Biochemical and Biophysical Research Communications xxx (2018) 1e6

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Real-time monitoring of IL-6 and IL-10 reporter expression for

anti-inflammation activity in live RAW 264.7 cells
Papawee Saiki a, *, Yoshihiro Nakajima b, Leo J.L.D. Van Griensven c, Koyomi Miyazaki a
a
Biomedical Research Institute, National Institute of Advance Industrial Science and Technology, Tsukuba, Ibaraki, Japan
b
Health Research Institute, National Institute of Advance Industrial Science and Technology, Takamatsu, Kagawa, Japan
c
Plant Research International, Wageningen University and Research Centre, Wageningen, the Netherlands

a r t i c l e i n f o a b s t r a c t

Article history: In previous study, we suggested that the interleukin (IL)-6 and IL-10 could serve as a good biomarker for
Received 21 September 2018 anti-inflammation that related to chronic inflammatory disease. Recently, we are finding new anti-
Accepted 27 September 2018 inflammation compounds from natural products by screening of IL-6 and IL-10 levels. Although, we
Available online xxx
could measure IL-6 and IL-10 levels by several methods. However, all methods could not measure
continuous kinetic of IL-6 and IL-10 levels. Most methods have multiple steps and take a long time.
Keywords:
Therefore, there is no a suitable method for screening. To this end, we established IL-6 and IL-10 pro-
Reporters
moter assay which can monitor with reference gene as Glyceraldehyde 3-phosphate dehydrogenase
IL-6
IL-10
(gapdh) promoter in living single cell. It could determine IL-6 and IL-10 levels continuously in real-time
Luciferase within two steps. We evaluated IL-6 and IL-10 reporter expression in LPS-induced RAW 264.7 cells with
Anti-Inflammation well-known anti-inflammatory compounds such as quercetin, xanthones, b-D-glucan and dexametha-
sone. As the results, the expression of IL-6 and IL-10 reporters were strongly induced by LPS. The
expression of IL-6 reporter was inhibited by all anti-inflammation compounds in LPS-induced RAW
264.7 cells. The expression of IL-10 reporter was inhibited by quercetin, xanthones and dexamethasone
in LPS-induced RAW 264.7 cells. While, expression of IL-10 reporter was induced by b-D-glucan. These
results indicated that this assay could use for determination of IL-6 and IL-10 reporter expression in LPS-
induced RAW 264.7 cells for anti-inflammation activity. Moreover, the results showed that natural
compounds have an effect on the time course of IL-6 and IL-10 expressions. Therefore, real-time
monitoring has a merit for natural compounds screening. We suggested that this assay could serve as
a compound screening assay for anti-inflammation activity.
© 2018 Elsevier Inc. All rights reserved.

1. Introduction insulin resistance, hyperlipidemia and hyperglycemia [8]. Further-

Inflammation is a part of immune response in our body.
Inflammation plays a role in several diseases such as coronary ar-
tery disease [1], obesity-related insulin resistance [2], atheroscle-
rosis [3], cancer [4], Alzheimer's disease [5], and Crohn's disease [5].
Lipopolysaccharide (LPS) is an endotoxin from the outer membrane
of Gram negative bacteria which activates pro-inflammatory cyto-
kines such as Interleukin 1 beta (IL-1b), IL-6, and Tumor Necrosis
Factor alpha (TNF-a) [6]. IL-6 is a pro-inflammatory cytokine which
may cause insulin resistance [7]. It plays a significant role in obesity
and in diabetes type 2 where it has been has been implicated in
* Corresponding author.
E-mail address: papawee-saiki@aist.go.jp (P. Saiki).
more, IL-6 plays a key role through chronic stressors which may
accelerate risk of age-related diseases [9]. IL-10 is an anti-
inflammatory cytokine that inhibited expression of IL-6 in LPS-
stimulated macrophages [10]. IL-10 is bridging the gap between
innate and acquired immunity. Macrophages are commonly the
first cells of the immune system which secrete pro-inflammatory
cytokines. The macrophages respond to the T-helper (Th) 1/Th2
balance through the production of IL-10 [11]. Moreover, it was re-
ported that the balance of IL-6/IL-10 in bipolar disorder worsens in
the later stages of the illness [12]. In our previous study, we also
suggested that the balance of IL-6/IL-10 could be a good indicator
for anti-inflammation that related to chronic inflammatory disease,
obesity, diabetes type 2, mania and depression [13].
Although we can determine IL-6 and IL-10 levels in vitro using
molecular biological or biochemical techniques, including Reverse

https://doi.org/10.1016/j.bbrc.2018.09.173
0006-291X/© 2018 Elsevier Inc. All rights reserved.

Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173
2 P. Saiki et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6

Transcription-Polymerase Chain Reaction (RT-PCR), quantitative
Polymerase Chain Reaction (qPCR) or Enzyme-Linked Immuno-
sorbent Assay (ELISA), it is impossible to continuously determine
the kinetics of gene expression or protein levels. Moreover, it is
difficult to determine cytokines on a large number of samples by
these techniques because of available time and costs. We found
these techniques are not suitable for screening assays.
Bioluminescence reporters are widely used for quantitative
monitoring of various biological functions including gene expres-
sion. The luciferase gene expressions are driven by favorite gene
promoter [14]. The advantage of using a luciferase reporter is that
luminescence can be measured longitudinally and quantitatively in
real-time in cultured cells and living organisms, enabling contin-
uous monitoring of gene expression [15,16]. Recently, Dual-
Luciferase Reporter Assay System [17] has been established and is
now widely used. However, this assay could not determine reporter
expression in real-time. It also could not determine reporter
expression in living cells. Furthermore, we could not measure
expression of dual reporters at the same time. Recently, we estab-
lished simultaneous multicolor luciferase reporter assay for moni-
toring of multi genes expressions [18].
In this study, we established new IL-6 and IL-10 reporters that
could determine reporter expression along with gapdh reporter in
LPS-induced RAW 264.7 cells. This new assay could determine IL-6
and IL-10 reporter expression in living cell in real-time. We eval-
uated this assay using well-known anti-inflammatory compounds
including quercetin, xanthones, b-D-glucan and dexamethasone. In
this study, we showed the merit of real-time monitoring that will
be useful for natural compounds screening.
2. Materials and methods
2.1. Plasmid construction
To construct test reporter vector pELuc-PEST-test/Hyg, ELuc-
PEST was excised with HindIII and XbaI from pELuc-PEST-Test

Fig. 1. The expression of IL6-ELuc:gapdh-SLR and IL10-ELuc:gapdh-SLR reporter in RAW 264.7 cells by real-time bioluminescence recording. The real-time bioluminescence
recording of (a) IL6-ELuc (Green line) and (b) IL10-ELuc (Green line) with gapdh-SLR (Red line) transactivation in RAW 264.7 cells. The real-time bioluminescence recording of (c)
IL6-ELuc:gapdh-SLR and (d) IL10-ELuc:gapdh-SLR promoters transactivation in LPS-induced RAW 264.7 cells. The expression of relative (e) IL-6/gapdh and (f) IL-10/gapdh reporter.
Error bars indicate standard deviation (n ¼ 4). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173
 P. Saiki et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6 3

(TOYOBO Co., Osaka, Japan), and the fragment was ligated into the
HindIII/XbaI site of pSLG-Test/Hyg [19] from which the SLG frag-
ment was removed. The promoter regions of human IL-6 (nt 1000
to þ121), where þ1 indicated the putative transcription start site)
and IL-10 (nt 1000 to þ59) was amplified from human genome
DNA purified from human lymphocyte, Jurkat cells by PCR with the
following primers, respectively: IL-6 forward CCGTAGTTTCCTTC-
TAGCTTC, IL-6 reverse AGCTGGGCTCCTGGAGGGGAG, IL-10 forward
ATCCTGACTTCTTTTCCTTG, and IL-10 reverse GCCTTCTTTTGCAA-
GTCTGTC. After verification of PCR products ligated into pTA2
vector (TOYOBO Co., Osaka, Japan) by sequencing, each promoter
fragment was excised and ligated upstream of PEST-fusing ELuc
gene of pELuc-PEST-test/Hyg.
2.2. Cell culture
The mouse Abelson leukaemia virus transformed monocyte
macrophage cell lines (RAW 264.7 cells) were obtained from Riken
Cell Bank (Tsukuba, Japan). RAW 264.7 cells were cultured in Dul-
becco's modified Eagle's medium (DMEM) (Wako Pure Chemical
Industries, Ltd., Osaka, Japan) containing 10% fetal bovine serum
(FBS) (Biowest, Tokyo, Japan) at 37  C in 5% CO2 in a humidified
incubator.
2.3. Determination of IL-6 and IL-10 expression by quantitative
polymerase chain reaction (qPCR)
RAW 264.7 cells (5  105 cells/ml) were treated in 6-well poly-
styrene tissue culture plates with 2 ml cells suspension in each well
for 24 h. The medium was then removed and replaced by fresh
medium containing 1 mg/ml Lipopolysaccharide (LPS) from Escher-
ichia coli O26:B6 (Sigma-Aldrich Corporation, Missouri, U.S.A.) with
10 mM quercetin or 100 mg/ml b-D-glucan or 25 mM xanthone
(Sigma-Aldrich Corporation, Missouri, U.S.A.) as anti-inflammatory
compounds for 6 and 12 h. Total RNA was extracted from the whole
cells using RNAiso Plus Total RNA extraction reagent (Takara Bio
Inc., Kusatsu, Japan). cDNA was generated using PrimeScript RT
Master Mix (Takara Bio Inc., Kusatsu, Japan). Quantitative real-time
PCR proceeded using SYBR®Premix Ex TaqTM II and a Light-
CyclerTM (Roche Diagnostics, Mannheim, Germany). The PCR
conditions comprised 10 s at 95  C followed by 45 cycles of 5 s at
95  C, 10 s at 58  C, and 10 s at 72  C [20]. All data were normalized
to the internal standard gapdh [21]. The primer sequences were:
IL-6, 50 -CAGAGGATACCACTCCCAACAGAC-30 and 50 -CTCTGAAG-
GACTCTGGCTTTGTC-3’; IL-10, 50 - GACAACATACTGCTAACCGACTCC-
30 and 50 - GCTCCTTGATTTCTGGGCCATG-3’; and gapdh, 50 -GACCT-
CAACTACATGGTCTACA-30 and 50 -ACTCCACGACATACTCAGCAC-3.

Fig. 2. The effect anti-inflammatory compounds on expression of IL6-ELuc:gapdh-SLR and IL10-ELuc:gapdh-SLR promoters in RAW 264.7 cells by real-time bioluminescence
recording. The expression of the relative IL-6/gapdh reporter with (a) 10 mM quercetin, (b) 100 mg/ml b-D-glucan and (c) 25 mM xanthone. The expression of the relative IL-10/gapdh
reporter with (d) 10 mM quercetin, (e) 100 mg/ml b-D-glucan and (f) 25 mM xanthone respectively. Error bars indicate standard deviation (n ¼ 4).

Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173
4 P. Saiki et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6

2.4. Real-time monitoring of IL-6/IL-10 reporter expression by dual-
colour bioluminescence
RAW 264.7 cells (1.4  106 cells) were plated in 35-mm dish in
DMEM medium under the standard conditions for 24 h. IL-6 or IL-
10 reporter plasmid as described in plasmid construction and
gapdh-SLR reporter plasmid [22] were co-transfected by Hilymax
transfection reagent (Dojindo Molecular Technologies, Inc., MD,
U.S.A.) according to the manufacturer's instructions. One day after
transfection, cells were replaced with DMEM with 10% FBS, 0.1 mM
D-Luciferin potassium salt (Wako Pure Chemical Industries, Ltd.,
Osaka, Japan), 25 mM hepes (Thermo Fisher Scientific Inc., MA,
U.S.A.) with or without 1 mg/ml LPS with 10 mM quercetin or 100 mg/
ml b-D-glucan or 25 mM xanthone or 0.1 mM dexamethasone-Water
Soluble (Sigma-Aldrich Corporation, Missouri, U.S.A.) as anti-
inflammatory compounds. Bioluminescence was recorded in real-
time for 1 min in the presence or absence of optical filter (R60-
long pass filter, HOYA, Tokyo, Japan) at 19-min intervals under a
5% CO2 atmosphere at 37  C for 48 h using an AB-2500 Kronos
(ATTO, Tokyo, Japan) as described previously [23].
2.5. Statistical analysis
The real-time quantitative PCR data were analysed by one-way
analysis of variance (ANOVA) with Tukey's test for selected pairs.
The statistical software “EZR” was used for statistical analysis [24].
Values are indicated as means ± SE. The significant differences are
shown as probability values.
ELISA [27]. It was also reported that 3e25 mM xanthone have anti-
inflammatory activity by inhibition of TNF-a and IL-4 secretion and
suppression of mRNA iNOS and COX-2 expression [28,29]. Our
previous study reported that 100 mg/ml Phellinus igniarius derived
b-D-glucan stimulates transcription of IL-10 and suppresses tran-
scription of IL-6 in LPS-treated RAW 264.7 cells [13]. In this present
study, RAW 264.7 cells were treated with LPS in the presence or
absence of quercetin, b-D-glucan and xanthone. Then, total RNA
was extracted at 6 and 12 h. The expression of IL-6 and IL-10 were
performed by qPCR. The results showed that quercetin and
xanthone significantly suppressed IL-6 and IL-10 at 6 and 12 h
(Fig. S1). b-D-glucan slightly suppressed IL-6 expression at 6 and
12 h. Whereas, b-D-glucan slightly stimulated IL-10 expression at
12 h.
Then, we examined the effect of natural compounds that have
been reported for anti-inflammatory activity on expression of IL-6
and IL-10 reporters. RAW 264.7 cells were transfected IL6-
ELuc:gapdh-SLR and IL10-ELuc:gapdh-SLR promoters. The expres-
sion of IL-6 and IL-10 reporters were measured in the presence or
absence of LPS, 10 mM quercetin, 100 mg/ml b-D-glucan and 25 mM
xanthone by real-time bioluminescence recording. Our results
showed that 10 mM quercetin inhibited the expression of IL-6 and
IL-10 reporters (Fig. 2a,d). We found that 25 mM xanthone has anti-
inflammatory activity by inhibition of expressions of IL-6 and IL-10
reporters (Fig. 2c,f). We also found that 100 mg/ml b-D-glucan
slightly stimulated IL-10 and suppressed IL-6 reporter expression
(Fig. 2b,e). These observations suggested that real-time biolumi-
nescence could determine expression of IL-6 and IL-10 in RAW

3. Results and discussion

In this study, we developed a dual-colour luciferase reporter

assay for determination of IL6-gapdh and IL10-gapdh reporter
expression. For monitoring of IL-6 and IL-10 expressions, we con-
structed two luciferase reporter plasmids, in which IL-6 promoter
fragment (nt 1000 to þ121, where þ1 indicates the putative
transcription start site) or IL-10 promoter fragment (nt 1000
to þ59) was inserted upstream of PEST-fusing ELuc. IL-6 or IL-10
reporter plasmid was co-transfected with reference reporter
plasmid (gapdh promoter fragment was inserted upstream of SLR)
into RAW 264.7 cells for 24 h. After 24 h, transfected RAW
264.7 cells were treated with/without LPS. The transcriptional ac-
tivities of IL-6 and IL-10 promoters were measured as green-
emitting beetle luciferase from Pyrearinus termitilluminans (ELuc,
lmax ¼ 538 nm) luciferase activity [25]. The transcriptional activity
of gapdh promoter was measured as red-emitting beetle luciferase
from Phrixothrix hirtus (SLR, lmax ¼ 630 nm) luciferase activity [26].
The transcriptional activities of ELuc and SLR were measured by
real-time bioluminescence monitoring device (Kronos; Atto) in
every 19min for 48 h. The relative expression of IL-6/gapdh reporter
was calculated by dividing IL6-ELuc luminescence intensity by
gapdh-SLR luminescence intensity at each time point. As expected,
IL-6 (Fig. 1c) and IL-10 (Fig. 1d) driven ELuc luminescence were
strongly induced by LPS, peaking after 12 h. In the absence of LPS
stimulation, both of ELuc and SLR luminescence intensity were
initially low along 48 h (controls in Fig. 1a and b). The relative IL-6/
gapdh reporter expression was induced 26-fold by LPS compared
with non-treatment of LPS (Control) in RAW 264.7 cells (Fig. 1e).
Moreover, relative IL-6/gapdh reporter expression was induced 14-
fold by LPS in Fig. 1f.
We would like to evaluate our new assay by using well-known
anti-inflammatory compounds. Therefore, we confirmed the anti-
inflammatory activity of various compounds by qPCR method. Fig. 3. The effect of dexamethasone on expression of IL-6 and IL-10 reporters. Relative
It was reported that 10 mM quercetin inhibit TNF-a and IL-6 (a) IL-6/gapdh and (b) IL-10/gapdh reporter expression with dexamethasone-water
cytokine levels in LPS-treated RAW 264.7 cells by measuring soluble (DEX). Error bars indicate standard deviation (n ¼ 4).

Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173
 P. Saiki et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
Fig. 4. The effect of natural compounds on peak time. The expression of relative IL-6/
gapdh reporters (a) and IL-10/gapdh reporters (b). The results represent the mean of
four representative experiments. ***p < 0.01 versus the LPS positive control (peak
time).
264.7 cells for anti-inflammatory activity.
However, the data from qPCR showed that mRNA expression of
IL-10 was significantly induced by b-D-glucan after 12 h (Fig.S1b).
Whereas, mRNA expression of IL-10 was barely induced by b-D-
glucan at 6 h. This finding suggested that time course had an effect
on mRNA expression. Therefore, it may cause misrepresentation of
IL-10 expression. By real-time monitoring, we could see a peak time
of IL-6 and IL-10 reporter expression clearly without a risk of time-
course effect. These results from real-time monitoring confirmed
that b-D-glucan could stimulate IL-10 levels.
Moreover, we evaluated our new assay with dexamethasone.
Dexamethasone is a synthetic pharmaceutical corticosteroid [26]. It
has been used for has anti-inflammatory and immunosuppressant
[27]. It was reported that 0.1 mM dexamethasone strongly sup-
pressed IL-6 mRNA expression in RAW 264.7 cells at 6 and 12 which
has analysed by RT-PCR [27]. We co-transfected IL6-ELuc:gapdh-
SLR and IL10-ELuc:gapdh-SLR promoters into RAW 264.7 cells for
24 h. After co-transfection, transfected RAW 264.7 cells were
measured for expression of IL-6 and IL-10 reporters with D-lucif-
erin and 0.1 mM dexamethasone-Water Soluble by real-time
bioluminescence recording. The profiles are shown in Fig. 3. The
results showed that expression of IL-6 and IL-10 reporters were
suppressed by 0.1 mM dexamethasone.
The peak time of relative IL-6/gapdh reporter expression was
delayed by LPS stimulation with quercetin, b-D-glucan and
xanthone significantly. The peak time of relative IL-10/gapdh re-
porter expression was slightly delayed by LPS stimulation with
quercetin and xanthone. Whereas, the peak time of relative IL-10/
gapdh reporter expression was slightly brought forward by b-D-
glucan. Quercetin, b-D-glucan and xanthone are different com-
pounds from natural products. These observations suggested that
different natural compounds had different effects on kinetics of IL-6
and IL-10 reporter expression (Fig. 4). Therefore, we could not
Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173
5
select just only onetime point to see expression of IL-6 an and IL-10
reporters. We also could not choose the correct expression time for
natural compound screening. Therefore, we need real-time moni-
toring of IL-6 and IL-10 expression for natural compounds
screening.
The dual-colour luciferase could be applied in live mice. It was
reported that ELuc:SLR transgenic mice could measure dual-
reporters expression in eye, SCN, pituitary, thyroid, lung, liver, ad-
renal and ovary [23]. Therefore, we might be able to apply IL-6/IL-
10 promoters for transgenic mice and measure IL-6/IL-10 in organs
in the future.
Conflicts of interest
This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors.
Acknowledgements
We would like to thank Dr. Yoshihiro Ohmiya and Dr. Hideaki
Oike for helpful discussions.
Transparency document
Transparency document related to this article can be found
online at https://doi.org/10.1016/j.bbrc.2018.09.173.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.bbrc.2018.09.173.
References
[1] G.K. Hansson, Inflammation, atherosclerosis, and coronary artery disease,
N. Engl. J. Med. 352 (2005) 1685e1695.
[2] H. Xu, G.T. Barnes, Q. Yang, G. Tan, D. Yang, C.J. Chou, J. Sole, A. Nichols,
J.S. Ross, L.A. Tartaglia, H. Chen, Chronic inflammation in fat plays a crucial role
in the development of obesity-related insulin resistance, J. Clin. Invest. 112
(2003) 1821e1830.
[3] P. Libby, Inflammation and atherosclerosis, Circulation 105 (2002)
1135e1143.
[4] L.M. Coussens, Z. Werb, Inflammation and cancer, Nature 420 (2002)
860e867.
[5] R.W. Jones, Inflammation and Alzheimer's disease, Lancet 358 (2001)
436e437.
[6] F. Meng, C.A. Lowell, Lipopolysaccharide (LPS)-induced macrophage activation
and signal transduction in the absence of Src-family kinases Hck, Fgr, and Lyn,
J. Exp. Med. 185 (1997) 1661e1670.
[7] P.D. Anderson, N.N. Mehta, M.L. Wolfe, C.C. Hinkle, L. Pruscino, L.L. Comiskey,
J. Tabita-Martinez, K.F. Sellers, M.R. Rickels, R.S. Ahima, M.P. Reilly, Innate
immunity modulates adipokines in humans, J. Clin. Endocrinol. Metab. 92
(2007) 2272e2279.
[8] K. Eder, N. Baffy, A. Falus, A.K. Fulop, The major inflammatory mediator
interleukin-6 and obesity, Inflamm. Res. 58 (2009) 727e736.
[9] J.K. Kiecolt-Glaser, K.J. Preacher, R.C. MacCallum, C. Atkinson, W.B. Malarkey,
R. Glaser, Chronic stress and age-related increases in the proinflammatory
cytokine IL-6, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 9090e9095.
[10] D.F. Fiorentino, A. Zlotnik, T. Mosmann, M. Howard, A. O'garra, IL-10 inhibits
cytokine production by activated macrophages, J. Immunol. 147 (1991)
3815e3822.
[11] Y. Azuma, K. Ohura, Endomorphins 1 and 2 inhibit IL-10 and IL-12 production
and innate immune functions, and potentiate NF-kappaB DNA binding in THP-
1 differentiated to macrophage-like cells, Scand. J. Immunol. 56 (2002)
260e269.
[12] M. Kunz, K.M. Cerese r, P.D. Goi, G.R. Fries, A.L. Teixeira, B.S. Fernandes,
P.S. Belmonte-de-Abreu, M. Kauer-Sant'Anna, F. Kapczinski, C.S. Gama, Serum
levels of IL-6, IL-10 and TNF-a in patients with bipolar disorder and schizo-
phrenia: differences in pro-and anti-inflammatory balance, Rev. Bras. Psi-
quiatr. 33 (2011) 268e274.
[13] P. Suabjakyong, K. Nishimura, T. Toida, L.J. Van Griensven, Structural charac-
terization and immunomodulatory effects of polysaccharides from Phellinus
linteus and Phellinus igniarius on the IL-6/IL-10 cytokine balance of the
mouse macrophage cell lines (RAW 264.7), Food Funct 6 (2015) 2834e2844.
6 P. Saiki et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6

[14] Y. Nakajima, Y. Ohmiya, Bioluminescence assays: multicolor luciferase assay,
secreted luciferase assay and imaging luciferase assay, Expet Opin. Drug
Discov. 5 (2010) 835e849.
[15] D.K. Welsh, S.A. Kay, Bioluminescence imaging in living organisms, Curr. Opin.
Biotechnol. 16 (2005) 73e78.
[16] K.E. Luker, G.D. Luker, Applications of bioluminescence imaging to antiviral
research and therapy: multiple luciferase enzymes and quantitation, Antiviral
Res 78 (2008) 179e187.
[17] D.S. McNabb, R. Reed, R.A. Marciniak, Dual luciferase assay system for rapid
assessment of gene expression in Saccharomyces cerevisiae, Eukaryot. Cell 4
(2005) 1539e1549.
[18] Y. Ohmiya, Simultaneous multicolor luciferase reporter assays for monitoring
of multiple genes expressions, Comb. Chem. High Throughput Screen. 18
(2015) 937e945.
[19] Y. Kimura, C. Fujimura, Y. Ito, T. Takahashi, S. Aiba, Evaluation of the Multi-
ImmunoTox Assay composed of 3 human cytokine reporter cells by exam-
ining immunological effects of drugs, Toxicol. Vitro 28 (2014) 759e768.
[20] P. Saiki, Y. Kawano, L.J. Van Griensven, K. Miyazaki, The anti-inflammatory
effect of Agaricus brasiliensis is partly due to its linoleic acid content, Food
& function 8 (2017) 4150e4158.
[21] K. Miyazaki, N. Itoh, S. Ohyama, K. Kadota, K. Oishi, Continuous exposure to a
novel stressor based on water aversion induces abnormal circadian locomotor
rhythms and sleep-wake cycles in mice, PloS One 8 (2013) e55452.
[22] T. Takahashi, Y. Kimura, R. Saito, Y. Nakajima, Y. Ohmiya, K. Yamasaki, S. Aiba,
An in vitro test to screen skin sensitizers using a stable THP-1-derived IL-8
reporter cell line, THP-G8, Toxicol. Sci. 124 (2011) 359e369.
[23] T. Noguchi, T. Michihata, W. Nakamura, T. Takumi, R. Shimizu, M. Yamamoto,
M. Ikeda, Y. Ohmiya, Y. Nakajima, Dual-color luciferase mouse directly dem-
onstrates coupled expression of two clock genes, Biochemistry 49 (2010)
8053e8061.
[24] Y. Kanda, Investigation of the freely available easy-to-use software 'EZR' for
medical statistics, Bone Marrow Transplant. 48 (2013) 452e458.
[25] V.R. Viviani, A.C. Silva, G.L. Perez, R.V. Santelli, E.J. Bechara, F.C. Reinach,
Cloning and molecular characterization of the cDNA for the Brazilian larval
click-beetle Pyrearinus termitilluminans luciferase, Photochem. Photobiol. 70
(1999) 254e260.
[26] V.R. Viviani, E.J. Bechara, Y. Ohmiya, Cloning, sequence analysis, and expres-
sion of active Phrixothrix railroad-worms luciferases: relationship between
bioluminescence spectra and primary structures, Biochemistry 38 (1999)
8271e8279.
[27] A. Xagorari, A. Papapetropoulos, A. Mauromatis, M. Economou, T. Fotsis,
C. Roussos, Luteolin inhibits an endotoxin-stimulated phosphorylation
cascade and proinflammatory cytokine production in macrophages,
J Pharmacol Exp Ther 296 (2001) 181e187.
[28] S. Tewtrakul, C. Wattanapiromsakul, W. Mahabusarakam, Effects of com-
pounds from Garcinia mangostana on inflammatory mediators in RAW264.7
macrophage cells, J. Ethnopharmacol. 121 (2009) 379e382.
[29] L.G. Chen, L.L. Yang, C.C. Wang, Anti-inflammatory activity of mangostins from
Garcinia mangostana, Food Chem. Toxicol. 46 (2008) 688e693.

Please cite this article in press as: P. Saiki, et al., Real-time monitoring of IL-6 and IL-10 reporter expression for anti-inflammation activity in live
RAW 264.7 cells, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.09.173