رسالة انكليزي مايكروفومينا

University of Arkansas, Fayetteville
ScholarWorks@UARK
Graduate Theses and Dissertations
8-2019
Studies on Pathogenesis of the Diseases Caused by

Macrophomina phaseolina and Phomopsis longicolla on Soybean
Marcio Leizer Zaccaron
University of Arkansas, Fayetteville
Follow this and additional works at: https://scholarworks.uark.edu/etd
Part of the Agronomy and Crop Sciences Commons, and the Plant Pathology Commons
Citation
Zaccaron, M. L. (2019). Studies on Pathogenesis of the Diseases Caused by Macrophomina phaseolina
and Phomopsis longicolla on Soybean. Graduate Theses and Dissertations Retrieved from
https://scholarworks.uark.edu/etd/3330
This Dissertation is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for
inclusion in Graduate Theses and Dissertations by an authorized administrator of ScholarWorks@UARK. For more
information, please contact scholar@uark.edu.
Studies on Pathogenesis of the Diseases Caused by Macrophomina phaseolina and Phomopsis
longicolla on Soybean
A dissertation submitted in partial fulfillment

of the requirements for the degree of
Doctor of Philosophy in Plant Sciences
by
Marcio Zaccaron
Universidade Federal da Grande Dourados
Bachelor of Science in Agronomy, 2009
Iowa State University
Master of Science in Plant Pathology, 2013
August 2019
University of Arkansas
The dissertation is approved for recommendation to the Graduate Council.
__________________________________
John Rupe, PhD
Dissertation Director
__________________________________ __________________________________
Burt Bluhm, PhD Pengying Chen, PhD
Committee Member Committee Member
__________________________________ __________________________________
Edward Gbur, PhD Douglas Karcher, PhD
Committee Member Committee Member
__________________________________
Larry Purcell, PhD
Committee Member
Abstract
Soybean (Glycine max), a legume, is an economically important crop in many parts of the
world, including the USA, Brazil, Argentina, China, and India, currently the top five producing
countries. Soybean is primarily used as feed, with incising markets for food and biodiesel.
Similar to most crops, soybean yield and quality are affected by a diverse group of plant
pathogens. In particular, several species of filamentous fungi have been the cause of severe yield
losses in most growing regions world-wide. The soil born fungus Macrophomina phaseolina,
causal agent of charcoal rot, has been found to be endemic to several soybean production areas.
Charcoal rot has been historically associated with severe yield reduction, particularly when
coupled with drought stress. However, little is known about how irrigation-regimes change
affect the relationship between disease severity and yield. A different soil and seed born fungus
Phomopsis longicolla, causes severe seed decay under conducive environmental conditions,
warm and wet weather during soybean senescence. Although both fungi co-inhabit soybean
roots and stems for extended periods of times, little is known about their interactions. Recently,
P. longicolla has been shown to be amenable to genetic manipulation via Agrobacterium
tumefaciens. However, no study has yet taken advantage of this amenability to dissect potential
mechanisms associated to Phomopsis seed decay. This study was designed to understand how
different irrigation regimes may impact severity of charcoal rot and its relationship to soybean
yield. Additionally, the interplay between M. phaseolina and P. longicolla in soybean tap roots
via the formation of zone lines was investigated. Lastly, taking advantage of available genetic
transformation methodology, experiments were implemented to elucidate putative molecular
mechanisms of Phomopsis seed decay pathogenesis. Results indicated that drought stress
significantly increases charcoal rot severity and decreased yield. However, no consistent
relationship was observed between these variables. Observations also showed that P. longicolla
forms zone lines in soybean taproots thereby precluding M. phaseolina from colonizing these
tissues. In this study, for the first time, forward and reverse genetic approaches and
transcriptomics were employed on P. longicolla successfully. Multiple genes linked to
decreased pathogenicity were identified in P. longicolla.

Table of contents
CHAPTER I: GENERAL INTRODUCTION .........................................................................................................1
BIOLOGY OF M. PHASEOLINA ......................................................................................................................................1
VEGETATIVE INDEXES ...............................................................................................................................................4
BIOLOGY OF P. LONGICOLLA ......................................................................................................................................5
ZONE LINES AND P. LONGICOLLA ............................................................................................................................... 7
MOLECULAR GENETICS AND P. LONGICOLLA..............................................................................................................9
THE CCAAT-BINDING COMPLEX............................................................................................................................. 11
DISSERTATION SCOPE .............................................................................................................................................. 11
LITERATURE CITED .................................................................................................................................................. 13
CHAPTER II: DROUGHT STRESS AND ITS EFFECTS ON CHARCOAL ROT AND YIELD OF
SOYBEAN .................................................................................................................................................................. 24
ABSTRACT ............................................................................................................................................................... 24
INTRODUCTION ........................................................................................................................................................ 25
MATERIALS AND METHODS...................................................................................................................................... 28
RESULTS .................................................................................................................................................................. 32
DISCUSSION ............................................................................................................................................................. 35
TABLES .................................................................................................................................................................... 43
FIGURES................................................................................................................................................................... 46
CHAPTER III: ZONE LINES ASSOCIATED WITH P. LONGICOLLA ALTER SOYBEAN ROOT
COLONIZATION BY M. PHASEOLINA .............................................................................................................. 57
ABSTRACT ............................................................................................................................................................... 57
INTRODUCTION ........................................................................................................................................................ 58
RESULTS .................................................................................................................................................................. 64
DISCUSSION ............................................................................................................................................................. 66
TABLES .................................................................................................................................................................... 73
FIGURES................................................................................................................................................................... 76
CHAPTER IV: A FORWARD GENETIC SCREEN IN PHOMOPSIS LONGICOLLA PROVIDES UNIQUE
INSIGHTS INTO PATHOGENESIS ...................................................................................................................... 80
ABSTRACT ............................................................................................................................................................... 80
INTRODUCTION ........................................................................................................................................................ 80
RESULTS .................................................................................................................................................................. 91
DISCUSSION ............................................................................................................................................................. 93
TABLES .................................................................................................................................................................. 103
FIGURES................................................................................................................................................................. 104
CHAPTER V: MONSTR-SEQ, A RESTRICTION SITE-ASSOCIATED DNA SEQUENCING
TECHNIQUE TO CHARACTERIZE AGROBACTERIUM-MEDIATED TRANSFER-DNA INSERTIONS
IN PHOMOPSIS LONGICOLLA ............................................................................................................................ 110
ABSTRACT ............................................................................................................................................................. 110
INTRODUCTION ...................................................................................................................................................... 110
MATERIALS AND METHODS.................................................................................................................................... 112
RESULTS ................................................................................................................................................................ 115
DISCUSSION ........................................................................................................................................................... 116
LITERATURE CITED ................................................................................................................................................ 118
TABLES .................................................................................................................................................................. 122
FIGURES................................................................................................................................................................. 123
CHAPTER VI: HAP3, A COMPONENT OF THE CCAAT-BINDING COMPLEX OF PHOMOPSIS
LONGICOLLA, REGULATES PATHOGENESIS DURING INFECTION OF SOYBEAN ........................... 126
ABSTRACT ............................................................................................................................................................. 126
INTRODUCTION ...................................................................................................................................................... 127
MATERIALS AND METHODS ................................................................................................................................... 129
RESULTS ................................................................................................................................................................ 135
DISCUSSION ........................................................................................................................................................... 141
LITERATURE CITED ................................................................................................................................................ 145
TABLES .................................................................................................................................................................. 153
FIGURES................................................................................................................................................................. 156
CHAPTER VII: CONCLUSION ........................................................................................................................... 166
List of Published Papers
Chapter V published as:

Zaccaron, M., Sharma, S., and Bluhm, B. H. 2018. MoNSTR-seq, a restriction site-associated
DNA sequencing technique to characterize Agrobacterium-mediated transfer-DNA insertions in
Phomopsis longicolla. Lett. Appl. Microbiol. 66:19-24
Chapter VI submitted as:

Zaccaron, M., Zaccaron, A., Ridenour, J., Ramegowda, Y., Sharma, S., and Bluhm, B. H. 2019.
HAP3, a component of the CCAAT-binding complex of Phomopsis longicolla, regulates
pathogenesis during infection of soybean. Mol. Plant-Microbe Interact. under review
Chapter I: General introduction
Biology of M. phaseolina
The Ascomycota fungi Macrophomina phaseolina and Phomopsis longicolla are
economically important soybean pathogens worldwide (Wrather et al. 2010; Zorrilla et al. 1994;
Bellaloui et al. 2008). Although these fungi cause very different diseases in soybean production
systems, many similarities are noteworthy between these organisms and the diseases they cause.
Both, M. phaseolina and P. longicolla are ubiquitous and endemic in many soybean production
areas (Gacitua Arias et al. 2013; Short and Wyllie 1978; Roy and Abney 1988; Hartman, et al.
1999). Environmental conditions have been reported to play a very important role in the
development of diseases caused by these filamentous fungal pathogens (Mengistu et al. 2011;
Rupe and Ferriss 1986). While drought is associated with more severe epidemics of charcoal rot;
caused my M. phaseolina, moist and warm conditions favor Phomopsis seed decay, caused by P.
longicolla (Kendig et al. 2000; Baker et al. 1987). Additionally, chemical control has not been
shown effective in the management of either charcoal rot or Phomopsis seed decay (Wrather et
al. 2004; Jaiman et al. 2009). Furthermore, only limited sources of horizontal resistance are
known for these diseases (Jackson et al. 2005; Bellaloui et al. 2008). Both organisms and the
diseases caused by their association with soybean have been known and studied for nearly a
century (Lehman 1923; Haigh 1930). However, to date little is known about the molecular
mechanisms involved in their pathogenesis.
M. phaseolina is a soil borne fungus that infects soybean roots early in the season then
systemically colonizes the root system and basal stem (Mengistu et al. 2011). Charcoal rot has
been reported to cause severe yield losses in most soybean growing areas worldwide, including,
but not limited to Brazil, Argentina, China, and the US (Wrather et al. 1997). M. phaseolina has
1
a wide host range, reportedly found to infect over 500 plant species within 100 families including
several economically important crop species like cotton (Gossypium hirsutum) (Su et al. 2001),
maize (Zea mays) (Livingston 1945), sorghum (Sorghum bicolor) (Tenkouano et al. 1993),
tomatoes (Solanum lycopersicum) (Shaukat and Siddiqui 2003), strawberry (Fragaria ananassa)
(Koike 2008), and common bean (Phaseolus vulgaris) (Songa et al. 1997). M. phaseolina is a
ubiquitous agricultural soil inhabitant able to survive and remaining infectious in this
environment for long intervals under adverse conditions (Gangopadhyay et al. 1982; Short et al.
1980; Sheikh and Ghaffar 1979). M. phaseolina’s wide host range coupled with its capability to
persist in soil saprophytically on crop residue or via survival structures, i.e. microsclerotia, make
disease control with chemical or cultural practices ineffective (Hartman, et al. 1999).
M. phaseolina asymptomatically infects soybean plants during vegetative developmental
stages. M. phaseolina microsclerotia germinate early in the season when soil temperatures reach
20°C and is capable of infecting seedling or adult plants alike through their roots (Short et al.
1980; Bristow 1986; Collins et al. 1991). No signs or symptoms can be distinguished during
infection (Cloud and Rupe 1994; Doubledee et al. 2018). However, M. phaseolina can be easily
recovered from asymptomatic roots and stems of soybean plants under natural field inoculum
(Mengistu et al. 2011; Kendig et al. 2000). In most epidemics, soybean plants remain
symptomless and no signs of the pathogen are seen until beginning of plant senescence (Short et
al. 1978; Wyllie and Calvert 1969). However, in some cases charcoal rot is reported to cause
wilt and premature plant death, particularly when associated with drought stress (Hartman, et al.
1999; Navi and Yang 2008; Mengistu et al. 2011). Following the premature plant death or late
senescence stages, M. phaseolina rapidly produces large numbers of microsclerotia in roots and
stems of colonized plants (Short et al. 1978; Kendig et al. 2000). As a result, a distinct light
2
silvery-gray to blackish discoloration is observed in dead colonized plants. Even though
multiple reports have described ubiquitous M. phaseolina colonization in dead soybean plants
throughout the crop development stages (Hartman, et al. 1999; Romero Luna et al. 2017), no
causal effect relationship has been experimentally demonstrated linking M. phaseolina
colonization to plant death thus far (Doubledee et al. 2018).
During the onset of senescence, signs of M. phaseolina become visible. Colonized plants
develop a silvery-gray aspect, root and stem tissues can present a dark-gray to blackish
discoloration, and microsclerotia can be seen imbedded in most plant tissues, particularly the tap
root and basal stem (Akhtar et al. 2011; Almeida et al. 2008; Azarmanesh et al. 2011; Hartman,
et al. 1999). Disease assessments at or after soybean senescence have been the most common
form of data gathering for epidemiological or resistance screening studies (Mengistu et al. 2013;
Hartman, et al. 1999; Romero Luna et al. 2017). These disease quantifications are predicated
upon the intensity of signs observed in the specimen tissues, particularly roots and stems
(Mengistu et al. 2007).
Abiotic stresses, such as drought, heat, and mineral deficiency, have been shown to
interact with plant disease resistance, at times exacerbating symptom development (Fujita et al.
2006; Xiong and Yang 2003; Atkinson and Urwin 2012). In particular, drought has been linked
to increased severity of multiple row crop diseases including maize ear rot (Parsons and
Munkvold 2010), sorghum stalk rot (Tesso et al. 2005), and crown rot of barley (Hordeum
vulgare) (Liu and Liu 2016). Diseases caused by M. phaseolina have also been reported to
increase in severity under drought stress in sorghum (Cloud and Rupe 1994; Pande et al. 1990;
Diourte et al. 1995; Odvody and Dunkle 1979), sunflower (Helianthus annuus) (Blanco-López
and Jiménez-Díaz 1983; Ijaz et al. 2013), and common bean (Garcia-Olivares et al. 2012;
3
Mayek-Pérez et al. 2002). In soybean, the amplifying effect of drought stress on charcoal rot has
been described, including increased root colonization (Kendig et al. 2000; Mengistu et al. 2011).
Root infection by M. phaseolina has been shown to reduce stomatal conductance in soybean
plants while not affecting yield (Doubledee et al. 2018). As a result of climate change, drought
events are projected to continue to increase in frequency and severity during this century in
certain areas, including North America and northeast Brazil (Marvel et al. 2019; Cook et al.
2015). Thus, charcoal rot is likely to become a larger concern for soybean production, causing
increased yield losses.
Vegetative indexes
Vegetative indexes have been used to remotely and non-destructively estimate soybean
stress, including water deficit. The Normalized Difference Vegetative Index (NDVI) is a widely
used vegetative index obtained by the difference of the reflectance of near-infrared (0.725 to
1.1µm) and visible spectrum (0.58 to 0.68µm) divided by the sum of these two quantities, thus
yielding a ratio between -1 and 1 (Justice et al. 1985; Karnieli et al. 2010). NDVI takes
advantage of unique plant features, such as the absorption of light in the visible spectrum, which
includes photosynthetically active radiation, making them appear relatively dark in this wave-
length band (Björkman and Demmig-Adams 1995). Meanwhile, plant canopies reflect most of
near-infrared radiation received, which facilitates plant thermal regulation (Peñuelas and Filella
1998). Therefore, under conditions conducive to plant growth and development, healthy and
vigorous plants will present an NDVI value closer to 1 and diseased or stressed plants close to 0
(Chenglin Liu et al. 2004; Moriondo et al. 2007; Bravo et al. 2003). NDVI is also consider a
good estimator of photosynthesis activity (Gamon et al. 1995; Young and Harris 2005). More
4
recently, NDVI has been adopted as an indicator of drought stress. Drought conditions decrease
plant greenness, thereby measurably decreasing their NDVI (Sims et al. 2006; Xu et al. 2011).
Biology of P. longicolla
Phomopsis longicolla is a soil and seed borne pathogen that causes pod and stem blight
and seed decay in soybean (Hobbs et al. 1985; Sinclair 1993). P. longicolla, a ubiquitous and
important seed pathogen of soybean, is a member of the Diaporthe-Phomopsis species complex
that includes D. phaseolorum f. sp. sojae, D. phaseolorum f. sp. caulivora, and D. aspalathi
(Gomes et al. 2013; Hobbs and Phillips 1985; Hobbs et al. 1985; Kmetz 1978; Mengistu et al.
2014; Nevena et al. 1997). P. longicolla is predominantly associated with Phomopsis seed decay
(PSD) in the U.S. (Hobbs et al. 1985), although it has been reported to cause stem lesions in
other regions of the world (Cui et al. 2009). Symptoms of PSD include shriveled and elongated
seeds with chalky and cracked seed coats. These symptoms are easily discernable from other
common soybean seed diseases, such as purple seed stain caused by Cercospora kikuchii
(Hartman, et al. 1999). In addition to decreasing the nutritional quality of infected seeds
(Hepperly and Sinclair 1978; Mayhew and Caviness 1994), P. longicolla can substantially impair
seed germination and vigor, negatively affecting seedling emergence when infected seeds are
planted in laboratory or field conditions (McGee et al. 1980; Mengistu and Heatherly 2006).
Besides colonizing pods and seeds, P. longicolla can asymptomatically infect vegetative tissues
as early as three weeks after seedling emergence only displaying signs upon senescence (Walcott
et al. 1998; Impullitti and Malvick 2013).
P. longicolla can successfully overwinter in production areas in colonized plant debris
and is capable of asymptomatically infecting soybean plants during vegetative and reproductive
developmental stages (Roy and Abney 1988; Rupe and Ferriss 1987; Rupe 1990). Following
5
infection, P. longicolla maintains an endophytic-like lifestyle for most of crop development
causing no apparent symptoms nor exhibiting any signs of colonization (Rupe and Ferriss 1987).
At senescence, P. longicolla infects seeds and under conducive environmental condition can
cause severe seed decay (Baker et al. 1987). Additionally, once plants mature, P. longicolla
produces large numbers of pycnidia on the surfaces of aerial plant parts. In particular,
characteristic vertical-row alignment pattern of pycnidia are distinctively observed on soybean
plants main stem (Hartman, et al. 1999; Baker et al. 1987; Roy and Abney 1988).
PSD is endemic throughout North American soybean production areas, and has been
described as one of the most common diseases affecting soybean seeds in the U.S. (Sinclair
1992). In recent years, PSD has increased in incidence and severity in Southeastern states, partly
due to the prevalence of the early soybean production system (ESPS) in the region (TeKrony et
al. 1996; Logan et al. 1998). The ESPS encourages early planting of short-season soybean
cultivars to avoid late-summer stresses of heat and periodic droughts that occur throughout the
region. Due to early planting, the reproductive stages of soybean development may occur during
periods of high temperature and humidity, both of which favor PSD development (Shortt 1981).
Delayed harvests also favor PSD, as the pathogen has an extended opportunity to colonize seeds
before seed moisture can be adequately reduced by controlled drying (Wilcox et al. 1974).
Beyond the Southeastern U.S., PSD occurs periodically in the Midwest when environmental
conditions are favorable or harvests are substantially delayed (Kmetz 1978; Shortt 1981). The
potential implications of climate change on PSD are difficult to project. However, several long-
term forecasting models suggest the increased occurrence of extreme weather events, including
heat waves, flooding, and storms (Pachauri et al. 2014), which could conceivably favor increased
incidence of PSD across U.S. soybean producing regions.
6
The relationship between P. longicolla and soybean is complex and may involve more
than one type of association. In addition to causing PSD, P. longicolla is commonly found as an
asymptomatic endophyte in soybean vegetative tissues, including stems, leaves, and petioles
(Kmetz 1978). Interestingly, P. longicolla is reported to endophytically associate with a range of
taxonomically diverse plants, including Euphorbia nutans (Euphorbiaceae), Abutilon theophrasti
(Malvaceae), Ipomoea lacunosa (Convolvulaceae), Xanthium strumarium (Asteraceae), and a
tropical red seaweed Bostrychia radicans (Rhodomelaceae) (Erbert et al. 2012; Gomes et al.
2013; Udayanga et al. 2011), which suggests it has evolved broadly effective mechanisms of
endophytism. P. longicolla produces a wide variety of anti-microbial compounds, such as 3-
nitropropionic acid (Flores et al. 2013), 18-deoxy-cytochalasin H, mycophenolic acid, and
dicerandrol C (Erbert et al. 2012). These observations suggest P. longicolla could function as a
beneficial endophyte in soybean, although the exact nature of the relationship requires further
elucidation.
Zone lines and P. longicolla
During colonization of soybean roots and stems, P. longicolla has been observed to form
zone lines (Olson et al. 2015), structures that are postulated to be analogous to barrage zones on
defined media (Brayford 1990). Zone lines are often seen in dead or senesced soybean taproots
and lower stem and have been considered a sign of charcoal rot (Romero Luna et al. 2017).
However, recent studies have shown that these typical black zone lines on soybean plants are
caused by P. longicolla and not M. phaseolina (Olson et al. 2015; Vidić et al. 2013; Ghissi et al.
2014). Zone lines are macroscopic black lines seen in decaying woody plant tissues (Campbell
1933). They vary from a few millimeters to a several centimeters, straight or tortuous, in some
cases they can be observed as stand-alone lines, but more often form an enclosed shape, e.g. an
7
ellipsoid (Olson et al. 2015; Li 1983). Zone lines are formed by intense colonization of plant
material by pigmented fungal tissue and are often observed during wood decay (Lopez-Real
1975). Several species of filamentous fungi have been shown to cause zone lines including
Xylaria polymorpha (Robinson and Laks 2010), Polyporus squamosus (Campbell and Munson
1936), Armillaria melea (Campbell 1934), and Phellinus weirri (Li 1981). However, P.
longicolla is the first species observed to cause zone lines in soybean (Olson et al. 2015).
Phomopsis spp. have been reported to cause zone lines in alfalfa (Nikandrow 1989, 1990) and
elm trees (Webber and Gibbs 1984; Brayford 1990; Webber 1981). Phomopsis spp. isolated
from elm trees have been shown to produce barrage zones in culture when colony margins of
genetic distinct isolates meet or are in proximity to colonies from different fungal species
(Webber 1981). Zone lines in plant debris have been considered a possible survival structure and
demonstrably associated with long term viability of Poria weirii in soil environment (Nelson
1964).
The potential duality underlying the endophytic/pathogenic basis of the P.
longicolla/soybean relationship has led to fundamental questions about how to dissect
pathogenesis. A cut stem assay method is commonly used to assess P. longicolla virulence and
soybean resistance (Li et al. 2010), in which soybean stems are cut and inoculated with an agar
plug colonized by the pathogen. However, P. longicolla is reported to produce appressoria
during infection of soybean pods (Baker et al. 1987), which suggests a degree of developmental
specialization during plant infection. The cut stem assay is predicated on wounding, e.g., cutting
the stem, which would presumably bypass specialized infectious development during
pathogenesis. Additionally, soybean seeds and pods could express resistance responses not
8
observed in stems, and thus a cut stem assay may not fully capture the range of phenotypes
associated with PSD.
Molecular genetics and P. longicolla
Despite its importance as the causal agent of PSD, few studies have explored the
molecular basis of pathogenesis in P. longicolla. Recently, new molecular resources have
become available, including a protocol for genetic transformation (Li et al. 2013) and draft
genome sequences for two isolates of P. longicolla, including the type strain, TWH P74 (Li et al.
2015). However, functional genomics approaches have not yet been applied to the P.
longicolla/soybean pathosystem. Forward genetic screens provide a powerful tool for the
molecular dissection of pathogenesis in filamentous fungi. Forward genetic screens have been
used effectively to discover novel genes and dissect pathogenesis in several filamentous fungi,
including Fusarium graminearum, Colletotrichum higginsianum, Magnaporthe grisea, and
Leptosphaeria maculan (Gupta and Chattoo 2007; Idnurm and Howlett 2002; Korn et al. 2015;
Seong et al. 2005).
A key constraint with forward genetics is the ability to efficiently characterize genomic
lesions in mutants. Numerous approaches have been developed to define insertion sites of
mutagenesis cassettes, including plasmid rescue (Tam and Lefebvre 1993), thermal asymmetric
interlaced PCR (TAIL PCR; Dent et al. 2005), restriction enzyme site directed amplification
PCR (Gonzalez-Ballester et al. 2005), and 3’- rapid amplification of cDNA ends (Meslet-
Cladiere and Vallon 2012). These methods, however, have distinct limitations, particularly
regarding throughput. With the advent of next-generation DNA sequencing, whole-genome re-
sequencing at varying depths of coverage has been utilized successfully to identify genomic
lesions in some species of fungi (Esher et al. 2015). However, costs currently associated with
9
whole-genome resequencing often hinder the application of this approach to large collections of
insertional mutants, and may be less effective for non-model organisms due to the limited
availability of reference genome sequences.
Restriction Digestion Associated sequencing (RAD-seq) is a reduced representation
sequencing strategy in which genomic regions flanking a specific restriction enzyme are
selectively enriched for sequencing (Baird et al. 2008). The general workflow consists of
digesting genomic DNA with a restriction enzyme, ligating oligonucleotide adapters to the
digested DNA, enriching fragments containing the restriction site via PCR amplification,
selecting fragments based on size, and sequencing fragments on a next-generation DNA
sequencing platform. Distinct advantages of RAD-seq include flexibility regarding the selection
of restriction enzymes, no requirement for a reference genome sequence a priori, and
substantially higher throughput compared to whole-genome re-sequencing.
To date, the molecular basis of pathogenesis underlying PSD is poorly understood, in
large part due to the unavailability of crucial genetic and genomic resources for P. longicolla or
related species within the genus. In recent years, significant advancements have been made in
support of molecular genetics and functional genomics approaches in P. longicolla, including
protocols for genetic transformation (Li et al. 2013) and characterization of T-DNA insertions
(Zaccaron et al. 2018), and draft genome sequences for two isolates of the pathogen, including
the type strain (Li et al. 2015). In addition, draft genome sequences are available for D. helianthi
(Baroncelli et al. 2016), two isolates of D. ampelina (Savitha et al. 2016), an unidentified
Diaporthe sp. (de Sena Filho et al. 2016), and the causal agent of southern stem canker of
soybean, D. aspalathi (Li et al. 2016). Recently, a targeted gene deletion approach utilizing
Agrobacterium tumefaciens-mediated transformation was successfully employed to functionally
10
characterize DhPKS1 in D. helianthi (Ruocco et al. 2018). However, the ability to perform
functional genomics in P. longicolla, particularly reverse genetics via targeted gene deletion, has
not been reported thus far.
The CCAAT-binding complex
The heterotrimeric CCAAT-binding complex (CBC) has recently been reported to control
pathogenesis and mycotoxin production in Fusarium verticillioides in corn. CBC of eukaryotes
is broadly conserved in animals, plants, and fungi (Becker et al. 1991; Edwards et al. 1998;
McNabb and Pinto 2005). The fungal CBC was originally described in Saccharomyces
cerevisiae as the Hap regulatory complex and found to consist of three core subunits: Hap2,
Hap3, and Hap5 (McNabb et al. 1995; Olesen et al. 1987). More recently, a fourth subunit of the
CBC exclusive to fungi, HapX, has been identified and characterized in filamentous
Ascomycetes (Jung et al. 2010; Tanaka et al. 2002). In fungi, all three core components must be
present for the functionality of the complex (McNabb et al. 1995; Ridenour and Bluhm 2014).
The CBC is a key regulator of iron acquisition and homeostasis (Chakravarti et al. 2017) and the
shift from fermentation to aerobic respiration in yeast (McNabb and Pinto 2005). In filamentous
fungi, the CBC has been implicated as a regulator of responses to oxidative stress, secondary
metabolism, and plant pathogenesis (Hong et al. 2013; Ridenour and Bluhm 2014; Thön et al.
2010; Yin and Keller 2011).
Dissertation scope
By reducing water deficit stress, irrigation could also decrease yield losses caused by
charcoal rot. However, soybean yield response to charcoal rot under different water deficit stress
levels is not well understood. Additionally, zone lines are now known not to be a sign of
charcoal rot, but instead be caused by P. longicolla (Olson et al. 2015). However, there is no
11
current information on how these two soybean-root inhabitants interplay. Thus, in this
dissertation the effect of charcoal rot on soybean yield under different water regimes was
explored. Additionally, investigations were carried out on whether P. longicolla via zone lines
alter root colonization by M. phaseolina. In addition to zone lines, P. longicolla is an endophyte
with a wide host range, a seed pathogen of soybean, a soil inhabitant, and displays a distinct
lifestyle switch from endophytism to saprophytism at the end of its host life cycle. The many
interesting biological characteristics of P. longicolla coupled with its amenability to cultivation
in vitro, DNA manipulation, and genetic transformation make this filamentous plant pathogenic
fungi a particularly interesting model to better understand disease and biological mechanisms.
Therefore, in this dissertation studies were carried out in an endeavor to generate tools and
resources for future molecular genetics studies in this organism while simultaneously
investigating mechanisms of its pathogenesis. Here are described a forward genetic study, a new
method to identify T-DNA insertions in mutants created via Agrobacterium-mediated
transformation, and a targeted gene knock-out experiment. These studies identified P. longicolla
genes associated with its pathogenesis in soybean.
12
Literature cited
Akhtar, K. P., Sarwar, G., and Arshad, H. M. I. 2011. Temperature response, pathogenicity,
seed infection and mutant evaluation against Macrophomina phaseolina causing charcoal
rot disease of sesame. Archives of Phytopathology and Plant Protection 44:320-330
Almeida, Á. M., Amorim, L., Bergamin Filho, A., Torres, E., Farias, J. R., Benato, L. C., Pinto,
M. C., and Valentim, N. 2003. Progress of soybean charcoal rot under tillage and no-
tillage systems in Brazil. Fitopatologia Brasileira 28:131-135
Almeida, Á. M. R., Sosa-Gomez, D. R., Binneck, E., Marin, S. R. R., Zucchi, M. I., Abdelnoor,
R. V., and Souto, E. R. 2008. Effect of crop rotation on specialization and genetic
diversity of Macrophomina phaseolina. Tropical Plant Pathology 33:257-264
Atkinson, N. J., and Urwin, P. E. 2012. The interaction of plant biotic and abiotic stresses: from
genes to the field. J Exp Bot. 63:3523-3543
Azarmanesh, N., Bond, J. P., Vick, A., Mengistu, A., and Fakhoury, A. M. 2011. A qPCR assay
to detect and quantify Macrophomina phaseolina in soybean roots. Phytopathology
101:S11-S12
Baird, N.A., Etter, P.D., Atwood, T.S., Currey, M.C., Shiver, A.L., Lewis, Z.A., Selker, E.U.,
Cresko, W.A. and Johnson, E.A. 2008. Rapid SNP discovery and genetic mapping using
sequenced RAD markers. PloS One 3:e3376
Baker, D. M., Minor, H. C., Brown, M. F., and Brown, E. A. 1987. Infection of immature
soybean pods and seeds by Phomopsis longicolla. Can. J. Microbiol. 33:797-801
Baroncelli, R., Scala, F., Vergara, M., Thon, M. R., andRuocco, M. 2016. Draft whole-genome
sequence of the Diaporthe helianthi 7/96 strain, causal agent of sunflower stem canker.
Genomics data 10:151-152
Becker, D. M., Fikes, J. D., and Guarente, L. 1991. A cDNA encoding a human CCAAT-
binding protein cloned by functional complementation in yeast. PNAS. 88:1968-1972
Bellaloui, N., Mengistu, A., and Paris, R. L. 2008. Soybean seed composition in cultivars
differing in resistance to charcoal rot (Macrophomina phaseolina). Journal of
Agricultural Science 146:667-675
Björkman, O., and Demmig-Adams, B. 1995. Regulation of Photosynthetic Light Energy

Capture, Conversion, and Dissipation in Leaves of Higher Plants. In Ecophysiology of
Photosynthesis. Springer, Berlin, Heidelberg 17-47
Blanco-López, M. A., and Jiménez-Díaz, R. M. 1983. Effect of irrigation on susceptibility of

sunflower to Macrophomina phaseolina. Plant Disease 67:1214-1217
13
Bravo, C., Moshou, D., West, J., McCartney, A., and Ramon, H. 2003. Early Disease Detection
in Wheat Fields using Spectral Reflectance. Biosystems Engineering. 84:137-145
Brayford, D. 1990. Vegetative incompatibility in Phomopsis from elm. Mycological Research.

94:745-752
Bristow, P. R. 1986. Macrophomina phaseolina, Another Cause of the Twin-Stem Abnormality

Disease of Soybean. Plant Disease 70:1152-1153
Campbell, A. H. 1933. Zone lines in plant tissues I. The black lines formed by Xylaria
polymorpha (Pers.) Grev. In hardwoods. Annals of Applied Biology 20:123-145
Campbell, A. H. 1934. Zone lines in plant tissues: II. The black lines formed by Armillaria
mellea (Vahl) Quel. Annals of Applied Biology 21:1-22
Campbell, A. H., and Munson, R. G. 1936. Zone lines in plant tissues III. The black lines
formed by Polyporus squamosus (Huds.) Fr. Annals of Applied Biology 23:453-464
Chakravarti, A., Camp, K., McNabb, D. S., and Pinto, I. 2017. The Iron-Dependent Regulation
of the Candida albicans Oxidative Stress Response by the CCAAT-Binding Factor.
PLOS ONE 12:e0170649
Chenglin Liu, Bingfang Wu, Yichen Tian, Wenbo Xu, and Jianxi Huang. 2004. Crop drought
monitoring using serial NDVI amp; NDWI in Northern China. In: IGARSS 2004. IEEE
International Geoscience and Remote Sensing Symposium 2264-2267
Cloud, G. L., and Rupe, J. C. 1994. Influence of nitrogen, plant growth stage, and environment
on charcoal rot of grain sorghum caused by Macrophomina phaseolina (Tassi) Goid.
Plant Soil 158:203-210
Collins, D. J., Wyllie, T. D., and Anderson, S. H. 1991. Biological activity of Macrophomina
phaseolina in soil. Soil Biology and Biochemistry 23:495-496
Cook, B. I., Ault, T. R., and Smerdon, J. E. 2015. Unprecedented 21st century drought risk in
the American Southwest and Central Plains. Science Advances 1:e1400082
Cui, Y.-L., Duan, C.-X., Wang, X.-M., Li, H.-J., and Zhu, Z.-D. 2009. First report of
Phomopsis longicolla causing soybean stem blight in China. Plant Pathology 58:799
Dent, R. M., Haglund, C. M., Chin, B. L., Kobayashi, M. C., and Niyogi, K. K. 2005.
Functional Genomics of Eukaryotic Photosynthesis Using Insertional Mutagenesis of
Chlamydomonas reinhardtii. Plant Physiol. 137:545-556
Diourte, M., Starr, J. L., Jeger, M. J., Stack, J. P., and Rosenow, D. T. 1995. Charcoal rot
(Macrophomina phaseolina) resistance and the effects of water stress on disease
development in sorghum. Plant Pathology 44:196-202
14
Doubledee, M. D., Rupe, J. C., Rothrock, C. S., and Bajwa, S. G. 2018. Effect of root infection
by Macrophomina phaseolina on stomatal conductance, canopy temperature and yield of
soybean. Canadian Journal of Plant Pathology 40:272-283
Edwards, D., Murray, J. A. H., and Smith, A. G. 1998. Multiple Genes Encoding the Conserved
CCAAT-Box Transcription Factor Complex Are Expressed in Arabidopsis. Plant
Physiology 117:1015-1022
Erbert, C., Lopes, A. A., Yokoya, N. S., Furtado, N. A. J. C., Conti, R., Pupo, M. T., Lopes, J. L.
C., and Debonsi, H. M. 2012. Antibacterial compound from the endophytic fungus
Phomopsis longicolla isolated from the tropical red seaweed Bostrychia radicans. Botm.
55:435-440
Esher, S.K., Granek, J.A. and Alspaugh, J.A. 2015. Rapid mapping of insertional mutations to
probe cell wall regulation in Cryptococcus neoformans. Fungal Genet Biol. 82:9-21
Flores, A. C., Pamphile, J. A., Sarragiotto, M. H., and Clemente, E. 2013. Production of 3-
nitropropionic acid by endophytic fungus Phomopsis longicolla isolated from Trichilia
elegans A. JUSS ssp. elegans and evaluation of biological activity. World J Microbiol
Biotechnol. 29:923-932
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki, K., and
Shinozaki, K. 2006. Crosstalk between abiotic and biotic stress responses: a current
view from the points of convergence in the stress signaling networks. Current Opinion in
Plant Biology 9:436-442
Gacitua Arias, S., Rubilar Pons, R., and Sanfuentes Von Stowasser, E. 2013. Temporal analysis
of charcoal root rot in forest nurseries under different pathogen inoculum densities and
soil moisture content. Tropical Plant Pathology 38:179-187
Gamon, J. A., Field, C. B., Goulden, M. L., Griffin, K. L., Hartley, A. E., Joel, G., Penuelas, J.,
and Valentini, R. 1995. Relationships Between NDVI, Canopy Structure, and
Photosynthesis in Three Californian Vegetation Types. Ecological Applications 5:28-41
Gangopadhyay, S., Wyllie, T. D., and Teague, W. R. 1982. Effect of bulk density and moisture
content of soil on the survival of Macrophomina phaseolina. Plant and Soil 68:241-247
Garcia-Olivares, J. G., Lopez-Salinas, E., Cumpian-Gutierrez, J., Cantu-Almaguer, M. A.,

Zavala-Garcia, F., and Mayek-Pérez, N. 2012. Grain Yield and Charcoal Rot Resistance
Stability in Common Beans under Terminal Drought Conditions. J. Phytopathol 160:98-
105
Ghissi, V. C., Reis, E. M., and Deuner, C. C. 2014. Etiology of Phomopsis root rot in soybean.
Summa Phytopathologica 40:270-272
15
Gomes, R. R., Glienke, C., Videira, S. I. R., Lombard, L., Groenewald, J. Z., and Crous, P. W.
2013. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia
31:1-41
Gonzalez-Ballester, D., de Montaigu, A., Galván A., Fernández, E. 2005. Restriction enzyme
site-directed amplification PCR: A tool to identify regions flanking a marker DNA.
Analytical biochemistry 340:330-335
Gupta, A., and Chattoo, B. B. 2007. A novel gene MGA1 is required for appressorium
formation in Magnaporthe grisea. Fungal Genetics and Biology 44:1157-1169
Haigh, J. C. 1930. Macrophomina phaseoli (Maubl.) Ashby and Rhixoctonia bataticola (Tanb.)
Butler. Ann. Roy. Bot. Gard. 11:213-249
Hartman, G. L., Sinclair, J. B., and Rupe, J. C. 1999. Compendium of soybean diseases.
American Phytopathological Society (APS Press), St. Paul.
Hepperly, P. R., and Sinclair, J. B. 1978. Quality losses in Phomopsis-infected soybean seeds.
Phytopathology 68:1684-1687
Hobbs, T., and Phillips, D. 1985. Identification of Diaporthe and Phomopsis Isolates from
Soybean. Phytopathology 75:500
Hobbs, T. W., Schmitthenner, A. F., and Kuter, G. A. 1985. A New Phomopsis species from
soybean. Mycologia 77:535-545
Hong, S.-Y., Roze, L. V., and Linz, J. E. 2013. Oxidative Stress-Related Transcription Factors
in the Regulation of Secondary Metabolism. Toxins 5:683-702
Idnurm, A., and Howlett, B. J. 2002. Isocitrate Lyase Is Essential for Pathogenicity of the
Fungus Leptosphaeria maculans to Canola (Brassica napus). Eukaryot Cell 1:719-724
Ijaz, S., Sadaqat, H. A., and Khan, M. N. 2013. A review of the impact of charcoal rot
(Macrophomina phaseolina) on sunflower. Journal of Agricultural Science 151:222-227
Impullitti, A. e., and Malvick, D. k. 2013. Fungal endophyte diversity in soybean. J Appl
Microbiol. 114:1500–1506
Jackson, E. W., Fenn, P., and Chen, P. 2005. Inheritance of Resistance to Phomopsis Seed
Decay in Soybean PI 80837 and MO/PSD-0259 (PI 562694). Crop Science 45:2400-
2404
Jaiman, R. K., Jain, S. C., and Sharma, P. 2009. Field Evaluation of Fungicides, Bioagents and
Soil Amendments Against Root Rot Caused by Macrophomina phaseolina in Cluster
Bean. Journal of Mycology and Plant Pathology 39:74-76
16
Jung, W. H., Saikia, S., Hu, G., Wang, J., Fung, C. K.-Y., D’Souza, C., White, R., and Kronstad,
J. W. 2010. HapX Positively and Negatively Regulates the Transcriptional Response to
Iron Deprivation in Cryptococcus neoformans. PLOS Pathogens 6:e1001209
Justice, C. O., Townshend, J. R. G., Holben, B. N., and Tucker, C. J. 1985. Analysis of the
phenology of global vegetation using meteorological satellite data. International Journal
of Remote Sensing 6:1271-1318
Karnieli, A., Agam, N., Pinker, R. T., Anderson, M., Imhoff, M. L., Gutman, G. G., Panov, N.,
and Goldberg, A. 2010. Use of NDVI and land surface temperature for drought
assessment: Merits and limitations. Journal of climate 23:618-633
Kendig, S. R., Rupe, J. C., and Scott, H. D. 2000. Effect of Irrigation and Soil Water Stress on
Densities of Macrophomina phaseolina in Soil and Roots of Two Soybean Cultivars.
Plant Disease 84:895-900
Kmetz, K. T. 1978. Soybean Seed Decay: Prevalence of Infection and Symptom Expression
Caused by Phomopsis sp., Diaporthe phaseolorum var. sojae, and D. phaseolorum var.
caulivora. Phytopathology 68:836-840
Koike, S. T. 2008. Crown rot of strawberry caused by Macrophomina phaseolina in California.

Plant Disease 92:1253-1253
Korn, M., Schmidpeter, J., Dahl, M., Müller, S., Voll, L. M., and Koch, C. 2015. A Genetic
Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum
higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host
Penetration. PLOS ONE 10:e0125960
Lehman, S. G. 1923. Pod and Stem Blight of Soybean. Annals of the Missouri Botanical
Garden. 10:111-178
Li, C. Y. 1983. Melanin-like Pigment in Zone Lines of Phellinus weirii-Colonized Wood.

Mycologia 75:562-566
Li, C. Y. 1981. Phenoloxidase and Peroxidase Activities in Zone Lines of Phellinus weirii.
Mycologia. 73:811-821
Li, S., Hartman, G. L., and Boykin, D. L. 2010. Aggressiveness of Phomopsis longicolla and
Other Phomopsis spp. on Soybean. Plant Disease 94:1035-1040
Li, S., Ridenour, J. B., Kim, H., Hirsch, R. L., Rupe, J. C., and Bluhm, B. H. 2013.
Agrobacterium tumefaciens-mediated transformation of the soybean pathogen Phomopsis
longicolla. Journal of Microbiological Methods 92:244-245
17
Li, S., Song, Q., Martins, A. M., and Cregan, P. 2016. Draft genome sequence of Diaporthe
aspalathi isolate MS-SSC91, a fungus causing stem canker in soybean. Genomics Data
7:262-263
Li, S., Song, Q., Ji, P., and Cregan, P. 2015. Draft Genome Sequence of Phomopsis longicolla
Type Strain TWH P74, a Fungus Causing Phomopsis Seed Decay in Soybean. Genome
Announc. 3: e00010-15
Liu, X., and Liu, C. 2016. Effects of Drought-Stress on Fusarium Crown Rot Development in
Barley. PLOS ONE 11:e0167304
Livingston, J. 1945. Charcoal Rot of Corn and Sorghum. Historical Research Bulletins of the
Nebraska Agricultural Experiment Station.
Logan, J., Mueller, M. A., and Graves, C. R. 1998. A Comparison of Early and Recommended
Soybean Production Systems in Tennessee. Journal of Production Agriculture 11:319-
325
Lopez-Real, J. M. 1975. Formation of pseudosclerotia (‘zone lines’) in wood decayed by

Armillaria mellea and Stereum hirsutum: I. Morphological aspects. Transactions of the
British Mycological Society 64:465-471
Marvel, K., Cook, B. I., Bonfils, C. J. W., Durack, P. J., Smerdon, J. E., and Williams, A. P.
2019. Twentieth-century hydroclimate changes consistent with human influence. Nature
569:59-65
Mayek-Pérez, N., GarcÍa-Espinosa, R., LÓpez-CastaÑeda, Cá., Acosta-Gallegos, J. A., and

Simpson, J. 2002. Water relations, histopathology and growth of common bean
(Phaseolus vulgaris L.) during pathogenesis of Macrophomina phaseolina under drought
stress. Physiological and Molecular Plant Pathology. 60:185-195
Mayhew, W. L., and Caviness, C. E. 1994. Seed Quality and Yield of Early-Planted, Short-
Season Soybean Genotypes. Agronomy Journal. 86:16-19
McGee, D. C., Brandt, C. L., and Burris, J. S. 1980. Seed mycoflora of soybeans relative to
fungal interactions, seedling emergence, and carry over of pathogens to subsequent crops.
McNabb, D. S., and Pinto, I. 2005. Assembly of the Hap2p/Hap3p/Hap4p/Hap5p-DNA

Complex in Saccharomyces cerevisiae. Eukaryotic Cell 4:1829-1839
McNabb, D. S., Xing, Y., and Guarente, L. 1995. Cloning of yeast HAP5: a novel subunit of a
heterotrimeric complex required for CCAAT binding. Genes Dev. 9:47-58
Mengistu, A., Arelli, P., Bond, J., Nelson, R., Rupe, J., Shannon, G., and Wrather, A. 2013.
Identification of Soybean Accessions Resistant to Macrophomina phaseolina by Field
18
Screening and Laboratory Validation. Plant Health Progress DOI:10.1094/PHP-2013-
0318-01-RS
Mengistu, A., Castlebury, L. A., Morel, W., Ray, J. D., and Smith, J. R. 2014. Pathogenicity of
Diaporthe spp. isolates recovered from soybean (Glycine max) seeds in Paraguay.
Canadian Journal of Plant Pathology 36:470-474
Mengistu, A., and Heatherly, L. G. 2006. Planting date, irrigation, maturity group, year, and
environment effects on Phomopsis longicolla, seed germination, and seed health rating of
soybean in the early soybean production system of the midsouthern USA. Crop
Protection. 25:310–317
Mengistu, A., Ray, J. D., Smith, J. R., and Paris, R. L. 2007. Charcoal Rot Disease Assessment
of Soybean Genotypes Using a Colony-Forming Unit Index. Crop Science. 47:2453-
2461
Mengistu, A., Smith, J. R., Ray, J. D., and Bellaloui, N. 2011. Seasonal progress of charcoal rot
and its impact on soybean productivity. Plant Disease 95:1159-1166
Meslet-Cladière, L., and Vallon, O. 2012. A new method to identify flanking sequence tags in
Chlamydomonas using 3’-RACE. Plant Methods 8:21 DOI: 10.1186/1746-4811-8-21
Moriondo, M., Maselli, F., and Bindi, M. 2007. A simple model of regional wheat yield based
on NDVI data. European Journal of Agronomy 26:266-274
Navi, S. S., and Yang, X. B. 2008. Foliar symptom expression in association with early infection
and xylem colonization by Fusarium virguliforme (formerly F. solani f sp glycines), the
causal agent of soybean sudden death syndrome. Plant Health Progress
DOI:10.1094/PHP-2008-0222-01-RS
Nelson, E. E. 1964. Some probable relationships of soil fungi and zone lines to survival of
Poria weirii in buried wood blocks. Phytopathology 54:120-121
Nevena, M., Jelena, V., and Franić-Mihajlović, D. 1997. A comparative study of

Diaporthe/Phomopsis fungi on soybean from two different regions of the world.
Mycopathologia 139:107-113
Nikandrow, A. 1990. Acrocalymma medicaginis and Phomopsis sp. as Causal Agents of Crown
Rot of Lucerne in Australia. Journal of Phytopathology 130:24-36
Nikandrow, A. 1989. Zone lines diagnostic of Phomopsis sp. in lucerne crown rot. Australasian
Plant Pathology 18:86-89
Odvody, G. N., and Dunkle, L. D. 1979. Charcoal stalk rot of sorghum: effect of environment
on host-parasite relations. Phytopathology 69:250-254
19
Olesen, J., Hahn, S., and Guarente, L. 1987. Yeast HAP2 and HAP3 activators both bind to the
CYC1 upstream activation site, UAS2, in an interdependent manner. Cell 51:953-961
Olson, T. R., Gebreil, A., Micijevic, A., Wise, K. A., Mueller, D. S., Chilvers, M. I., and
Mathew, F. M. 2015. Association of Diaporthe longicolla with Black Zone Lines on
Mature Soybean Plants. Plant Health Progress DOI:10.1094/PHP-RS-15-0020
Pachauri, R. K., Allen, M. R., Barros, V. R., Broome, J., Cramer, W., Christ, R., Church, J. A.,
Clarke, L., Dahe, Q., Dasgupta, P., and others. 2014. Climate change 2014: synthesis
report. Contribution of Working Groups I, II and III to the fifth assessment report of the
Intergovernmental Panel on Climate Change. IPCC.
Pande, S., Mughogho, L. K., and Karunakar, R. I. 1990. Effect of moisture stress, plant
population density and pathogen inoculation on charcoal stalk rot of sorghum. Annals of
Applied Biology 116:221-232
Parsons, M. W., and Munkvold, G. P. 2010. Associations of planting date, drought stress, and
insects with Fusarium ear rot and fumonisin B1 contamination in California maize. Food
Addit Contam Part A Chem Anal Control Expo Risk Assess. 27:591-607
Peñuelas, J., and Filella, I. 1998. Visible and near-infrared reflectance techniques for
diagnosing plant physiological status. Trends in Plant Science 3:151-156
Ridenour, J. B., and Bluhm, B. H. 2014. The HAP complex in Fusarium verticillioides is a key
regulator of growth, morphogenesis, secondary metabolism, and pathogenesis. Fungal
Genetics and Biology 69:52-64
Robinson, S. C., and Laks, P. E. 2010. Wood Species and Culture Age Affect Zone Line
Production of Xylaria polymorpha. Open Mycology Journal 4:18-21
Romero Luna, M. P., Mueller, D., Mengistu, A., Singh, A. K., Hartman, G. L., and Wise, K. A.
2017. Advancing Our Understanding of Charcoal Rot in Soybeans. J Integr Pest Manag.
8:DOI10.1093/jipm/pmw020
Roy, K. W., and Abney, T. S. 1988. Colonization of pods and infection of seeds by Phomopsis
longicolla in susceptible and resistant soybean lines inoculated in the greenhouse.
Canadian Journal of Plant Pathology 10:317-320
Ruocco, M., Baroncelli, R., Cacciola, S. O., Pane, C., Monti, M. M., Firrao, G., Vergara, M.,
Magnano, S. L. G., Vannacci, G., Scala, F. 2018. Polyketide synthases of Diaporthe
helianthi and involvement of DhPKS1 in virulence on sunflower. BMC genomics 27
DOI:10.1186/s12864-017-4405-z
Rupe, J. C., and Ferriss, R. S. 1986. Effects of pod moisture on soybean seed infection by
Phomopsis sp. Phytopathology 76:273-277
20
Rupe, J. C. 1990. Effect of temperature on the rate of infection of soybean seedlings by
Phomopsis longicolla. Canadian Journal of Plant Pathology. 12:43-47
Rupe, J., and Ferriss, R. 1987. A Model for Predicting the Effects of Microclimate on Infection
of Soybean by Phomopsis longicolla. Phytopathology 77:1162-1166
Savitha, J., Bhargavi, S. D., & Praveen, V. K. 2016. Complete Genome Sequence of the
Endophytic Fungus Diaporthe (Phomopsis) ampelina. Genome announcements
4:e00477-16
de Sena Filho, J. G., Quin, M. B., Spakowicz D. J., Shaw, J. J., Kucera, K., Dunican, B., Strobel,
S. A., Schmidt-Dannert, C. 2016. Genome of Diaporthe sp. provides insights into the
potential inter-phylum transfer of a fungal sesquiterpenoid biosynthetic pathway. Fungal
biology 120: 1050-1063
Seong, K., Hou, Z., Tracy, M., Kistler, H. C., and Xu, J.-R. 2005. Random Insertional
Mutagenesis Identifies Genes Associated with Virulence in the Wheat Scab Fungus
Fusarium graminearum. Phytopathology 95:744-750
Shaukat, S. S., and Siddiqui, I. A. 2003. The influence of mineral and carbon sources on
biological control of charcoal rot fungus, Macrophomina phaseolina by fluorescent
pseudomonads in tomato. Letters in Applied Microbiology 36:392-398
Sheikh, A. H., and Ghaffar, A. 1979. Relation of sclerotial inoculum density and soil moisture
to infection of field crops by Macrophomina phaseolina. Pakistan Journal of Botany
11:185-189
Short, G. E., Wyllie, T. D., and Ammon, V. D. 1978. Quantitative enumeration of

Macrophomina phaseolina in soybean tissues. Phytopathology 68:736-741
Short, G. E., Wyllie, T. D., and Bristow, P. R. 1980. Survival of Macrophomina phaseolina in
soil and in residue of soybean. Phytopathology 70:13-17
Shortt, B. J. 1981. Epidemiology of Phomopsis Seed Decay of Soybean in Illinois. Plant Disease
65:62-64
Sims, D. A., Luo, H., Hastings, S., Oechel, W. C., Rahman, A. F., and Gamon, J. A. 2006.
Parallel adjustments in vegetation greenness and ecosystem CO2 exchange in response to
drought in a Southern California chaparral ecosystem. Remote Sensing of Environment
103:289-303
Sinclair, J. B. 1992. Discoloration of Soybean Seeds - An Indicator of Quality. Plant Disease

76:1087-1091
Sinclair, J. B. 1993. Phomopsis Seed Decay of Soybeans- A Prototype for Studying Seed
Disease. Plant Disease 77:329-334
21
Songa, W., Hillocks, R. J., Mwango’mbe, A. W., Buruchara, R., and Ronno, W. K. 1997.
Screening common bean accessions for resistance to charcoal rot (Macrophomina
phaseolina) in Eastern Kenya. Experimental Agriculture 33:459-468
Su, G., Suh, S.-O., Schneider, R. W., and Russin, J. S. 2001. Host Specialization in the
Charcoal Rot Fungus, Macrophomina phaseolina. Phytopathology 91:120-126
Tam, L. W., and Lefebvre, P. A. 1993. Cloning of flagellar genes in Chlamydomonas

reinhardtii by DNA insertional mutagenesis. Genetics 135:375-384
Tanaka, A., Kato, M., Nagase, T., Kobayashi, T., and Tsukagoshi, N. 2002. Isolation of genes
encoding novel transcription factors which interact with the Hap complex from
Aspergillus species. Biochimica et Biophysica Acta - Gene Structure and Expression
1576:176-182
TeKrony, D. M., Grabau, L. J., DeLacy, M., and Kane, M. 1996. Early Planting of Early-
Maturing Soybean: Effects on Seed Germination and Phomopsis Infection. Agronomy
Journal 88:428-433
Tenkouano, A., Miller, F. R., Frederiksen, R. A., and Rosenow, D. T. 1993. Genetics of
nonsenescence and charcoal rot resistance in sorghum. Theoret. Appl. Genetics 85:644-
648
Tesso, T. T., Claflin, L. E., and Tuinstra, M. R. 2005. Analysis of Stalk Rot Resistance and
Genetic Diversity among Drought Tolerant Sorghum Genotypes. Crop Science 45:645-
652
Thön, M., Al Abdallah, Q., Hortschansky, P., Scharf, D. H., Eisendle, M., Haas, H., and
Brakhage, A. A. 2010. The CCAAT-binding complex coordinates the oxidative stress
response in eukaryotes. Nucleic Acids Res. 38:1098-1113
Udayanga, D., Liu, X., McKenzie, E. H. C., Chukeatirote, E., Bahkali, A. H. A., and Hyde, K. D.
2011. The genus Phomopsis: biology, applications, species concepts and names of
common phytopathogens. Fungal Diversity 50:189-225
Vidić, M., Petrović, K., Đorđević, V., and Riccioni, L. 2013. Occurrence of Phomopsis
longicolla β Conidia in Naturally Infected Soybean. J Phytopathol. 161:470-477
Yin, W., and Keller, N. P. 2011. Transcriptional regulatory elements in fungal secondary
metabolism. J Microbiol. 49:329-339
Walcott, R. R., McGee, D. C., and Misra, M. K. 1998. Detection of Asymptomatic Fungal
Infections of Soybean Seeds by Ultrasound Analysis. Plant Disease 82:584-589
Webber, J. 1981. A natural biological control of Dutch elm disease. Nature 292:449-451
22
Webber, J. F., and Gibbs, J. N. 1984. Colonization of elm bark by Phomopsis oblonga.
Transactions of the British Mycological Society 82:348-352
Wilcox, J. R., Laviolette, F. A., Athow, K. L., and others. 1974. Deterioration of soybean seed
quality associated with delayed harvest. Plant Disease Reporter 58:130-133
Wrather, J. A., Shannon, J. G., Stevens, W. E., Sleper, D. A., and Arelli, A. P. 2004. Soybean
cultivar and foliar fungicide effects on Phomopsis sp. seed infection. Plant disease
88:721-723
Wrather, A., Shannon, G., Balardin, R., Carregal, L., Escobar, R., Gupta, G. K., Ma, Z., Morel,
W., Ploper, D., and Tenuta, A. 2010. Effect of diseases on soybean yield in the top eight
producing countries in 2006. Plant Health Progress DOI:10.1094/PHP-2010-0125-01-
RS.
Wrather, J. A., Anderson, T. R., Arsyad, D. M., Gai, J., Ploper, L. D., Porta-Puglia, A., Ram, H.
H., and Yorinori, J. T. 1997. Soybean disease loss estimates for the top 10 soybean
producing countries in 1994. Plant Disease 81:107-110
Wyllie, T. D., and Calvert, O. H. 1969. Effect of flower removal and pod set on formation of
sclerotia and infection of Glycine max by Macrophomina phaseoli. Phytopathology
59:1243-1245
Xiong, L., and Yang, Y. 2003. Disease Resistance and Abiotic Stress Tolerance in Rice Are
Inversely Modulated by an Abscisic Acid–Inducible Mitogen-Activated Protein Kinase.
The Plant Cell 15:745-759
Xu, L., Samanta, A., Costa, M. H., Ganguly, S., Nemani, R. R., and Myneni, R. B. 2011.
Widespread decline in greenness of Amazonian vegetation due to the 2010 drought.
Geophysical Research Letters 38: L07402
Young, S. S., and Harris, R. 2005. Changing patterns of global‐scale vegetation photosynthesis,
1982–1999. International Journal of Remote Sensing 26:4537-4563
DNA sequencing technique to characterize Agrobacterium-mediated transfer-DNA
insertions in Phomopsis longicolla. Lett. Appl. Microbiol. 66:19-24
Zorrilla, G., Knapp, A. D., and McGee, D. C. 1994. Severity of Phomopsis Seed Decay, Seed
Quality Evaluation, and Field Performance of Soybean. Crop Science 34:172-177
23
Chapter II: Drought stress and its effects on charcoal rot and yield of soybean
Abstract
Charcoal rot, caused by the soil-borne fungal pathogen Macrophomina phaseolina, is
associated with drought stress. The primary controls for charcoal rot in soybean are to avoid
drought stress and, if possible, plant a moderately resistant cultivar. To determine the effect of
irrigation and cultivar on charcoal rot in soybean, a study was conducted in 2011 and 2013 with
four soybean cultivars, with and without M. phaseolina inoculation, and with three irrigation
regimes: full season irrigation, irrigation terminated (cut) at R5, and no irrigation. Canopy
reflectance as measured by the normalized difference vegetative index (NDVI) was greater in
irrigated than non-irrigated plots, in non-inoculated than inoculated plots, and with ‘Ozark’ than
the other cultivars. At R6, NDVI was not different among the cultivars in 2011, but was
significantly lower in ‘R01581F’ than in ‘Osage’ or ‘Hutcheson’. With most cultivars at R6,
NDVI were significantly lower for the no irrigation and the irrigation cut at R5 treatments than
the full season irrigation. There were no significant differences in NDVI with the no irrigation
or irrigation cut at R5 treatments. Full season irrigation yielded significantly more than no
irrigation or irrigation cut at R5 plots in 2012 with most cultivars, but only for R01581F in 2013.
Non-inoculated plots yielded significantly more than inoculated plots across cultivar and
irrigation treatments. In 2011, stem colonization by M. phaseolina was significantly less in full
season irrigation than in no irrigation plots. In 2013, colonization was significantly greater in full
season irrigation plots than in plot where irrigation was cut at R5. There was a significant three-
way interaction of inoculation, cultivar and irrigation in root colonization measured visually
using a 1 to 5 index. When there were significant differences among cultivars, Osage had lower
RSS ratings than the other cultivars. Hutcheson and R01581F generally had higher RSS ratings
24
than the other cultivars in the different inoculation and irrigation treatments and Ozark usually
had lower ratings than Hutcheson and R01581F, but higher than Osage. Comparing irrigation
treatments within cultivars and inoculations, in general full-season irrigation had the lowest
distribution of RSS ratings followed by no irrigation and then irrigation cut at R5. Regressions
of yield to NDVI at R3 and at R6 were significant in both years with positive slopes. Regression
analysis relating charcoal rot to yield within a year and irrigation treatment were not significant
for CFU’s in 2013, proportion stem colonization in either year, or RSS except for irrigation cut at
R5 in 2011 where the regression was significant with a positive slope and an R2 of 0.355.
Overall, irrigation significantly affected yield and there were significant effects of irrigation,
cultivar, and inoculation on RSS, but RSS did not negatively affect yield.
Introduction
Macrophomina phaseolina, the causal agent of charcoal rot, is an important soil-borne
pathogen of soybean (Almeida et al. 2003; Wrather et al. 1997; Hartman, et al. 1999). Charcoal
rot has been reported to cause severe yield losses in most soybean growing areas worldwide,
including, but not limited to Brazil, Argentina, China, and the US (Wrather et al. 1997). M.
phaseolina has a wide host range, reportedly found to infect over 500 plant species within 100
families including several economically important crop species like cotton (Su et al. 2001),
maize (Livingston 1945), sorghum (Tenkouano et al. 1993), tomatoes (Shaukat and Siddiqui
2003), strawberry (Koike 2008), and common bean (Songa et al. 1997). M. phaseolina is a
ubiquitous agricultural soil-inhabitant able to survive and remaining infectious in this
environment for long periods under adverse conditions (Gangopadhyay et al. 1982; Short et al.
1980; Sheikh and Ghaffar 1979). M. phaseolina wide host range coupled with its capability to
25
persist in soil saprophytically on crop residue or via survival structures, i.e. microsclerotia, make
disease control with chemical or cultural practices ineffective (Hartman, et al. 1999).
M. phaseolina asymptomatically infects soybean plants during vegetative developmental
stages. M. phaseolina microsclerotia germinate early in the season when soil temperatures reach
20°C and are capable of infecting seedling or adult plants alike through their roots (Short et al.
1980; Bristow 1986; Collins et al. 1991). No signs or symptoms are visually apparent until
soybean late reproductive stages (Cloud and Rupe 1994; Doubledee et al. 2018; Mengistu et al.
2011b). However, M. phaseolina can be easily recovered from asymptomatic roots and stems of
soybean plants under natural field inoculum (Mengistu et al. 2011b; Kendig et al. 2000).
Multiple reports have described ubiquitous signs of M. phaseolina in dead soybean plants
throughout the crop development stages (Hartman, et al. 1999; Romero Luna et al. 2017).
However, thus far no causal effect relationship has been experimentally demonstrated linking M.
phaseolina colonization to plant death (Doubledee et al. 2018). During the onset of senescence,
signs of M. phaseolina become visible. Colonized plants develop a silvery-gray aspect, root and
stem tissues can present a dark-gray to blackish discoloration, and microsclerotia can be seen
imbedded in most plant tissues, particularly taproot and basal stem (Akhtar et al. 2011; Almeida
et al. 2008; Azarmanesh et al. 2011; Hartman, et al. 1999). Disease assessments at or after
soybean senescence have been the most common form of evaluating for epidemiological or
resistance screening studies (Mengistu et al. 2013; Hartman, et al. 1999; Romero Luna et al.
2017). These disease quantifications are predicated upon the intensity of signs observed in the
root and stem tissues (Mengistu et al. 2007).
Abiotic stresses, such as drought, heat, and mineral deficiency interacts with plant disease
resistance, at times exacerbating symptom development (Fujita et al. 2006; Xiong and Yang
26
2003; Atkinson and Urwin 2012). In particular, drought has been linked to increased severity of
multiple row crop diseases including maize ear rot (Parsons and Munkvold 2010), sorghum stalk
rot (Tesso et al. 2005), and crown rot of barley (Liu and Liu 2016). Diseases caused by M.
phaseolina have also been reported to increase in severity under drought stress in sorghum
(Cloud and Rupe 1994; Pande et al. 1990; Diourte et al. 1995; Odvody and Dunkle 1979),
sunflower (Blanco-López and Jiménez-Díaz 1983; Ijaz et al. 2013), and common bean (Garcia-
Olivares et al. 2012; Mayek-Pérez et al. 2002). In soybean, the amplifying effect of drought
stress on charcoal rot has been described, including increased root colonization (Kendig et al.
2000; Mengistu et al. 2011b). Root infection by M. phaseolina reduces stomatal conductance in
soybean plants while having inconsistent effects on yield (Doubledee et al. 2018). As a result of
climate change, drought events are projected to continue to increase in frequency and severity
during this century in certain areas, including North America and northeast Brazil (Marvel et al.
2019; Cook et al. 2015). Thus, charcoal rot is likely to become a larger concern for soybean
production, causing increased yield losses.
Vegetative indexes based on canopy reflectance have been used to remotely and non-
destructively estimate soybean stress, including water deficit. The Normalized Difference
Vegetative Index (NDVI) is a widely used vegetative index obtained by the difference of the
reflectance of near-infrared (0.725 to 1.1µm) and visible spectrum (0.58 to 0.68µm) divided by
the sum of these two quantities, thus yielding a ratio between -1 to 1 (Justice et al. 1985; Karnieli
et al. 2010). NDVI takes advantage of unique plant features, such as the absorption of light in
the visible spectrum, which includes photosynthetically active radiation, making them appear
relatively dark in this wave-length band (Björkman and Demmig-Adams 1995). Meanwhile,
plant canopies reflect most of near-infrared radiation received, which facilitates plant thermal
27
regulation (Peñuelas and Filella 1998). Therefore, under conditions conducive to plant growth
and development, healthy and vigorous plants will present an NDVI value closer to 1 and
diseased or stressed plants close to 0 (Chenglin Liu et al. 2004; Moriondo et al. 2007; Bravo et
al. 2003). NDVI is also consider a good estimator of photosynthesis activity (Gamon et al. 1995;
Young and Harris 2005). More recently, NDVI has been adopted as an indicator of drought
stress. Drought conditions decrease plant greenness, thereby measurably decreasing their NDVI
(Sims et al. 2006; Xu et al. 2011).
When available and economically viable, irrigation is used in soybean production to
curtail yield losses due to drought stress. By reducing water deficit stress, irrigation could also
decrease yield losses caused by charcoal rot. However, soybean yield response to charcoal rot
under different water deficit stress levels is not well understood. Thus, the objectives of the
present study were to elucidate: (1) the effect of charcoal rot on soybean yield under field
conditions, (2) the result of drought stress on charcoal rot severity, and (3) the change in yield in
response to charcoal rot under different irrigation regimes.
Materials and methods
Experimental design and implementation. A field experiment was designed and
implemented at Lon Mann Cotton research station, Marianna, AR to examine how drought stress
modulates the effect of charcoal rot on soybean yield. The experiment had a full-factorial design
with three irrigation regimes, four cultivars, and two inoculation treatments. A split-plot design
was implemented in the field with irrigation being the main plot and the combination of cultivar
x inoculation the split-plot level. Each treatment combination was replicated six times. The
experiment was executed during the growing season of 2011 and repeated in 2013.
28
Experimental units were represented by six-row plots, 6.1 meters in length, with approximately
81 cm between rows planted in-furrow. Plots were sown at a rate of 32 seeds m-1.
Three irrigation regimes were established to induce different levels of water deficit stress
on plants. Plots were irrigated according to crop recommendations throughout the growing
season (full-season), or the irrigation was stopped at the R5 developmental stage (irrigation cut at
R5), or no irrigation was applied at any moment. Four cultivars, with maturity within 5 days of
each other, were used in this experiment, ‘Osage’, ‘Ozark’, ‘Hutcheson’, and ‘RO1581F’.
Preliminary results indicated that the cultivar Osage had moderate resistance to charcoal rot, and
cultivar RO1581F had moderate tolerance to drought stress. Additionally, reports also indicate
cultivars Ozark and Hutcheson to be susceptible to charcoal rot (da Silva et al. 2019; Mengistu et
al. 2012, 2011a). To ensure disease development, each combination of cultivar and irrigation
regime had an inoculated and a non-inoculated treatment. Plots were mechanically harvested
and yield adjusted to 13% moisture content.
Inoculum preparation. The isolate Conway (Twizeyimana et al. 2012) collected from
disease soybean plants at Conway, AR was the source for inoculum production used in the field
inoculation. The isolate was first grown on potato dextrose agar. After five days, the colonized
growth medium was fragmented and used to inoculate sterile sorghum seeds. After three weeks,
colonized sorghum seeds were transferred to a metal screen and allowed to air dry in a fume
hood for approximately five days. After drying, any large clump of colonized seeds was broken
by hand. The inoculum was mixed with soybean seeds in the planting envelope at the rate of 5
grams per 200 seeds.
NDVI. The normalized vegetative index (NDVI) was obtained directly from a hand held
GreenSeeker sensor (Trimble, Sunnyvale, CA, USA) employed in the field. Between 15 and
29
20 measurements were taken on each of the two central rows of every plot. Measurements were
made at the R3 and R6 developmental stages during the growing seasons of 2011 and 2013. The
sensor was kept approximately 50 cm above the top of plant canopies. Measurements were made
between 10am and 3pm. For each assessment, readings from each plot were averaged yielding a
single data point per plot that was used for statistical analysis.
Disease measurements. Charcoal rot was assessed by root colonization severity, length
of stem colonization, and by estimating M. phaseolina CFUs per gram of root. At physiological
maturity, ten plants were collected from the outer two rows of every plot. All disease
measurements were performed on the same plants. Soil was removed with running tap water and
plants were allowed to air dry on a greenhouse bench. Charcoal rot severity on soybean roots
was estimated as previously described (Mengistu et al. 2013). In short, tap roots from ten plats
were excised from the main stem and split along the vertical axis. Each root was given a 1 to 5
severity rating based on the level of colonization observed in the interior tissues, where 1
signifies the absence of charcoal rot signs and 5 was given to roots with severe charcoal rot. The
level of colonization was primarily assessed based on the presence and abundance of M.
phaseolina microsclerotia and discoloration of root tissue, typical signs of charcoal rot. Charcoal
rot was also measured in regards to how much of the main stem was colonized by M. phaseolina.
The main stems of ten plants were split along its vertical axis and assessed for the presence of
microsclerotia. Then, the length between the soil line and the upper-most charcoal rot sign and
the plant height from the soil line to the tip of the main stem were measured to determine the
percent the stem colonization. In 2013, the colony forming unities per gram of root (CFU) were
enumerated as previously described (Mengistu et al. 2011a). In short, after split and rated for
severity, taproots collected from each plot were pooled and dried at 30C for 15 days and ground
30
with a Wiley  mill (Model 4; Thomas Scientific, Swedesboro, NJ, USA) with a 28-mesh screen.
The mill was cleaned with compressed air and disinfested with 70% ethanol between samples. A
subsample of 5mg was taken from ground roots of every plot and mixed in a blender for one
minute with 100 ml of 0.5% sodium hypochlorite aqueous solution. Root grounds were
recovered and rinsed with sterile distilled water on a 45m sieve. Root grounds were mixed with
molten PDA kept at 60C. The medium was amended with tergitol (100 l L-l; Sigma-Aldrich,
St. Louis, MO, USA) and rifampicin (100mg L-1; RPI, Mount Prospect, IL, USA). The medium
with the root grounds was dispensed evenly on five Petri dishes and incubated at 28C for five
days. M. phaseolina colonies were morphologically identified on each plate and counted and
CFU’s calculated.
Zone lines. The incidence of root zone lines (Olson et al. 2015) was recorded on roots
sampled for charcoal rot assessments. In split soybean tap roots, zone lines were distinguishable
as continuous black lines or curves often tracing an elliptical or circular shape, or a segment
thereof. The presence of these zone lines was scored as present or absent on every root and the
incidence of zone lines calculated for each plot.
Soil initial inoculum. To estimate the initial inoculum M. phaseolina colony forming
units were enumerated per gram of soil in the area where the experimental was conducted. At
planting, three soil cores were collected at depth of 0-10 cm from each of the two central rows of
every plot. Soil was kept refrigerated at 4C till processing. Soil from each sample was
thoroughly homogenized and CFU’s were enumerated as previously described (Mengistu et al.
2008). A subsample of approximately 5 grams was taken, weighed and oven-dried for the
estimation of moisture content. A second 5g subsample was used for plating. To estimate M.
phaseolina CFUs, soil was disinfested, rinsed and plated as described above. After 5 days plates
31
were read and CFUs were expressed per unit of dry soil. Enumeration of M. phaseolina CFU
was normalized for 1 gram of dry soil.
Environmental data. Soil temperature and moisture were recorded in full season
irrigation and no irrigation treatments. A soil moisture and temperature sensor (Grainger, Lake
Forest, IL, USA) was buried 10 cm bellow the soil surface in two plots in the central area of the
experiment in the field. One sensor was placed in a plot under the full-season irrigation regime
and another sensor in a plot without any irrigation. The sensors were deployed at planting,
placed approximately 5 cm from the row. Each sensor was equipped with a data logger
recovered at the end of the season for data retrieval.
Statistical analysis. Analysis of variance for all variables was performed with the
GLIMMIX procedure in SAS version 9.4 (SAS Institute, Cary, NC, USA). Charcoal rot root
severity (RSS) was analyzed as an ordered categorical variable. For RSS, statistical analysis was
carried out with the Multinomial distribution and cumulative logit link function options in the
GLIMMIX procedure in SAS. The variables NDVI, colonization proportion, and zone line
incidence were analyzed with a Beta distribution option in the GLIMMIX procedure in SAS.
The Variables yield and root CFU were analyzed with the Gamma distribution option in the
GLIMMIX procedure in SAS. Before Analysis, the variable root CFU was transformed to log2
of x. Linear regression analysis was performed with the lm function in R version 3.5.1 (R. Core
Team 2018).
Results
Charcoal rot severity. Root rot severity (RRS) was affected by a 3-way interaction of
irrigation x cultivar x inoculation (P<0.05; Table 1). The distribution of ratings for each
treatment are presented in Figure 1A. The significant contrasts between all treatments is
32
presented in Figure 2. Inoculation did not always significantly affect RRS, but when it did
ratings were more severe in inoculated than non-inoculated plots. This occurred for Osage in the
cut at R5 irrigation, Hutcheson and Osage in the full season irrigation and Ozark and R01581F in
the no irrigation treatment. Figure 1B shows the significant differences between cultivars under
different irrigation and inoculation treatments. In the inoculated plots, Hutcheson had
significantly greater RRS ratings than Osage and R01581F with full season irrigation. With no
irrigation Osage had lower RRS ratings than all the other cultivars and Hutcheson had
significantly lower ratings than R01581F. There were no cultivar differences in RSS ratings
with the cut at R5 irrigation. With the non-inoculated plots, Osage had significantly lower RSS
ratings than all of the other cultivars with the cut at R5 and the full season irrigation treatments
and Ozark had significantly lower RSS ratings than Hutcheson under with irrigation. Figure 1C
presents the significant differences between irrigation treatments with each cultivar in inoculated
and non-inoculated plots. With Hutcheson, RSS ratings were significantly greater in the full
season than the no irrigation inoculated plots, Osage had significantly greater RSS ratings with
the cut at R5 than the other irrigation treatments in inoculated plots. R01581F had significantly
lower RSS ratings with full season irrigation than the other irrigation treatments in inoculated
plots. With Hutcheson, Osage and R01581F in non-inoculated plots, RSS ratings were
significantly higher with cut at R5 than full season irrigation. With Osage RSS ratings were also
higher for no irrigation than full season irrigation in non-inoculated plots. RSS ratings for Ozark
in inoculated or in non-inoculated plots were not significantly different between irrigation
treatments.
Soybean main stem colonization was affected by the interactions of cultivar x year and
irrigation x year (P<0.05; Table 1). In 2011, the greatest stem colonization was in the no
33
irrigation plots and that was significantly greater than the full season irrigation (Fig. 3).
However, in 2013, stem colonization was greatest with full season irrigation and least with
irrigation cut at R5. Stem colonization in 2011 was significantly lower with Osage than all of the
other cultivars (Fig. 3B). There were no significant differences in stem colonization between
cultivars in 2013. There were no significant effects on root colonization by M. phaseolina (CFU;
Table 1). Root colonization levels ranged from 825 to 68,455 colony forming unities per gram
of dried root tissue.
NDVI. At R3, there were significant cultivar and inoculation main effects and a
significant year by irrigation interaction (Table 1). Osage had a significantly greater NDVI than
the other cultivars (Fig. 4a). Non-inoculated plots had a significantly greater NDVI than
inoculated plots (Fig. 4b). In both years, plots with full irrigation had significantly greater
NDVI’s than plots with no irrigation (Fig. 4c) NDVI’s were greater in 2013 than 2011.
At R6, there were significant year by cultivar and irrigation by cultivar interactions
(Table 1). The lowest NDVI occurred with R01581F in 2013 at R6 (Fig. 5A). All other
cultivars in 2013 and all cultivars in 2011 were not significantly different. NDVI’s were
significantly greater for full season irrigation than the no irrigation or the cut at R6 irrigation
treatments with all cultivars except Osage (Fig. 6B).
Yield. There was a significant main effect of inoculation and a significant year x
irrigation x cultivar interaction on yield (Table 1). Yields were significantly greater in the non-
inoculated than the inoculated plots, 1857 vs 1722 kg ha-1, respectively. In 2011, Yields were
significantly greater for the irrigated than the cut at R5 or the no irrigation treatments for all
cultivars except Osage (Fig. 7). With Osage, full season and cut at R5 had significantly greater
yields than no irrigation. In 2013, yields were lower, but not significantly lower for the no
34
irrigation and the cut at R5 irrigation than the full season irrigation plots for all cultivars except
R01581F. R01581F had significantly greater yields in the full season than the other irrigation
treatments. Analyzed across year, cultivar and inoculation, there were significant positive
correlations between NDVI at both R3 and R6 with yield (Table 2). There were no significant
correlations between yield and stem colonization.
Zone line incidence. There was a significant year and cultivar interaction for zone line
incidence (Table 1). Osage and R01581F had the greatest incidences of zone lines in 2011 and
Hutcheson and Osage had the greatest incidence in 2013. Ozark had the lowest incidence in
2011 and the Ozark and R01581F had the lowest in 2013. (Table 3).
Environmental conditions. Average soil temperatures were above 30oC from July 1
through August 8 in 2011, but was at or below 30oC throughout 2013 (Fig. 7). Soil moisture in
the non-irrigated plots reached -200 kPa from July 20-29, August 5-8, and September 1-20 in
2011. In 2013, non-irrigated plots reached -200 kPa from September 1-20.
Discussion
Irrigation strongly impacted soybean yield. As expected, treatments under full-season
irrigation had much higher yields, indicating that there was a significant water deficit stress on
plots under no irrigation, or when irrigation was cut at the developmental stage R5. Water deficit
stress, consequence of the different irrigation regimes, was also illustrated by canopy greenness
levels measured by NDVI. Together, yield and NDVI differences among the irrigation
treatments support considerable differences in stress levels the different treatments underwent
during the growing seasons. NDVI has been previously identified not only as a good estimator
for drought stress but also a good predictor of yield in multiple crops (Moriondo et al. 2007;
Crusiol et al. 2017). A significant relationship between NDVI and yield was also identified in
35
both years of this study further supporting considerable water deficit stress differences among
the treatments. Surprisingly, yield and NDVI at R6 indicated very little differences between
irrigating soybean thru R5 and no irrigation. Although, the critical importance of irrigation
scheduled during reproductive stages of soybean, in particular during pod fill, has been amply
reported in the literature (Francis et al. 2018; Doss et al. 1974; Ashley and Ethridge 1978).
Charcoal rot root symptoms were affected by irrigation. Higher root disease severity was
observed in treatments where irrigation was cut at R5, particularly in artificially inoculated plots.
This was the only treatment combination where no cultivar effect was observed; all cultivars
presented high severity levels. Additionally, when irrigation was cut at R5, artificial inoculation
only affected charcoal rot symptoms for the cultivar Osage, increasing it. Together, these data
indicate the water deficit stress may have provided a more conducive environment for disease
development, overwhelming any horizontal resistance in this cultivar. Meanwhile, in treatments
not irrigated or irrigated full season, where disease severity was lower, cultivar had a more
significant effect. In particular, Hutcheson consistently presented higher disease severity while
Osage presented lower disease. Thus, the present work further implicates drought stress as an
important factor in charcoal rot severity. Furthermore, under extreme environmental conditions
and abundance of inoculum, differences due to quantitative genetic resistance may not be
detectable wish RSS assessment. Therefore, some level of water deficit stress management may
be advisable in field-based resistance screening for charcoal rot. Our results indicate that
inoculation coupled with full season irrigation were the best circumstances to observe charcoal
rot severity differences among cultivars.
Charcoal rot severity poorly explained variations in yield although non-inoculated plots
yielded significantly better than inoculated plots. M. phaseolina is considered to be a major
36
soybean pathogen. Charcoal rot has been reported to cause severe yield loss throughout soybean
growing regions world-wide, particularly when coupled with drought. Even though irrigation
had an observable effect on charcoal rot severity, the variation in disease due to irrigation was
not significantly correlated to yield, even in treatments with increased drought stress levels. This
study found little relationship between charcoal rot severity and yield responses. These results
were not replicated in 2013. Meanwhile, root CFU and stem colonization could not explain yield
in any circumstance. This poor relationship between disease measurements and yield response
could be the result of cultivar tolerance. Tolerance is the host genetic-controlled phenomenon
where the presence of disease does not impact yield. However, significant levels of tolerance to
charcoal rot have not been described. Alternatively, the poor relationship between charcoal rot
and yield could be the result of non-representative disease assessments. The measurements used
to assess disease might not appropriately describe damage done to soybean by charcoal rot. This
would indicate that disease measurements done at or after the onset of senescence, as it is
commonly done for over five decades, may not hold great value for genetic resistance screening
or epidemiological studies. In this case, disease assessments done during developmental stages
critical for yield components might provide a more reliable estimation of yield loss due to
charcoal rot.
No charcoal rot symptoms were observed before plant senescence. When severe,
charcoal rot has been reported to kill soybean plants, causing discoloration on dead tissues,
particularly under drought stress. Even though severe tap root symptoms were observed in most
taproots of plants under no irrigation, no premature dead plants were observed before harvest
maturity. Furthermore, there are no reports of charcoal rot causing death of soybean plants under
controlled experimental conditions. However, the ready production of abundant microsclerotia
37
at the onset of senescence or premature plant death caused by extraneous factors, could make
apparent a correlation relationship between plant death and signs of charcoal rot despite the lack
of cause-effect.
38
Literature cited
Akhtar, K. P., Sarwar, G., and Arshad, H. M. I. 2011. Temperature response, pathogenicity, seed
infection and mutant evaluation against Macrophomina phaseolina causing charcoal rot
disease of sesame. Arch. Phytopathol. Plant Prot. 44:320–330
Almeida, Á. M., Amorim, L., Bergamin Filho, A., Torres, E., Farias, J. R., Benato, L. C., Pinto,
M. C., and Valentim, N. 2003. Progress of soybean charcoal rot under tillage and no-
tillage systems in Brazil. Fitopatol. Bras. 28:131–135
diversity of Macrophomina phaseolina. Trop. Plant Pathol. 33:257–264
Ashley, D. A., and Ethridge, W. J. 1978. Irrigation Effects on Vegetative and Reproductive
Development of Three Soybean Cultivars 1. Agron. J. 70:467–471
Atkinson, N. J., and Urwin, P. E. 2012. The interaction of plant biotic and abiotic stresses: from
genes to the field. J. Exp. Bot. 63:3523–3543
Azarmanesh, N., Bond, J. P., Vick, A., Mengistu, A., and Fakhoury, A. M. 2011. A qPCR assay
to detect and quantify Macrophomina phaseolina in soybean roots. Phytopathology.
101:S11–S12
Björkman, O., and Demmig-Adams, B. 1995. Regulation of Photosynthetic Light Energy

Capture, Conversion, and Dissipation in Leaves of Higher Plants. Pages 17–47 in:
Ecophysiology of Photosynthesis, Springer Study Edition. E.-D. Schulze and M.M.
Caldwell, eds. Springer Berlin Heidelberg, Berlin, Heidelberg.
Blanco-López, M. A., and Jiménez-Díaz, R. M. 1983. Effect of irrigation on susceptibility of

sunflower to Macrophomina phaseoli. Plant Dis. 67:1214–1217
Bravo, C., Moshou, D., West, J., McCartney, A., and Ramon, H. 2003. Early Disease Detection
in Wheat Fields using Spectral Reflectance. Biosyst. Eng. 84:137–145
Bristow, P. R. 1986. Macrophomina phaseolina, Another Cause of the Twin-Stem Abnormality

Disease of Soybean. Plant Dis. 70:1152
Chenglin Liu, Bingfang Wu, Yichen Tian, Wenbo Xu, and Jianxi Huang. 2004. Crop drought
monitoring using serial NDVI and NDWI in Northern China. Pages 2264–2267 vol.4 in:
IGARSS 2004. 2004 IEEE International Geoscience and Remote Sensing Symposium
Cloud, G. L., and Rupe, J. C. 1994. Influence of nitrogen, plant growth stage, and environment
on charcoal rot of grain sorghum caused by Macrophomina phaseolina (Tassi) Goid.
Plant Soil. 158:203–210
39
Collins, D. J., Wyllie, T. D., and Anderson, S. H. (Department of P. P. 1991. Biological activity
of Macrophomina phaseolina in soil. Soil Biol. Biochem. U. K.
Cook, B. I., Ault, T. R., and Smerdon, J. E. 2015. Unprecedented 21st century drought risk in the
American Southwest and Central Plains. Sci. Adv. 1:e1400082
Crusiol, L. G. T., Carvalho, J. de F. C., Sibaldelli, R. N. R., Neiverth, W., do Rio, A., Ferreira, L.
C., Procópio, S. de O., Mertz-Henning, L. M., Nepomuceno, A. L., Neumaier, N., and
Farias, J. R. B. 2017. NDVI variation according to the time of measurement, sampling
size, positioning of sensor and water regime in different soybean cultivars. Precis. Agric.
18:470–490
Diourte, M., Starr, J. L., Jeger, M. J., Stack, J. P., and Rosenow, D. T. 1995. Charcoal rot
(Macrophomina phaseolina) resistance and the effects of water stress on disease
development in sorghum. Plant Pathol. 44:196–202
Doss, B. D., Pearson, R. W., and Rogers, H. T. 1974. Effect of Soil Water Stress at Various
Growth Stages on Soybean Yield 1. Agron. J. 66:297–299
Doubledee, M. D., Rupe, J. C., Rothrock, C. S., and Bajwa, S. G. 2018. Effect of root infection
by Macrophomina phaseolina on stomatal conductance, canopy temperature and yield of
soybean. Can. J. Plant Pathol. 40:272–283
Francis, P. B., Stark, C. R., Henry, C. G., Espinoza, L., Ismanov, M., Hayes, S., and Earnest, L.
2018. Scheduling of Furrow Irrigation Initiation on Soybean Yield and Net Returns. Crop
Forage Turfgrass Manag. 4
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki, K., and
Shinozaki, K. 2006. Crosstalk between abiotic and biotic stress responses: a current view
from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol.
9:436–442
Gamon, J. A., Field, C. B., Goulden, M. L., Griffin, K. L., Hartley, A. E., Joel, G., Penuelas, J.,
and Valentini, R. 1995. Relationships Between NDVI, Canopy Structure, and
Photosynthesis in Three Californian Vegetation Types. Ecol. Appl. 5:28–41
Gangopadhyay, S., Wyllie, T. D., and Teague, W. R. 1982. Effect of bulk density and moisture
content of soil on the survival of Macrophomina phaseolina. Plant Soil. 68:241–247
Garcia-Olivares, J. G., Lopez-Salinas, E., Cumpian-Gutierrez, J., Cantu-Almaguer, M. A.,

Zavala-Garcia, F., and Mayek-Perez, N. 2012. Grain Yield and Charcoal Rot Resistance
Stability in Common Beans under Terminal Drought Conditions. J. Phytopathol. 160:98–
105
Hartman, G. L., Sinclair, J. B., and Rupe, J. C., eds. 1999. Compendium of soybean diseases.
Fourth Edition. American Phytopathological Society (APS Press), St. Paul.
40
Ijaz, S., Sadaqat, H. A., and Khan, M. N. 2013. A review of the impact of charcoal rot
(Macrophomina phaseolina) on sunflower. J. Agric. Sci. 151:222–227
Justice, C. O., TOWNSHEND, J. R. G., HOLBEN, B. N., and TUCKER, C. J. 1985. Analysis of
the phenology of global vegetation using meteorological satellite data. Int. J. Remote
Sens. 6:1271–1318
Karnieli, A., Agam, N., Pinker, R. T., Anderson, M., Imhoff, M. L., Gutman, G. G., Panov, N.,
and Goldberg, A. 2010. Use of NDVI and land surface temperature for drought
assessment: Merits and limitations. J. Clim. 23:618–633
Plant Dis. 84:895–900
Koike, S. T. 2008. Crown rot of strawberry caused by Macrophomina phaseolina in California.

Plant Dis. 92:1253–1253
Liu, X., and Liu, C. 2016. Effects of Drought-Stress on Fusarium Crown Rot Development in
Barley. PLOS ONE. 11:e0167304
Livingston, J. 1945. Charcoal Rot of Corn and Sorghum. Hist. Res. Bull. Neb. Agric. Exp. Stn.
Marvel, K., Cook, B. I., Bonfils, C. J. W., Durack, P. J., Smerdon, J. E., and Williams, A. P.
2019. Twentieth-century hydroclimate changes consistent with human influence. Nature.
569:59
Mayek-Pérez, N., GarcÍa-Espinosa, R., LÓpez-CastaÑeda, Cá., Acosta-Gallegos, J. A., and

Simpson, J. 2002. Water relations, histopathology and growth of common bean
(Phaseolus vulgaris L.) during pathogenesis of Macrophomina phaseolina under drought
stress. Physiol. Mol. Plant Pathol. 60:185–195
Mengistu, A., Arelli, P. A., Bellaloui, N., Bond, J. P., Shannon, G. J., Wrather, A. J., Rupe, J. C.,
Chen, P., Little, C. R., Canaday, C. H., Newman, M. A., and Pantalone, V. R. 2012.
Evaluation of Soybean Genotypes for Resistance to Three Seed-borne Diseases. Plant
Health Prog.
Mengistu, A., Arelli, P. A., Bond, J. P., Shannon, G. J., Wrather, A. J., Rupe, J. B., Chen, P.,
Little, C. R., Canaday, C. H., Newman, M. A., and Pantalone, V. R. 2011a. Evaluation of
Soybean Genotypes for Resistance to Charcoal Rot. Plant Health Prog.
Mengistu, A., Arelli, P., Bond, J., Nelson, R., Rupe, J., Shannon, G., and Wrather, A. 2013.
Identification of Soybean Accessions Resistant to Macrophomina phaseolina by Field
Screening and Laboratory Validation. Plant Health Prog.
41
Mengistu, A., Ray, J. D., Smith, J. R., and Paris, R. L. 2007. Charcoal Rot Disease Assessment
of Soybean Genotypes Using a Colony-Forming Unit Index. Crop Sci. 47:2453
Mengistu, A., Reddy, K. N., Zablotowicz, R. M., and Wrather, A. J. 2008. Propagule Densities
of Macrophomina phaseolina in Soybean Tissue and Soil as Affected by Tillage, Cover
Crop, and Herbicide. Plant Health Prog.
Mengistu, A., Smith, J. R., Ray, J. D., and Bellaloui, N. 2011b. Seasonal progress of charcoal rot
and its impact on soybean productivity. Plant Dis. 95:1159–1166
Moriondo, M., Maselli, F., and Bindi, M. 2007. A simple model of regional wheat yield based on
NDVI data. Eur. J. Agron. 26:266–274
Odvody, G. N., and Dunkle, L. D. 1979. Charcoal stalk rot of sorghum: effect of environment on
host-parasite relations. Phytopathology. 69:250–254
Mature Soybean Plants. Plant Health Prog.
Pande, S., Mughogho, L. K., and Karunakar, R. I. 1990. Effect of moisture stress, plant
population density and pathogen inoculation on charcoal stalk rot of sorghum. Ann. Appl.
Biol. 116:221–232
Parsons, M. W., and Munkvold, G. P. 2010. Associations of planting date, drought stress, and
insects with Fusarium ear rot and fumonisin B1 contamination in California maize. Food
Addit. Contam. Part Chem. Anal. Control Expo. Risk Assess. 27:591–607
Peñuelas, J., and Filella, I. 1998. Visible and near-infrared reflectance techniques for diagnosing
plant physiological status. Trends Plant Sci. 3:151–156
R. Core Team. 2018. R: A Language and Environment for Statistical Computing.
2017. Advancing Our Understanding of Charcoal Rot in Soybeans. J. Integr. Pest Manag.
8
Shaukat, S. S., and Siddiqui, I. A. 2003. The influence of mineral and carbon sources on
biological control of charcoal rot fungus, Macrophomina phaseolina by fluorescent
pseudomonas in tomato. Lett. Appl. Microbiol. 36:392–398
Sheikh, A. H., and Ghaffar, A. 1979. Relation of sclerotial inoculum density and soil moisture to
infection of field crops by Macrophomina phaseolina. Pak. J. Bot. 11:185–189
Short, G. E., Wyllie, T. D., and Bristow, P. R. 1980. Survival of Macrophomina phaseolina in
soil and in residue of soybean. Phytopathology. 70:13–17
42
da Silva, M. P., Pereira, A., Rupe, J. C., Bluhm, B. H., Gbur, E. E., Wood, L., Mozzoni, L. A.,
and Chen, P. 2019. Effectiveness of a Seed Plate Assay for Evaluating Charcoal Rot
Resistance in Soybean and the Relationship to Field Performance. Plant Dis. :PDIS-10-
18-1908-RE
Sims, D. A., Luo, H., Hastings, S., Oechel, W. C., Rahman, A. F., and Gamon, J. A. 2006.
Parallel adjustments in vegetation greenness and ecosystem CO2 exchange in response to
drought in a Southern California chaparral ecosystem. Remote Sens. Environ. 103:289–
303
Songa, W., Hillocks, R. J., Mwango’mbe, A. W., Buruchara, R., and Ronno, W. K. 1997.
Screening common bean accessions for resistance to charcoal rot (macrophomina
phaseolina) in eastern Kenya. Exp. Agric. 33:459–468
Su, G., Suh, S.-O., Schneider, R. W., and Russin, J. S. 2001. Host Specialization in the Charcoal
Rot Fungus, Macrophomina phaseolina. Phytopathology. 91:120–126
Tenkouano, A., Miller, F. R., Frederiksen, R. A., and Rosenow, D. T. 1993. Genetics of
nonsenescence and charcoal rot resistance in sorghum. Theor. Appl. Genet. 85:644–648
Tesso, T. T., Claflin, L. E., and Tuinstra, M. R. 2005. Analysis of Stalk Rot Resistance and
Genetic Diversity among Drought Tolerant Sorghum Genotypes. Crop Sci. 45:645–652
Twizeyimana, M., Hill, C. B., Pawlowski, M., Paul, C., and Hartman, G. L. 2012. A Cut-Stem
Inoculation Technique to Evaluate Soybean for Resistance to Macrophomina phaseolina.
Plant Dis. 96:1210–1215
Wrather, J. A., Anderson, T. R., Arsyad, D. M., Gai, J., Ploper, L. D., Porta-Puglia, A., Ram, H.
H., and Yorinori, J. T. 1997. Soybean disease loss estimates for the top 10 soybean
producing countries in 1994. Plant Dis. 81:107–110
Xiong, L., and Yang, Y. 2003. Disease Resistance and Abiotic Stress Tolerance in Rice Are
Inversely Modulated by an Abscisic Acid–Inducible Mitogen-Activated Protein Kinase.
Plant Cell. 15:745–759
Xu, L., Samanta, A., Costa, M. H., Ganguly, S., Nemani, R. R., and Myneni, R. B. 2011.
Widespread decline in greenness of Amazonian vegetation due to the 2010 drought.
Geophys. Res. Lett. 38
Young, S. S., and Harris, R. 2005. Changing patterns of global‐scale vegetation photosynthesis,
1982–1999. Int. J. Remote Sens. 26:4537–456
43
Tables
Table 1. Analysis of variance for fixed effects. The p values of each fixed effect are shown for each dependent variable studied. The
analyze of variance was performed with the GLIMMIX procedure of SAS 9.4 system.
NDVI NDVI Colonization Zone line Root
Effect 1 2 Yield3 4 5 RSS7
at R3 at R6 proportion incidence CFU6
year <.0001 0.096 0.3263 0.9955 0.4841 - 0.0951
irrigation <.0001 <.0001 <.0001 0.0079 0.2791 0.6071 0.0009
cultivar <.0001 <.0001 0.7188 <.0001 0.0100 0.2533 <.0001
inoculation 0.0233 0.2221 0.0185 0.1355 0.4077 0.6903 <.0001
year*irrigation 0.0002 0.1891 0.0387 0.0016 0.5727 - 0.0584
year*cultivar 0.1710 0.0049 0.0639 0.0010 0.0261 - 0.2027
year*inoculation 0.5698 0.6776 0.7432 0.9403 0.4520 - 0.2745
irrigation*cultivar 0.2933 <.0001 0.0639 0.3797 0.6726 0.4176 0.3837
irrigation*inoculation 0.7355 0.7741 0.9347 0.4175 0.6761 0.2658 0.366
cultivar*inoculation 0.0736 0.8509 0.5576 0.654 0.7595 0.7425 0.9546
year*irrigation*cultivar 0.8590 0.5087 0.0363 0.5938 0.8373 - 0.0509
year*irrigation*inoculation 0.6637 0.8978 0.4886 0.7417 0.4265 - 0.4967
year*cultivar*inoculation 0.0682 0.8415 0.7931 0.5252 0.4073 - 0.2179
irrigation*cultivar*inoculation 0.9947 0.9686 0.9151 0.8495 0.9790 0.8952 0.0139
year*irrigation*cultivar*inoculation 0.5524 0.8376 0.2933 0.1390 0.6147 - 0.5403
1NDVI measure at the pod stage, before seed filling. 2NDVI measured at the completion of seed filling stage. 3grain yield adjusted to
13% moisture content. 4Mean proportion of main stem with signs of charcoal rot. 5Incidence of zone lines caused by P. longicolla
visually assessed in ten taproots for every plot. 6Colony forming unities of M. phaseolina per gram of dry soybean tap root evaluated
from plants collected in 2013. 7Severity of charcoal rot on soybean taproots measured from 1, no disease, to 5 severe signs of charcoal
rot.
44
Table 2. Relationship between NDVI and soybean yield.
Intercept Slope
Stage Year Standard Standar R2
P value1 Estimate P value2 Estimate
error d error
2011 0.000481 -1221.5 341.8 3.60E-16 6213 673.5 0.3747
R3
2013 5.80e-11 -8771 1236 1.72E-15 12851 1477 0.3629
2011 <2e-16 -3226.9 317.2 <2E-16 7764.1 477.1 0.6509
R6
2013 0.0495 -673.4 339.9 2.16E-13 4226.6 538.2 0.3184
Statistics generated from linear regression where yield is modelled as a function of NDVI
measured at wither the pod stage before seed filling (R3) and the completion of seed filling stage
(R6). 1P value for the null hypothesis of intercept = 0. 2P value for the null hypothesis of
regression slope = zero.
Table 3. Incidence of zone lines in soybean roots.

Year Cultivar Mean1 SE
2011 Hutchens 17.19 B 0.0306
2011 Osage 25.86 A 0.0408
2011 Ozark 7.78 C 0.0165
2011 RO1581F 21.86 AB 0.0422
2013 Hutchens 28.98 A 0.0413
2013 Osage 26.59 A 0.0403
2013 Ozark 19.17 B 0.0335
2013 RO1581F 18.39 B 0.0321
1Means incidence of zone lines caused by P. longicolla in soybean tap roots. Zone lines were
visually assessed in ten taproots for every plot. Roots were collected after the onset of
senescence. Means followed by different letters are significantly different from each other
(P<0.05) according to Tukey’s range test.
45
Figures
A
Cut at R5 Full season No irrigation
1.00
1.00
Inoculated
Proportionof roots 0.75
0.75
1.00 Severity
Response
Response
0.50
0.50
0.75 5 5
0.25 Response
0.25
0.50
Proportion
Proportion
0.00 4
5 4
0.00
0.25
Proportion
1.00
1.00 3
0.00 ns * ns ns ** ** ns ns ns ns * * 4 3
Non-Inoculated
0.75
0.75 2
1.00 3 2
0.50
0.50
0.75 1
2 1
0.25
0.25
0.50
0.00 1
0.00
0.25
n e rk F n e rk F n e rk F
15 k
15 k
15 k
F
F
O n
ge
O n
ge
O n
ge
so sag za 581 so sag za 581 so sag za 581
RO zar
R za r
RO zar
o
o
0.00
81
81
81
es
es
es
sa
sa
sa
e e e
O
O
chn O O 1 h O 1 h O 1
ch
ch
ch
O O
ut o ge ark O1F utscon age ark RO81F utscon age ark RO81F
O
ut
ut
ut
Hhes sa Oz 1R58 s Oz 15 s Oz 15
H
H
Hhe Hhe
c O c O c O
ut RO ut RO ut RO
H H H
B Cut at R5 Full season No irrigation
Inoculated
RO1581F RO1581F RO1581F
Ozark Ozark Ozark

RO1581F cofi$sig
Osage Osage Osage
Ozark Not
0 significant
on e rk on
ge r k
O on
Osage 1
Significant
rk
O e
s ag za es s a z a
Non-Inoculated
g
s
za
he Os
sa
e
RO1581F O h O
RO1581Futc O
ch
RO1581Futc
ut
H H n
groek
H
Ozark Ozark Ozark hszeaas

cO
O
ut
Osage Osage Osage H
on ge r k on ge r k
es s a z a
O on
rk
O e
es s a z a
g
h
s
za
O
sa
tc O
e
h O
ch
H
u u tc O
ut
H
H
C
Hutcheson Osage Ozark RO1581F
Inoculated
Not irrigated Not irrigated Not irrigated Not irrigated

RO1581F cofi$sig
Full season Full season Full season Full season
Ozark Not
0 significant
Osage 1
Significant
s e R5
on
se 5
on
se 5
on
s e R5
on
Non-Inoculated
ll t R
ll t R
as
as
as
as
at
at
Fu t a
Fu t a
ut
ut
u
Not irrigated Not irrigated Not irrigated Not irrigated

ekn
ll
ll
C
C
Fu
Fu
asgro
szea
cOOh
Full season Full season Full season Full season

ut
H
s e R5
on
se 5
on
s e R5
on
se 5
on
ll t R
ll t R
as
as
as
as
at
at
Fu t a
Fu t a
ut
ut
u
u
ll
ll
C
C
C
Fu
Fu
46
Figure 1. Irrigation interacted with cultivar and inoculation and significantly impacted charcoal
rot severity in soybean roots as measured with the RSS severity scale. (A) Bars of different
colors indicate the proportion of roots rated for within each severity scale, 1- absence of signs to
5- severe charcoal rot. Significance levels are shown for inoculation comparisons within cultivar
and irrigation, not significant (ns), P<0.05 (*), and P<0.01 (**). (B) significance for contrasts of
cultivars within inoculation and irrigation. (C) significance for contrasts of irrigation within
inoculation and cultivars. Contrasts were considered significant when P<0.05. Analysis of
variance, least square means, and contrasts were obtained with the GLIMMIX procedure in SAS
9.4. RSS severity scale was treated as ordered categorical with Multinomial distribution.
47
No Irrig x Osage x Not Inoc
No Irrig x Osage x Inoculat
No Irrig x Hutchens x Not Inoc
No Irrig x Hutchens x Inoculat
Full Sea x RO1581F x Not Inoc
Full Sea x RO1581F x Inoculat
Full Sea x Ozark x Not Inoc
No Irrig x RO1581F x Inoculat
Full Sea x Ozark x InoculatNo Irrig x Ozark x Not Inoc
co$sig
No Irrig x Ozark x Inoculat
Full Sea x Osage x Not Inoc Not
0 significant
Full Sea x Osage x Inoculat No Irrig x Osage x Not Inoc
1
Significant
Full Sea x Hutchens x NotNo InocIrrig x Osage x Inoculat
No Irrig x Hutchens x Not Inoc
Full Sea x Hutchens x Inoculat
No Irrig x Hutchens x Inoculat
Cut at R x RO1581F x Not Inoc
Full Sea x RO1581F x Not Inoc
Cut at R x RO1581F x Inoculat
Full Sea x RO1581F x Inoculat
Cut at R x Ozark x Not Inoc
Full Sea x Ozark x Not Inoc
Cut at R x Ozark x InoculatFull Sea x Ozark x Inoculat
Cut at R x Osage x Not Inoc Full Sea x Osage x Not Inoc
Cut at R x Osage x Inoculat Full Sea x Osage x Inoculat
Cut at R x Hutchens x NotFull InocSea x Hutchens x Not Inoc
Full
Cut at R x Hutchens x Inoculat Sea x Hutchens x Inoculat
Cut at R x RO1581F x Not Inoc
c at oc lat oc lat oc lat oc lat oc lat oc lat oc lat oc lat oc lat oc lat oc
Cut at IR no cxulRO1581F
n u n ux Inoculat n u n u n u n u n u n u n u n u n
t t I o c o t I o c o t I oc o t I o c ot I o c ot I oc o t I o c o t I o c o t I o c o t I o c o t I
CutNat o IR no xNoOzark
In N xIn Not N In N In N In N In N In N In N In N In N
Inoc
x x x x x ex x sx x Fx x kx x ex x sx x Fx x kx x ex x
F 1FatrkRaxrk Ozark
Cut e g xs Inoculat
n F 1 r k r e g s n F 1 rk r e g s
5 8 5 za z sag sa hen he 581 58 za za sag sa hen he 581 58 za za sag sa hen
1 8
1
Cut O at O
1 O x x O x ut u 1 O1 Inoc
R x O
Osage c tcx Not O O O O tc tc 1 1 O O O O tc
ROx R rCutg rrigatig Rx g H H RO R a x a x x a x Hu Hu RO RO x R x x x Hu
x r i i
r r x xOsage x x xxInoculate e ea e x x x x t R t R t R x
r ig rrig o I o I o Ir o Ir rig rrig ea ea ll Sull Sll S ll S ea ea R t R t a ut a t at t a t R
Ir I N NCut N at N RIr xo IHutchens
S S u x Not u S S t a u
u Inoc u u a
o o o ll ull F F F F ull ull ut a ut C C C C ut
N N Cut at N RNxFuHutchens F F F C C
x Inoculat C
c a t c a t c a t c a t c a t c a t c a t c a t c at c at c a t c
Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino cul Ino
o t o o t o o t o o t o o t o ot o o t o o t o o t o o t o o t o o t
N In N In N In N In N In N In N In N In N In N In N In N
x Fx x kx x ex x sx x Fx x kx x ex x sx x Fx x kx x ex x
F 1 rk r e g s n F 1 r k r e g s n F 1 r k r e g s
5 81 58 za za sag sa hen he 581 58 za za sag sa hen he 581 58 za za sag sa hen
1 O1 x O x O O x O utc utc 1 O1 x O x O O x O utc utc 1 O1 x O x O O x O utc
ROx R rig rrig ig x rig x H x H ROx R ea ea a x ea x H x H ROx R R t R R x R x H
x r r x e x t t
g ig I o I Ir Ir ig ig a a l S ll S S l S a a R R t a t a at a R
rI ri Irr No N No No Irr Irr Se l Se Ful Fu ull Ful Se l Se at at Cu Cu ut Cut at
o o o o ll l F l l ul t ut C ut
N N N N Fu F u F u F Cu C C
Figure 2. All contrasts from irrigation x cultivar x inoculation 3-way interaction for charcoal rot
severity measured with 1-5 disease scale. Contrasts were considered significant when P<0.05.
Analysis of variance, least squares means, and contrasts were obtained with the GLIMMIX
procedure in SAS 9.4. RSS severity scale was treated as ordered categorical with Multinomial
distribution.
48
A
A A
AB
AB
B
B
AB
AB AB
AB AB
B
Figure 3. Proportion of main stem colonization. The proportion of main stem length colonized
by M. phaseolina was affected by the interactions of cultivar by year and irrigation by year. Bars
within each panel with different letters are significantly different (P<0.05) according to Tukey’s
range test. Error bars represent the standard error of the mean.
49
A B
B
A A
B B B
C
AB A
B
C
C
Figure 4. NDVI at R3 developmental stage reviews soybean plants were significantly more
stressed in 2011 than in 2013. (A) Cultivar had a significant effect on NDVI measure at R3.
The cultivar Ozark presented significantly higher NDVI than Hutcheson, Osage, and RO1581F.
(B) Non-inoculated treatments had significantly higher NDVI measurements than inoculated
treatments. (C) Plants had significantly lower NDVI in 2011 for all irrigation regimes than in
2013. Bars within each panel with different letters are significantly different (P<0.05) according
to Tukey’s range test. Error bars represent the standard error of the mean.
50
A
A A A A A A
AB
B
A AB A
ABC
CD ABC DE
DEF DEF DEF
EF
F
Figure 5. NDVI at R6 developmental stage. At R6, significant interactions of cultivar by year

and cultivar by irrigation were observed. (A) RO1581F had significantly lower NDVI at 2013,
all other cultivars had similar NDVI measurements in both years. (B) Full-season irrigation and
irrigation cut at R5 presented similar NDVI measurements for the cultivar Osage. Whereas,
Hutcheson, Ozark, and RO1581F presented significantly lower NDVI measurements when
irrigation was cut at R5 when compared to cull season irrigation. Bars within each panel with
different letters are significantly different (P<0.05) according to Tukey’s range test. Error bars
represent the standard error of the mean.
51
A
A AB
AB
ABCD
ABCDEF
EFG
FG FG
FG FG FG
G
ABC
ABCD
ABCDE
ABCDEF
BCDEF
CDEFG CDEFG CDEF CDEF DEFG
DEFG
FG
2011
2011
3200
11 2400
1600 Irrigation
Regimes
Yield (kg ha)
800
0 Irrigation
Irrigation Regimes No Irrigation
2013
Regimes No Irrigation Irrigation cut at R5
2013
3200
2400 No Irrigation Irrigation cut at R5 Irrigated full season
13
1600
Irrigation cut at R5 Irrigated full season
800
0
Figure 6. Effect of Irrigation,
Irrigated inoculation and cultivar on soybean yield. Bars within each panel
full season
Hutcheson Osage Ozark RO1581F
with different letters are significantly different (P<0.05) according to Tukey’s range test. Error
Hutcheson bars
Osage
representOzark RO1581F
the standard error of the mean.
Ozark RO1581F
52
Soil temperature and moisture
2011 2013
Soil temperature °C
Soil temperature °C
40
30
30
20
20
10 10
Soil−water tension (Kpa)
Soil−water tension (Kpa)

0 0
−50 −50
Irrigation
−100 −100 No
Yes
−150 −150
−200 −200
July August September October November June July August September October
Time Time
Figure 7. Soil temperature and moisture. Solid lines indicate daily mean values while dashed lines indicate daily maximum and
minimum. Measurements were taken at a depth of10 cm. Sensor were 5cm offset from soybean planting row atop of a furrow bed.
Blue lines are soil temperature and moisture measured in irrigated plots. Red lines are soil temperature and moisture measured in non-
irrigated plots. Dashed lines around solid lines represent the daily maximum and minimum values.
56
Chapter III: Zone lines associated with P. longicolla alter soybean root colonization by M.
phaseolina
Abstract
Charcoal rot is an economically important soybean disease caused by M. phaseolina. During
plant senescence M. phaseolina produces large numbers of melanized microsclerotia in stem and
root tissues that serve as primary inoculum for future epidemics. The amount of microsclerotia
in soybean tap rots and the extent of stem in which they are produced are used to rate charcoal
rot disease severity. Zone lines are often associated with wood decaying fungi that densely
colonize a layer of three to five host cells with dark pigmented hyphae. The objectives of this
study were: (I) to determine if zone lines incidence is affected by location and soybean cultivar
and (II) to investigate the fungi associated with zone lines in soybean tap roots. In the growing
season of 2012, a set of 18 cultivars of maturity groups (MG) II to V were grown at two
locations, Rohwer and Stuttgart, AR. A second set of cultivars, 14 from MG IV and 12 from
MG V, was grown in Marianna, AR. Only cultivars Osage, R01581F, and DK4866 were present
at all locations. Cultivar had a significant effect on the presence of zone lines at Stuttgart (P
0.002) and at Rohwer (P<0001), where incidence ranged from 0-49% and 5-72%, respectively,
but not at Marianna (P 0.519) where incidence ranged from 38-87%. Incidence was significantly
higher at Rohwer than at Stuttgart (P<.0001), but there was a significant interaction between
location and cultivar (P<0.001). When isolations were made from tissues enclosed by the zone
lines, P. longicolla was isolated from 95.4% of roots while M. phaseolina was isolated from only
2.5% of roots and other filamentous fungi comprised 1.9% (n=368). DNA sequencing of ITS,
EF-1 and -tubulin confirmed the identity of P. longicolla and showed tap root isolates were
indistinguishable from previously characterized seed isolates, phylogenetically. Our results
57
indicate that zone lines in soybean taproots associated with P. longicolla seem to restrict
colonization of M. phaseolina, which could be a confounding variable when screening for
charcoal rot resistance, especially since zone lines incidence seems to be affected by cultivar and
location.
Introduction
The Ascomycota fungi Macrophomina phaseolina and Phomopsis longicolla are
economically important soybean pathogens worldwide (Bellaloui et al. 2008; Wrather et al.
2010; Zorrilla et al. 1994). M. phaseolina, the causal agent of charcoal rot, is a soil born fungus
that infects soybean roots early in the season then systemically colonizes the root system and
basal stem (Mengistu et al. 2011). In most epidemics, soybean plants remain symptomless and
no signs of the pathogen are seen until the beginning of plant senescence (Short et al. 1978;
Wyllie and Calvert 1969). However, in some cases charcoal rot is reported to cause wilt and
premature plant death, particularly when associated with drought stress (Hartman, et al. 1999;
Mengistu et al. 2011; Navi and Yang 2008). Following the premature plant death or late
senescence stages, M. phaseolina rapidly produces large numbers of microsclerotia in roots and
stems of colonized plants (Kendig et al. 2000; Short et al. 1978). As a result, a distinct light
silvery-gray to blackish discoloration is observed in dead colonized plants. Besides the
characteristic discoloration, zone lines are also often seen in dead colonized tissues and have
been considered a sign of charcoal rot (Romero Luna et al. 2017). However, recent studies have
shown that black zone lines in stems and roots of dead or senesced soybean plants are caused by
P. longicolla and not M. phaseolina (Ghissi et al. 2014; Olson et al. 2015; Vidić et al. 2013).
Zone lines are layers of two to five host cells densely colonized with dark pigmented hyphae;
58
they are a common sign of fungi associated with wood decay (Campbell 1933; Li 1983;
Robinson and Laks 2010).
P. longicolla is a soil and seed born pathogen that causes pod and stem blight and seed decay
in soybean (Hobbs et al. 1985; Sinclair 1993). P. longicolla, alike M. phaseolina, is ubiquitously
present in soybean production areas, has prolonged incubation periods, and produce copious
amounts of structures, i.e. pycnidia, during plant senescence (Almeida et al. 2008; Short et al.
1978; Sinclair 1993; Wrather et al. 2010). P. longicolla can successfully overwinter in
production areas in colonized plant debris and is capable of asymptomatically infecting soybean
plants during vegetative and reproductive developmental stages (Roy and Abney 1988; Rupe
1990; Rupe and Ferriss 1987). Following infection, P. longicolla maintains an endophytic-like
lifestyle for most of crop development causing no apparent symptoms nor exhibiting any signs of
colonization (Rupe and Ferriss 1987). At senescence, P. longicolla infects seeds and under
conducive environmental condition can cause severe seed decay (Baker et al. 1987).
Additionally, once plants mature, P. longicolla produces large numbers of pycnidia on the
surfaces of aerial plant parts. In particular, characteristic vertical-row alignment pattern of
pycnidia are distinctively observed on soybean plants main stem (Baker et al. 1987; Hartman et
al. 1999; Roy and Abney 1988).
Zone lines are macroscopic black lines seen in decaying woody plant tissues (Campbell
1933). They vary from a few millimeters to a several centimeters, straight or tortuous. In some
cases, they can be observed as stand-alone lines, but more often form an enclosed shape, e.g. an
ellipsoid (Li 1983; Olson et al. 2015). Zone lines are formed by intense colonization of plant
material by pigmented fungal tissue and are often observed during wood decay (Lopez-Real
1975). Several species of filamentous fungi have cause zone lines including Xylaria polymorpha
59
(Robinson and Laks 2010), Polyporus squamosus (Campbell and Munson 1936), Armillaria
melea (Campbell 1934), and Phellinus weirri (Li 1981). However, P. longicolla is the first
species observed to cause zone lines in soybean (Olson et al. 2015). Phomopsis spp. causes zone
lines in alfalfa (Nikandrow 1989, 1990) and elm trees (Brayford 1990; Webber 1981; Webber
and Gibbs 1984). Phomopsis spp. isolated from elm trees produces barrage zones in culture
when colony margins of genetic distinct isolates meet or are in proximity to colonies from
different fungal species (Webber 1981). Zone lines in plant debris have been considered a
possible survival structure and are demonstrably associated with long term viability of Poria
weirii in soil environment (Nelson 1964).
P. longicolla causes zone lines in soybean (Olson et al. 2015). However, there has not been
documentation of how prevalent this phenomenon is in field conditions. Additionally, it remains
unknown if cultivar has an effect in the incidence of zone lines in soybean. This study
endeavored to understand how commonly zone lines are produced in soybean tap roots and if
their incidence is affected by cultivar. Additionally, field observations have suggested that signs
of M. phaseolina seem to not be produced in taproot tissues covered by zone lines. Thus, in this
study it was investigated if M. phaseolina colonization is restricted from soybean root tissues
where zone lines are present.
Plant material and M. phaseolina infestation. Zone lines incidence was assessed in
soybean tap roots of diverse plant materials grown in multiple locations in Arkansas. A total of
41 soybean genotypes, including cultivars and advanced breeding lines, were grown in M.
phaseolina artificially infested soil in three locations in the state of Arkansas during the growing
season of 2012. The primary purpose of these tests was to compare cultivar responses to charcoal
60
rot. A set of 18 genotypes, of maturity groups II to V, was grown in Stuttgart and Rohwer, AR.
A second set of 26 genotypes, of maturity groups IV and V, was grown in Marianna, AR. There
were three genotypes present in both sets, ‘Osage’, ‘R01581F’, and ‘DK4866’. A randomized
complete block design was employed in all locations with four replications in the trials at
Stuttgart and Rohwer, and five in the trial at Marianna. Experimental units consisted of four-row
plots of 6.1 meters in length with 81 cm between rows seeded with 32 seeds m-1. Before
planting, soil was tilled and bedded.
All plots were artificially infested with M. phaseolina. Initial inoculum was produced by
growing M. phaseolina on sterile sorghum seeds. The M. phaseolina soybean isolate MP-
Conway was selected for having high aggressiveness (Twizeyimana et al. 2012). Inoculum was
initially grown on potato dextrose agar (PDA; Becton Dickinson and Company, Franklin Lakes,
NJ, USA) at room temperature for seven days. Autoclave safe bags containing one liter of dried
sorghum seeds and 0.3 liter of distilled water were autoclaved twice and cooled at room
temperature for two days. One Petri dish of M. phaseolina was sectioned into rectangles of
approximate 0.5 cm2 and added to one bag of sterilized and cooled sorghum seeds. Inoculum
was periodically mixed to promote uniform colonization and incubated for 3 weeks under room
temperature. After incubation, colonized sorghum seeds were air dried for five days on a wire
screen in a fume hood. Once dried, inoculum was stored in paper bags at room temperature until
used. The inoculum mixture was planted with the soybean seeds at a rate of 1.6 grams per meter
of row.
Sample collection and processing. At the R7 reproductive stage, ten plants per plot were
dug from the two outer rows of each plot and washed with running tap water for removal of
debris and soil residue. Only plants with yellow or brown stems were collected. Plants were air
61
dried on a greenhouse bench and stems were separated from roots at the soil line and discarded.
Taproots were split in half with sharp trimming shears, and the presence of zone lines was
recorded for each individual root by visual examination. A dissecting scope was used to confirm
the presence of small zone lines when necessary. Roots were cleaned and disinfested before
further processing. The split taproots were washed in running tap water for 5 minutes for
removal of remaining soil particles and contaminating debris. Then, clean roots were surface
disinfested by submergence in 0.5% sodium hypochlorite for two minutes, blotted dry with
sterile paper towels, and air dried at room temperature for 24 hours. Roots were stored in paper
bags at room temperature until isolations could be performed.
Isolations were made from roots selected from a single replication for each location. First, a
single experimental block from each experiment was randomly chosen. Roots with zone lines
large enough to be dissected, at least 5mm in dimensions, were selected to undergo isolation.
Isolations were performed on one half of each longitudinally-split tap root, while the other was
discarded. A sharp sterile knife was used to remove a thin layer (2 to 3 mm) of tissue from atop
the root site to be sampled for isolation. The knife was sterilized with 70% ethanol and flamed
between every root. Tissue specimen of approximately 2 to 4 mm2 were cut and removed from
sampled tap root with a sharp scalpel. From every sampled tap root, two specimens were
collected from the following sites:1) the center of a zone line, 2) tissue often of light-yellow
discoloration enclosed by zone lines, 3) the black lines themselves, and tissue 2 to 4 mm outside
the zone lines (Fig. 1). Isolations were carried out under aseptic conditions in a laminar-flow
cabinet with the aid of a dissecting scope. Specimens from each root site were plated
equidistantly on a Petri dish containing PDA and incubated at room temperature. After ten days,
plates were visually assayed for the presence of M. phaseolina and P. longicolla. Notes on the
62
presence of Fusarium spp. and other unidentified filamentous fungi also were taken. In total,
isolations were made from 368 soybean tap roots with zone lines. During isolations, soybean tap
roots were classified as having 1) no visible M. phaseolina microsclerotia, 2) having
microsclerotia further than 0.5 cm from zone lines, or 3) having visible microsclerotia adjacent to
the zone line sampled.
Identification of P. longicolla. DNA sequencing of house-keeping loci was used to confirm
morphological identification of selected P. longicolla isolates. Two sets of 14 P. longicolla
isolates were selected from isolates recovered from either root tissues within the zone lines or
from tissues outside the zone lines. Three commonly used barcoding loci for phylogenetic
studies in filamentous fungi, including population studies in Phomopsis/Diaporthe were chosen
and amplified on selected isolates. Strains were single spored and grown on potato dextrose
broth (PDB; Becton Dickinson and Company, Franklin Lakes, NJ, USA) incubated at room
temperature in the dark. After five days, tissue was harvested and DNA extracted via cetyl
trimethylammonium bromide (CTAB) method as described (Li et al. 2013). PCR amplification
of internal transcribed spacer (ITS), elongation factor 1, and -tubulin was done with primers
and conditions described in identifying Phomopsis spp. (Table 1; Udayanga et al. 2012).
Forward and reverse sequencing of amplicons were obtained from Genewiz (South Plainfield,
NJ, USA) via Sanger method. Sequences were converted to fastq format with the SeqIO.parse
function from Biopython v1.70 (Cock et al. 2009) and trimmed with trimfq from seqtk v1.0-r68
(https://github.com/lh3/seqtk, accessed: March 2019) using error rate threshold of 0.05. Forward
and reverse sequences were assembled with CAP3 version 02/10/15 (Huang and Madan 1999).
Sequences were aligned with MAFFT v7.407 (Katoh and Standley 2013) with parameters --
localpair and --maxiterate 1000. The alignments were visualized and their ends were manually
63
trimmed with Jalview v2.10.4 (Waterhouse et al. 2009). The alignments were concatenated and
a maximum likelihood phylogenetic tree was inferred with RAxML v8.2.11 (Stamatakis 2014)
with settings adjusted for 100 rapid bootstrap replicates and GTRGAMMA as the nucleotide
substitution model. The tree was visualized and exported with FigTree v1.4.3
(http://tree.bio.ed.ac.uk/software/figtree/, accessed: March 2019). Nucleotide sequences of other
Diaporthe species were obtained from GenBank using the ncbi-acc-download script
(https://github.com/kblin/ncbi-genome-download, accessed: March 2019) based on the accession
numbers provided in other studies (Gomes et al. 2013; Udayanga et al. 2012). Nucleotide
sequences of Stenocarpella maydis A1-1 was obtained by homology searches performed with
BLASTn (Altschul et al. 1997) against its genome assembly (GenBak accession
GCA_002270565.1; Zaccaron et al. 2017).
Statistical analysis. Incidence of zone lines was statistically analyzed with SAS 9.4. Analysis
of variance was performed with the GLIMMIX procedure assuming binomial distribution for the
presence of zone lines and a logit link function option. The Stuttgart and Rohwer locations were
analyzed together with location as a fixed effect. The dataset generated by isolations of fungi
from soybean roots was zero-inflated, precluding parametric statistical analyzes.
Results
Zone line incidence. Zone lines were observed in 48.14 % of the 2740 senesced soybean
tap roots examined. For the 18 cultivars grown at Rohwer and Stuttgart, there were significant
location and cultivar main effects and a significant location by cultivar interaction (Table 2).
The incidence of zone lines was significantly higher (P<.0001) at Rohwer (44%) than at Stuttgart
(17%). The range in incidences ranged from 5 to 72% and 0 to 49% at Rohwer and Stuttgart,
respectively (Table 3). Some cultivars had similar incidences of zone lines between the locations
64
such as Osage, R01581F, JTN-5208, and Jack. Others like Pharaoh, EXP2XC3810, and
Spencer, had significantly higher incidences at Rohwer than at Stuttgart. There was a high
incidence of zone lines at Marianna (67.62%) ranging from 38 to 87% (Table 4). There were no
significant differences among cultivars. The tests had three cultivars in common: Osage,
R01581F, and DK4866. Incidences for Osage were 67,44, and 73%, for R01581F were 49, 49,
and 38%, and for DK4866 were 71, 11, and 73% at Rohwer, Stuttgart, and Marianna,
respectively (Tables 3 and 4).
Zone line isolations. The predominate fungi isolated in association with the zone lines were
P. lonogicolla and M. phaseolina with recovery rates of 75.2% and 18.4%, respectively.
Meanwhile, other filamentous fungi were isolated at a rate of 9.9%, reaching 21% when tissues
outside the zone lines were sampled. More than half of roots where other fungi were isolated, it
was a Fusarium spp. (58%). The isolation of P. longicolla was particularly frequent for
isolations taken from the line or the tissue enclosed by the line with rates of 91.6 and 95.2%,
respectively (Fig. 2). When signs of charcoal rot were seen adjacent to the zone lines, M.
phaseolina was isolated from tissues enclosed by zone lines at a rate of 3.9%. In the outer tissue
(tissue not enclosed by the zone line), P. longicolla was still the predominate species isolated
when M. phaseolina was either present, but not up to the line or not visibly present recovered at a
rate of 41.2 and 64.5, respectively. M. phaseolina was the predominate fungus (93.8%) isolated
from the outer tissue when M. phaseolina was visibly present up to the line. Other fungi were a
minor component of the isolations, but were most frequent in the outer tissue when M.
phaseolina was not visibly present (28.7). The incidences of other fungi from the enclosed tissue
was very small (1.2%).
65
Identification of P. longicolla associated with zone lines. Isolates of P. longicolla were
identified based on culture morphology and alpha conidia. Sequencing the ITS and the EF1-,
and -tubulin genes, 28 randomly selected isolates identified as P. longicolla. When these
sequences, along with published sequences of other fungi, were used to construct a phylogenetic
tree, all of the 28 isolates clustered with the P. longicolla type-strains TWH_P74 (Li et al. 2015)
and other P. longicolla strains isolated from soybean seeds previously described (Gomes et al.
2013; Udayanga et al. 2012). These isolates were distinct from other similar fungi associated
with soybean: Diaporthe phaseolorum, D. sojae, and D. aspalathi (Fig. 3).
Discussion
Zone lines in soybean roots are associated with P. longicolla. Our findings strongly
support P. longicolla as zone lines causal agent in soybean roots, as previously reported (Ghissi
et al. 2014; Olson et al. 2015). P. longicolla was isolated almost exclusively from soybean
taproot tissues enclosed by zone lines from plants of multiple locations and cultivars. Phomopsis
species have been known to produce zone lines in taxonomically diverse plants, including areca
palm (Saccardo, 1913), alfalfa (Nikandrow 1989), and elm trees (Webber and Gibbs 1984). The
function of such zone lines and their impact on Phomopsis spp. fitness remains unknown.
However, zone lines caused wood decaying fungi have been associated with increased
survivability in soil (Nelson 1964).
Cultivar and location had strong effect on the incidence of zone lines. Zone lines were
observed in some degree in every one of the 41 soybean genotypes assayed. However, soybean
genotype was found to significantly impact incidence of zone lines. These findings suggest the
expression of zone lines in soybean may be, at least in part, quantitatively and genetically
controlled. Phomopsis spp. production of zone lines has been linked to response to the proximity
66
of a colony of a genetically different filamentous fungus, including members of the same species.
Thus, a possible host genetic control of zone lines incidence in soybean may not related
exclusively to soybean resistance to root colonization by P. longicolla. Thus, zone lines
incidence may be affected by soybean susceptibility to infection by other filamentous fungi.
Additionally, the location where cultivars were grown significantly change their level of zone
lines incidence, indicating environmental conditions, the difference in microbial community, or
their interplay may play a role in zone lines development in soybean. It remains unclear if
soybean root colonization by Phomopsis longicolla and later formation of zone lines have an
impact on crop performance. Similarly, zone lines interplay with root-colonizing pathogens and
their diseases remain unknown.
Zone lines restricted soybean root colonization by M. phaseolina. Virtually no signs of
M. phaseolina were observed in soybean root tissues enclosed by zone lines. Additionally, M.
phaseolina was isolated from these tissues in very low levels, even when collected from roots
with severe charcoal rot. The mechanism by which employed by P. longicolla to suppress M.
phaseolina root colonization is not known. However, multiple metabolites with antimicrobial
properties have been identified in Phomopsis spp., including P. longicolla (Ahmed et al. 2011;
Choi et al. 2013; Corrado and Rodrigues 2004; Horn et al. 1995). The recently published P.
longicolla draft genome shows it possesses one of the largest set of genes involved in the
production of secondary metabolites among sequenced fungi to date. The secretion of
antimicrobial metabolites could explain M. phaseolina growth restriction observed in soybean
taproots, although such interaction has not been observed in growth media. Phomopsis sp. zone
lines has been show to act as biocontrol to scolytid beetles, vectors of Ceratocystis ulmi, causal
agent of Dutch elm disease (Webber 1981). When beetles breeding galleries overlapped with
67
zone lines, it was observed a severe decrease in numbers and fitness of beetle offspring, reducing
their vectoring ability. Thus, supporting the presence of a level of biotoxicity present in
Phomopsis spp. zone lines.
Zone lines and root colonization by P. longicolla should be further studied and
considered during epidemiological and resistance screening studies. The present work shows
Phomopsis longicolla zone lines incidence may be genetically controlled by the host and impact
root colonization by M. phaseolina. It is unclear if the charcoal rot impact on soybean yield is
affected by zone lines. However, this work suggests that zone lines could be a confounding
factor when assessing charcoal rot severity in soybean by currently used methods. In particular,
methods using CFU quantification. It is unclear if zone lines or root colonization by Phomopsis
longicolla impacts the presence of other filamentous fungi in soybean roots, either pathogens or
growth promoting. Together, this work brings to light the importance of considering zone lines
caused by P. longicolla when assessing for root diseases resistance or evaluating disease
management practices.
68
Literature cited
Ahmed, I., Hussain, H., Schulz, B., Draeger, S., Padula, D., Pescitelli, G., van Ree, T., and
Krohn, K. 2011. Three New Antimicrobial Metabolites from the Endophytic Fungus
Phomopsis sp. Eur. J. Org. Chem. 2011:2867–2873
diversity of Macrophomina phaseolina. Tropical Plant Pathology. 33:257–264
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.
J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25:3389–3402
soybean pods and seeds by Phomopsis longicolla. Can. J. Microbiol. 33:797–801
Bellaloui, N., Mengistu, A., and Paris, R. L. 2008. Soybean seed composition in cultivars
differing in resistance to charcoal rot (Macrophomina phaseolina). Journal of
Agricultural Science. 146:667–675
Brayford, D. 1990. Vegetative incompatibility in Phomopsis from elm. Mycological Research.

94:745–752
Campbell, A. H. 1933. Zone lines in plant tissues I. The black lines formed by Xylaria
polymorpha (pers.) Grev. Ln hardwoods. Annals of Applied Biology. 20:123–145
Campbell, A. H. 1934. Zone Lines in Plant Tissues: II. The Black Lines Formed by Armillaria
mellea (Vahl) Quel. Annals of Applied Biology. 21:1–22
Campbell, A. H., and Munson, R. G. 1936. Zone lines in plant tissues. III. The black lines
formed by Polyporus squamosus (Huds.) Fr. Annals of Applied Biology. 23:453–464
Choi, J. N., Kim, J., Ponnusamy, K., Lim, C., Kim, J. G., Muthaiya, M. J., and Lee, C. H. 2013.
Identification of a new phomoxanthone antibiotic from Phomopsis longicolla and its
antimicrobial correlation with other metabolites during fermentation. The Journal of
Antibiotics. 66:231
Cock, P. J. A., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., Friedberg, I.,
Hamelryck, T., Kauff, F., Wilczynski, B., and de Hoon, M. J. L. 2009. Biopython: freely
available Python tools for computational molecular biology and bioinformatics.
Bioinformatics. 25:1422–1423
Corrado, M., and Rodrigues, K. F. 2004. Antimicrobial evaluation of fungal extracts produced by
endophytic strains of Phomopsis sp. J. Basic Microbiol. 44:157–160
69
Ghissi, V. C., Reis, E. M., and Deuner, C. C. 2014. Etiology of phomopsis root rot in soybean.
Summa Phytopathologica. 40:270–272
2013. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia.
31:1–41
Hobbs, T. W., Schmitthenner, A. F., and Kuter, G. A. 1985. A New Phomopsis Species from
Soybean. Mycologia. 77:535
Horn, W. S., Simmonds, M. S. J., Schwartz, R. E., and Blaney, W. M. 1995. Phomopsichalasin, a
novel antimicrobial agent from an endophytic Phomopsis sp. Tetrahedron. 51:3969–3978
Huang, X., and Madan, A. 1999. CAP3: A DNA sequence assembly program. Genome Res.
9:868–877
Katoh, K., and Standley, D. M. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol. Biol. Evol. 30:772–780
Plant Disease. 84:895–900
Li, C. Y. 1983. Melanin-like Pigment in Zone Lines of Phellinus weirii-Colonized Wood.

Mycologia. 75:562
Li, C. Y. 1981. Phenoloxidase and Peroxidase Activities in Zone Lines of Phellinus weirii.
Mycologia. 73:811
longicolla. Journal of Microbiological Methods. 92:244–245
Announc. 3
Lopez-Real, J. M. 1975. Formation of pseudosclerotia (‘zone lines’) in wood decayed by

Armillaria mellea and Stereum hirsutum: I. Morphological aspects. Transactions of the
British Mycological Society. 64:465-IN7
Mengistu, A., Smith, J. R., Ray, J. D., and Bellaloui, N. 2011. Seasonal progress of charcoal rot
and its impact on soybean productivity. Plant Disease. 95:1159–1166
70
Navi, S. S., and Yang, X. B. 2008. Foliar symptom expression in association with early infection
and xylem colonization by Fusarium virguliforme (formerly F. solani f. sp. glycines), the
causal agent of soybean sudden death syndrome. Plant Health Progress. :0222–01
Nelson, E. E. 1964. Some probable relationships of soil fungi and zone lines to survival of Poria
weirii in buried wood blocks. Phytopathology. 54:120–121
Nikandrow, A. 1990. Acrocalymma medicaginis and Phomopsis sp. as Causal Agents of Crown
Rot of Lucerne in Australia. Journal of Phytopathology. 130:24–36
Nikandrow, A. 1989. Zone lines diagnostic of Phomopsis sp. in lucerne crown rot. Australasian
Plant Pathology. 18:86–89
Mature Soybean Plants. Plant Health Progress.
Robinson, S. C., and Laks, P. E. 2010. Wood Species and Culture Age Affect Zone Line
Production of Xylaria polymorpha. Open Mycology Journal. 4:18–21
2017. Advancing Our Understanding of Charcoal Rot in Soybeans. J Integr Pest Manag.
8
Roy, K. W., and Abney, T. S. 1988. Colonization of pods and infection of seeds by Phomopsis
longicolla in susceptible and resistant soybean lines inoculated in the greenhouse.
Canadian Journal of Plant Pathology. 10:317–320
Rupe, J. C. 1990. Effect of temperature on the rate of infection of soybean seedlings by

Phomopsis longicolla. Canadian Journal of Plant Pathology. 12:43–47
Rupe, J., and Ferriss, R. 1987. A Model for Predicting the Effects of Microclimate on Infection
of Soybean by Phomopsis longicolla. Phytopathology. 77:1162–1166
Saccardo, P.A. 1913. Notae mycologicae. Series XV. Fungi ex Gallia, Germania, Italia, Melita
(Malta), Mexico, India, Japonia. Ann. mycol. 11:14–21
Short, G. E., Wyllie, T. D., and Ammon, V. D. 1978. Quantitative enumeration of

Macrophomina phaseolina in soybean tissues. Phytopathology. 68:736–741
Disease. Plant Disease. 77:329
Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of
large phylogenies. Bioinformatics. 30:1312–1313
71
Twizeyimana, M., Hill, C. B., Pawlowski, M., Paul, C., and Hartman, G. L. 2012. A Cut-Stem
Inoculation Technique to Evaluate Soybean for Resistance to Macrophomina phaseolina.
Plant Disease. 96:1210–1215
Udayanga, D., Liu, X., Crous, P. W., McKenzie, E. H. C., Chukeatirote, E., and Hyde, K. D.
2012. A multi-locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal
Diversity. 56:157–171
Vidić, M., Petrović, K., Đorđević, V., and Riccioni, L. 2013. Occurrence of Phomopsis
longicolla β Conidia in Naturally Infected Soybean. J Phytopathol. 161:470–477
Waterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M., and Barton, G. J. 2009. Jalview
Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics.
25:1189–1191
Webber, J. 1981. A natural biological control of Dutch elm disease. Nature. 292:449–451
Webber, J. F., and Gibbs, J. N. 1984. Colonization of elm bark by Phomopsis oblonga.
Transactions of the British Mycological Society. 82:348–352
Wrather, A., Shannon, G., Balardin, R., Carregal, L., Escobar, R., Gupta, G. K., Ma, Z., Morel,
W., Ploper, D., and Tenuta, A. 2010. Effect of diseases on soybean yield in the top eight
producing countries in 2006. Plant Health Progress.
Wyllie, T. D., and Calvert, O. H. 1969. Effect of flower removal and pod set on formation of
sclerotia and infection of Glycine max by Macrophomina phaseoli. Phytopathology.
59:1243–1245
Zaccaron, A. Z., Woloshuk, C. P., and Bluhm, B. H. 2017. Comparative genomics of maize ear
rot pathogens reveals expansion of carbohydrate-active enzymes and secondary
metabolism backbone genes in Stenocarpella maydis. Fungal Biology. 121:966–983
Quality Evaluation, and Field Performance of Soybean. Crop Science. 34:172
72
Tables
Table 1. Primers used to amplify the loci for phylogenetic analysis (Udayanga et al. 2012).
Locus Primer Sequence

ITS ITS1 CTTGGTCATTTAGAGGAAGTAA
ITS4 TCCTCCGCTTATTGATATGC
CAL CAL228F GAGTTCAAGGAGGCCTTCTCCC
CAL737R САТСТТТСТGCCCATCATGG
EF-1 EF1-728F CATCGAGAAGTTCGAGAAGG
EF1-986R TACTTCAAGGAACCCTTACC
-tubulin Bt2a GGTAACCAAATCGGTGCTGCTTTC
Bt2b ACCCTCAGTGTAGTGACCCTTGGC
Table 2. Analysis of variance for incidence of zone lines in soybean roots during the growing
season of 2013.
Location Effect Num DF Den DF F Value P
Rohwer and Stuttgart Location 1 11.13 51.1 <.0001
Cultivar 17 69.69 1.46 0.155
Location*Cultivar 8 75.9 3.73 0.001
Mariana Cultivar 25 84.86 1.48 0.0976
73
Table 3. Incidence of zone lines in soybean cultivars grown at Rohwer and Stuttgart, AR during
the growing season of 2012. Significant groupings were adjusted by Tukey-Kramer test at
significance level of P=0.05. Location was treated as a fixed effect, enabling comparisons of
cultivars across both locations.
Estimate
Cultivar MG
Rohwer Stuttgart
Jack II 5 C 0 C
K07-1544 III 17 BC 0 C
NKBrandS39-A3 III 13 BC 0 C
Exp2_XC3810 Late III 71 A 2 C
Exp1_Stine39LA02 Late III 14 BC 14 BC
Pharaoh Early IV 72 A 5 C
Spencer Early IV 64 AB 8 C
DT97-4290 IV 34 B 2 C
JTN-4307 IV 14 BC 21 BC
DK4866 Late IV 71 A 11 BC
LS980358 Late IV 62 AB 12 BC
CPL-RC5007 V 71 A 28 BC
Osage V 67 AB 44 AB
R01581F V 49 AB 49 AB
JTN-5208 V 44 AB 45 AB
JTN-5308 V 42 AB 19 BC
MorsoyRT5388N V 40 B 34 B
CPL-RC5663 V 36 B 21 BC
74
Table 4. Incidence of zone lines in soybean cultivars grown at Marianna, AR during the
growing season of 2013. Cultivar did not explain significant variations in zone line incidence.
Cultivar MG Incidence (%) Standard error

HBK4924 IV 81 7.07
DG4880 IV 79 7.49
R04_122 IV 79 7.38
DG4925 IV 78 7.72
Progeny4510 IV 76 8.24
DG4765 IV 75 8.41
DK4866 IV 73 8.99
R05_4114 IV 71 9.05
Progeny4710 IV 71 9.05
DG4755 IV 65 9.90
DG4825 IV 64 9.98
P94Y81 IV 61 10.36
P94Y70 IV 61 10.18
DG4670 IV 54 10.73
Ozark V 87 5.55
R04_572 V 78 7.83
R05_235 V 75 8.29
DG5475 V 74 8.53
Osage V 73 8.77
Progeny5210 V 72 8.84
DG5565 V 67 9.50
RO1_416F V 67 9.61
R06_4433 V 59 10.33
DG5175 V 59 10.41
DG5625 V 52 10.79
R01581F V 38 10.19
75
Figures
Enclosed Tissue
Line tissue
Outer tissue
Figure 1. Signs of zone lines in soybean roots in the presence of charcoal rot and isolation
location on a root specimen. Zone lines can be seen restricting the presence of microsclerotia,
signs of M. phaseolina colonization, on a soybean taproot tissues enclosed by zone lines. The
ellipses illustrate the three different sampling sites where tissue was taken for isolations.
76
M. phaseolina Microsclerotia
Absent n= 76 Present n= 114 Adjacent to zone line n= 178
Enclosed tissue
Isolation site
Line tissue
Isolation frequency (%)
Outer tissue
i a a
fung icoll olin ngi olla lina ngi olla olin
a
er ong hase er fu ngic aseo er fu ngic hase
Oth P. l M . p Oth P . lo
M . ph Oth P. lo M . p
Figure 2. P. longicolla was the predominantly fungus isolated from zone lines in soybean tap
roots. Isolations were performed on soybean taproots with zone lines. Specimen were collected
and plated from tissues within the zone line, the black line itself, and tissues just outside the zone
line. P. longicolla was recovered from virtually every specimen collected from the center of
zone lines. M. phaseolina was only predominant on specimen collected outside the zone lines in
roots with severe charcoal rot. Rate of isolations represent the proportion of sampled roots
where that particular taxa was recovered. Because more than one taxon could at times be
recovered, the isolation frequency depicted for each set might not total ‘100%’.
77
P. longicolla from roots; outside zone lines
P. longicolla from roots; center of zone lines
P. longicolla from soybean seeds
P. longicolla type strain
78
Figure 3. Phomopsis sp. strains isolated from soybean taproot zone lines group with P.
longicolla type strain. 28 P. longicolla strains were isolated from soybean tap roots from plant
grown at Marianna, AR, Stuttgart, AR, and Rohwer, AR. 14 strains were recovered from within
zone lines and 14 strains recovered from outside the zone lines. The ITS, EF-1, and -tubulin
loci were amplified, sequenced and employed for the construction of the phylogenetic tree.
Publicly available sequences of other Diaporthe spp. and Phomopsis spp. reported to be isolated
from soybean plants were also used. Tree was rooted with Stenocarpella maydis as the
outgroup. All 28 P. longicolla strains isolated from soybean tap roots clustered together with
known P. longicolla, including the type-strain THW_P74.
79
Chapter IV: A forward genetic screen in Phomopsis longicolla provides unique insights
into pathogenesis
Abstract
Phomopsis longicolla (Hobbs) causes Phomopsis seed decay of soybean (Glycine max),
and lesions on soybean stems, pods, and petioles. P. longicolla can exist endophytically within
soybean stems, which has given rise to the hypothesis that pathogenesis occurs when the fungus
transitions from endophytic or hemibiotrophic growth to necrotrophy. In this study, a forward
genetic screen was performed to elucidate genetic mechanisms underlying necrotrophy.
Insertional mutants were created via Agrobacterium-mediated transformation and evaluated for
their ability to induce necrosis in soybean stems using a cut stem assay. A significant reduction
in soybean stem necrosis was observed in nine insertional mutants when compared to the wild-
type strain. No consistent gain-of-function mutations (increased necrosis) were observed. One
mutant, PL343, was found to be impaired in stem lesion formation, seed infection, and
colonization despite wild-type growth in defined culture media. The genomic lesion in mutant
PL343 was characterized with a modified RADseq approach that enriched T-DNA insertion-
junctions. Next-generation DNA sequencing identified a single copy of the disruption cassette in
the promoter region of a cellobiose dehydrogenase gene (CDH). This study describes new
biological resources to dissect the interaction between P. longicolla and soybean, and provides
new insight into conserved mechanisms underlying stem and seed necrosis caused by P.
longicolla.
Introduction
Phomopsis longicolla, a ubiquitous and important seed pathogen of soybean (Glycine
max), is a member of the Diaporthe-Phomopsis species complex that includes D. phaseolorum f.
80
sp. sojae, D. phaseolorum f. sp. caulivora, and D. phaseolorum f. sp. meridionalis (Gomes et al.
2013a; Hobbs and Phillips 1985; Hobbs et al. 1985; Kmetz 1978; Mengistu et al. 2014; Nevena
et al. 1997). P. longicolla is predominantly associated with Phomopsis seed decay (PSD) in the
U.S. (Hobbs et al. 1985), although it has been reported to cause stem lesions in other regions of
the world (Cui et al. 2009). Symptoms of PSD include shriveled and elongated seeds with
chalky and cracked seed coats. These symptoms are easily discernable from other common
soybean seed diseases, such as purple seed stain caused by Cercospora spp. (Hartman, et al.
1999). In addition to decreasing the nutritional quality of infected seeds (Hepperly and Sinclair
1978; Mayhew and Caviness 1994), P. longicolla can substantially impair seed germination and
vigor, which negatively affects seedling emergence in laboratory and field conditions (McGee et
al. 1980; Mengistu and Heatherly 2006). Besides colonizing pods and seeds, P. longicolla can
asymptomatically infect vegetative tissues as early as three weeks after seedling emergence, with
symptoms only observed upon senescence (Walcott et al. 1998; Impullitti and Malvick 2013).
PSD is endemic throughout North American soybean production areas, and has been
described as one of the most common diseases affecting soybean seeds in the U.S. (Sinclair
1992). In recent years, PSD has increased in incidence and severity in Southeastern states, partly
due to the prevalence of the early soybean production system (ESPS) in the region (TeKrony et
al. 1996; Logan et al. 1998). The ESPS encourages early planting of soybean with relatively
early maturity to avoid late-summer stresses of heat and periodic droughts that occur throughout
the region. Due to early planting, the reproductive stages of soybean development may occur
during periods of high temperature and humidity, both of which favor PSD development (Shortt
1981). Delayed harvests also favor PSD, as the pathogen has an extended opportunity to
colonize seeds before seed moisture can be adequately reduced by controlled drying (Wilcox et
81
al. 1974). Beyond the Southeastern U.S., PSD occurs periodically in the Midwest when
environmental conditions are favorable or harvests are substantially delayed (Kmetz 1978; Shortt
1981). The potential implications of climate change on PSD are difficult to project. However,
several long-term forecasting models suggest the increased occurrence of extreme weather
events, including heat waves, flooding, and storms (Pachauri et al. 2014), which could
conceivably favor increased incidence of PSD across U.S. soybean producing regions.
The relationship between P. longicolla and soybean is complex and may involve more
than one type of association. In addition to causing PSD, P. longicolla is commonly found as an
asymptomatic endophyte in soybean vegetative tissues, including stems, leaves, and petioles
(Kmetz 1978). Interestingly, P. longicolla is reported to endophytically associate with a range of
taxonomically diverse plants, including Euphorbia nutans (Euphorbiaceae), Abutilon theophrasti
(Malvaceae), Ipomoea lacunosa (Convolvulaceae), Xanthium strumarium (Asteraceae), and a
tropical red seaweed Bostrychia radicans (Rhodomelaceae) (Erbert et al. 2012; Gomes et al.
2013; Udayanga et al. 2011), which suggests it has evolved broadly effective mechanisms of
endophytism. P. longicolla produces a wide variety of anti-microbial compounds, such as 3-
nitropropionic acid (Flores et al. 2013), 18-deoxy-cytochalasin H, mycophenolic acid, and
dicerandrol C (Erbert et al. 2012). During colonization of soybean roots and stems, P. longicolla
has been observed to form zone lines (Olson et al. 2015), structures that are postulated to be
analogous to barrage zones on defined media (Brayford 1990). These observations suggest P.
longicolla could function as a beneficial endophyte in soybean, although the exact nature of the
relationship requires further elucidation.
The potential duality underlying the endophytic/pathogenic basis of the P.
longicolla/soybean relationship has led to fundamental questions about how to dissect
82
pathogenesis. A cut stem assay is commonly used to assess P. longicolla virulence and soybean
resistance (Li et al. 2010), in which soybean stems are cut and inoculated with an agar plug
colonized by the pathogen. However, P. longicolla is reported to produce appressoria during
infection of soybean pods (Baker et al. 1987), which suggests a degree of developmental
specialization during plant infection. The cut stem assay is predicated on wounding, e.g., cutting
the stem, which would presumably bypass specialized infectious development during
pathogenesis. Additionally, soybean seeds and pods could express resistance responses not
observed in stems, and thus a cut stem assay may not fully capture the range of phenotypes
associated with PSD.
Despite its importance as the causal agent of PSD, few studies have explored the
molecular basis of pathogenesis in P. longicolla. Recently, new molecular resources have
become available, including a protocol for genetic transformation (Li et al. 2013) and draft
genome sequences for two isolates of P. longicolla, including the type isolate (Li et al. 2015).
However, functional genomics approaches have not yet been applied to the P. longicolla/soybean
pathosystem. Forward genetic screens provide a powerful tool for the molecular dissection of
pathogenesis in filamentous fungi. Forward genetic screens have been used effectively to
discover novel genes and dissect pathogenesis in several filamentous fungi, including Fusarium
graminearum, Colletotrichum higginsianum, Magnaporthe grisea, and Leptosphaeria maculan
(Gupta and Chattoo 2007; Idnurm and Howlett 2002; Korn et al. 2015; Seong et al. 2005).
In this study, a forward genetic screen was developed to dissect the molecular basis of
pathogenicity in P. longicolla. To this end, a collection of random insertional mutants was
created via Agrobacterium-mediated transformation and initially screened for virulence using the
cut stem assay. From the primary screen, a subset of mutants was analyzed in greater depth,
83
including the ability to infect and colonize soybean seeds. This study represents the first
application of molecular genetics to dissect mechanisms of virulence in the P.
longicolla/soybean pathosystem.
Generation of P. longicolla mutant collection. Mutagenesis in P. longicolla was achieved via
Agrobacterium tumefaciens-mediated transformation of wild-type strain PL2010AR, as
previously described (Li et al. 2013). A. tumefaciens strain AGL-1 (Lazo et al. 1991) carrying
the pBHt2_sGFP plasmid derived from pBHt2 (Mullins et al. 2001), was used to produce
random mutants of P. longicolla. Briefly, for each transformation event, PL2010AR mycelia
were harvested from one seven-day-old culture growing on 0.2× strength potato dextrose agar
medium (PDA; BD Diagnostic Systems, Sparks, MD, USA) and suspended in 1 ml of sterile
water. Fungal tissue was fragmented using glass beads in a TissueLyser (Quiagen, Germantown,
MD, USA) at a rate of 30 cycles per second for 90 seconds. One ml of fragmented P. longicolla
hyphae was mixed with 1 ml of an induced A. tumefaciens cell culture with OD600 of 0.2, and
subsequently spread on sterile cellophane disks overlaying induction media agar (Mullins et al.
2001). Following incubation in the dark at room temperature for three days, cellophane discs
were inverted and transferred to plates containing 0.2× strength PDA amended with cefotaxime
(200 μg ml-1) and hygromycin B (100 μg ml-1) (Research Products International, Mt. Prospect,
IL, USA). Cellophane discs were removed and discarded after two days, and P. longicolla
colonies visually expressing GFP were transferred to 24-well plates containing 0.2× strength
PDA amended with hygromycin B (100 μg ml-1) after an additional 2-3 days. Cultures were
initially incubated at room temperature and then moved to 4°C for short-term storage. Colonized
84
cubes of 0.2× strength PDA amended with hygromycin (100 μg ml-1) were suspended in 50%
glycerol (v:v) solution and stored at -80°C for long-term storage of all mutants generated.
Southern blot analysis. Tissue was prepared for each strain by culturing in potato dextrose
broth medium (PDB; BD Diagnostic Systems, Sparks, MD, USA) for seven days on an orbital
shaker at 80 RPM at room temperature. Fungal genomic DNA was isolated with a modified
cetyltrimethylammonium bromide (CTAB) method (Leslie and Summerell 2006). Briefly, DNA
was digested with HindIII and probed for the hygromycin phosphotransferase-encoding gene
hph. A 350-base pair hph-specific probe was amplified via PCR with primers HYG-F and HYG-
R (Li et al. 2013). The probe was labeled with 32P and purified as described previously (Flaherty
et al. 2003). Hybridizations were performed as described by Sambrook and Russell (2001).
Following hybridization, blots were washed as described by Flaherty et al. (2003), exposed to a
phosphorimaging screen, and visualized with a Typhoon FLA 9500 (GE Healthcare Bio-
Sciences, Pittsburgh, PA, USA).
Pathogenicity screen. Wild-type strain PL2010AR and 1114 random mutants were evaluated
for pathogenesis on soybean cultivar ‘Hutcheson’ (Buss et al. 1988) with a slightly modified cut
stem assay (Li et al. 2010). Fungal strains were grown on 0.2× strength PDA for 4 days in an
incubator in a 12:12 hour light-dark cycle at 25C. Soybean plants were grown in 48-well insert
trays until the first trifoliate leaf was fully expanded (V2 stage; approximately 20 days after
planting), at which point the main stem was cleaved with a razor blade 2 cm above the unifoliate
leaf node. For inoculations, the base (wide end) of a sterile micropipette tip (200 l) was used to
collect a plug of 0.2× strength PDA medium colonized with fungal mycelia. The base of the
micropipette tip containing the inoculum was placed atop the cut stem to create direct contact
between the cut stem and the colonized media. After 10 days, the micropipette tip was removed
85
and the length of necrotic lesion was measured from the edge of the cut stem. Each of the 1114
mutant strains and the wild type were inoculated on 3 and 79 plants, respectively. From the 1114
screened mutants, 44 mutants were selected for phenotypic validation with the same cut stem
method. For this secondary round of screening, replicates (three per strain) were comprised of
four plants grown side-by-side in a randomized complete block design. From the 44 mutants
screened a second time, a final set of 19 mutants was selected, each of which underwent three
rounds of hyphal-tip purification before the cut stem assay was performed twice more as
described above.
Seed infection assay. Soybean plants were inoculated during pod filling stage (R5) with
conidial suspensions. Seed infection rate was assessed by plating mature seeds on PDA.
Inoculum was produced by growing strains on oatmeal agar medium (OA; BD Diagnostic
Systems, Sparks, MD, USA) at room temperature for seven days in a 12:12 hour light:dark cycle.
Conidia were gently dislodged from pycnidia with a cell spreader in 5 ml of sterile deionized
water per plate. Conidial suspensions were filtered through two layers of sterile cheesecloth, and
adjusted to 105 conidia ml-1 in 100 µl l-1 of Tween-20. Soybean plants (cultivar ‘Traff’; PI
490930; maturity group 000) were grown in 4-inch pots on a greenhouse bench in a 14:10 hour
light:dark cycle. At pod filling stage (R5; approximately 50 days after planting), conidial
suspensions were sprayed on all aboveground plant parts with an air brush until runoff. Twelve
plants were inoculated with each strain or mock inoculated with 100 µl l-1 Tween-20.
Immediately after inoculation, plants were placed in a dew chamber for 48 hours and then
returned to the green house where they were kept until harvest maturity. Plants were bottom
watered as needed in trays, without wetting aerial tissues. A randomized complete block design
was used with each plant considered an independent experimental unit (n=12). Three treatments
86
were applied, the inoculation of wither the wild-type strain and the mutant PL343, and mock
inoculated plants. At harvest, seeds were collected from pods and grouped by plant. For surface
sterilization, seeds were dipped in 0.5% sodium hypochlorite for 30 seconds, followed by 30
seconds in 70% ethanol. After rising in sterile deionized water for 30 seconds twice, seeds were
plated on full-strength PDA amended with 100 µg ml-1 of carbenicillin (Research Products
International, Mt Prospect, IL, USA). A maximum of five seeds were plated per 90-mm petri
dish, and plates were incubated in the dark at room temperature. The emergence of P. longicolla
from each seed was visually assessed and recorded five days after plating. The experiment was
performed twice.
Seed colonization. Physiologically mature soybean seeds were wounded and inoculated with P.
longicolla strains and colonization was estimated by quantifying seed ergosterol content. Seeds
were produced by growing soybean cultivar Traff as described above. Pods were hand harvested
at the onset of yellowing during late reproductive stages (R6-R7; approximately 70 days after
planting). Pods, and then seeds, were surface disinfested as described above and allowed to dry
on sterile paper towels in a laminar flow hood. Seeds were placed in sterile 24-well plates, one
seed per well, and wounded by inserting a sterile 12-gage hypodermic needle to a depth of
approximately 4 mm. A 5 mm-diameter plug of colonized 0.2× strength PDA medium or
uninoculated medium (mock treatment) was placed atop the wound. Plates were kept in the dark
at room temperature. Ten days after inoculation, seeds were flash frozen in liquid nitrogen and
ground to a fine powder with a mortar and pestle. Ergosterol extraction was performed by
incubating 500 mg of ground tissue (fresh weight) in 2 ml of 2:1 chloroform:methanol (v:v) at
room temperature on an orbital shaker at 50 rpm overnight. The extract was filtered through a
nylon syringe filter (0.2 μm; VWR International, Radnor, PA, USA). Ergosterol quantification
87
was performed as previously described (Smith et al. 2014). Briefly, extracts were separated on a
high-performance liquid chromatography (HPLC) system (Shimadzu, Columbia, MD, USA)
equipped with an ODS 5u column (250 mm × 4.6 mm; Phenomenex, Torrance, CA, USA), and
ergosterol was detected with a UV photo diode array detector (Shimadzu). Peaks were detected
at λ = 282 nm. The concentration of ergosterol was determined by comparing peak area in
samples to a standard curve generated by analysis of HPLC-grade ergosterol (Sigma-Aldrich, St.
Louis, MO, USA). Experimental units were comprised of four seeds, each treatment had three
replicates, and the entire experiment was performed twice in a randomized complete block
design.
Characterization of T-DNA insertion. We developed a simple and cost-effective method to
pinpoint T-DNA insertion sites by enriching a DNA library with T-DNA insertion break
junctions via MoNSTR-seq (Zaccaron et al. 2018). The method development is detailed in
chapter V of this document. Briefly, DNA from each strain containing a T-DNA insertion was
digested with AseI and BpuEI (New England BioLabs, Ipswich, MA, USA). These sites were
known to be present within 100bp of right and left borders in the inserted T-DNA. Sequencing
adapters were designed and ligated to the digested DNA sticky-overhangs. Then, DNA was
digested with Fragmentase (New England BioLabs, Ipswich, MA, USA). A sequencing adapter
was ligated at the blunt end left by Fragmentase as described by Zaccaron et al. (2018).
Enrichment of T-DNA insertion sites was achieved by PCR-amplification with primers targeting
the ligated adapters, followed by size selection of 480bp. Cleanup steps were performed after
digestion and ligation steps with AMPureXP beads (Beckman Coulter Inc., Brea, California,
USA). Following amplification, template was prepared on the Ion Torrent One Touch 2 system
(Life Technologies, Grand Island, NY, USA) and sequenced with Ion PGM on an Ion 314 V2
88
chip following the manufacturer's protocols. Reads were first mapped to the T-DNA cassette
and then mapped to the P. longicolla MSPL 10-6 draft genome (Genbank accession
AYRD00000000) with bwa version 0.7.10-r789 (Li and Durbin 2009) and processed with
SAMtools version 0.1.18 (Li et al. 2009).
P. longicolla carbohydrate-active enzymes from AA family were identified with dbCAN (Yin et
al. 2012). Protein sequences from AA8 enzymes were aligned with MAFFT v7.407 (Katoh et al.
2002) with default settings. The P. longicolla protein encoded by gene g16049 (AA3 enzyme)
was used as an outgroup. Aligned sites containing more than 50% gaps were removed with
trimAl v1.2 (Capella-Gutiérrez et al. 2009). A maximum likelihood tree was constructed with
RAxML v8.2.11 (Stamatakis 2014) with settings adjusted to perform 100 rapid bootstrap
replicates and to detect the best amino acid substitution model (parameter
PROTGAMMAAUTO). The constructed tree was visualized and edited with FigTree v1.4.3
(http://tree.bio.ed.ac.uk/software/figtree/, accessed: October 2018).
Quantitative reverse transcription-PCR (RT-qPCR). Relative expression of g4703 was
assessed via RT-qPCR in strains growing on full-strength PDA and on 0.5% carboxymethyl
cellulose agar (CMC) (Yeoh et al. 1985). Petri dishes with either PDA or CMC were overlaid
with sterile cellophane discs, inoculated in the center of the plate with a 5 mm plug of colonized
PDA, and incubated in the dark at room temperature. After six days, colonized cellophane discs
were removed, ground to a fine powder under liquid nitrogen, and total RNA was extracted using
Ribozol (Amresco, Solon, OH, USA). For each sample, two μg of total RNA was treated with
DNase (Promega, Madison, WI, USA) for 30 minutes at 37 °C to remove genomic DNA. Two
μg of DNA-free RNA were used to synthesize cDNA with M-MLV reverse transcriptase
(Promega, Madison, WI, USA). Primer quest (Integrated DNA Technologies, Coralville, IA,
89
USA) was used to design primer sets 343RTF1/R1 and PlTubF1/R1 to amplify CDH1 and beta
tubulin, respectively (Table 1). Sequences for the genes were obtained from the Phomopsis
longicolla genome (GenBank accession AYRD00000000). All primers were obtained from
Integrated DNA Technologies. Quantitative PCR reactions were performed in the AB
StepOnePlus instrument (Applied Biosystems, Foster City, CA, USA) and the data were
collected with the StepOnePlus software (version 2.1; Applied Biosystems, Foster City, CA,
USA). Reaction mixtures (10 μl) consisted of the following: 5 μl SYBR green PCR master mix
(Thermo Fisher Scientific, Waltham, MA), 500 nM each of forward and reverse primers, and 4
μl of cDNA template diluted 1:100 in nuclease free water. PCR conditions consisted of 1 cycle
for 10 minutes at 95 °C, 15 seconds at 95 °C, and 1 minute at 58 °C (40 cycles). Relative
expression of CDH1 was quantified with the comparative cycle threshold method with beta
tubulin as the endogenous control. Each treatment had three replicates, each consisting of three
colonized cellophane discs. Quantitative PCR was performed on three technical replicates for
each experimental unit, and the entire experiment was performed twice. A complete randomized
design was used.
Statistics. Pathogenicity selected mutants acquired via cut stem assay were statistically
compared to the wild-type strain via the many-to-one Dunnett’s test. First, an analysis of
variance was conducted with the ‘aov’ function in R (R Core Team). After uncovering the
significant effect of mutants on pathogenicity, a two-tailed Dunnett’s test was computed with the
‘multcomp’ package (Hothorn and Westfall, 2008) in R with the wild-type strain as the standard.
Simple linear regression was computed with the lm function in R. Tukey test applied to radial
growth, seed infection rate, and ergosterol concentration was computed with lme4 package
(Bates et al. 2015) in R. Incidence rate was treated as a Beta distributed variable, while length of
90
colonization, ergosterol concentration and radial growth were treated as Gamma distributed
variables.
Results
Creation of a panel of P. longicolla mutants. Creating P. longicolla mutants via
Agrobacterium-mediated transformation was highly efficient, and mutants displayed strong,
stable expression of GFP. Numerous macromorphological phenotypes were observed when
mutants were cultured in defined media, including altered rates of radial growth, irregular colony
margins, increased or decreased pigmentation, and decreased rates of pycnidiation and
conidiation. In total, 1719 mutants were isolated from three transformation events and placed in
50% glycerol (v:v) solution at -80°C for long term storage. From the 1719 mutants created, 1114
were screened for pathogenesis with a modified cut stem assay (Li et al. 2010).
Cut stem pathogenicity screen. To identify genes in P. longicolla associated with
pathogenesis, 1114 insertional mutants were evaluated with a modified cut stem assay (Li et al.
2010). In the preliminary screen, ten days after inoculation, wild-type strain PL2010AR caused
necrotic lesions averaging 27.8 mm (n=79) in length, while lesions caused by mutant strains
averaged 8.67 to 75 mm (n=3) in length (Fig. 1). Although a wide range of lesion lengths was
observed, most mutants caused lesions of similar length as the wild-type strain. Additionally,
although the wild type and vast majority of mutants produced pycnidia abundantly on necrotic
stem tissue; however, a few mutants showed reduced or no pycnidiation.
To confirm pathogenicity phenotypes observed in the preliminary screen, 44 mutant
strains displaying abnormal lesion length or mutants with reduced pycnidiation in planta were
re-screened with the cut stem assay. In this subsequent screen, the wild-type strain induced
lesions that averaged 13.83 mm in length, whereas lesions induced by the 44 mutant strains
91
ranged from 6.92 to 22.75 mm in length. From the 44 re-screened mutants, 19 were selected for
further study. Nine of the mutants induced lesions that were significantly (P < 0.005) shorter
compared to the wild type (Fig. 1) in repeated assessments. Of these nine, three also consistently
produced fewer pycnidia than the wild type.
Seed infection and colonization. A central goal of this study was to identify genes in P.
longicolla associated with pathogenesis, i.e. seed decay. To this end, seed infection and
colonization was investigated in mutant strain PL343. During growth on PDA medium, PL343
was indistinguishable from PL2010AR in colony morphology and radial growth (Fig. 2).
However, PL343 induced significantly shorter lesions on soybean stems. Additionally, a single
T-DNA insertion was detected in this strain, according to Southern blot (Fig. 3).
To assess if PL343 had reduced seed infection capability in addition to deficiency in stem
lesion formation, soybean plants were inoculated at pod-fill stage (R5) and P. longicolla
recovery rate from seeds was determined at harvest maturity by plating. P. longicolla was
recovered from 32.4% of seeds harvested from plants inoculated with the wild-type strain
PL2010AR, while the recovery rate from plants inoculated with the mutant-strain PL343 was
significantly lower, 7.2%. P. longicolla was not recovered from seeds of plants mock inoculated
(Fig. 4A). The experiment was replicated with similar results. Seed colonization capability of
PL343 was also examined. Strains were inoculated on soybean seeds in vitro and ergosterol was
measured to estimate colonization. Seeds inoculated with PL343 presented significantly reduced
ergosterol content when compared with seeds inoculated with the wild-type PL2010AR, 139.0
and 355.5 µg g-1 respectively. Ergosterol was not detected in soybean seeds mock inoculated
(Fig. 4B). The experiment was repeated with similar results.
92
Characterization of mutant PL343 via MoNSTR-seq. The site of T-DNA integration
in the P. longicolla mutant PL343 was identified with MoNSTR-seq. A total of 0.5 million reads
were obtained for PL343 sequenced library. T-DNA insertion site was identified by sequentially
mapping the reads first to the inserted-cassette sequence and then to P. longicolla genome. A
single insertion was mapped to a site 511 bp upstream of a predicted cellobiose dehydrogenase
gene open reading frame, homologue to CDH2 in Neurospora crassa designated g4703 in the P.
longicolla draft genome (Fig. 5). A Southern blot confirmed a single T-DNA insertion in the
PL343 mutant (Fig 3). The insertion site was validated via PCR.
g4703 expression. Expression of CDH1 was reduced by a large amount in PL343.
When the wild-type strain and PL343 were cultivated on PDA, CDH1 was transcribed at low
levels in both strains. However, when strains were cultivated in 0.5% CMC as carbon source, a
60-fold increase was detected in CDH1 transcripts in the wild type. Meanwhile, PL343
transcription of CDH1 remain at similarly low levels observed in PDA (Table 2)
Discussion
In this study, forward genetics was utilized in the P. longicolla-soybean pathosystem to
identify genes involved in pathogenesis. Agrobacterium-mediated transformation approach was
used to create P. longicolla random mutant library that was screened for pathogenicity. We
identified nine P. longicolla mutants with impaired pathogenicity, which correspond to
approximate 1% of the screened transformants. From the 18 selected for further study due to
Pathogenicity impairment, only five had multiple T-DNA insertions indicating this
transformation approach and methodology are suitable for forward genetics in this organism.
Due to the absence of known sexual stage in P. longicolla, it is not possible to separate multiple
T-DNA insertions through meiotic segregations. Thus, single T-DNA insertions are preferred
93
when putatively linking a mutation to the phenotype of interest. This study implicated the CDH1
ortholog to P. longicolla pathogenesis. A single T-DNA insertion was identified in the promoter
region of CDH1 of PL343 strain. Furthermore, analyze of the P. longicolla draft genome and
PCR-evidence indicate CDH1 is a single-copy gene in P. longicolla. However, CDH1
transcription was not abolished in PL343, but was severely reduced when compared to wild-type
strain.
The cellobiose dehydrogenase gene, CDH1, in P. longicolla appears to be a link between
pathogenicity and primary metabolism. Cellobiose dehydrogenases are secreted enzymes that
catalyze cellulose oxidation, they are also known to be involved in lignin degradation (Tan et al.
2015). CDH act as electron donors for lytic polysaccharide mono-oxygenases (LPMOs) during
redox-mediated oxidative cleavage of cellulose and hemicelluloses, greatly improving their
efficiency (Kracher and Ludwig 2016). LPMOs are known to be secreted by fungi to degrade
plant polysaccharides (Quinlan et al. 2011; Vaaje-Kolstad et al. 2010). Our results indicate that
this mechanism for plant biomass degradation is a key component of P. longicolla pathogenesis
in addition to be important to cellulose metabolism. The disruption of cellobiose dehydrogenase
has been reported to reduce, but not completely eliminate, the wood degradation and cellulose
utilization capability of the basidiomycetes Trametes versicolor (Dumonceaux et al. 2001;
Stapleton and Dobson 2003) and Podospora anserine (Tangthirasunun et al. 2017). CDH1 is the
first gene implicated in P. longicolla pathogenesis.
CDH1 is up-regulated in the presence of carboxymethyl cellulose (CMC). RT-qPCR
reviewed that CDH1 transcription was significantly increased when the wild-type strain was
cultivated in 0.5%CMC when compared to PDA. However, PL343 showed CDH1 transcription
at very low levels in both PDA and CMC, but transcription was not abolished. CDH1 increased
94
transcription in CMC when compared to PDA in filamentous fungi (Stapleton and Dobson 2003;
Tangthirasunun et al. 2017). All together, these results indicate the CDH1 transcription
regulation in PL343 has been disrupted, particularly in response to cellulose-derived compounds.
PL343 significantly reduced growth on CMC agar (Fig. 6) could be explained by its inefficient
utilization as nutritional source due to severely diminished availability of cellobiose
dehydrogenase. Similarly, this could partially explain PL343 impaired ability to cause necrosis
in stem and colonize seeds of soybean.
Although the mechanistic basis of infection by P. longicolla is poorly understood, the
genetic screen performed in this study provides a degree of new insight. Typically, PSD is not
associated with pod lesions in field conditions, which suggests a stealthy mechanism of entry. P.
longicolla is reported to form appressoria during external infection of soybean pods (Baker et al.
1987), which suggests a specialized mode of infection. This is in agreement with the endophytic
life style observed during early PSD pathogenesis. One possibility is that P. longicolla functions
as a hemibiotroph during external pod infections. Alternatively, the fungus may gain access to
seeds via endophytic colonization of soybean stems and pods. Mechanistically, the endophytic
phase of colonization should require manipulation of host defenses, possibly through effectors.
Whichever the mechanism of used by P. longicolla to gain access to soybean seeds, the
disruption of CDH1 significantly impaired it. Forward genetics is a very useful approach to
identify the molecular machinery necessary for penetration, endophytism, and early
pathogenesis; however, the cut stem assay may not be suitable for these objectives.
Formation of pycnidia on dead soybean plant material is an important mechanism of
dissemination for P. longicolla, yet the process remains poorly understood. In Arkansas and
other Midsouthern states, pycnidia are commonly observed on senescent tissues such as soybean
95
petioles and stems. In no-till cropping systems without rotation, pycnidia-laden tissues would
presumably overwinter on the ground and persist into the next season of soybean production
contributing with primary inoculum for PSD epidemic. Despite the clear importance of
pycnidiation in the P. longicolla-soybean pathosystem, little is known about its regulation;
however, the genetic resources generated in this study could further our understanding. The
mutant PL343, with the disrupted CDH1 gene, in addition to pathogenicity phenotype also did
not produced pycnidia in planta while producing pycnidia similarly to the wild-type in vitro
(Table 3). Thus, there appear to be a regulatory link between pycnidiation and necrotrophy or
indirectly with carbon primary metabolism. Two other genetically uncharacterized mutants were
observed to have reduced pycnidiation in planta when compared to the wild-type in addition to
have reduced lesion length on cut stem assay. The apparent link between pycnidiation and
necrotrophy is not unexpected since pycnidia is produced by P longicolla only on dead plant
tissue during PSD disease cycle. The putative regulatory link between pycnidiation and the
necrotic-saprophitic phase of P. longicolla-soybean pathosystem could be used dissect the
regulatory mechanisms underlying the end of endophytism at the onset of plant senescence.
In conclusion, our genetic screen has identified 9 mutants with impaired necrotrophic
causing capability and one candidate gene putatively associated with pathogenesis in P.
longicolla on soybean. We have shown that P. longicolla can be easily manipulated in a forward
genetic screen by generating and phenotyping 1114 insertional random mutants and
consequently identifying a gene, CDH1 linked to P. longicolla ability to cause necrotic lesion on
soybean stems, infect and colonize soybean seeds, and efficiently use carboxymethyl cellulose as
carbon source. This work is the first forward genetic study with P. longicolla and CDH1 is the
first gene in this organism to be associated with any function. Thus, this study represents the
96
first foothold on mechanistically understanding the complex relationship between P. longicolla
and soybean. Future work will be directed towards elucidating the mechanistic basis for
Phomopsis seed decay with focus on the molecular signaling associated with the endophytic to
saprophytic switch of P. longicolla during plant senescence onset.
97
Literature cited
Bates, D., Mächler, M., Bolker, B., and Walker, S. 2015. Fitting Linear Mixed-Effects Models
Using lme4. Journal of Statistical Software 67: 1-48
soybean pods and seeds by Phomopsis longicolla. Can. J. Microbiol. 33:797-801
Brayford, D. 1990. Vegetative incompatibility in Phomopsis from elm. Mycol. Res. 94:745-
752
Buss, G. R., Camper, H. M., and Roane, C. W. 1988. Registration of “Hutcheson” soybean.
Crop Sci. 28:1024-1025
Capella-Gutiérrez, S., Silla-Martínez, J. M., and Gabaldón, T. 2009. trimAl: a tool for
automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics
25:1972-1973
Cui, Y.-L., Duan, C. X., Wang, X.-M., Li, H. J., and Zhu, Z.-D. 2009. First report of Phomopsis
longicolla causing soybean stem blight in China. Plant Pathol. 58:799-799
Dumonceaux, T., Bartholomew, K., Valeanu, L., Charles, T., and Archibald, F. 2001.
Cellobiose dehydrogenase is essential for wood invasion and nonessential for kraft pulp
delignification by Trametes versicolor. Enzyme Microb. Technol. 29:478-489
Erbert, C., Lopes, A. A., Yokoya, N. S., Furtado, N. A. J. C., Conti, R., Pupo, M. T., Lopes, J. L.
C., and Debonsi, H. M. 2012. Antibacterial compound from the endophytic fungus
Phomopsis longicolla isolated from the tropical red seaweed Bostrychia radicans. Bot.
Mar. 55:435-440
Flaherty, J. E., Pirttilä, A. M., Bluhm, B. H., and Woloshuk, C. P. 2003. PAC1, a pH-
Regulatory Gene from Fusarium verticillioides. Appl. Environ. Microbiol. 69:5222-5227
Flores, A. C., Pamphile, J. A., Sarragiotto, M. H., and Clemente, E. 2013. Production of 3-
nitropropionic acid by endophytic fungus Phomopsis longicolla isolated from Trichilia
elegans A. JUSS ssp. elegans and evaluation of biological activity. World J. Microbiol.
Biotechnol. 29:923-932
2013. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia
Mol. Phylogeny Evol. Fungi. 31:1-41
formation in Magnaporthe grisea. Fungal Genet. Biol. 44:1157-1169
98
Hepperly, P. R., and Sinclair, J. B. 1978. Quality losses in Phomopsis-infected soybean seeds.
Hobbs, T., and Phillips, D. 1985. Identification of Diaporthe and Phomopsis Isolates from
Soybean. Phytopathology 75:500-509
Soybean. Mycologia 77:535-544
Hothorn, T., Bretz F., and Westfall P. 2008. Simultaneous Inference in General Parametric
Models. Biometrical Journal 50:346-363
Idnurm, A., and Howlett, B. J. 2002. Isocitrate Lyase Is Essential for Pathogenicity of the
Fungus Leptosphaeria maculans to Canola (Brassica napus). Eukaryot. Cell 1:719-724
Impullitti, A. e., and Malvick, D. k. 2013. Fungal endophyte diversity in soybean. J. Appl.
Microbiol. 114:1500-1506
Katoh, K., Misawa, K., Kuma, K., and Miyata, T. 2002. MAFFT: a novel method for rapid
multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res.
30:3059-3066
Kmetz, K. T. 1978. Soybean Seed Decay: Prevalence of Infection and Symptom Expression
Caused by Phomopsis sp., Diaporthe phaseolorum var. sojae, and D. phaseolorum var.
caulivora. Phytopathology 68:836-840
Korn, M., Schmidpeter, J., Dahl, M., Müller, S., Voll, L. M., and Koch, C. 2015. A Genetic
Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum
higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host
Penetration. PLOS ONE 10:e0125960
Kracher, D., and Ludwig, R. 2016. Cellobiose dehydrogenase: An essential enzyme for
lignocellulose degradation in nature - A review. Food Environ. 67:145-163
Lazo, G. R., Stein, P. A., and Ludwig, R. A. 1991. A DNA transformation-competent

Arabidopsis genomic library in Agrobacterium. Biotechnol. Nat. Publ. Co. 9:963-967
Leslie, J. F., and Summerell, B. A. 2006. The Fusarium laboratory manual. John Wiley & Sons
Li, H., and Durbin, R. 2009. Fast and accurate short read alignment with Burrows–Wheeler
transform. Bioinformatics 25:1754-1760
99
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G.,
and Durbin, R. 2009. The Sequence Alignment/Map format and SAMtools.
Bioinformatics 25:2078-2079
Other Phomopsis spp. on Soybean. Plant Dis. 94:1035-1040
longicolla. J. Microbiol. Methods 92:244-245
Li, S., Song, Q., Ji, P., and Cregan, P. 2015. Draft genome sequence of Phomopsis longicolla
type strain TWH P74, a fungus causing Phomopsis seed decay in soybean. Genome
Announc. 3: e00010-15
Logan, J., Mueller, M. A., and Graves, C. R. 1998. A Comparison of Early and Recommended
Soybean Production Systems in Tennessee. J. Prod. Agric. 11:319-325
Mayhew, W. L., and Caviness, C. E. 1994. Seed Quality and Yield of Early-Planted, Short-
Season Soybean Genotypes. Agron. J. 86:16-19
McGee, D. C., Brandt, C. L., and Burris, J. S. 1980. Seed mycoflora of soybeans relative to
fungal interactions, seedling emergence, and carry over of pathogens to subsequent crops.
Diaporthe spp. isolates recovered from soybean (Glycine max) seeds in Paraguay. Can. J.
Plant Pathol. 36:470-474
soybean in the early soybean production system of the midsouthern USA. Crop Prot.
25:310-317
Mullins, E. D., Chen, X., Romaine, P., Raina, R., Geiser, D. M., and Kang, S. 2001.
Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for
Insertional Mutagenesis and Gene Transfer. Phytopathology 91:173-180
Nevena, M., Jelena, V., and Franić-Mihajlović, D. 1997. A comparative study of

Diaporthe/Phomopsis fungi on soybean from two different regions of the world.
Mycopathologia 139:107-113
Mature Soybean Plants. Plant Health Prog. 16:118-122
100
Pachauri, R. K., Allen, M. R., Barros, V. R., Broome, J., Cramer, W., Christ, R., Church, J. A.,
Clarke, L., Dahe, Q., Dasgupta, P., and others. 2014. Climate change 2014: synthesis
report. Contribution of Working Groups I, II and III to the fifth assessment report of the
Intergovernmental Panel on Climate Change. IPCC.
Quinlan, R. J., Sweeney, M. D., Leggio, L. L., Otten, H., Poulsen, J.-C. N., Johansen, K. S.,
Krogh, K. B. R. M., Jørgensen, C. I., Tovborg, M., Anthonsen, A., Tryfona, T., Walter,
C. P., Dupree, P., Xu, F., Davies, G. J., and Walton, P. H. 2011. Insights into the
oxidative degradation of cellulose by a copper metalloenzyme that exploits biomass
components. Proc. Natl. Acad. Sci. 108:15079-15084
R Core Team. R: A Language and Environment for Statistical Computing. 2019. Vienna,
Austria. URL https://www.R-project.org/
Sambrook, J., and Russell, D. 2001. Molecular cloning: a laboratory manual. Cold Spring
harbor laboratory Cold Spring Harbor, NY.
Seong, K., Hou, Z., Tracy, M., Kistler, H. C., and Xu, J.-R. 2005. Random Insertional
Mutagenesis Identifies Genes Associated with Virulence in the Wheat Scab Fungus
Shortt, B. J. 1981. Epidemiology of Phomopsis Seed Decay of Soybean in Illinois. Plant Dis.
65:62-64
Sinclair, J. B. 1992. Discoloration of Soybean Seeds- An Indicator of Quality. Plant Dis.

76:1087-1091
Smith, J. E., Mengesha, B., Tang, H., Mengiste, T., and Bluhm, B. H. 2014. Resistance to
Botrytis cinerea in Solanum lycopersicoides involves widespread transcriptional
reprogramming. BMC Genomics 15:334
large phylogenies. Bioinformatics 30:1312-1313
Stapleton, P. C, and Dobson, A. D. W. 2003. Carbon repression of cellobiose dehydrogenase

production in the white rot fungus Trametes versicolor is mediated at the level of gene
transcription. FEMS Microbiol. Lett. 221:167-172
Tan, T.-C., Kracher, D., Gandini, R., Sygmund, C., Kittl, R., Haltrich, D., Hällberg, B. M.,
Ludwig, R., and Divne, C. 2015. Structural basis for cellobiose dehydrogenase action
during oxidative cellulose degradation. Nat. Commun. 6:7542
Tangthirasunun, N., Navarro, D., Garajova, S., Chevret, D., Tong, L. C. H., Gautier, V., Hyde,
K. D., Silar, P., and Berrin, J.-G. 2017. Inactivation of Cellobiose Dehydrogenases
Modifies the Cellulose Degradation Mechanism of Podospora anserina. Appl. Environ.
Microbiol. 83:e02716-16
101
TeKrony, D. M., Grabau, L. J., DeLacy, M., and Kane, M. 1996. Early Planting of Early-
Maturing Soybean: Effects on Seed Germination and Phomopsis Infection. Agron. J.
88:428-433
Udayanga, D., Liu, X., McKenzie, E. H. C., Chukeatirote, E., Bahkali, A. H. A., and Hyde, K. D.
2011. The genus Phomopsis: biology, applications, species concepts and names of
common phytopathogens. Fungal Divers. 50:189-225
Vaaje-Kolstad, G., Westereng, B., Horn, S. J., Liu, Z., Zhai, H., Sørlie, M., and Eijsink, V. G. H.
2010. An oxidative enzyme boosting the enzymatic conversion of recalcitrant
polysaccharides. Science 330:219-222
Walcott, R. R., McGee, D. C., and Misra, M. K. 1998. Detection of Asymptomatic Fungal
Infections of Soybean Seeds by Ultrasound Analysis. Plant Dis. 82:584-589
Wilcox, J. R., Laviolette, F. A., Athow, K. L., and others. 1974. Deterioration of soybean seed
quality associated with delayed harvest. Plant Dis. Report. 58:130-133
Yeoh, H. H., Khew, E., and Lim, G. 1985. A Simple Method for Screening Cellulolytic Fungi.
Yin, Y., Mao, X., Yang, J., Chen, X., Mao, F., and Xu, Y. 2012. dbCAN: a web resource for
automated carbohydrate-active enzyme annotation. Nucleic Acids Res. 40:445-451
102
Tables
Table 1. Primers used in this study.
Primer name Primer sequence Comment

343RTF1 5' TATTTGCAATGTGCCTCCACGG 3' qRT-PCR forward primer for CDH
343RTR1 5' ATCACGTAGCCTGTCGCGTA 3' qRT-PCR reverse primer for CDH
PlTubF1 5' CGACAGCAATGGCGTTTACAAC 3' qRT-PCR forward primer for tubulin
PlTubR1 5' ATGGTACCGGGCTCGAGAT 3' qRT-PCR reverse primer for tubulin
Forward primer to confirm insertion of
PL343F1 5' GTACGGAGTAGGTGTGTCTTTC 3'
mutagenesis cassette
Reverse primer to confirm insertion of
PL343R1 5' CGGCATGGCGGTTTAATATG 3'
Forward primer to confirm insertion of
PL343F2 5' CTGTACAGTACCTGCGTCTAATC 3'
Reverse primer to confirm insertion of
PL343R2 5' GCATCTCAATTTGTGCGTGTAA 3'
Table 2. RT-qPCR measuring the expression of CDH1 in PL343 and wild type.
PDA 0.5% CMC
PL2010AR PL343 PL2010AR PL343
1.00 (0.70-1.43) 0.44 (0.25-0.77) 61.84 (42.58-89.81) 2.11 (1.17-3.79)
qRT-PCR was performed with SYBR-green as the fluorescence reporter. The expression of the gene was
normalized to beta-Tubulin gene as endogenous control. The values show fold differences in expression of the
gene compared to the wild type on PDA. 2-ΔΔCT was used to calculate the relative expression of the gene. The
values in the parentheses represent the range of expression of the gene.
Tables 3. Pycnidiation of multiple strains of P. longicolla.

Pycnidiation levela
Strain Preliminary Secondary Final
screen screen screen
PL343 - - -
PL347 - - -
PL912 + + +
PL1126 - - -
PL1404 + + +
PL2010AR +++ +++ +++
a
+++ indicates wild-type level of pycnidiation. + indicates a reduction in pycnidiation greater than 50% when
compared to the wild-type levels, and - indicates absence of pycnidia.
103
Figures
**
Figure 1. Lesion length on soybean stems inoculated with P. longicolla. Strains were inoculated
on soybean using the cut stem protocol and lesions were measured ten days thereafter. (A) Mean
lesion length of 1114 random insertional mutants (n=3), wild type (strain PL2010AR) mean is
represented by a black line, respectively (n=79). (B) Pycnidiation and lesion on soybean stems
inoculated with the wild-type strain PL2010AR, and the insertional mutants PL1004 and PL343.
(C) Mean lesion length of selected mutants and wild type (n=3), error bars represent the standard
error of the mean. P values were calculated with Dunnett’s many-to-one test with wild type as
reference. **Significantly different from wild-type strain (P<0.01) according to Dunnett’s test.
104
Figure 2. Relationship between colony diameter and lesion length. A significant correlation
(R2= 0.74, P<0.0001) was observed between radial growth and lesion length of 20 strains of P.
longicolla, including the wild-type strain PL2010-AR (gray filled circle), PL343 (triangle), and
other selected mutants (white filled circle). Colony diameter was measured four days after
inoculation on full strength PDA plates (n=3) incubated in the dark at room temperature and
lesion length was measured ten days after inoculation on soybean cut stems (n=3). Both
experiments were repeated once and their average used to compute the linear regression
coefficient. Standard error is represented by the gray band around regression line.
105
Figure 3. Southern blot of P. longicolla mutant strains.
106
Figure 4. P. longicolla mutant PL343 has impaired seed infection and colonization. (A)
Recovery rate of P. longicolla from soybean seeds. Whole plants were inoculated at early pod-
filling stage and kept in a mist chamber for 48 hours immediately thereafter and once more at
yellow pod stage. At harvest maturity, seeds were hand harvested and plated on full strength
PDA after surface disinfestation. P. longicolla recovery rate was visually assessed five days
thereafter. (B) Ergosterol content on soybean seeds inoculated in vitro with P. longicolla. All
values for Mock were zero in both incidence and ergosterol measurements. Thus, Mock
treatment was left out of statistical analyze. Bars with different letters are significantly different
(P<0.01) according to Tukey’s range test.
107
Figure 5. Maximum likelihood phylogenetic tree of P. longicolla proteins from the AA8
CAZyme family and N. crassa CDH1 and CDH2. Conserved domain architecture is shown on
the right. CDH-cyt: cytochrome domain of cellobiose dehydrogenase; BetA: Choline
dehydrogenase; CBM_1: Fungal cellulose binding domain. Bootstrap support (100 replicates)
are indicated on the branches. Tree was rooted on a CAZyme AA3 protein from P. longicolla.
108
Figure 6. PL343 is hindered in radial growth relative to wild type on CMC (carboxymethyl
cellulose) but not PDA (potato dextrose agar). PL2010-AR (wild type) and PL343 were grown
on PDA (A) and 0.5% CMC (B) for 4 days in the dark at room temperature. 0.5% CMC plates
were stained with Congo red after incubation. (C) Strains were center inoculated with a 5mm
plug. Measurements were taken after 4-day incubation in the dark at room temperature. Letters
indicate statistically significant differences between strains as determined by Tukey-Kramér test
(P < 0.05).
109
Chapter V: MoNSTR-seq, a restriction site-associated DNA sequencing technique to
characterize Agrobacterium-mediated transfer-DNA insertions in Phomopsis longicolla
Abstract
Phomopsis longicolla (Hobbs) causes Phomopsis seed decay and stem lesions in soybean
(Glycine max). In this study, a novel, high-throughput adaptation of RAD-seq termed MoNSTR-
seq (Mutation analysis via Next-generation DNA Sequencing of T-DNA Regions) was
developed to determine the genomic location of T-DNA insertions in P. longicolla mutants.
Insertional mutants were created via ATMT, and one mutant, strain PL343, was further
investigated due to impaired stem lesion formation. MoNSTR-seq, in which DNA libraries are
created with two distinct restriction enzymes and customized adapters to simultaneously enrich
both T-DNA insertion borders, was developed to characterize the genomic lesion in strain
PL343. MoNSTR-seq successfully identified a T-DNA insertion in the predicted promoter
region of a gene encoding a cellobiose dehydrogenase (CDH1), and the position of the T-DNA
insertion in strain PL343 was confirmed by Sanger sequencing. Thus, MoNSTR-seq represents
an effective tool for molecular genetics in P. longicolla, and is readily adaptable for use in
diverse fungal species.
Introduction
Forward genetic screens are a powerful tool for gene discovery and pathway dissection in
filamentous fungi. Genetic screens have been used effectively to discover novel genes in plant
pathogenic fungi such as Fusarium graminearum, Colletotrichum higginsianum, Magnaporthe
grisea, and Leptosphaeria maculan (Idnurm and Howlett 2002; Seong et al. 2005; Gupta and
Chattoo 2007; Korn et al. 2015). However, a key constraint with forward genetics is the ability
to efficiently characterize genomic lesions in mutants. Numerous approaches have been
110
developed to define insertion sites of mutagenesis cassettes, including plasmid rescue (Tam and
Lefebvre 1993), thermal asymmetric interlaced PCR (TAIL PCR; Dent et al. 2005), restriction
enzyme site directed amplification PCR (Gonzalez-Ballester et al. 2005), 3’- rapid amplification
of cDNA ends (Meslet-Cladiere and Vallon 2012), and site finding PCR (Li et al. 2012). These
methods, however, have distinct limitations, particularly regarding throughput. With the advent
of next-generation DNA sequencing, whole-genome re-sequencing at varying depths of coverage
has been utilized successfully to identify genomic lesions in some species of fungi (Pomraning et
al. 2011; Esher et al. 2015). However, costs currently associated with whole-genome
resequencing often hinder the application of this approach to large collections of insertional
mutants, and may be less effective for non-model organisms due to the limited availability of
reference genome sequences.
Restriction Digestion Associated sequencing (RAD-seq) is a reduced representation
sequencing strategy in which genomic regions flanking a specific restriction enzyme are
selectively enriched for sequencing (Baird et al. 2008). The general workflow consists of
digesting genomic DNA with a restriction enzyme, ligating oligonucleotide adapters to the
digested DNA, enriching fragments containing the restriction site via PCR amplification,
selecting fragments based on size, and sequencing fragments on a next-generation DNA
sequencing platform. Distinct advantages of RAD-seq include flexibility regarding the selection
of restriction enzymes, no requirement for a reference genome sequence a priori, and
substantially higher throughput compared to whole-genome re-sequencing. RAD-seq has been
widely adopted in taxonomically diverse organisms for population genetics (e.g., Hohenlohe et
al. 2010; Cromie et al. 2013; Leboldus et al. 2015), plant breeding (Yang et al. 2011; Pfender et
al. 2011), and, more recently, for gene discovery among insertional mutants of green algae
111
(Zhang et al. 2014). However, RAD-seq has not yet been adapted to characterize random
insertional mutations in filamentous fungi.
Phomopsis longicolla is an important pathogen of soybean (Gomes et al. 2013; Mengistu
et al. 2014). Although P. longicolla is generally associated with Phomopsis seed decay (PSD) in
the U.S., it has been reported to cause serious stem canker diseases in other regions of the world
(Cui et al. 2009). Despite its importance as a pathogen of soybean, the molecular underpinnings
of pathogenesis in P. longicolla are unknown. Recently, new molecular resources have become
available, including a protocol for genetic transformation (Li et al. 2013) and draft genome
sequences for two isolates of P. longicolla (Li et al. 2015). However, neither molecular genetics
nor functional genomics have been utilized to investigate the P. longicolla/soybean pathosystem.
In this study, insertional mutants of P. longicolla were created via Agrobacterium-
mediated transformation, and one mutant was selected for further study based on reduced
virulence on soybean stems. Subsequently, a protocol was created utilizing an adaptation of
RAD-seq to determine the genomic location of T-DNA insertions in P. longicolla mutants. This
novel approach, called MoNSTR-seq (Mutation analysis via Next-generation DNA Sequencing
of T-DNA Regions), represents a significant advancement for molecular genetics in P. longicolla
and has broad potential applicability to other fungal systems.
Generation of P. longicolla mutants. Mutants of P. longicolla, including strain PL343,
were created via Agrobacterium tumefaciens-mediated transformation (ATMT) from wild-type
strain PL2010AR as previously described (Li et al. 2013). A. tumefaciens strain AGL-1 (Lazo et
al. 1991) carrying pBHt2_sGFP, derived from pBHt2 (Mullins et al. 2001), was used for
mutagenesis.
112
Southern blot analysis. Fungi were cultured in potato dextrose broth medium (PDB; BD
Diagnostic Systems) for seven days at 80 RPM at room temperature. Fungal genomic DNA was
isolated from dried tissue as described by Leslie and Summerell (2008). Southern blotting
followed the protocol of Sambrook and Russell (2001). DNA was digested and probed as
described by Li et al. (2013). The probe was labeled with 32P and purified as described
previously (Flaherty et al., 2003). Hybridizations were performed as described by Sambrook and
Russell (2001). Following hybridization, blots were washed as described by Flaherty et al.
(2003), exposed to a phosphorimaging screen, and visualized with a Typhoon FLA 9500 (GE
Healthcare Bio-Sciences, Pittsburgh, PA, USA).
Pathogenicity assay. Fungal strains were evaluated for pathogenesis on soybean cultivar
Hutcheson (Buss et al. 1988) with a slightly modified cut stem assay (Li et al. 2010). Fungal
strains were grown on 0.2× strength PDA for 4 days in an incubator under 12:12 hours light-dark
cycle at 25C. Soybean plants were grown in 48-cell insert trays until the first trifoliate leaf was
fully expanded (V2 stage of growth), at which point the stem was truncated 2 cm above the
unifoliate leaf node. For inoculation, the wide end of a sterile micropipette tip (1-200 l) was
used to excise a colonized plug of 0.2× strength PDA medium. The micropipette tip containing
the excised plug was placed in full contact with the cut stem (n= 12). After 10 days, the
micropipette tip was removed and the length of necrotic lesion was measured starting from the
edge of the cut stem.
Characterization of T-DNA insertions via MoNSTR-seq. MoNSTR-seq utilizes relatively
rare endonuclease sites (AseI and BpuEI) located 91 and 94 base pairs from T-DNA left and
right borders, respectively. RNA-free genomic DNA was extracted from strain PL343 with a
CTAB method as described by Li et al. (2013). DNA (1 μg per reaction) was digested with AseI
113
or BpuEI (New England BioLabs, Ipswich, MA, USA) at 37 °C for 3 hours. Digested DNA was
cleaned with a GeneJET gel extraction kit, followed by a DNA clean up microkit (Thermo Fisher
Scientific, Waltham, MA, USA). Custom barcoded sequencing adapters were designed
containing AseI and BpuEI sticky overhangs by modifying the Ion Torrent sequencing adapter
(Integrated DNA Technologies, Coralville, IA, USA; Table 1). Two μl of 20 μM solutions of
each adapter, 1_ AseI and 2_BpuEI, were ligated with T4 DNA ligase to digested DNA in
separate ligation reactions for 10 minutes at room temperature. After the ligation step, another
round of clean up was performed as described above to remove unligated adapters. The ligated
DNA samples were then combined and fragmented with Fragmentase® followed by end repair
as per manufacturer’s instructions (New England BioLabs). The Ion Torrent sequencing adapter
P1 obtained from Integrated DNA Technologies (Coralville, IA, USA) was ligated to the
fragmented DNA with the NEBNext Fast DNA Library Prep Kit (New England BioLabs). The
adapter-ligated DNA fragments were size selected for 480-bp fragments with Agilent
AMPureXP beads (Beckman Coulter Inc., Brea, California, USA). Finally, the library was
amplified with primers complimentary to the P1 adapter and the 1_ AseI or 2_BpuEI adapters
with the following parameters: 95 °C for 30s, 14 cycles of 95 °C for 30s, 56 °C for 30s, and 72
°C for 30s, followed by 72 °C for 5 min. Following amplification, the template was sequenced
with the Ion PGM platform with an Ion 314 V2 chip following the manufacturer's protocol.
Reads were first mapped to the T-DNA cassette and then mapped to the P. longicolla MSPL 10-
6 draft genome (Genbank accession AYRD00000000) using bwa version 0.7.10-r789 (Li and
Durbin 2009) and processed using SAMtools version 0.1.18 (Li et al. 2009).
114
Results
To identify genes in P. longicolla associated with pathogenesis, a collection of ATMT
mutants was screened with a cut stem assay (Li et al. 2010). Ten days after inoculation, PL343
caused stem lesions averaging 14.75 mm long, significantly (P<0.001) shorter than lesions
caused the wild type-strain, which averaged approximately 24.74 mm (Fig. 1A). The growth of
strain PL343 was significantly impaired when provided cellulose as a carbon source in a defined
culture medium, yet was indistinguishable from the wild type on potato dextrose agar (Fig. 1B).
The MoNSTR-seq protocol was developed to identify the site of T-DNA integration in
strain PL343. Unique restriction enzyme sites were identified within 90-95 bp of the left and
right borders of the mutagenesis cassette (Fig. 2). Genomic DNA from the mutant strain was
digested and adapters with corresponding overhangs were ligated before sequencing the
fragments (Fig. 2). Thus, the libraries were designed to be enriched for sequences containing the
break junction on either side of the mutagenesis cassette. A total of 0.5 million reads were
obtained for strain PL343 from one Ion Torrent 314 chip. The T-DNA insertion site was
identified by sequentially mapping reads first to the cassette and then to the draft genome of
strain MSPL 10-6 (GenBank accession SAMN01162173; Li et al. 2015). A read spanning the
right break junction was mapped to the genome. The T-DNA insertion was mapped to a site 511
bp upstream of the putative start codon of a gene predicted to encode a cellobiose dehydrogenase
homologous to CDH1 of Neurospora crassa (Fig. 3A). Southern blot analysis indicated the
presence of a single T-DNA insertion in strain PL343 (Fig. 3B). The T-DNA insertion
discovered via MoNSTR-seq was validated by PCR with primers flanking the putative insertion
site. The difference in band size between the wild type and PL343 was consistent with the length
of the insertion cassette (Fig. 3C). Sanger sequencing of the PCR products confirmed the
115
position of the T-DNA insertion and revealed a deletion of 87 bp from the left border of the
cassette. This deletion likely accounts for the absence of reads mapping to the left border
junction in the P. longicolla genome.
Discussion
The T-DNA insertion in the putative promoter of CDH1 in strain PL343 provides a
plausible explanation for the mutant’s phenotype. The impaired capability of this mutant to
induce necrosis on soybean stems, of which the predominant carbohydrate is cellulose,
implicates CDH1 in cellulose catabolism and pathogenesis. Cellobiose dehydrogenase enzymes,
such as those encoded by putative orthologs of CDH1, have long been associated with cellulose
degradation (Ayers et al., 1978). The recent discovery that cellobiose dehydrogenases act in
concert with lytic polysaccharide monooxygenases via an oxidative mechanism to depolymerize
cellulose (Tan et al., 2015) suggests that this specific mechanism of cellulose catabolism may be
paramount for carbohydrate acquisition in P. longicolla during pathogenesis. However, a
thorough functional characterization of CDH1 in P. longicolla will require additional effort,
including targeted gene disruption and complementation assays.
MoNSTR-seq represents a distinct improvement over genome walking (Shyamala and
Ames 1989) and plasmid rescue (Tam and Lefebvre 1993), two methods commonly used for
insertion site determination in filamentous fungi. MoNSTR-seq is relatively inexpensive and
simple to perform, allows high throughput characterization of mutants, and is adaptable to
various next-generation DNA sequencing platforms. Additionally, MoNSTR-seq could readily
be adapted to detect a wide range of cassette truncation scenarios, a major limitation of current
gene discovery methods, including a recent RAD-seq derived technique in Chlamydomonas
(ChlaMmeseq; Zhang et al, 2014). For example, combining long-read DNA sequencing and a
116
rare endonuclease site in the T-DNA would enable MoNSTR-seq to overcome large T-DNA
truncation events. Alternatively, short-read technologies coupled with multiple endonuclease
sites could be used to address the same constraint. Although in this paper a single mutant strain
was investigated, MoNSTR-seq can be used in high-throughput genotyping of mutant pools
using barcoded adapters. With T-DNA break junction enrichment, MoNSTR-seq circumvents
whole genome re-sequencing, which increases throughput, and decreases per-strain sequencing
expenses.
Additional advantages of MoNSTR-seq include the ability to obtain a considerable
amount of sequence data spanning T-DNA insertion sites, which is particularly useful when T-
DNA insertion occurs in a repetitive region. In principle, MoNSTR-seq is not affected by
genome complexity or size, and it also dispenses the need of a draft genome. Additionally, the
method can be widely adapted to existing fungal mutant collections generated using T-DNA
insertion. However, MoNSTR-seq is not likely to identify whole-plasmid insertions due to its
dependence upon targeted endonuclease-sites within the T-DNA.
On the whole, MoNSTR-seq makes the characterization of T-DNA break junctions in P.
longicolla mutants created via ATMT more affordable and technically accessible. This
technique facilitates the application of forward genetics as a tool for gene discovery in P.
longicolla. Relatively minor modifications of MoNSTR-seq should accelerate gene discovery in
collections of ATMT-derived mutants in a myriad of organisms.
117
Literature cited
Ayers, A., Ayers, S. and Eriksson, K.-E.L. 1978. Cellobiose oxidase purification and partial
characterization of a hemoprotein from Sporotrichum pulverulentum. Eur J Biochem.
90:171-181
Baird, N.A., Etter, P.D., Atwood, T.S., Currey, M.C., Shiver, A.L., Lewis, Z.A., Selker, E.U.,
Cresko, W.A. and Johnson, E.A. 2008. Rapid SNP discovery and genetic mapping using
sequenced RAD markers. PloS One 3:e3376
Using lme4. Journal of Statistical Software 67:1-48
Buss, G. R., Camper, H. M., and Roane, C. W. 1988. Registration of “Hutcheson” soybean.
Crop Sci. 28:1024-1025
Cromie, G.A., Hyma, K.E., Ludlow, C.L., Garmendia-Torres, C., Gilbert, T.L., May, P., Huang,
A.A., Dudley, A.M. and Fay J.C. 2013. Genomic sequence diversity and population
structure of Saccharomyces cerevisiae assessed by RAD-seq. Genes Genomes Genetics
3:2063-2172
Cui, Y.-L., Duan, C.-X., Wang, X.-M., Li, H.-J., and Zhu, Z.-D. 2009. First report of
Phomopsis longicolla causing soybean stem blight in China. Plant Pathol. 58:799-799
Dent, R.M., Haglund, C.M., Chin, B.L., Kobayashi, M.C. and Niyogi, K.K. 2005. Functional
genomics of eukaryotic photosynthesis using insertional mutagenesis of Chlamydomonas
reinhardtii. Plant Physiol. 137:545-556
Esher, S.K., Granek, J.A. and Alspaugh, J.A. 2015. Rapid mapping of insertional mutations to
probe cell wall regulation in Cryptococcus neoformans. Fungal Genet Biol. 82:9-21
Flaherty, J.E., Pirttila, A.M., Bluhm, B.H. and Woloshuk, C.P. 2003. PAC1, a pH-regulatory
gene from Fusarium verticillioides. Appl Environ Microbiol. 69:5222-5227
2013. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia:
Mol Phylogeny Evol Fungi 31:1-41
González-Ballester, D., Montaigu, A., Galván, A. and Fernández, E. 2005. Restriction enzyme
site-directed amplification PCR: a tool to identify regions flanking a marker DNA. Anal
Biochem. 340:330-335
formation in Magnaporthe grisea. Fungal Genet Biol. 44:1157-1169
118
Hohenlohe, P.A., Bassham, S., Etter, P.D., Stiffler, N., Johnson, E.A., and Cresko, W.A. 2010.
Population Genomics of Parallel Adaptation in Threespine Stickleback using Sequenced
RAD Tags. PloS Gen. 6:e1000862
Idnurm, A., and Howlett, B. J. 2002. Isocitrate lyase is essential for pathogenicity of the fungus
Leptosphaeria maculans to canola (Brassica napus). Eukaryot Cell 1:719-724
Korn, M., Schmidpeter, J., Dahl, M., Müller, S., Voll, L. M., and Koch, C. 2015. A genetic
screen for pathogenicity genes in the hemibiotrophic fungus Colletotrichum
higginsianum identifies the plasma membrane proton pump Pma2 required for host
penetration. PLoS One 10:e0125960

Arabidopsis genomic library in Agrobacterium. Biotechnol Nat Publ Co. 9:963-967
Leboldus, J.M., Kinzer, K., Richards, J., Ya, Z., Yan, C., Friesen, T.L. and Brueggeman, R.
2015. Genotype-by-sequencing of the plant-pathogenic fungi Pyrenophora teres and
Sphaerulina musiva utilizing Ion Torrent sequence technology. Mol Plant Pathol.
16:623-632
Leslie, J. F., and Summerell, B. A. 2008. The Fusarium laboratory manual. John Wiley &
Sons.
Li, H., and Durbin, R. 2009. Fast and accurate short read alignment with Burrows-Wheeler
transform. Bioinformatics 25:1754-1760.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G.,
Durbin, R., and 1000 Genome Project Data Processing Subgroup. 2009. The sequence
alignment/map format and SAMtools. Bioinformatics 25:2078-2079
Li, X., Moelleringa, E.R., Liu, B., Johnny, C., Fedewac, M., Sears, B.B., Kuoc, M.H. and
Benning, C. 2012. A galactoglycerolipid lipase is required for triacylglycerol
accumulation and survival following nitrogen deprivation in Chlamydomonas reinhardtii.
Plant Cell 24:4670-4686
longicolla. J. Microbiol. Methods. 92:244-245
Li, S., Song, Q., Ji, P., and Cregan, P. 2015. Draft genome sequence of Phomopsis longicolla
type strain TWH P74, a fungus causing phomopsis seed decay in soybean. Genome
Announc. 3:e00010-15
119
Diaporthe spp. isolates recovered from soybean (Glycine max) seeds in Paraguay. Can.
J. Plant Pathol. 36:470-474
Meslet-Cladière, L. and Vallon, O. 2012. A new method to identify flanking sequence tags in
Chlamydomonas using 3′-RACE. Plant Methods 8:21
Mullins, E. D., Chen, X., Romaine, P., Raina, R., Geiser, D. M., and Kang, S. 2001.
Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for
Insertional Mutagenesis and Gene Transfer. Phytopathology 91:173-180
Pfender, W.F., Saha, M.C., Johnson, E.A. and Slabaugh, M.B. 2011. Mapping with RAD
(restriction-site associated DNA) markers to rapidly identify QTL for stem rust resistance
in Lolium perenne. Theor and Appl Genet. 122:1467-1480
Pomraning, K.R., Smith, K.M. and Freitag, M. 2011. Bulk Segregant Analysis Followed by
High-Throughput Sequencing Reveals the Neurospora Cell Cycle Gene, ndc-1, To Be
Allelic with the Gene for Ornithine Decarboxylase, spe-1. Eukaryotic Cell 10:724-733
Sambrook, J., and Russell, R.W. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold
spring harbor laboratory press, Cold Spring Harbor, N.Y.
Seong, K., Hou, Z., Tracy, M., Kistler, H. C., and Xu, J.-R. 2005. Random insertional
mutagenesis identifies genes associated with virulence in the wheat scab fungus
Shyamala V. and Ames, G.F. 1989. Genome walking by single-specific-primer polymerase

chain reaction: SSP-PCR. Gene 84:1-8
Tam, L.W. and Lefebvre, P.A. 1993. Cloning of flagellar genes in Chlamydomonas reinhardtii
by DNA insertional mutagenesis. Genetics 135:375-384
Tan, T.C., Kracher, D., Gandini, R., Sygmund, C., Kittl, R., Haltrich, D., Hällberg, B.M.,
during oxidative cellulose degradation. Nat Comm. 6:7542
Yang, H., Tao, Y., Zheng, Z., Li, C., Sweetingham M.W. and Howieson, J.G. 2011. Application
of next-generation sequencing for rapid marker development in molecular plant breeding:
a case study on anthracnose disease resistance in Lupinus angustifolius L. BMC
Genomics 13:318
Zhang, R., Patena, W., Armbruster, U., Gang, S.S., Blum, S.R. and Jonikas, M.C. 2014. High-
Throughput Genotyping of Green Algal Mutants Reveals Random Distribution of
120
Mutagenic Insertion Sites and Endonucleolytic Cleavage of Transforming DNA. The
Plant Cell 26, 1398-1409
121
Tables
Table 1. Sequences of the modified duplex A-adapters (1_AseI and 2_BpuEI) containing the
restriction enzyme overhang, and the adapter P1 used for library preparation in MoNSTR-seq.
The letters in bold represent barcodes to distinguish the enzyme sites. *represents
Phosphorothioate bonds that prevent action of exo- and endonucleases.
Adapter
Sequence
name
A-Adapter 5’ TAATCGTTACCTTAGCTGAGTCGGAGACACGCAGGGATGAGATGG*T*T 3’
1_ASEI 5’ CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGAT 3’
A-Adapter 5’ ATCGTTCTCCTTACTGAGTCGGAGACACGCAGGGATGAGATGG*T*T 3’
2_BpuEI 5’ CCATCTCATCCCTGCGTGTCTCCGACTCAGTAAGGAGAACGATTC 3’
5' CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT 3’
Adapter P
5' ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGT*T* 3’
122
Figures
Figure 1. Phenotypic characterization of P. longicolla mutant strain PL343. (A) Radial growth
of strain PL2010AR (wild type; black bars) and mutant strain PL343 (white bars) on potato
dextrose agar and carboxymethyl cellulose agar (n= 6). (B) Length of necrotic lesions measured
10 days after inoculation on cut soybean stems (n= 12). Letters above bars, in the same plot,
indicate significant difference (P<0.001) according to Tukey-Kramer mean test. Error bars
represent the standard error of the mean. Statistical test was performed with lme4 (Bates et al.
2015) package in R (R Core Team, 2019) with radial growth and lesion length treated as Gamma
distributed variables.
123
Figure 2: Step-by-step illustration of MoNSTR-seq used to identify a T-DNA break junction in
the P. longicolla strain PL343.
124
A
PL2010AR
CDH1
T-DNA
F2 F1 R1 R2
PL343
T-DNA CDH1
B C
PL2010AR
Marker
PL343
PL2010AR PL343
1 2 3 4 5
5000 bp
1650 bp
500 bp
1000 bp
500 bp
Figure 3: Confirmation of the T-DNA insertion site identified via MoNSTR-seq in the genome
of strain PL343. (A) Cartoon depicting the T-DNA insertion in strain PL343, including PCR
primers designed to flank the predicted insertion site. (B) PCR amplification with PCR primers
flanking the T-DNA insertion in strain PL343. (C) Southern blot indicating the presence of a
single T-DNA insertion in strain PL343. Strain PL2010AR was the wild type used in this study.
125
Chapter VI: HAP3, a component of the CCAAT-binding complex of Phomopsis longicolla,
regulates pathogenesis during infection of soybean
Abstract
Phomopsis longicolla (Hobbs) causes Phomopsis seed decay, one of the most prevalent
and potentially damaging diseases of soybean seed. Currently, little is known about the
molecular basis of pathogenesis in P. longicolla, in part because crucial tools for molecular
genetics, such as targeted gene deletion, have not been demonstrated in this organism. In other
filamentous fungi, the heterotrimeric CCAAT-binding complex is involved in diverse aspects of
growth and development, including secondary metabolism, morphogenesis, and pathogenesis. In
this study, a putative component of the CCAAT-binding complex (HAP3) was identified and
characterized in P. longicolla. The HAP3 gene was successfully deleted via homologous
recombination, and the mutant was genetically complemented via reintroduction of the wild-type
gene. HAP3 deletion strains did not produce pycnidia or conidia and were substantially impaired
in radial growth. In addition, deletion of HAP3 significantly reduced P. longicolla pathogenicity
on soybean seeds and stems. Expression profiling during colonization of soybean seeds
identified 2353 genes differentially regulated following deletion of HAP3, including genes
predicted to encode plant biomass degrading enzymes, effector proteins, and structural and
enzymatic components of secondary metabolism. This study established the involvement of the
CCAAT-binding complex in P. longicolla pathogenesis and demonstrated the feasibility of
targeted gene deletion in this organism. Phenotypic similarities between HAP3 deletion mutants
of P. longicolla and other filamentous fungi suggest a broad involvement of the CCAAT-binding
complex in fungal growth, development, and pathogenesis.
126
Introduction
Phomopsis longicolla Hobbs (synonym = Diaporthe longicolla) is the primary causal
agent of Phomopsis seed decay (PSD) of soybean (Hobbs et al. 1985). Soybean seeds affected
by PSD are typically shriveled, cracked, chalky, and/or discolored, although symptomless
infection can occur when environmental conditions are not conducive for symptom development
(Sinclair 1993; Hepperly 1978; Sinclair 1992). PSD reduces seed quality by decreasing seed
germination and vigor (Zorrilla et al. 1994). Infected seeds are unable to germinate or germinate
poorly, potentially giving rise to infected seedlings with significantly increased rates of pre- and
post-emergence damping-off under disease-conducive conditions (Nicholson 1972). PSD affects
soybean seed quality in most soybean-growing regions of the world. In the U.S., PSD is
particularly problematic in the Mid-South where hot and humid conditions during seed
maturation can favor disease development (Kmetz et al. 1979; Rupe 1990). PSD has caused
significant economic losses over the past few decades throughout U.S. soybean production
regions and has received widespread attention in the Mid-South due to increased usage of early
soybean production system (ESPSs) (Wrather et al. 2003, 2004; Mengistu and Heatherly 2006).
ESPSs focus on planting early-maturing cultivars early in the spring to avoid late-season
droughts that periodically impact the Mid-South; however, soybean seed maturation in ESPSs
typically occurs in August, when heat and humidity are ideal for PSD (Egli et al. 2005; TeKrony
et al. 1983).
To date, the molecular basis of pathogenesis underlying PSD is poorly understood, in
large part due to the unavailability of crucial genetic and genomic resources for P. longicolla or
related species within the genus. In recent years, significant advancements have been made in
support of molecular genetics and functional genomics approaches in P. longicolla, including
127
protocols for genetic transformation (Li et al. 2013) and characterization of T-DNA insertions
(Zaccaron et al. 2018), draft genome sequences for two isolates of the pathogen, including the
type strain (Li et al. 2014, 2015), and a predicted interactome of protein models (Li et al. 2018).
In addition, draft genome sequences are available for D. helianthi (Baroncelli et al. 2016), two
isolates of D. ampelina (Savitha et al. 2016), an unidentified Diaporthe sp. (de Sena Filho et al.
2016), and the causal agent of southern stem canker of soybean, D. aspalathi (synonym =
Diaporthe phaseolorum var. meridionalis; Li et al. 2016). Recently, a targeted gene deletion
approach utilizing Agrobacterium tumefaciens was successfully employed to functionally
characterize DhPKS1 in D. helianthi (Ruocco et al. 2018). However, the ability to perform
functional genomics in P. longicolla, particularly reverse genetics via targeted gene deletion, has
not been reported thus far.
The heterotrimeric CCAAT-binding complex (CBC) of eukaryotes is broadly conserved
in animals, plants, and fungi (McNabb and Pinto 2005; Edwards et al. 1998; Becker et al. 1991).
The fungal CBC was originally described in Saccharomyces cerevisiae as the Hap regulatory
complex and found to consist of three core subunits: Hap2, Hap3, and Hap5 (Olesen et al. 1987;
McNabb et al. 1995). More recently, a fourth subunit of the CBC exclusive to fungi, HapX, has
been identified and characterized in filamentous Ascomycetes (Tanaka et al. 2002; Jung et al.
2010). In fungi, all three core components must be present for the functionality of the complex
(Ridenour and Bluhm 2014; McNabb et al. 1995). The CBC is a key regulator of iron
acquisition and homeostasis (Chakravarti et al. 2017) and the shift from fermentation to aerobic
respiration in yeast (McNabb and Pinto 2005). In filamentous fungi, the CBC has been
implicated as a regulator of responses to oxidative stress, secondary metabolism, and plant
128
pathogenesis (Ridenour and Bluhm 2014; Hong et al. 2013; Yin and Keller 2011; Thön et al.
2010).
The objective of this study was to identify potential mechanisms underlying pathogenesis
in P. longicolla. To this end, HAP3, which encodes the ortholog the CBC subunit Hap3, was
identified in P. longicolla and targeted for deletion using a reverse genetics approach.
Subsequently, HAP3 deletion mutants were evaluated for defects in growth, development, and
pathogenicity. Additionally, gene expression profiling was performed to determine how deletion
of HAP3 impacts transcriptional reprogramming during colonization of soybean seeds.
Materials and Methods
P. longicolla strains, soybean plants, and growing conditions. The wild-type strain
PL2010AR, described previously (Li et al. 2013), was utilized due to pronounced virulence and
amenability to genetic transformation. The HAP3 ortholog was identified as described below
and deleted in strain PL2010AR to create strains PLH100 and PLH101. The wild-type copy of
the HAP3 locus was reintroduced into strain PLH101 to create the genetically complemented
strain PLH101C. Each strain was single-spore purified on its respective selective medium and
routinely sub-cultured every 10-14 days on V8 agar with antibiotics to maintain selection of
deletion or complementation strains. Radial growth rates were assessed by center-inoculating 6-
mm colonized-PDA plugs on three Petri dishes containing potato dextrose agar (PDA), V8, or
complete medium (Correll 1987; Leslie and Summerell 2006). Cultures were incubated in 12:12
h light-dark cycles at 25C. The diameter of each colony was measured four days after
inoculation. To assess pycnidiation and conidiation, each strain was cultured on three oatmeal
agar plates (OMA; Becton Dickinson and Company, Franklin Lakes, NJ, USA) for 14 days at
129
25C in a 12:12 h light-dark cycle. All strains were stored as blocks of colonized PDA
suspended in 30% glycerol (v:v) at -80C.
The fast-maturing soybean cultivar ‘Traff’ (PI 470930; maturity group 000) was used to
assess pathogenicity of P. longicolla strains and the differential gene expression experiment.
Seeds were surface disinfested for 30 seconds in 70% ethanol followed by 30 seconds in 0.5%
sodium hypochlorite and thoroughly rinsed in sterile deionized water before they were sown into
flats containing pasteurized potting mixture (Metro-Mix 900; Sun Gro Horticulture, Agawam,
MA, USA) in greenhouses at the University of Arkansas - Fayetteville. Healthy and vigorous
seedlings were individually transplanted to four-inch pots four days after emergence. The
greenhouse temperature was maintained at 20-26C, with a 14:10 h light-dark cycle. To
maximize conditions for production of healthy seeds, plants were watered as needed by flooding
the trays containing the pots to avoiding wetting plant canopies.
Identification of HAP3 in P. longicolla. The draft assembly and predicted gene models of P.
longicolla strain MSPL10-6 (Li et al. 2014) were obtained at
http://bioinformatics.towson.edu/Phomopsis_longicolla/Download.aspx, accessed: April 2018.
The amino acid sequence of HAP3 from Fusarium verticillioides (Ridenour and Bluhm 2014)
was used as the query in homology searches with BLASTp (Altschul et al. 1997) to identify the
corresponding homologs in P. longicolla and other species. The P. longicolla HAP3 homolog
was manually curated by mapping the amino acid sequence of F. verticillioides HAP3 to the P.
longicolla genome with Exonerate v2.2 (Slater and Birney 2005). Introns within HAP3 of P.
longicolla were predicted by analyzing the splicing patterns of RNA-seq reads mapped to the P.
longicolla genome. The species phylogenetic tree was constructed based on 20 universal single-
copy orthologs (USCOs) conserved among the analyzed taxa identified with BUSCO v2 (Simão
130
et al. 2015). Protein sequences of USCOs were individually aligned with ClustalOmega v1.2.3
(Sievers et al. 2011) and gaps were removed with trimAl v1.2 (Capella-Gutiérrez et al. 2009).
Alignments were concatenated and a tree was inferred with RAxML v8.2.11 (Stamatakis 2014)
with settings adjusted to perform 100 rapid bootstrap replicates and to automatically select the
protein substitution model. Amino acid conservation among HAP3 orthologs was evaluated with
local and global alignments constructed with the Smith-Waterman (Smith and Waterman 1981)
and Needleman-Wunsch (Needleman and Wunsch 1970) algorithms, respectively, implemented
within the EMBOSS suite v6.6.0 (Rice et al. 2000). Protein sequences of HAP3 orthologs were
queried against the NCBI conserved domains database (CDD) v3.16 (Marchler-Bauer et al.
2017) for the identification of the histone-like conserved domain.
Creation of plasmids for targeted deletion and genetic complementation of HAP3. Binary
vector pCambia2301(CAMBIA Institute; http://www.cambia.org/, accessed: January 2017) was
modified by replacing elements between the left and right borders at XhoI and BstEII restriction
sites with hpt and sGFP cassettes flanked by multiple cloning sites (MCS). The resulting
plasmid was designated pBYR14. Subsequently, regions upstream (5' flank; 756 bp) and
downstream (3' flank; 760 bp) of the predicted P. longicolla HAP3 open reading frame were
inserted into the two MCS regions of pBYR14 to create the gene replacement construct. The 5'
flank was amplified from genomic DNA of wild-type P. longicolla strain PL2010AR with
primers PlHAP3-KpnI-F1/ PlHAP3-ApaI-F2, which introduced KpnI and ApaI restriction sites
for directional cloning into the first MCS of pBYR14. Similarly, the 3' flank was amplified by
PlHAP3-PacI-F3/ PlHAP3-HindIII-F4 which introduced PacI and HindIII restriction sites for
directional cloning into the second MCS of pBYR14. The plasmid carrying the P. longicolla
HAP3 replacement construct was designated pBYR61. To create the HAP3 complementation
131
construct, plasmid pCambia2301 was modified to convey geneticin resistance, thus resulting in
pBYR48. The HAP3 gene, including 1000 bp upstream of the predicted start codon and 776 bp
downstream from the predicted stop codon, was amplified with primers PacI-PlHAP3-5’F/
PlHAP3-HindIII-F4, which incorporated PacI and HindIII sites into the ends of the amplicon.
The resulting product was cloned into the PacI and HindIII sites of pBYR48 to create plasmid
pBYR62. The sequences of all primers used in this study are presented in Table 1.
Targeted deletion of HAP3 in P. longicolla. To delete HAP3, hyphal fragments of P.
longicolla strain PL2010AR were transformed with pBYR61 via Agrobacterium-mediated
transformation with strain AGL1 (Lazo et al. 1991), following a previously described protocol
(Li et al. 2013). Putative transformants were grown on selective medium containing 75 µg/ml of
hygromycin B and screened by PCR to confirm targeted deletion of the HAP3 gene. Primers
PLHAP3_PF/PLHAP3_PR were used to screen for the presence of HAP3, and
PacI_PLHAP3_5’F/HYGSCRN-A and GFPF/PLHAP3_A2 were used to assess the targeted
integration of the knock-out cassette. The potential presence of additional, ectopic insertions
was assessed by Southern blot analysis, as described below.
Southern blotting. Tissue was obtained from cultures grown in yeast extract peptone dextrose
(YEPD; Murthy et al. 1975) for 5 days on an orbital shaker at 80 RPM at room temperature.
Fungal genomic DNA was isolated with a modified cetyltrimethylammonium bromide method
(Leslie and Summerell 2006). Southern blots were prepared essentially as described by
Sambrook and Russell (2001). Briefly, genomic DNA was digested with KpnI and XcmI (New
England Biolabs, Ipswich, MA, USA) and probed for the hygromycin B resistance gene hph.
The probe consisted of 350 bp from the open reading frame of hph. The probe was obtained by
PCR amplification with primers HYGF/HYGR followed by purification with GeneJet Gel
132
Extraction Kit (Thermo Fisher Scientific, Waltham, MA, USA). The probe was then labeled
with 32P and hybridization was performed as described by Sambrook and Russell (2001). After
probing, blots were washed as described by Flaherty et al. (2003) and visualized with a Typhoon
FLA 9500 (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA).
Pathogenicity assays. The ability of strains to cause necrotic lesions on soybean stems and to
colonize soybean seeds was estimated with a cut stem assay as described by Li et al. (2010).
Briefly, stems of soybean plants (cultivar Traff) were clipped two cm above the first node at the
V2 developmental stage and inoculated with a colonized PDA plug held in place by a 1-200µl
disposable pipette tip. For negative controls, uninoculated PDA plugs were used. Eight plants
were inoculated with each strain or uninoculated medium and placed on a greenhouse bench in a
randomized complete block design. Ten days after inoculation, the length of necrotic lesion
developed from the inoculation point downward was measured.
The ability of strains to colonize soybean seeds was evaluated by wound-inoculations
followed by ergosterol measurements to quantify fungal biomass. Seeds of soybean cultivar
Traff were collected at R7 (yellow-senescing stage) from plants cultivated in greenhouse
conditions. Seeds were surface disinfested for 30 seconds in 70% ethanol, followed by 30
seconds in 0.5% sodium hypochlorite, two 30-second rinses in sterile deionized water, and dried
in a laminar flow hood. Seeds were placed in sterile 24-well culture plates and wounded with a
sterile 12-gauge needle. For each strain, three replications of four seeds each were inoculated
with 5-mm colonized PDA plugs from six-day-old cultures. For negative controls, non-
colonized PDA plugs were used. Inoculated seeds were incubated in the dark at room
temperature. Seven days after inoculation, seeds were flash frozen with liquid nitrogen and
manually ground into a fine powder with a mortar and pestle. Ergosterol was extracted by
133
incubating 500 mg of ground seeds with 2 ml of chloroform:methanol (2:1, v:v) overnight.
Ergosterol was analyzed in an HPLC system with UV detection with peak detection at λ = 282
nm as previously described (Cooley et al. 2005). Ergosterol was quantified by measuring peak
area in samples and comparing it to peak areas of standards (1, 10, 100, and 500 ppm).
Gene expression analysis. The wild-type strain PL2010AR and HAP3 deletion strain PLH101
were inoculated on seeds of soybean cultivar Traff as described above. Three replications, each
containing 24 seeds, were inoculated with either PL2010AR or PLH101. To enrich P. longicolla
tissue, seed coats were carefully removed from colonized seeds six days after inoculation, and
the 24 seed coats in each sample were pooled, flash frozen, and ground in liquid nitrogen with a
mortar and pestle. Total RNA was extracted with Ribozol (Amresco, Solon, Ohio, USA). For
each sample, 2 μg total RNA was treated with DNase (Promega, Madison, WI, USA) for 30
minutes at 37°C to remove genomic DNA and then used as template to synthesize cDNA with
M-MLV reverse transcriptase (Promega, Madison, WI, USA). RNA-seq was performed on three
pooled, infected seed coat samples of PL2010AR and PLH101 (as described above) with the Ion
Torrent PGM at the University of Arkansas. Sequenced reads were mapped to the soybean
(version Gmax_189; Schmutz et al. 2010) and P. longicolla MSPL10-6 genomes with GSNAP
(Wu et al. 2016) version 2014-10-09. Only reads that exclusively mapped to the P. longicolla
genome were used in the differential expression analysis.
P. longicolla gene annotation. P. longicolla gene models were functionally annotated by
querying their protein sequences in a BLASTP search (BLAST v2.2.29) against the NCBI nr
database with an E-value cutoff of 1e-5. GO terms and functional descriptions were attributed
with Blast2GO v3.0 (Conesa et al. 2005). Genes encoding secreted proteins, candidate effectors,
secondary metabolite backbones, carbohydrate-active enzymes (CAZymes), proteases,
134
peroxidases, and lipases were identified as previously reported by Zaccaron et al. (2017). Genes
encoding cytochrome P450 enzymes were identified by the presence of an IPR001128 domain
from InterPro, and gene orthologs associated with pathogenesis were identified with a BLASTP
search against the PHI database 4.5 (Pathogen-Host Interaction; http://www.phi-base.org,
accessed: November 2018) with an E-value cutoff of 1e-5. Cluster of Orthologous Groups
(COGs) classification (Tatusov et al. 1997) was performed with the EggNOG-mapper webserver
(Huerta-Cepas et al. 2017), with parameters set to use the DIAMOND mapping mode,
automatically adjusted taxonomic scope, orthologs that prioritize coverage, and gene ontologies
that prioritize quality.
Statistical analyses. Experiments utilized randomized complete block designs and data were
analyzed in R version 3.2.4 (R Core Team, 2019). Package lme4 (Bates et al. 2015) was used to
perform analysis of variance considering block as a random effect. Multiple comparisons were
performed with Tukey-Kramer tests. Radial growth, conidiation, length of necrosis,
concentration of ergosterol were treated as Gamma distributed variables. Differential expression
analysis of RNA-seq data was performed with the software package DESeq2 (Love et al. 2014).
Results
Identification and targeted deletion of HAP3 in P. longicolla. Homology searches performed
with BLASTp revealed a single candidate Hap3 ortholog in P. longicolla, encoded by gene
g5542. Based on a local alignment, the protein encoded by P. longicolla gene g5542 shared
37.2% identity and 49.2% similarity with S. cerevisiae Hap3 (GenBank accession CAA52633.1).
However, further observations indicated that gene g5542 was not predicted correctly. The
protein encoded by gene g5542 contained 839 amino acids, approximately 600 more than
previously described fungal Hap3 orthologs (Ridenour and Bluhm 2014). For this reason, P.
135
longicolla gene g5542 was manually curated based on HAP3 of F. verticillioides (Ridenour and
Bluhm 2014) and RNA-seq data generated in this study. The curated P. longicolla HAP3 had a
predicted ORF of 1039 bp (Fig. 1A), and encoded a 202 amino-acid protein, which contained a
histone-fold motif near the N-terminus (Fig. 1B). Additionally, the Hap3 protein of P. longicolla
shared significant homology with HAP3 orthologs from S. cerevisiae (59.7% identity) and F.
verticillioides, (66.5% identity), based on local amino acid sequence alignments (Fig. 1B).
To functionally characterize the role of HAP3 in P. longicolla, the HAP3 locus was
deleted via homologous recombination in the wild-type strain PL2010AR via Agrobacterium
tumefaciens-mediated transformation (Li et al. 2013). Each transformation event yielded an
average of 120 transformants, approximately 60% of which contained homologous
recombination of the deletion cassette at the HAP3 locus based on preliminary PCR analysis.
Deletion strains PLH100 and PLH101 were selected for further analysis. The targeted
integration of the deletion cassette at the HAP3 locus was confirmed by PCR via amplification
with A1/has and GFPF/A2, while pF/pR was amplified to test for the presence of the wild-type
HAP3. Furthermore, Southern blots showed a single integration of the deletion cassette in
PLH100 and PLH101 (Figure 2). For genetic complementation, the wild-type HAP3 gene,
including the putative promoter region, open reading frame, and putative terminator region, was
reintroduced into the HAP3 deletion strain PLH101, thereby creating the genetically
complemented strain PLH101C.
Deletion of HAP3 impaired growth and asexual reproduction in P. longicolla. Compared to
the wild-type strain, the HAP3 deletion strains PLH100 and PLH101, grew significantly less on
defined growth media (Figure 3A and B). No pycnidia or conidia were observed in the HAP3
deletion strains after 15 days of growth on oatmeal agar. However, prolific production of both
136
pycnidia and conidia were observed in the wild type and genetic complement after 10 days (Fig.
4).
HAP3 is important for pathogenesis in P. longicolla. To investigate the role of HAP3 in
pathogenesis, soybean stems and seeds were inoculated with the wild type, HAP3 deletion
strains, or the genetic complement strain. The wild type and genetic complement caused severe
necrosis and prolific production of pycnidia on soybean stems, while the HAP3 deletion strains
caused minimal necrosis and failed to produce pycnidia (Fig 5A, and B). When inoculated on
seeds, the wild type and genetic complement produced abundant aerial hyphae over the entire
seed coat. In contrast, seeds inoculated with the HAP3 deletion strains exhibited dark
discoloration of the seed coat but no apparent aerial fungal growth was observed (Fig. 5C). In
addition, ergosterol measurements indicated that soybean seeds inoculated with the HAP3
deletion strains had significantly less colonization than seeds inoculated with the wild type or the
complementation strain (Fig. 5D). Over all, deletion strains colonized soybean stems and seeds
approximately 5-fold less than the wild type as measured by lesion length and ergosterol
quantification, respectively. (Fig. 5B and D).
Deletion of HAP3 altered the expression profile of P. longicolla during colonization of
soybean seeds. To identify genes putatively regulated by HAP3 during pathogenesis,
physiologically mature soybean seeds were inoculated with the HAP3 deletion strain PLH101 or
wild-type strain PL2010AR. RNA was extracted from colonized seed coats and sequenced.
Each RNA-seq library produced 630,780 to 1,298,400 reads with an average length of 242 bp.
Read mapping indicated that 70-90% of the reads from each library mapped to the P. longicolla
genome (strain MSPL 10-6), while only 0.2-18% of the reads mapped to the soybean genome,
and 9-14% of all reads were unmapped or mapped ambiguously.
137
A total of 2,353 genes were differentially expressed in the HAP3 deletion strain.
Compared to the wild type during seed colonization, 1.455 genes were upregulated and 898 were
downregulated in strain PLH101 (Fig. 6A). Based on COG classifications, the expression of
genes with diverse functions were altered upon deletion of HAP3 (Fig 6B). Genes associated
with information storage and processing (e.g., RNA processing and modification, transcription,
and replication, recombination and repair) were predominately downregulated in the HAP3
deletion strain. However, genes functionally related to metabolism (e.g., amino acid transport
and metabolism, lipid transport and metabolism, and secondary metabolism biosynthesis,
transport and catabolism) were predominately upregulated. Furthermore, GO enrichment
analyses indicated significant (FDR < 0.05) over-representation of genes involved in
oxidoreductase activities and detoxification among the upregulated genes in P. longicolla strain
PLH101 during soybean seed colonization (Table 2). Notably, the most upregulated gene was
g10996 (log2FC = 10.2; Fig 6A), which encoded a putative secreted multicopper oxidase
homologous (66% identity) to a bilirubin oxidase (3ABG_A) from the fungus Albifimbria
verrucaria (Mizutani et al. 2010). On the other hand, genes predicted to encode transmembrane
transporters were enriched among the downregulated genes in P. longicolla strain PLH101
(Table 3).
Deletion of HAP3 affected the expression of genes involved in plant biomass degradation.
To identify differentially expressed genes encoding putative plant cell wall degrading enzymes
(PCWDEs), carbohydrate-active enzymes (CAZymes) were evaluated in P. longicolla. Among
the 1,127 predicted CAZymes, 260 were differentially expressed in strain PLH101, which
included genes from all six major classes of CAZymes (Table 4). Genes encoding PCWDE
usually belong to CAZyme families from the glycoside hydrolases class, such as GH3, GH5 and
138
GH6 (Juge 2006; Kubicek et al. 2014; Vries and Visser 2001). In P. longicolla, 186 genes were
predicted to encode PCWDEs, of which 19 were up-regulated and 31 were downregulated in
strain PLH101. Specifically, of the 144 genes predicted to be involved in hemicellulose
degradation, 10 were overexpressed and 31 were under expressed. On the other hand, of the 42
genes predicted to be involved in pectin degradation, 9 were upregulated and none was
downregulated.
Other genes associated with plant biomass degradation were differentially expressed in
strain PLH101, including copper-dependent lytic polysaccharide monooxygenases (LPMOs).
Out of the 46 putative LPMOs in P. longicolla, 15 were downregulated and one was upregulated
in strain PLH101 during seed colonization. Additionally, of the five putative cellobiose
dehydrogenases in P. longicolla, two were downregulated, including gene g784, which is a
homolog (63% identity) of Neurospora crassa cellobiose dehydrogenase CDH1. Cellobiose
dehydrogenases act in concert with LPMOs to enhance enzymatic activity towards cellulose,
hemicellulose, and starch (Tan et al. 2015). The widespread downregulation of genes coding
PCWDEs and LPMOs may partially explain the reduced colonization of soybean seeds and
stems caused by deletion of HAP3.
Deletion of HAP3 affected the expression of candidate effector genes in P. longicolla.
Deletion of HAP3 increased the expression of numerous candidate effector genes while
downregulating the expression of others (Fig. 7). Specifically, among the 397 genes predicted to
encode small secreted proteins (SSPs), 68 (17%) were upregulated and 17 (4%) were
downregulated in the PLH101 strain. Some of the differentially expressed SSP genes in P.
longicolla shared homology with known plant avirulence determinants (Table 5). Notably, the
up-regulated candidate effector genes g9614, g1873, and g7272 shared substantial homology
139
with the necrosis-inducing Phytophthora-associated protein 1 (NPP1; Figure 8), which has been
shown to trigger plant defense and necrosis (Qutob et al. 2002; Fellbrich et al. 2002). Thirteen
P. longicolla SSP genes homologous to Magnaporthe oryzae cell-death inducing protein 1 and 4
(MoCDIP1 and 4; Chen et al. 2013) were also differentially regulated in the HAP3 deletion strain
during seed colonization. Specifically, two MoCDIP1 homologs were identified, with one up-
and one downregulated; 11 MoCDIP4 homologs were identified, with one up- and 10-
downregulated (Table 4). Six other upregulated candidate effectors (genes g9817, g7665,
g12120, g15154, g11872, and g7191) encoded proteins containing lysin motif (LysM) domains.
LysM proteins bind to chitin and have been reported in other plant pathogenic fungi as effectors
that suppress plant chitin-triggered immune responses and protect fungal cell walls against plant
chitinases (Akcapinar et al. 2015; Marshall et al. 2011). Interestingly, the most up-regulated
candidate effector (gene g6307; log2FC = 8.2) encoded a putative cerato-platanin protein (CPP).
Homology searches indicated that P. longicolla gene g6307 is taxonomically restricted, with
homologs found only in Diaporthe helianthin and D. ampelina, and the Basidiomycetes
Moniliophthora roreri, M. perniciosa and Pleurotus ostreatus.
Genes involved in secondary metabolism were mis-regulated in P. longicolla strain PLH101.
A total of 111 secondary metabolite backbone genes were identified in P. longicolla, including 54
polyketide synthases (PKSs), 34 nonribosomal peptide synthetases (NRPSs), 7 PKS-NRPS
hybrids, 7 dimethylallyl tryptophan synthases (DMATs), and 9 terpene synthases (TSs). From
these 111 backbone genes, 23 were differentially expressed in P. longicolla strain PLH101 (Fig.
9A). Among these were 11 highly-reducing PKSs (10 upregulated and 1 downregulated), one non-
reducing PKS (upregulated), and 5 partially-reducing PKSs (3 upregulated and 2 downregulated).
Additionally, 73 secondary metabolite gene clusters were identified, which, along with the
140
predicted backbone genes, accounted for a total of 786 genes associated with secondary
metabolism in P. longicolla. Of these 786 genes, 129 were up-regulated and 32 were down-
regulated in P. longicolla strain PLH101 during soybean seed colonization.
Interestingly, deletion of HAP3 induced the expression of several genes within predicted
secondary metabolite gene clusters. Notably cluster8, cluster9, and cluster11, had 15, 10, and 11
genes upregulated, respectively (Fig. 9B and C). Predicted cluster11 shared homology with the
azaphilone cluster from Aspergillus niger (Zabala et al. 2012). The azaphilone cluster in
Aspergillus niger has two PKS backbones (azaA and azaB), which were homologous to g1581
(48% identity) and g1582 (51% identity), respectively. Other genes from the azaphilone cluster
with homologs in P. longicolla included the O-acetyltransferase azaD (g1587; 35% identity), the
FAD-linked oxidoreductase azaG (g1584; 42% identity), the FAD-dependent monooxygenase
azaH (g1588; 40% identity), and the dehydrogenase azaJ (g1589; 48% identity).
Discussion
HAP3 of P. longicolla is predicted to encode a subunit of the CCAAT-Binding Complex
(CBC), a global transcriptional regulator that is broadly conserved among taxonomically diverse
eukaryotes (Thön et al. 2010). In fungi, the CBC has been described as a transcriptional
activator or repressor of genes involved in diverse processes, including primary and secondary
metabolism, iron homeostasis, response to environmental stress, and pathogenesis (Hortschansky
et al. 2017). However, direct relationships between the CBC and plant pathogenesis have only
recently been established among filamentous fungi. In Fusarium verticillioides, disruption of the
CBC via deletion of HAP3 impaired fumonisin biosynthesis, kernel colonization, and stalk rot
during interactions with maize (Ridenour and Bluhm 2014; Ridenour et al. 2016). Disruption of
the CBC also impaired pathogenesis in F. oxysporum and U. maydis on tomato and maize,
141
respectively (López-Berges et al. 2012; Mendoza‐Mendoza et al. 2009). In this study, disrupting
the HAP3 subunit in P. longicolla significantly reduced pathogenesis on soybean seeds and
stems. This finding may point to a broader role for the CBC in plant pathogenesis specifically,
and plant-fungal interactions in general.
Disruption of the CBC extensively influenced growth and development in P. longicolla.
The pronounced misregulation of radial growth, asexual reproduction, and secondary metabolism
in HAP3 deletion strains of P. longicolla was consistent with HAP3 deletion strains in other
filamentous fungi. For example, deletion of HAP3 in F. verticillioides caused pronounced
reductions in radial growth, conidiation, and fumonisin biosynthesis, while simultaneously
inducing a derepression of pigmentation (Ridenour and Bluhm 2014; Ridneour et al. 2016).
Similarly, disruption of the CBC caused defects in growth, development, and sexual
reproduction in Neurospora crassa (Chen et al. 1998). Disrupting the CBC also caused similar
defects in growth and conidiation in F. oxysporum and U. maydis (López-Berges et al. 2012;
Mendoza‐Mendoza et al. 2009). The consistency of these phenotypes across taxonomically
diverse species of filamentous fungi suggests at least partially conserved roles for the CBC in
fungal growth and development.
The exact mechanism through which the CBC regulates plant pathogenesis in P.
longicolla is not known. Among human pathogenic fungi such as A. fumigatus, the CBC is
postulated to maintain iron homeostasis and/or amelioriate the effects of iron starvation during
host colonization (Haas 2012). In this study, significant differences in the expression of genes
involved in iron scavenging and transport were observed, with the majority of these genes
expressed at lower levels in the HAP3 deletion strain. The role of iron in plant pathogenesis is
complex: it is a coveted micronutrient, yet can also be utilized by plants to form reactive oxygen
142
species and subsequently induce oxidative stress (Aznar et al. 2015). In P. longicolla, both iron
acquisition and tolerance of oxidative stress could potentially be components of pathogenesis
that are impaired upon disruption of the CBC. Additionally, differential gene expression data
from the wild type vs. HAP3 deletion strain suggested additional regulatory functions of the
CBC during pathogenesis. For example, disruption of the CBC in P. longicolla down regulated
numerous genes involved in the catabolism of complex plant-produced carbohydrates, which
possibly links the CBC with primary metabolism during pathogenesis. Intriguingly, a subset of
genes up-regulated in the P. longicolla HAP3 deletion strain could potentially trigger host
defenses due to aberrant expression. For example, effectors are used by diverse fungal
pathogens to manipulate host responses during specific stages of the infection process
(Bhattacharjee et al. 2011; Fudal et al. 2018; Mentlak et al. 2012), and the mis-regulation of
effector gene expression during pathogenesis could have the unintended consequence of
triggering detection by the host (Lo Presti et al. 2015; Stotz et al. 2014). Additionally, one gene
encoding a putative cerato-platanin protein was up-regulated during pathogenesis in the P.
longicolla HAP3 deletion strain. Cerato-platanin proteins are a broadly conserved family of
fungal genes of somewhat uncertain function, although some are known elicitors of plant defense
responses (Gaderer et al. 2014). Further dissection of regulatory pathways underlying
pathogenesis in P. longicolla will be required to fully understand the role of the CBC in the
initiation and progression of plant infection.
In conclusion, this study demonstrated that HAP3 of P. longicolla plays an important role
in growth, development, and pathogenesis on soybean. This study also presents the first report
of successful targeted gene deletion in P. longicolla, which will open new avenues of study in
this pathosystem and help to guide the development of molecular genetics techniques in related
143
Phomopsis species. Additionally, the expression profiling data in this study represents the first
such insight into how the CBC reprograms fungal gene expression during plant pathogenesis.
These RNA-seq data is publicly available will help in design further experiments to better
understand P. longicolla association with soybean plants.
144
Literature cited
Akcapinar, G. B., Kappel, L., Sezerman, O. U., and Seidl-Seiboth, V. 2015. Molecular diversity
of LysM carbohydrate-binding motifs in fungi. Curr. Genet. 61:103-113
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.
J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25:3389-3402
Aznar, A., Chen, N. W. G., Thomine, S., and Dellagi, A. 2015. Immunity to plant pathogens
and iron homeostasis. Plant Sci. 240:90-97
Baroncelli, R., Scala, F., Vergara, M., Thon, M. R., and Ruocco, M. 2016. Draft whole-genome
sequence of the Diaporthe helianthi 7/96 strain, causal agent of sunflower stem canker.
Genomics Data 10:151-152
Using lme4. J. Stat. Softw. 67:1-48
Becker, D. M., Fikes, J. D., and Guarente, L. 1991. A cDNA encoding a human CCAAT-
binding protein cloned by functional complementation in yeast. Proc. Natl. Acad. Sci.
88:1968-1972
Bhattacharjee, S., Halane, M. K., Kim, S. H., and Gassmann, W. 2011. Pathogen Effectors
Target Arabidopsis EDS1 and Alter Its Interactions with Immune Regulators. Science
334:1405-1408
Capella-Gutiérrez, S., Silla-Martínez, J. M., and Gabaldón, T. 2009. trimAl: a tool for
automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics
25:1972-1973
Chakravarti, A., Camp, K., McNabb, D. S., and Pinto, I. 2017. The Iron-Dependent Regulation
of the Candida albicans Oxidative Stress Response by the CCAAT-Binding Factor.
PLOS ONE 12:e0170649
Chen, H., Crabb, J. W., and Kinsey, J. A. 1998. The Neurospora aab-1 gene encodes a CCAAT
binding protein homologous to yeast HAP5. Genetics 148:123-130
Chen, S., Songkumarn, P., Venu, R. C., Gowda, M., Bellizzi, M., Hu, J., Liu, W., Ebbole, D.,
Meyers, B., and Mitchell, T. 2013. Identification and characterization of in planta–
expressed secreted effector proteins from Magnaporthe oryzae that induce cell death in
Rice. Mol. Plant. Microbe Interact. 26:191-202
Conesa, A., Götz, S., García-Gómez, J. M., Terol, J., Talón, M., and Robles, M. 2005.
Blast2GO: a universal tool for annotation, visualization and analysis in functional
genomics research. Bioinforma. Oxf. Engl. 21:3674-3676
145
Cooley, C., H. Bluhm, B., L. Reuhs, B., and P. Woloshuk, C. 2005. Glass-fiber disks provide
suitable medium to study polyol production and gene expression in Eurotium rubrum.
Correll, J. C. 1987. Nitrate Nonutilizing Mutants of Fusarium oxysporum and Their Use in
Vegetative Compatibility Tests. Phytopathology 77:1640-1646
Edwards, D., Murray, J. A. H., and Smith, A. G. 1998. Multiple Genes Encoding the Conserved
CCAAT-Box Transcription Factor Complex Are Expressed in Arabidopsis. Plant
Physiol. 117:1015-1022
Egli, D. B., TeKrony, D. M., Heitholt, J. J., and Rupe, J. 2005. Air temperature during seed
filling and soybean seed germination and vigor. Crop Sci. 45:1329-1335
Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F., Engelhardt, S., Felix, G.,
Kemmerling, B., Krzymowska, M., and Nürnberger, T. 2002. NPP1, a Phytophthora-
associated trigger of plant defense in parsley and Arabidopsis. Plant J. 32:375-390
Flaherty, J. E., Pirttilä, A. M., Bluhm, B. H., and Woloshuk, C. P. 2003. PAC1, a pH-
Regulatory Gene from Fusarium verticillioides. Appl. Environ. Microbiol. 69:5222-5227
Fudal, I., Balesdent, M.-H., and Rouxel, T. 2018. Effector Biology in Fungal Pathogens of
Nonmodel Crop Plants. Trends Plant Sci. 23:753-755
Gaderer, R., Bonazza, K., and Seidl-Seiboth, V. 2014. Cerato-platanins: a fungal protein family
with intriguing properties and application potential. Appl. Microbiol. Biotechnol.
98:4795-4803
Haas, H. 2012. Iron - A Key Nexus in the Virulence of Aspergillus fumigatus. Front. Microbiol.
3:28
Hepperly, P. R. 1978. Quality Losses in Phomopsis-Infected Soybean Seeds. Phytopathology

68:1684-1687
Soybean. Mycologia 77:535-544
Hong, S.-Y., Roze, L. V., and Linz, J. E. 2013. Oxidative Stress-Related Transcription Factors
in the Regulation of Secondary Metabolism. Toxins 5:683-702
Hortschansky, P., Haas, H., Huber, E. M., Groll, M., and Brakhage, A. A. 2017. The CCAAT-
binding complex (CBC) in Aspergillus species. Biochim. Biophys. Acta BBA - Gene
Regul. Mech. 1860:560-570
146
Huerta-Cepas, J., Forslund, K., Coelho, L. P., Szklarczyk, D., Jensen, L. J., von Mering, C., and
Bork, P. 2017. Fast Genome-Wide Functional Annotation through Orthology
Assignment by eggNOG-Mapper. Mol. Biol. Evol. 34:2115-2122
Juge, N. 2006. Plant protein inhibitors of cell wall degrading enzymes. Trends Plant Sci.
11:359-367
Jung, W. H., Saikia, S., Hu, G., Wang, J., Fung, C. K.-Y., D’Souza, C., White, R., and Kronstad,
J. W. 2010. HapX Positively and Negatively Regulates the Transcriptional Response to
Iron Deprivation in Cryptococcus neoformans. PLOS Pathog. 6:e1001209
Kmetz, K. T., Ellett, C. W., and Schmitthenner, A. F. 1979. Soybean seed decay: Sources of
inoculum and nature of infection. Phytopathology 69:798-801
Kubicek, C. P., Starr, T. L., and Glass, N. L. 2014. Plant cell wall-degrading enzymes and their
secretion in plant-pathogenic fungi. Annu. Rev. Phytopathol. 52:427-451

Arabidopsis genomic library in Agrobacterium. Biotechnol. Nat. Publ. Co. 9:963-967
Leslie, J. F., and Summerell, B. A. 2006. The Fusarium laboratory manual. John Wiley &
Sons.
Li, S., Darwish, O., Alkharouf, N., Matthews, B., Ji, P., Domier, L. L., Zhang, N., and Bluhm, B.
H. 2014. Draft genome sequence of Phomopsis longicolla isolate MSPL 10-6.
Genomics Data 3:55-56
Li, S., Musungu, B., Lightfoot, D., and Ji, P. 2018. The Interactomic Analysis Reveals
Pathogenic Protein Networks in Phomopsis longicolla Underlying Seed Decay of
Soybean. Front. Genet. 9:104
longicolla. J. Microbiol. Methods. 92:244-245
Announc. 3: e00010-15
Li, S., Song, Q., Martins, A. M., and Cregan, P. 2016. Draft genome sequence of Diaporthe
aspalathi isolate MS-SSC91, a fungus causing stem canker in soybean. Genomics Data
7:262-263
147
Lo Presti, L., Lanver, D., Schweizer, G., Tanaka, S., Liang, L., Tollot, M., Zuccaro, A.,
Reissmann, S., and Kahmann, R. 2015. Fungal Effectors and Plant Susceptibility.
Annu. Rev. Plant Biol. 66:513-545
López-Berges, M. S., Capilla, J., Turrà, D., Schafferer, L., Matthijs, S., Jöchl, C., Cornelis, P.,
Guarro, J., Haas, H., and Pietro, A. D. 2012. HapX-Mediated Iron Homeostasis Is
Essential for Rhizosphere Competence and Virulence of the Soilborne Pathogen
Fusarium oxysporum. Plant Cell 24:3805-3822
Love, M. I., Huber, W., and Anders, S. 2014. Moderated estimation of fold change and
dispersion for RNA-seq data with DESeq2. Genome Biol. 15:550
Marchler-Bauer, A., Bo, Y., Han, L., He, J., Lanczycki, C. J., Lu, S., Chitsaz, F., Derbyshire, M.
K., Geer, R. C., Gonzales, N. R., Gwadz, M., Hurwitz, D. I., Lu, F., Marchler, G. H.,
Song, J. S., Thanki, N., Wang, Z., Yamashita, R. A., Zhang, D., Zheng, C., Geer, L. Y.,
and Bryant, S. H. 2017. CDD/SPARCLE: functional classification of proteins via
subfamily domain architectures. Nucleic Acids Res. 45:D200-D203
Marshall, R., Kombrink, A., Motteram, J., Loza-Reyes, E., Lucas, J., Hammond-Kosack, K. E.,
Thomma, B. P. H. J., and Rudd, J. J. 2011. Analysis of two in planta expressed LysM
effector homologs from the fungus Mycosphaerella graminicola reveals novel functional
properties and varying contributions to virulence on wheat. Plant Physiol. 156:756-769
McNabb, D. S., and Pinto, I. 2005. Assembly of the Hap2p/Hap3p/Hap4p/Hap5p-DNA

Complex in Saccharomyces cerevisiae. Eukaryot. Cell 4:1829-1839
McNabb, D. S., Xing, Y., and Guarente, L. 1995. Cloning of yeast HAP5: a novel subunit of a
heterotrimeric complex required for CCAAT binding. Genes Dev. 9:47-58
Mendoza‐Mendoza, A., Eskova, A., Weise, C., Czajkowski, R., and Kahmann, R. 2009. Hap2
regulates the pheromone response transcription factor prf1 in Ustilago maydis. Mol.
Microbiol. 72:683-698
soybean in the early soybean production system of the midsouthern USA. Crop Prot.
25:310-317
Mentlak, T. A., Kombrink, A., Shinya, T., Ryder, L. S., Otomo, I., Saitoh, H., Terauchi, R.,
Nishizawa, Y., Shibuya, N., Thomma, B. P. H. J., and Talbot, N. J. 2012. Effector-
Mediated Suppression of Chitin-Triggered Immunity by Magnaporthe oryzae Is
Necessary for Rice Blast Disease. Plant Cell 24:322-335
Mizutani, K., Toyoda, M., Sagara, K., Takahashi, N., Sato, A., Kamitaka, Y., Tsujimura, S.,
Nakanishi, Y., Sugiura, T., Yamaguchi, S., Kano, K., and Mikami, B. 2010. X-ray
148
analysis of bilirubin oxidase from Myrothecium verrucaria at 2.3 A resolution using a
twinned crystal. Acta Crystallograph. Sect. F Struct. Biol. Cryst. Commun. 66:765-770
Murthy, M. S., Rao, B. S., Reddy, N. M., Subrahmanyam, P., and Madhvanath, U. 1975. Non-
equivalence of YEPD and synthetic complete media in yeast reversion studies. Mutat.
Res. 27:219-223
Needleman, S. B., and Wunsch, C. D. 1970. A general method applicable to the search for
similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48:443-453
Nicholson, J. F. 1972. Internal Seed-Borne Nature of Sclerotinia sclerotiorum and Phomopsis

sp. and Their Effects on Soybean Seed Quality. Phytopathology 62:1261-1263
Olesen, J., Hahn, S., and Guarente, L. 1987. Yeast HAP2 and HAP3 activators both bind to the
CYC1 upstream activation site, UAS2, in an interdependent manner. Cell 51:953-961
Qutob, D., Kamoun, S., and Gijzen, M. 2002. Expression of a Phytophthora sojae necrosis-
inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32:361-
373
Rice, P., Longden, I., and Bleasby, A. 2000. EMBOSS: The European Molecular Biology Open
Software Suite. Trends Genet. 16:276-277
Ridenour, J. B., and Bluhm, B. H. 2014. The HAP complex in Fusarium verticillioides is a key
regulator of growth, morphogenesis, secondary metabolism, and pathogenesis. Fungal
Genet. Biol. 69:52-64
Ridenour, J. B., Smith, J. E., and Bluhm, B. H. 2016. The HAP Complex Governs Fumonisin
Biosynthesis and Maize Kernel Pathogenesis in Fusarium verticillioides. J. Food Prot.
79:1498-1507
Ruocco, M., Baroncelli, R., Cacciola, S. O., Pane, C., Monti, M. M., Firrao, G., Vergara, M.,
Magnano di San Lio, G., Vannacci, G., and Scala, F. 2018. Polyketide synthases of
Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower. BMC
Genomics 19:27
Rupe, J. 1990. Effect of Temperature on the Rate of Infection of Soybean Seedlings by

Phomopsis longicolla. Can. J. Plant Pathol. 12:43-47
Sambrook, J., and Russell, D. 2001. Molecular cloning: a laboratory manual. Cold Spring
harbor laboratory Cold Spring Harbor, NY.
149
Savitha, J., Bhargavi, S. D., and Praveen, V. K. 2016. Complete Genome Sequence of the
Endophytic Fungus Diaporthe (Phomopsis) ampelina. Genome Announc. 4:e00477-16.
Schmutz, J., Cannon, S. B., Schlueter, J., Ma, J., Mitros, T., Nelson, W., Hyten, D. L., Song, Q.,
Thelen, J. J., Cheng, J., Xu, D., Hellsten, U., May, G. D., Yu, Y., Sakurai, T., Umezawa,
T., Bhattacharyya, M. K., Sandhu, D., Valliyodan, B., Lindquist, E., Peto, M., Grant, D.,
Shu, S., Goodstein, D., Barry, K., Futrell-Griggs, M., Abernathy, B., Du, J., Tian, Z.,
Zhu, L., Gill, N., Joshi, T., Libault, M., Sethuraman, A., Zhang, X.-C., Shinozaki, K.,
Nguyen, H. T., Wing, R. A., Cregan, P., Specht, J., Grimwood, J., Rokhsar, D., Stacey,
G., Shoemaker, R. C., and Jackson, S. A. 2010. Genome sequence of the
palaeopolyploid soybean. Nature 463:178-183
de Sena Filho, J. G., Quin, M. B., Spakowicz, D. J., Shaw, J. J., Kucera, K., Dunican, B., Strobel,
S. A., and Schmidt-Dannert, C. 2016. Genome of Diaporthe sp. provides insights into
the potential inter-phylum transfer of a fungal sesquiterpenoid biosynthetic pathway.
Fungal Biol. 120:1050-1063
Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., McWilliam, H.,
Remmert, M., Söding, J., Thompson, J. D., and Higgins, D. G. 2011. Fast, scalable
generation of high-quality protein multiple sequence alignments using Clustal Omega.
Mol. Syst. Biol. 7:539
Simão, F. A., Waterhouse, R. M., Ioannidis, P., Kriventseva, E. V., and Zdobnov, E. M. 2015.
BUSCO: assessing genome assembly and annotation completeness with single-copy
orthologs. Bioinformatics 31:3210-3212
Sinclair, J. B. 1992. Discoloration of Soybean Seeds- An Indicator of Quality. Plant Dis.

76:1087-1091
Disease. Plant Dis. 77:329-334
Slater, G. S. C., and Birney, E. 2005. Automated generation of heuristics for biological
sequence comparison. BMC Bioinformatics 6:31
Smith, T. F., and Waterman, M. S. 1981. Identification of common molecular subsequences. J.

Mol. Biol. 147:195-197
large phylogenies. Bioinformatics 30:1312-1313
Stotz, H. U., Mitrousia, G. K., de Wit, P. J. G. M., and Fitt, B. D. L. 2014. Effector-triggered
defence against apoplastic fungal pathogens. Trends Plant Sci. 19:491-500
150
Tan, T.-C., Kracher, D., Gandini, R., Sygmund, C., Kittl, R., Haltrich, D., Hällberg, B. M.,
during oxidative cellulose degradation. Nat. Commun. 6:7542
Tanaka, A., Kato, M., Nagase, T., Kobayashi, T., and Tsukagoshi, N. 2002. Isolation of genes
encoding novel transcription factors which interact with the Hap complex from
Aspergillus species. Biochim. Biophys. Acta BBA - Gene Struct. Expr. 1576:176-182
Tatusov, R. L., Koonin, E. V., and Lipman, D. J. 1997. A genomic perspective on protein
families. Science 278:631-637
TeKrony, D. M., Egli, D. B., Stuckey, R. E., and Balles, J. 1983. Relationship between weather
and soybean seed infection by Phomopsis sp. Phytopathology 73:914-918
Thön, M., Al Abdallah, Q., Hortschansky, P., Scharf, D. H., Eisendle, M., Haas, H., and
Brakhage, A. A. 2010. The CCAAT-binding complex coordinates the oxidative stress
response in eukaryotes. Nucleic Acids Res. 38:1098-1113
Vries, R. P. de, and Visser, J. 2001. Aspergillus Enzymes Involved in Degradation of Plant Cell
Wall Polysaccharides. Microbiol Mol Biol Rev. 65:497-522
Wrather, J. A., Shannon, J. G., Stevens, W. E., Sleper, D. A., and Arelli, A. P. 2004. Soybean
cultivar and foliar fungicide effects on Phomopsis sp. seed infection. Plant Dis. 88:721-
723
Wrather, J. A., Sleper, D. A., Stevens, W. E., Shannon, J. G., and Wilson, R. F. 2003. Planting
date and cultivar effects on soybean yield, seed quality, and Phomopsis sp. seed infection.
Plant Dis. 87:529-532
Wu, T. D., Reeder, J., Lawrence, M., Becker, G., and Brauer, M. J. 2016. GMAP and GSNAP
for genomic sequence alignment: enhancements to speed, accuracy, and functionality.
Stat. Genomics Methods Protoc. 1418:283-334
Yin, W., and Keller, N. P. 2011. Transcriptional regulatory elements in fungal secondary
metabolism. J. Microbiol. 49:329-339
Zabala, A. O., Xu, W., Chooi, Y.-H., and Tang, Y. 2012. Characterization of a silent azaphilone
gene cluster from Aspergillus niger ATCC 1015 reveals a hydroxylation-mediated pyran-
ring formation. Chem. Biol. 19:1049-1059
Zaccaron, A. Z., Woloshuk, C. P., and Bluhm, B. H. 2017. Comparative genomics of maize ear
rot pathogens reveals expansion of carbohydrate-active enzymes and secondary
metabolism backbone genes in Stenocarpella maydis. Fungal Biol. 121:966-983
151
Quality Evaluation, and Field Performance of Soybean. Crop Sci. 34:172-177
152
Tables
Table 1. Names and sequence of primers used in this study
Primer name Primer sequence

PlHAP3. KpnI_F1 GGCGGTACCATTGTGTCTGCGTCCCAGCCC
PlHAP3. ApaI_F2 GCGGCTGGGCCCATTTGGCTACCTGCAGCGGGTG
PlHAP3. PacI_F3 GCGGCGTTAATTAAAACCCGTGCAGGCAGGCTA
PlHAP3. HindIII_F4 GGGAAGCTTGCGGCGAGGTAGACGATGGTG
PacI_PlHAP3_5’F GCGGCGTTAATTAAGTCGTTGCGCGCGACTTGA
PLHAP3_A2 CGGTTGCTACAGTCGGATG
PLHAP3_PF GACGAGGAAGCACAAATGAATG
PLHAP3_PR CGTGGGACATGGACGAATAG
HYGSCRN-A CTACTGCTACAAGTGGGGCTGA
GFPF ATCCTGGGGCACAAGCTG
HYGF CCAGTGATACACATGGGGATCAGC
HYGR GGATATGTCCTGCGGGTAAATAGCTG
Table 2. Gene onthology terms enriched among the over-expressed genes in Phomopsis
longicolla PLH101
GO Name FDR1 P value
oxidation-reduction process 3.50E-16 1.39E-19
exopeptidase activity 2.73E-03 2.18E-06
coenzyme binding 1.01E-02 1.08E-05
oxidoreductase activity, acting on CH-OH group of donors 1.34E-02 1.79E-05
oxidoreductase activity, acting on peroxide as acceptor 1.76E-02 2.58E-05
carbohydrate derivative catabolic process 2.11E-02 3.36E-05
cellular oxidant detoxification 3.64E-02 6.30E-05
1Falsediscovery rate. P values and FDR for enrichment GO groups were obtained from
Blast2go.
153
Table 3. Gene onthology terms enriched among the under-expressed genes in Phomopsis
longicolla PLH101.
GO Name FDR P Value
cellulose catabolic process 5.32E-04 4.95E-07
xylan catabolic process 1.67E-02 3.77E-05
galactosidase activity 1.67E-02 3.77E-05
transmembrane transporter activity 4.13E-02 1.15E-04
Table 4. Number of up- and downregulated CAZyme genes in the P. longicolla strain PLH101
during soybean seed colonization.
CAZyme class Total genes Upregulated % Downregulated %
AA 265 44 16.6 26 9.8
GH 463 55 11.9 59 12.7
GT 127 12 9.4 8 6.3
PL 45 9 20.0 0 0.0
CE 197 31 15.7 9 4.6
CBM 83 15 18.1 9 10.8
Total 1127 157 13.9 103 9.1
154
Table 5. Genes differentially expressed in PLH101, during soybean seed colonization, with
characterized effector-protein homolog.
Gene ID1 Log2(FC)2 P-value3 Homolog effector4 Species5 Identity (%)6 E-value7
g9614 8.0 2.49E-13 NPP1 Phytophthora parasitica 46.5 2.61E-68
g9817 6.4 8.33E-52 SLP_1 Magnaporthe oryzae 60.2 1.31E-62
g1873 5.2 9.42E-25 NPP1 Phytophthora parasitica 30.9 1.06E-12
g7665 5.2 2.09E-08 Vd5LysM Verticillium dahliae 34.4 3.49E-62
g6578 5.0 6.94E-08 AVR-Pita1JB Magnaporthe oryzae 26.0 1.28E-11
g12120 4.5 0.00236 Vd4LysM Verticillium dahliae 26.6 1.53E-32
g4025 4.0 4.82E-06 MoCDIP1 Magnaporthe oryzae 79.7 0
g7272 4.0 0.01148 NPP1 Phytophthora parasitica 33.1 2.92E-27
g7830 3.7 2.35E-24 PopW_RSc2775 Ralstonia solanacearum 31.5 1.57E-07
g4073 3.3 0.01860 PGIP2 Botrytis cinerea 28.5 8.21E-15
g7191 2.9 7.79E-05 SLP_1 Magnaporthe oryzae 47.8 3.96E-34
g13248 2.8 0.01449 MoCDIP4 Magnaporthe oryzae 32.6 1.17E-10
g9318 1.7 1.46E-05 PopW_RSc2775 Ralstonia solanacearum 33.5 1.23E-14
g5797 -2.8 4.00E-26 MoCDIP4 Magnaporthe oryzae 29.4 2.21E-18
g10295 -3.4 0.00032 MoCDIP4 Magnaporthe oryzae 36.1 4.07E-31
g1705 -3.8 0.00019 MoCDIP1 Magnaporthe oryzae 62.6 1.1E-148
g4533 -3.9 1.11E-06 AVR-Pita1 Magnaporthe oryzae 25.5 2.52E-08
1
Phomopsis longicolla identification number. 2Log2 of fold change in gene expression in the
PLH101 HAP3 knock out strain compared to the wild type measured by RNA-seq experiment
with three biological replicates. 3P value for the contrast of wild type and mutant PLH101
expression level for that particular gene. 4Characterized effector gene in different organism
homolog to the respective P. longicolla gene. 5Species of filamentous fungi where the effector
gene homolog was characterized. 6Amino acid level identity between the P. longicolla gene and
its respective homolog. 7Number of expected homolog genes by chance, given the size of
database queried and the size of quarry. E-score was obtained by the BLAST algorithm.
155
Figures
Figure 1. The predicted HAP3 ortholog in P. longicolla. (A) Genomic region of P. longicolla
MSPL 10-6 genome where HAP3 was located, and the predicted gene structure of HAP3. (B)
Similarity of HAP3 with its homologs in selected taxa. Protein lengths are shown in scale with
the histone-fold motif indicated as rectangles. The heat map shows the identity values (%) of
HAP3 with the corresponding homologs in other species based on local and global amino acid
sequence alignments. The species were organized based on their phylogeny, represented by the
maximum likelihood phylogenetic tree. Branches with bootstrap support of 100 had their label
omitted.
156
Figure 2. Targeted deletion of HAP3 in P. longicolla. (A) Schematic representation of the
HAP3 locus in P. Longicolla and the homologous recombination strategy for its targeted
deletion. (B) P. longicolla strains PL2010AR (wild type), PLH100, PLH101, and PLH102
(HAP3 deletion strains; Δhap3), and PLH100C, PLH101C, and PLH102C (HAP3
complementation strain) were validated by PCR with the following primer pairs:
PLHAP3_PF/PLHAP3_PR (Probe 1); PacI_PLHAP3_5’F/HYGSCRN-A (Probe 2); and
GFPF/PLHAP3_A2 (Probe 3). (C) Genomic DNA was digestion with KpnI and XcmI and
probed with the hygromycin phosphotransferase-encoding gene, hph, specific probe (Probe 4).
The presence of a single band indicates integration of a single copy of the deletion construct into
the genome of strains PLH100, PLH101, and PLH102. Arrows indicate gene directionality, and
black bars represent the locations of probes relative to genomic loci.
157
Figure 3. Deletion of HAP3 impaired P. longicolla growth. (A) HAP3 deletion strains
presented visually indistinguishable growth phenotype on different growth media. P. longicolla
strains PL2010AR (wild type), PLH100 and PLH101 (HAP3 deletion strains), and PLH101C
(HAP3 complementation strain) were grown on MM (minimum medium), PDA (potato dextrose
agar), V8 (V8 juice agar), and CM (complete medium) for four days under 12:12 hours
light:dark cycle at 25C. (B) Statistical comparisons of strains radial growth within the different
tested media (n = 3). Error bars represent the estimated standard error for the mean of each
combination of strain and medium. Letters indicate statistically significant differences between
strains within each medium as determined by Tukey-Kramer HSD at P-value <0.05. Statistical
comparisons were performed with lme4 package in R treating diameter (mm) as a Gamma
distributed variable.
158
Figure 4. HAP3 is critical for asexual reproduction of Phomopsis longicolla. The wild-type
strain PL2010AR, the HAP3 deletion strains PLH100 and PLH101, and the complementation
strain PLH101C were grown on oatmeal agar. Plates were incubated at 25C under 12:12 h
light:dark cycle and conidia were harvested 14 days after inoculation (n=3). Error bars represent
the estimated standard error of the mean. Letters indicate statistically significant differences
between strains according to Tukey-Kramer HSD at P value <0.05. Statistical comparisons were
performed with lme4 package in R conidiation as a Gamma distributed variable. *Not detected.
159
A B
25
(mm(mm)
PL2010AR PLH100 PLH101 PLH101C Mock A A
)
20
lengthlesion
15
of necrotic
10
Lesion
B B
5
Length
0
wildARtype 0 101
1000 01 101C
101 M oM
ck
C
010 LH1 LH1
PL2 P P PLH
C D
PL2010AR PLH100 PLH101 PLH101C Mock
-1 fresh weight)
125 A
A
100
x.mgean
75
Ergosterol (µg
50
B
25 B
0
WildRtype
H100H101
0 1 H101C
C Mock
10A H10 H10 101 M oc
k
PL2
0 PL PL PLH
Figure 5. Deletion of HAP3 impairs P. longicolla pathogenicity. (A) Necrotic lesions and
pycnidiation on stems of soybean cultivar Traff (PI 470930) inoculated with the wild-type strain
PL2010AR, HAP3 deletion strains PLH100 and PLH101, and complementation strain PLH101C.
For the negative control, stems were inoculated with sterile 0.2x PDA plugs. (B) Ten days after
inoculation with the cut-stem method, the length of necrotic lesion was measured. The cut-stem
inoculation method was used (n=8). (C) P. longicolla strains were also inoculated on surface
disinfested physiologically-mature soybean seeds of cultivar Traff. Bottom pictures are the cross
section of inoculated soybean seeds. (D) Ergosterol was extracted from seeds and quantified ten
days after inoculation (n=4). Error bars represent the estimated standard error of the mean.
Letters indicate statistically significant differences between strains within each media as
determined by Tukey-Kramer HSD at P value <0.05. Statistical comparisons were performed
with lme4 package in R treating lesion length and ergosterol concentration as Gamma distributed
variables.
160
Figure 6. Differentially expressed genes in P. longicolla PLH101 compared to the wild type
while colonizing soybean seeds. (A) Volcano plot of genes expressed during soybean seed
colonization. The x-axis shows the log2 of the fold change in gene expression compared to the
wild type, and the y-axis shows -log10 of the adjusted P-value. Red and blue dots represent
genes up- and downregulated, respectively, with threshold of |log2FC| > 1.5 and adjusted P-value
< 0.05. Parameters obtained from DESeq2 package implemented in R. (B) Number of genes
differentially expressed classified in different clusters of orthologous groups (COG) categories.
A: RNA processing and modification; B: Chromatin structure and dynamics; C: Energy
production and conversion; D: Cell cycle control, cell division, and chromosome partitioning; E:
Amino acid transport and metabolism; F: Nucleotide transport and metabolism; G: Carbohydrate
transport and metabolism; H: Coenzyme transport and metabolism; I: Lipid transport and
metabolism; J: Translation, ribosomal structure and biogenesis; K: Transcription; L: Replication,
recombination and repair; M: Cell wall/membrane/envelope biogenesis; N: Cell motility; O:
Post-translational modification, protein turnover, and chaperones; P: Inorganic ion transport and
metabolism; Q: Secondary metabolites biosynthesis, transport, and catabolism; R: General
function prediction only; S: Function unknown; T: Signal transduction mechanisms; U:
Intracellular trafficking, secretion, and vesicular transport; V: Defense mechanisms; W:
Extracellular structures; Y: Nuclear structure; Z: Cytoskeleton.
161
−2 2
g5231
g6578
g9136
g9817
g12462
g9614
g7432
g12120
g1873
g14167
g10032
g16416
g12091
g10202
g6092
g16091
g5711
g12440
g8170
g3529
g6307
g16420
g12521
g6476
g676
g7830
g10179
g9566
g6452
g7665
g13908
g7191
g13281
g3863
g4025
g12519
g7531
g4444
g6210
g12223
g14327
g6635
g10683
g13562
g9860
g11518
g13285
g14238
g9318
g13248
g9509
g4073
g9162
g10964
g7419
g4617
g15472
g11872
g11223
g15345
g7413
g3870
g12290
g1784
g7410
g15154
g7032
g7272
g5797
g6836
g10767
g13132
g7593
g8080
g15887
g570
g14659
g6073
g10295
g1705
g10901
g12460
g5847
g4533
g11054
WT1
WT2
WT3
HAP31
HAP32
HAP33
162
Figure 7. Candidate effector genes differentially expressed in Phomopsis longicolla strain
PLH101. The heat map shows the expression values of genes encoding candidate effectors in P.
longicolla PLH101 compared with the wild type during soybean seed colonization.
163
Figure 8. Multiple sequence alignment of Phytophthora sojae necrosis-inducing protein
(PsojNIP) and its homologs in Phomopsis longicolla that were upregulated in PLH101 strain
during soybean seed colonization. Amino acids in red correspond to predicted signal peptide.
Amino acids highlighted in blue were described to be conserved in PsojNIP and its homologs in
10 other species.
164
Figure 9. Secondary metabolism genes differentially expressed in P. longicolla PLH101.
(A) Heat map of the expression values of secondary metabolite backbone genes. (B) Bar graph
showing the size of predicted secondary metabolite gene clusters and the number of genes
considered overexpressed (Up) and under expressed (Down) in PLH101. (C) Secondary
metabolite gene clusters in P. longicolla with differentially expressed genes. Genes upregulated
are shown in red.
165
Chapter VII: Conclusion
In this dissertation, studies on the pathogenesis of Macrophomina phaseolina on soybean
reviewed a complicated relationship. Although this study shows that drought stress does indeed
increase charcoal rot severity, the disease was more pronounced when drought followed a period
non-drought, from seeding to seed set. To a lesser degree, soil inoculum levels also were shown
to affect charcoal rot. Our experiments also showed that there were consistent differences
among soybean cultivars for disease severity. In particular, the cultivar ‘Hutcheson’ consistently
displayed higher charcoal rot severity levels than the cultivar ‘Osage’. Additionally, the work
presented here describes the restriction of soybean root colonization by M. phaseolina in the
presence of zone lines caused by P. longicolla. Zone lines incidence was not affected by
irrigation regimes. However, their incidence was significantly affected by cultivar and location.
In particular the cultivar Osage had high incidence of zone lines in all field experiments. Thus,
indicating this trait might be quantitatively genetically controlled by the host. It remains unclear
if zone lines on soybean roots and stems have any effect on crop or disease development.
In more mechanistically investigations, a few candidate genes were identified to be
involved in of P. longicolla pathogenesis. In particular, the gene g4307, a homolog to CDH2 in
Neurospora crassa, was shown to be involved in soybean pathogenesis. When disrupted in P.
longicolla, strains were significantly impaired in infecting and colonizing soybean stems and
seeds, while not being affected in vitro. Here we report a new technique developed to
economically and effectively used to economically and effectively identify g4307 disruption in a
random mutant. MoNSTR-seq is effective, low cost, and with multiplex applications for high
throughput. Importantly, this work illustrated the amenability of P. longicolla to forward
166
genetics and to DNA manipulation techniques. Together, this represents a set of important tools
available to scientists to discovery-oriented research in P. longicolla pathogenesis and biology.
Here we also report the relevant role of HAP3 in gene regulation in P. longicolla during
soybean seed colonization. The targeted disruption of HAP3 decreased pathogenesis of P.
longicolla. Additionally, its disruption was observed to cause thousands of genes to be
significantly differentially expressed in P. longicolla during pathogenesis when compared to the
wild-type strain. This was the first time a gene was targetedly disrupted in P. longicolla via
reverse genetics. Additionally, the publicly available transcriptomics data reported here
represents the first look into gene expression during P. longicolla colonization of soybean seeds.
All together, the work and resources described here represents a significant advancement in
putative molecular mechanisms of Phomopsis seed decay and will aid future studies on this
topic.
167

رسالة انكليزي مايكروفومينا

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

رسالة انكليزي مايكروفومينا

Uploaded by

Copyright:

Available Formats

University of Arkansas, Fayetteville

Graduate Theses and Dissertations

Studies on Pathogenesis of the Diseases Caused by

Follow this and additional works at: https://scholarworks.uark.edu/etd

A dissertation submitted in partial fulfillment

The dissertation is approved for recommendation to the Graduate Council.

P. longicolla has been shown to be amenable to genetic manipulation via Agrobacterium

transformation methodology, experiments were implemented to elucidate putative molecular

transcriptomics were employed on P. longicolla successfully. Multiple genes linked to

decreased pathogenicity were identified in P. longicolla.

Chapter V published as:

Chapter VI submitted as:

The Ascomycota fungi Macrophomina phaseolina and Phomopsis longicolla are

mechanisms involved in their pathogenesis.

M. phaseolina asymptomatically infects soybean plants during vegetative developmental

causal effect relationship has been experimentally demonstrated linking M. phaseolina

colonization to plant death thus far (Doubledee et al. 2018).

(Mengistu et al. 2007).

increased yield losses.

important seed pathogen of soybean, is a member of the Diaporthe-Phomopsis species complex

et al. 1998; Impullitti and Malvick 2013).

P. longicolla can successfully overwinter in production areas in colonized plant debris

characteristic vertical-row alignment pattern of pycnidia are distinctively observed on soybean

incidence of PSD across U.S. soybean producing regions.

(Kmetz 1978). Interestingly, P. longicolla is reported to endophytically associate with a range of

taxonomically diverse plants, including Euphorbia nutans (Euphorbiaceae), Abutilon theophrasti

(Malvaceae), Ipomoea lacunosa (Convolvulaceae), Xanthium strumarium (Asteraceae), and a

endophytism. P. longicolla produces a wide variety of anti-microbial compounds, such as 3-

nitropropionic acid (Flores et al. 2013), 18-deoxy-cytochalasin H, mycophenolic acid, and

Zone lines and P. longicolla

The potential duality underlying the endophytic/pathogenic basis of the P.

longicolla/soybean relationship has led to fundamental questions about how to dissect

plug colonized by the pathogen. However, P. longicolla is reported to produce appressoria

associated with PSD.

Molecular genetics and P. longicolla

molecular basis of pathogenesis in P. longicolla. Recently, new molecular resources have

including Fusarium graminearum, Colletotrichum higginsianum, Magnaporthe grisea, and

Seong et al. 2005).

availability of reference genome sequences.

Restriction Digestion Associated sequencing (RAD-seq) is a reduced representation

selecting fragments based on size, and sequencing fragments on a next-generation DNA

of restriction enzymes, no requirement for a reference genome sequence a priori, and

substantially higher throughput compared to whole-genome re-sequencing.

To date, the molecular basis of pathogenesis underlying PSD is poorly understood, in

support of molecular genetics and functional genomics approaches in P. longicolla, including

Agrobacterium tumefaciens-mediated transformation was successfully employed to functionally

not been reported thus far.

The CCAAT-binding complex

pathogenesis and mycotoxin production in Fusarium verticillioides in corn. CBC of eukaryotes

2010; Yin and Keller 2011).

alter root colonization by M. phaseolina. In addition to zone lines, P. longicolla is an endophyte

interesting biological characteristics of P. longicolla coupled with its amenability to cultivation

method to identify T-DNA insertions in mutants created via Agrobacterium-mediated

genes associated with its pathogenesis in soybean.

Björkman, O., and Demmig-Adams, B. 1995. Regulation of Photosynthetic Light Energy

Blanco-López, M. A., and Jiménez-Díaz, R. M. 1983. Effect of irrigation on susceptibility of

Brayford, D. 1990. Vegetative incompatibility in Phomopsis from elm. Mycological Research.

Bristow, P. R. 1986. Macrophomina phaseolina, Another Cause of the Twin-Stem Abnormality

Garcia-Olivares, J. G., Lopez-Salinas, E., Cumpian-Gutierrez, J., Cantu-Almaguer, M. A.,

Koike, S. T. 2008. Crown rot of strawberry caused by Macrophomina phaseolina in California.

Li, C. Y. 1983. Melanin-like Pigment in Zone Lines of Phellinus weirii-Colonized Wood.

Lopez-Real, J. M. 1975. Formation of pseudosclerotia (‘zone lines’) in wood decayed by

Mayek-Pérez, N., GarcÍa-Espinosa, R., LÓpez-CastaÑeda, Cá., Acosta-Gallegos, J. A., and

McNabb, D. S., and Pinto, I. 2005. Assembly of the Hap2p/Hap3p/Hap4p/Hap5p-DNA