A Man Called Ove: A Novel

  

  From Everand

  A Man Called Ove: A Novel

  Fredrik Backman

  Rating: 4.5 out of 5 stars

  4.5/5 (4609)
• The Art of Racing in the Rain: A Novel

  

  From Everand

  The Art of Racing in the Rain: A Novel

  Garth Stein

  Rating: 4 out of 5 stars

  4/5 (4200)
• A Tree Grows in Brooklyn

  

  From Everand

  A Tree Grows in Brooklyn

  Betty Smith

  Rating: 4.5 out of 5 stars

  4.5/5 (1929)
• The Yellow House: A Memoir (2019 National Book Award Winner)

  

  From Everand

  The Yellow House: A Memoir (2019 National Book Award Winner)

  Sarah M. Broom

  Rating: 4 out of 5 stars

  4/5 (98)
• Steve Jobs

  

  From Everand

  Steve Jobs

  Walter Isaacson

  Rating: 4.5 out of 5 stars

  4.5/5 (806)
• Devil in the Grove: Thurgood Marshall, the Groveland Boys, and the Dawn of a New America

  

  From Everand

  Devil in the Grove: Thurgood Marshall, the Groveland Boys, and the Dawn of a New America

  Gilbert King

  Rating: 4.5 out of 5 stars

  4.5/5 (266)
• The Woman in Cabin 10

  

  From Everand

  The Woman in Cabin 10

  Ruth Ware

  Rating: 3.5 out of 5 stars

  3.5/5 (2322)
• Yes Please

  

  From Everand

  Yes Please

  Amy Poehler

  Rating: 4 out of 5 stars

  4/5 (1891)
• A Heartbreaking Work Of Staggering Genius: A Memoir Based on a True Story

  

  From Everand

  A Heartbreaking Work Of Staggering Genius: A Memoir Based on a True Story

  Dave Eggers

  Rating: 3.5 out of 5 stars

  3.5/5 (231)
• Team of Rivals: The Political Genius of Abraham Lincoln

  

  From Everand

  Team of Rivals: The Political Genius of Abraham Lincoln

  Doris Kearns Goodwin

  Rating: 4.5 out of 5 stars

  4.5/5 (234)
• Fear: Trump in the White House

  

  From Everand

  Fear: Trump in the White House

  Bob Woodward

  Rating: 3.5 out of 5 stars

  3.5/5 (738)
• Wolf Hall: A Novel

  

  From Everand

  Wolf Hall: A Novel

  Hilary Mantel

  Rating: 4 out of 5 stars

  4/5 (3811)
• John Adams

  

  From Everand

  John Adams

  David McCullough

  Rating: 4.5 out of 5 stars

  4.5/5 (2409)
• On Fire: The (Burning) Case for a Green New Deal

  

  From Everand

  On Fire: The (Burning) Case for a Green New Deal

  Naomi Klein

  Rating: 4 out of 5 stars

  4/5 (74)
• The Light Between Oceans: A Novel

  

  From Everand

  The Light Between Oceans: A Novel

  M.L. Stedman

  Rating: 4.5 out of 5 stars

  4.5/5 (789)
• The Unwinding: An Inner History of the New America

  

  From Everand

  The Unwinding: An Inner History of the New America

  George Packer

  Rating: 4 out of 5 stars

  4/5 (45)
• Manhattan Beach: A Novel

  

  From Everand

  Manhattan Beach: A Novel

  Jennifer Egan

  Rating: 3.5 out of 5 stars

  3.5/5 (792)
• The Constant Gardener: A Novel

  

  From Everand

  The Constant Gardener: A Novel

  John le Carré

  Rating: 3.5 out of 5 stars

  3.5/5 (104)
• Rise of ISIS: A Threat We Can't Ignore

  

  From Everand

  Rise of ISIS: A Threat We Can't Ignore

  Jay Sekulow

  Rating: 3.5 out of 5 stars

  3.5/5 (137)
• Little Women

  

  From Everand

  Little Women

  Louisa May Alcott

  Rating: 4 out of 5 stars

  4/5 (104)
• Earthquake Precautionary Measures

  

  Document16 pages

  Earthquake Precautionary Measures

  Jenny Forcadilla

  No ratings yet
• Magnitude and Intensity

  

  Document1 page

  Magnitude and Intensity

  Jenny Forcadilla

  No ratings yet
• Philo - Mod2 Q1 Method of Philospphizing v3

  

  Document27 pages

  Philo - Mod2 Q1 Method of Philospphizing v3

  Jenny Forcadilla

  No ratings yet
• Mount Hibok-Hibok

  

  Document17 pages

  Mount Hibok-Hibok

  Jenny Forcadilla

  No ratings yet
• Mount Bulusan

  

  Document27 pages

  Mount Bulusan

  Jenny Forcadilla

  No ratings yet
• Mayon

  

  Document12 pages

  Mayon

  Jenny Forcadilla

  No ratings yet
• Mount Kanlaon

  

  Document33 pages

  Mount Kanlaon

  Jenny Forcadilla

  No ratings yet
• Chapter 1 and Chapter 2

  

  Document18 pages

  Chapter 1 and Chapter 2

  Jenny Forcadilla

  No ratings yet
• Mount Pinatubo

  

  Document116 pages

  Mount Pinatubo

  Jenny Forcadilla

  No ratings yet
• Uself by Group

  

  Document7 pages

  Uself by Group

  Jenny Forcadilla

  No ratings yet
• Chapter 3 Chapter 4

  

  Document16 pages

  Chapter 3 Chapter 4

  Jenny Forcadilla

  No ratings yet
• GMO Lesson

  

  Document38 pages

  GMO Lesson

  Jenny Forcadilla

  No ratings yet
• Taal Volcano

  

  Document70 pages

  Taal Volcano

  Jenny Forcadilla

  No ratings yet
• The Language of Mathematics

  

  Document6 pages

  The Language of Mathematics

  Jenny Forcadilla

  No ratings yet
• 2-The Code of Ethics For Professional Teachers (Complete)

  

  Document15 pages

  2-The Code of Ethics For Professional Teachers (Complete)

  Jenny Forcadilla

  No ratings yet
• 1.1 - Teaching As A Profession, Vocation and Mission

  

  Document18 pages

  1.1 - Teaching As A Profession, Vocation and Mission

  Jenny Forcadilla

  No ratings yet
• Cultural, Social, & Political Praxis

  

  Document18 pages

  Cultural, Social, & Political Praxis

  Jenny Forcadilla

  No ratings yet
• Preparations of Teachers

  

  Document2 pages

  Preparations of Teachers

  Jenny Forcadilla

  No ratings yet
• General Chemistry 2: Intermolecular Forces and Liquids and Solids Quarter 1 - Module 1

  

  Document37 pages

  General Chemistry 2: Intermolecular Forces and Liquids and Solids Quarter 1 - Module 1

  Jenny Forcadilla

  100% (4)
• Overview On Growth Development

  

  Document4 pages

  Overview On Growth Development

  Jenny Forcadilla

  No ratings yet
• Philo-Notes: Learn Philosophy Online!

  

  Document17 pages

  Philo-Notes: Learn Philosophy Online!

  Jenny Forcadilla

  No ratings yet