Available online at www.sciencedirect.

com

Annals of Diagnostic Pathology 14 (2010) 396 – 401

CRTC1/MAML2 fusion transcript in central mucoepidermoid carcinoma

of mandible—diagnostic and histogenetic implications☆
Diana Bell, MDa,⁎, Christopher F. Holsinger, MDb , Adel K. El-Naggar, MD, PhDa
a
Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA
b
Department of Head and Neck Surgery, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA

Abstract Intraosseous salivary gland carcinomas are extremely rare, comprising only 2% to 3% of all
mucoepidermoid carcinomas (MECs) reported. The t(11;19) translocation and its CRTC1/MAML1
fusion transcript have been identified in MEC at different sites and are believed to be associated with
the development of a subset of these tumors. However, the status of the fusion transcript has not been
reported in intraosseous MEC. Here, we report 3 examples of central MEC of the mandible,
including a case with a history of primary retromolar MEC. Reverse transcriptase–polymerase chain
reaction and DNA sequencing analyses of the microdissected components of these tumors were used
for the detection and verification of the fusion transcript. We identified, for the first time, the t(11;19)
fusion gene transcript in central MEC, including in the previous primary retromolar MEC. No fusion
transcript was detected in the second primary noncentral MEC or in another central MEC. The
results indicate that central MEC can manifest the fusion transcript. This finding may have diagnostic
and histogenetic roles in the future analysis of this entity.
Published by Elsevier Inc.

Keywords: Intraosseous mucoepidermoid carcinoma; Fusion gene; Histogenesis

1. Background decades of life. Eversole et al [1] found that approximately

Mucoepidermoid carcinoma (MEC) typically arises from
major or minor salivary glands and comprises 5% to 10% of
all salivary gland tumors [1-3]. Intraosseous salivary gland
carcinomas are extremely rare, comprising 2% to 3% of all
MECs reported [1,2,4,5]. Approximately 108 examples of
MEC arising in the mandible have been reported [4,6-8].
Central MEC affects females twice more frequently than
males and involves the mandible twice more often than the
maxilla. The most common site of occurrence is the
premolar-molar-angle region of the mandible. It has been
reported in all ages ranging from 1 to 78 years, but the
overwhelming majority of cases occur in the fourth and fifth
☆
Grant support: This work was supported in part by the Kenneth D.
Müller Professorship, National Cancer Institute Specialized Program of
Research Excellence grant in head and neck cancer and Grant NIH-NCI CA-
16672 from the National Cancer Institute.
⁎ Correspondent author. Tel.: +1 713 792 2585; fax: +1 713 792 5532.
E-mail address: diana.bell@mdanderson.org (D. Bell).
1092-9134/$ – see front matter. Published by Elsevier Inc.
doi:10.1016/j.anndiagpath.2010.05.009
50% of mandibular tumors were associated with dental cysts
and/or impacted teeth, whereas Brookstone and Huvos [4]
reported an association rate of 32% [9]. In children, these
tumors are rare, with a sex ratio similar to that in adults and a
mandible-to-maxilla ratio of 1:1 [10].
The main symptoms of central MEC of the mandible are
swelling and pain, with trismus, paresthesia, and tooth
mobility being noted occasionally. The disease is more
common in patients with a history of a cyst or impacted
tooth, which gives credence to the theory that odontogenic
epithelium is capable of giving rise to mucous secretory cells
that may undergo neoplastic transformation to MEC. The
radiographic features of central MEC of the mandible are
usually a well-circumscribed unilocular/multilocular radio-
lucency; however, these lesions may be initially confused
with odontogenic benign and malignant tumors [1,4,11–16].
The t(11;19) translocation and its CRTC1/MAML1
fusion transcript have been identified in MEC at different
sites [17-22] and are believed to be associated with the
development of a subset of these tumors. To date, the
 D. Bell et al. / Annals of Diagnostic Pathology 14 (2010) 396–401 397

status of the fusion transcript has not been reported in

intraosseous MEC.
We report 3 cases of central MEC of the mandible,
including 1 case with a history of primary retromolar MEC.
To assess the involvement of the fusion transcript in central
MEC and to determine the relationship between the 2 tumors
in 1 patient, we used reverse transcriptase–polymerase chain
reaction (RT-PCR) and DNA sequencing analyses to study
the microdissected components of these tumors.

2. Materials and methods

A search of the database of the Department of Pathology

at The University of Texas MD Anderson Cancer Center
from 1998 to 2010 for the diagnosis central MEC yielded 3
tumors that had paraffin-tissue blocks available, and these
formed the major materials of our study. Two cases were
treated at MD Anderson (one case has been previously
reported [23]), and one of the authors (AEN) was a
consultant on the third case.
Microdissection, RNA extraction, RT-PCR assay for the Fig. 1. Computed tomography of the neck with intravenous contrast showing
CRTC1/MAML2 transcript, and DNA sequencing were an expansive lesion in the mandible (case 3).
done as previously described in detail [18,22].

extension. The patient underwent incision and curettage of

3. Results
The clinicopathologic features of the retrieved cases are
summarized in Table 1.
3.1. Case presentation
Case 3 was a 49-year-old man, who in 2002 was
diagnosed with a mucoepidermoid low-grade carcinoma of
the retromolar trigone. The patient did not receive any further
treatment because it was considered to be a low-grade lesion
with complete excision at the time of tooth removal. In
August 2009, the patient noticed a painless lump in the angle
of his left mandible. A computed tomographic scan indicated
cystic expansion of the mandible (Fig. 1). An expansile lytic
lesion, 3.5 × 2.2 cm and multiloculated with thin internal
septations, was present at the left mandibular angle
extending into the body and ramus. The lesion caused
cortical thinning, was not associated with a tooth, did not
show any mineralization, and was without soft tissue
the left mandibular cystic mass. The pathologic assessment
was consistent with a well-differentiated MEC. He under-
went a left composite resection, including left hemimandi-
bulectomy, partial resection of adjacent floor of mouth,
partial resection of adjacent buccal mucosa, and left selective
neck dissection of levels 1 through 3. The patient is free of
disease after 5 months.
Gross evaluation of cut sections of the bone revealed a
2.8-cm cystic cavity with smooth lining filled with partially
hemorrhagic and gelatinous material (Fig. 2). Final histo-
pathologic examination revealed low-grade cystic mucinous
adenocarcinoma, which favored the diagnosis of a second
primay cystic mucinous adenocarcinoma, probably arising
from a glandular odontogenic cyst, although the possibility
of multifocal MEC with dominant mucinous component
cannot be excluded (Fig. 3A-C).
Case 1 was initially reported as an adenocarcinoma
arising in a squamous mucosa-lined cyst wall (radiological
impression of dentigerous cyst), with a final diagnosis of

Table 1
Clinicopathologic features of reported cases
Case Age (y)/Sex Histology Location Cyst/Extraction associated Treatment Follow-up
1 18/Male MEC, low grade Mandibular body Yes Segmental mandibulectomy, Lost to follow-up
suprahyoid neck dissection
2 20/Male MEC, intermediate grade Mandibular ramus Yes Curettage NA
3 49/Male MEC, low grade Mandibular body NA Hemimandibulectomy, NED × 3 mo
neck dissection levels I-III,
partial resection of floor of mouth
NA indicates not available; NED, no evidence of disease.
398 D. Bell et al. / Annals of Diagnostic Pathology 14 (2010) 396–401

Fig. 4. Nested RT-PCR amplification product of the CRTC1/MAML2 fusion

Fig. 2. Cut sections of the mandible revealed a 2.8-cm cystic cavity with
smooth lining filled with partially hemorrhagic and gelatinous material
(case 3).
low-grade MEC [23]. Case 2 was consistent with an MEC,
intermediate grade (Fig. 3D-F).
transcript (117 bp) in retromolar MEC (case 3) and intraosseous MEC (case
2) (malignant Warthin tumor and H3113 cell line pellet were used as positive
controls). The fusion transcript is lacking in intraosseous MEC (case 1, case
3) (normal parotid and squamous carcinoma as negative controls). Beta-actin
was used as control for the mRNA amplification quality. M indicates
molecular weight marker; SCC, squamous cell carcinoma; Malignant WT,
previously sequenced malignant wild-type gene positive for the transcript;
H3113, cell line positive for t(11;19) transcript.

3.2. Molecular analysis

To determine whether the previous retromolar MEC
(intermediate grade upon review at MD Anderson) and the
current mandibular MEC in case 3 were genetically related,
we used RT-PCR and DNA sequencing to analyze
microdissected components of these tumors. The transcript
was present in the retromolar MEC and absent in the
current mandibular MEC (Figs. 4 and 5). The fusion
transcript was also identified in the intraosseous interme-
diate MEC (case 2) and lacking in the other central low-
grade MEC (case 1) (Fig. 4).
4. Discussion
Our findings show that central MEC of the mandible can
manifest the fusion transcript. In case 3, the lack of the fusion

Fig. 3. Histologic evaluation of intraosseous mandibular carcinoma in case 3 shows a low-grade cystic mucinous adenocarcinoma, which favors the scenario
of MEC arising from a glandular odontogenic cyst (A-C). Case 2 shows classical histological features of MEC, similar to those of tumors of salivary gland
origin (D-F).
 D. Bell et al. / Annals of Diagnostic Pathology 14 (2010) 396–401
Fig. 5. Composite illustrations of the phenotypic, transcript, and sequence
analysis of retromolar and intraosseous MECs from case 3 (A) hematoxylin
and eosin–stained sections, (B) CRTC1/MAML2 fusion transcript and beta-
actin as control by gel electrophoresis, and (C) nucleotide of the fusion
transcript; g, breakpoint. The full amplified gene sequence of CRTC1/
MAML2 with nested probes is ggaggagacggcggccttcgaggaggtcatgaag-
gacctgagcct gacgcgggccgcgcggctccagggttccttgaaaagaaaacaggtagttaacctatct
cctgccaacagcaa (probes bolded; g, breakpoint).
transcript in the primary noncentral MEC indicates an
independent central second primary tumor. Because the
initial clinical and radiological diagnosis in 2 central low-
grade MECs was a benign odontogenic cyst, our findings
support a future role for the fusion analysis in initial
diagnostic efforts.
Three theories regarding the etiology of central mucoe-
pidermoid tumors have been advanced [1,4,6,24-26]. The
first theory suggests that MEC arises from mucous
metaplasia of an odontogenic cyst wall. The second
hypothesis suggests the entrapment of retromolar mucous
glands during the development of the mandible, resulting in
nests of mucous-type secretory cells capable of undergoing
neoplastic alteration. The third possibility is the develop-
mental inclusion of ectopic salivary gland tissue, described
as occurring inferior to the mandibular canal. Our results,
399
although speculative, favor central MEC development from
ectopic intraosseous salivary gland tissue. The malignant
transformation of nests of mucous-secreting cells during
puberty is a possibility that cannot be ruled out, especially
given the influence of growth factors [10].
Salivary gland neoplasms that arise within the confines
of the mandible and maxilla behave very differently from
other tumors found in the major and minor salivary glands
[4,25-30]. Clinically and radiographically, these lesions
mimic other osteolytic and odontogenic processes and often
are associated with odontogenic cysts. A prompt biopsy is
always indicated for such intraosseous, radiolucent lesions.
After surgical resection, the high rates of local recurrence
and late distant metastasis suggest the need for postoper-
ative radiotherapy, semiannual clinical and radiographic
examinations (panoramic view, computed tomography scan,
or both) for 5 years, and then annual follow-up examina-
tions. When managed appropriately, the 5-year survival rate
is excellent, and the overall prognosis is good.
Our findings showing the absence of the t(11;19) fusion
gene in a subset of central MECs raises the possibility of a
different histogenesis, from a glandular odontogenic precur-
sor as opposed to the ectopic salivary origin of the transcript-
positive intraosseous MECs. We, and others, have recently
reported the presence of the fusion transcript in a limited
group of tumors, including MECs at different sites
(bronchiolar, cervix, breast), some Warthin tumors, and
clear cell hidradenoma of skin, but not in other types of
malignancies [17-20,22]. Collectively, these results indicate
a role for the fusion gene as an early or etiologic event in the
development and/or malignant transformation of a limited
number of interrelated benign and malignant epithelial
neoplasms of salivary and/or adnexal origin.
The detection of this fusion transcript in a significant
number of MECs may have an impact on diagnosis,
prognosis, and treatment. Fine-needle aspiration cytology is
increasingly being used as part of a diagnostic triage for
putative salivary gland tumors, although its true diagnostic
role remains controversial. With respect to MEC, studies
suggest that fine-needle aspiration cytology is considered
diagnostically accurate in high- or intermediate-grade
tumors but unsatisfactory for low-grade MEC. The
application of molecular techniques to cytological material
to detect the CRTC1-MAML2 fusion transcript/protein may
be helpful in cases of uncertainty, although clinical studies
are required to validate such an approach. The finding that
high-grade MEC may also express the fusion transcript
suggests that detection of the transcript may be helpful in
distinguishing this tumor type from poorly differentiated
adenocarcinoma or clear cell carcinomas when conventional
histological distinction is difficult.
Mucoepidermoid carcinomas as a group show a histo-
logical spectrum in which grading is of prognostic
significance for clinical outcome. Grading schemes have
been developed that use a quantitative point-scoring scheme
based on histological parameters of cell type/pattern and
400 D. Bell et al. / Annals of Diagnostic Pathology 14 (2010) 396–401
aggressive features to distinguish between low-, intermedi-
ate-, and high-grade tumors. These studies suggest that grade
is of prognostic value with regard to disease-free survival
after primary treatment, although these and other studies
report that, as for other salivary gland malignancies, clinical
stage is a better indicator of prognosis. An initial study to
investigate an association between CRTC1-MAML2 ex-
pression and MEC tumor grade found that expression was
restricted to low- and intermediate-grade MEC [31].
However, a subsequent study demonstrated that the
CRTC1-MAML2 transcript may be a feature of all grades
of MEC, and as such, this feature may not be used in
“molecular” grading systems [22]. Although these studies
suggest that there is no distinct association between MEC
grade and CRTC1-MAML2 transcript expression, additional
data reported by these groups indicate that such expression
may be associated with tumor behavior [22,31].
The presence of CRTC1-MAML2 in a significant
proportion of MECs offers an avenue for an alternative
treatment approach based upon its putative role in tumor
initiation and progression. However, in MEC, the CRTC1-
MAML2 fusion product is not itself an enzyme. Instead, it
acts in conjunction with other proteins to form transcription
activation complexes that act on Notch- and CREB-
regulated pathways. Therefore, therapeutic targeting is
less clear. To date, most attention has been paid to the
role of Notch inhibition via a number of mechanisms.
“Anti-Notch” agents under investigation for clinical use
include γ-secretase inhibitors, although the finding that
CRTC1-MAML2–mediated Notch-target activation occurs
in the presence of γ-secretase inhibitors would suggest that
these agents are unlikely to be effective in MEC. More
promising, although clearly still investigational, is the
potential role for RNA interference strategies in the
abrogation of tumor progression.
In summary, we have identified, to our knowledge for the
first time, t(11;19) fusion gene transcripts in a subset of
central MEC, originating from ectopic salivary rests, and the
absence of the fusion transcript in MEC with glandular
odontogenic precursors.
Acknowledgments
The authors thank Asif Loya, MD, from the Department
of Pathology, Memorial Cancer Hospital, Lahore, Pakistan,
for providing the material on case 2.
References
[1] Eversole LR, Sabes WR, Rovin S. Aggressive growth and neoplastic
potential of odontogenic cysts: with special reference to central
epidermoid and mucoepidermoid carcinomas. Cancer 1975;35:270-82.
[2] Ezsias A, Sugar AW, Milling MA, et al. Central mucoepidermoid
carcinoma in a child. J Oral Maxillofac Surg 1994;52:512-5.
[3] Gingell JC, Beckerman T, Levy BA, et al. Central mucoepidermoid
carcinoma. Review of the literature and report of a case associated with
an apical periodontal cyst. Oral Surg Oral Med Oral Pathol
1984;57:436-40.
[4] Brookstone MS, Huvos AG. Central salivary gland tumors of the
maxilla and mandible: a clinicopathologic study of 11 cases with
an analysis of the literature. J Oral Maxillofac Surg 1992;50:
229-36.
[5] Lebsack JP, Marrogi AJ, Martin SA. Central mucoepidermoid
carcinoma of the jaw with distant metastasis: a case report and review
of the literature. J Oral Maxillofac Surg 1990;48:518-22.
[6] Maremonti P, Califano L, Mangone GM, et al. Intraosseous
mucoepidermoid carcinoma. Report of a long-term evolution case.
Oral Oncol 2001;37:110-3.
[7] Pons Vicente O, Almendros Marques N, Berini Aytes L, et al. Minor
salivary gland tumors: a clinicopathological study of 18 cases. Med
Oral Patol Oral Cir Bucal 2008;13:E582-8.
[8] Tucci R, Matizonkas-Antonio LF, de Carvalhosa AA, et al. Central
mucoepidermoid carcinoma: report of a case with 11 years' evolution
and peculiar macroscopical and clinical characteristics. Med Oral Patol
Oral Cir Bucal 2009;14:E283-6.
[9] Rhymes Jr R, Hardin Jr JC. Mucoepidermoid carcinoma:
report of case. J Oral Surg Anesth Hosp Dent Serv 1963;21:
239-42.
[10] Baj A, Bertolini F, Ferrari S, et al. Central mucoepidermoid carcinoma
of the jaw in a teenager: a case report. J Oral Maxillofac Surg
2002;60:207-11.
[11] Bhaskar SN. Central mucoepidermoid tumors of the mandible. Report
of 2 cases. Cancer 1963;16:721-6.
[12] Browand BC, Waldron CA. Central mucoepidermoid tumors of the
jaws. Report of nine cases and review of the literature. Oral Surg Oral
Med Oral Pathol 1975;40:631-43.
[13] Browne RM. Metaplasia and degeneration in odontogenic cysts in
man. J Oral Pathol 1972;1:145-58.
[14] Chaudhry AP, Dedolph Jr TH, Vickers RA. Muco-epidermoid tumor
arising from ectopic minor salivary glands in the maxilla: report of
case. J Oral Surg Anesth Hosp Dent Serv 1961;19:521-3.
[15] Dhawan IK, Bhargava S, Nayak NC, et al. Central salivary gland
tumors of jaws. Cancer 1970;26:211-7.
[16] Grubka JM, Wesley RK, Monaco F. Primary intraosseous mucoepi-
dermoid carcinoma of the anterior part of the mandible. J Oral
Maxillofac Surg 1983;41:389-94.
[17] Achcar Rde O, Nikiforova MN, Dacic S, et al. Mammalian mastermind
like 2 11q21 gene rearrangement in bronchopulmonary mucoepider-
moid carcinoma. Hum Pathol 2009;40:854-60.
[18] Bell D, Luna MA, Weber RS, et al. CRTC1/MAML2 fusion transcript
in Warthin's tumor and mucoepidermoid carcinoma: evidence for a
common genetic association. Genes Chromosomes Cancer
2008;47:309-14.
[19] Lennerz JK, Perry A, Dehner LP, et al. CRTC1 rearrangements in the
absence of t(11;19) in primary cutaneous mucoepidermoid carcinoma.
Br J Dermatol 2009;161:925-9.
[20] Lennerz JK, Perry A, Mills JC, et al. Mucoepidermoid carcinoma of the
cervix: another tumor with the t(11;19)-associated CRTC1-MAML2
gene fusion. Am J Surg Pathol 2009;33:835-43.
[21] O'Neill ID. Gefitinib as targeted therapy for mucoepidermoid
carcinoma of the lung: possible significance of CRTC1-MAML2
oncogene. Lung Cancer 2009;64:129-30.
[22] Tirado Y, Williams MD, Hanna EY, et al. CRTC1/MAML2 fusion
transcript in high grade mucoepidermoid carcinomas of salivary
and thyroid glands and Warthin's tumors: implications for
histogenesis and biologic behavior. Genes Chromosomes Cancer
2007;46:708-15.
[23] Holsinger FC, Owens JM, Raymond AK, et al. Central mucoepider-
moid carcinoma of the mandible: tumorigenesis within a keratocyst.
Arch Otolaryngol Head Neck Surg 2002;128:718-20.
[24] Melrose RJ, Abrams AM, Howell FV. Mucoepidermoid tumors of the
intraoral minor salivary glands: a clinicopathologic study of 54 cases.
J Oral Pathol 1973;2:314-25.
 D. Bell et al. / Annals of Diagnostic Pathology 14 (2010) 396–401
[25] Pierri LK, Schneider KL, Super S, et al. Intraosseous high-grade
mucopidermoid carcinoma with four potential microscopic diagnoses.
J Oral Med 1986;41:47-50.
[26] Stoch RB, Smith I. Mucoepidermoid carcinoma in the mandible: report
of case. J Oral Surg 1980;38:56-8.
[27] Looser KG, Kuehn PG. Primary tumors of the mandible. A study of 49
cases. Am J Surg 1976;132:608-14.
[28] Pincock JL, el-Mofty SK. Recurrence of cystic central mucoepider-
moid tumor of the mandible. Report of a case with 3 recurrences in 7
years. Int J Oral Surg 1985;14:81-4.
401
[29] Stoll HC, Marchetta FC. Tumors of salivary gland origin presenting
as primary jaw tumors. Oral Surg Oral Med Oral Pathol 1957;10:
1262-7.
[30] Thomas G, Pandey M, Mathew A, et al. Primary intraosseous
carcinoma of the jaw: pooled analysis of world literature and report
of two new cases. Int J Oral Maxillofac Surg 2001;30:349-55.
[31] Behboudi A, Enlund F, Winnes M, et al. Molecular classification of
mucoepidermoid carcinomas—prognostic significance of the MECT1-
MAML2 fusion oncogene. Genes Chromosomes Cancer 2006;45:
470-81.