2.

Materials and Methods

2.1. Reagents

In this study, the reagents that were purchased from commercial sources: included

Bafilomycin A1 (Baf), Tetrodotoxin (TTX, Alomone Labs); Ascorbic acid (Sigma-

Aldrich). However, cells were cultured at the institution laboratory.

2.2. Characterization of neuronal cultures

The Howard Hughes Medical Institute's Janelia Farm Research Campus'

Institutional Animal Care and Use and Institutional Biosafety Committees authorized all

experiments. Sprague-Dawley rat pups were used to make a cell culture including both

neurons and glia. Decapitated P0 puppies had their heads placed in ice-cold neural

dissection fluid for dissection (NDS, see media addendum). Pre-warmed plating medium

(PM) was used to wash and enzymatically digest the hippocampi, which were

subsequently mechanically digested via trituration. The papain digestion took about 60

units. Cells were seeded on Matrigel-coated coverslips and incubated at 37°C, 5% CO2 in

partial pressure medium (PM) for around 24 hours before being switched to growth

medium (GM) for the duration of the experiment, with media exchanges every four days.

These cells were cultured for 3 days before being infected with either

AAV.hSynapsin.iGluSnFR or AAV.GFAP.iGluSnFR. Stimulating infected neurons was

done with a custom-built field stimulator that utilized platinum wires. Images were

captured using either an inverted Olympus IX81 motorized microscope (with 10X

objective and 0.4 NA, Chroma Ett-GFP or ET-TxRed filter sets) or an EMCCD camera
20
 (with Andor iXon+ 897, 34.8 frames per second) (20X or 60X objective). Trains 1, 2, and

3 received 40V, 30 Hz, and 1 millisecond pulses, respectively, of field stimulation.

Stimuli on the field: 1, 2, 3, 5, 10, 20, 40, 80, 160. A C&L Instruments, Inc. laminar flow

chamber was used to accomplish buffer exchange during glutamate titrations. MATLAB

(The MathWorks) was used to analyze the photos.

2.3. Plasmid constructs

I have to send you infos about my constract.

21
 Material and
Methods

To live, glutamate is a critical signaling molecule found in the brain and other body organs.

Visualizing and quantifying glutamate transients can be useful to biologists for a variety of

reasons, but it's especially important in neurobiology. In Alzheimer's and stroke, glutamate

dysregulation is implicated, as is glutamate's role in nearly every aspect of healthy brain function

(Janelia, 2015).

Traditional tools like microdialysis have low signal-to-noise ratios, poor localization, and

sluggish kinetics, making them unsuitable for glutamate detection in intact cells. Recent optical

sensors utilize glutamate-binding proteins and fluorescent readouts. Due to small fluorescence

increases upon glutamate binding, these have improved temporal and spatial resolution, but are

still limited to proof-of-principle experiments only (Janelia, 2015).

According to Janelia scientists, they have created a brand-new fluorescent reporter called

iGluSnFR, which is made from E. coli GltI and circularly permuted GFP. One-wavelength

glutamate sensors were developed in vitro and validated in ever-more-complex in vivo systems

in order to get the best possible fluorescence response. Compared to current sensors, this one is

much more sensitive to glutamate. It responds quickly and only to glutamate. This gene can be

used in imaging experiments with two colors and long-term in vivo imaging of glutamate

signaling in worms, zebrafish and mice.

Furthermore, the iGluSnFR construct offers an improved way to map excitatory synaptic activity

in the brain, which will also benefit glutamate imaging studies in non-neuronal tissues, as well as

existing imaging methods for studying neural activity and signaling events (Janelia, 2015).

In addition to existing imaging methods for studies of neural activity and signaling events, the

iGluSnFR construct offers an improved way to map excitatory synaptic activity directly in the

brain. The enhanced performance of iGluSnFR will also benefit glutamate imaging studies in

non-neuronal tissues (Janelia, 2015).

22
 Material and
Methods

The coding sequence of the original plasmid, pAAV.hSynapsin.SF-iGluSnFR.A184S (Addgene

Plasmid #106174), was amplified by PCR using the following primers:

GluSnfr For BamHI

i. ATGGAGACAGACACACTCCTGC GluSnfr Rev EcoRI GC GGATCCGCCACC

ATGGAGACAGACACACTCCTGC

ii. GAATTC CTAACGTGGCTTCTTCTGCCAAAG GC GAATTC

CTAACGTGGCTTCTTCTGCCAAAG

Using BamHI/EcoRI, the PCR product was cloned into the pCDNA3-Syn vector to generate

pCDNA3-Syn iGluSnfrA184S. EcoRI-mediated site-directed mutagenesis was then used to

generate pCDNA3-Syn iGluSnfrA184V using the following flowing primers:

i. GluSnfr A184V sense

TTA CCT TGA TGG ATG ACG TGA TGG ATG ACG TCC ACC ACC ACC ACC ACC ACC

ACC ACC ACC ACC ACC ACC ACC

ii. GluSnfr A184V antisense

CAC GTT CGG CCA GCA CCA CCA CCA CCA CCA CCA CCA CCA CCA CCA CCA CCA

CCA C AGG TAA

23
Material and
Methods

22
 Material and
Methods

2.3. Culture of primary hippocampal neurons (it`s the same in my case)

Primary hippocampal neuron dissection cultures were created using newborn C57/BL6

mice (post-natal day 0 - 1). When it came to animal handling, we complied with all North

Rhine-Westphalia regulations and standards. Hippocampi were harvested from mice

brains and placed in ice-cold Hank's balanced salt solution (HBSS, Gibco) supplemented

with 20 percent FBS before being sliced into 4 - 6 pieces for further study. Under sterile

conditions, hippocampi pieces were put in a 15 ml tube. After that, they were washed

three times: once with HBSS containing 20% FBS and twice with HBSS devoid of the

protein-rich solution. This was followed by 15 minutes of digestion at 37oC with trypsin

(5 mg/ml, Sigma) and DNase (0.5 mg/ml, Sigma) on the hippocampi fragments. Trypsin

was suppressed by washing the cells twice with 20% FBS and then twice with HBSS

without serum. To triturate the disintegrating tissue, a predefined volume of plating

medium containing DNase (0.5 mg/ml) was utilized. The cell solution was applied to 18

mm Matrigel-coated glass coverslips (50 l per coverslip). Plates were placed in a humid

incubator (37oC, 5% CO2) for 60 minutes to allow cells to settle and attach.

Each well was then plated with 1 milliliter of plating media. After a 24-hour incubation

period, 0.5 ml of growth media was added to each well. We replaced the growth medium

with growth medium that included 6 M cytosine arabinoside 48 hours after plating to

inhibit glia cell proliferation (AraC, Sigma). For 15-25 days, neurons were cultured in a

petri dish (DIV). A third of the medium was changed out weekly and fresh growth media

with 2 M AraC was introduced weekly.

23
 Material and
Methods

Media and solutions used for neuronal culture:

Digestion solution - 137 mM NaCl, 5 mM KCl, 7 mM Na2HPO4, 25 mM HEPES,

adjusted with NaOH to pH 7.2 with 5 mg/ml trypsin (Sigma) and 0.5 mg/ml DNase

(Sigma)

Growth medium - Neurobasal A medium (NBA, Gibco) containing the following

supplements: 2% B27 (Gibco), 2 mM Glutamax (Gibco), 10 units/ml penicillin and

10 µg/ml streptomycin (Gibo)

Plating medium - minimal essential medium (MEM, Gibco) containing the following

supplements per 500 ml: 2.5 g glucose, 100 mg NaHCO3, 50 mg transferrin

(Calbiochem), 10% FBS (Biochrome), 1 ml 0.2 M L-glutamine (Sigma), 2.5 mg insulin

(Sigma)

2.5. Transfection of hippocampal neurons (it`s also the same)

Nerves were transfected using an improved calcium phosphate transfection method (Threadgill et

al., 1997).

Between the 4th and 5th day following culture, neurons were transfected. 30 minutes before

transfection, neuron-containing coverslips were switched to a new plate with pre-warm NBA

media without additives. CaP/DNA precipitate was made by mixing the components mentioned

below according to the directions found on each coverslip. For this experiment, 3 ng of DNA

was utilized, as well as 25 ul of BBS (which comprises 50 mmol of BES, 280 mg of sodium

chloride, and 1.5 mmol of sodium biphosphate dihydrochloride) and 50 l of deionized water. For

15 to 20 minutes, the mixture was incubated at RT without illumination. The precipitate was then

24
 Material and
Methods
slowly infused with 450 l of NBA medium, which was added in little drops. The media used to

culture the neurons prior to transfection was supplemented with precipitate and NBA (500

l/coverslip), and the mixture was incubated for 15 to 20 minutes at 37°C. It was necessary to

wash the cells three times, without Ca2+ and Mg2+, to eliminate the fine sand precipitate. The

cells were then incubated for 10 to 15 minutes between washings. Finally, the cells were

transferred back to the original dish and cultured as before. In the instance of dual transfection,

the total amount of DNA was kept at 6 g, with equal amounts of both plasmids.

One maxi-prep purification kit free of endotoxins was utilized to clean all of the transfected

DNA plasmids (Qiagen).

2.6. Fluorescent probes: pHluorin ( I would also use this part in combination about

pHoenix constract infos wich I will sned you additionally- pHlourin i spart oft he

pHoenix)

Optical methods such as pHluorin-based assays can be used to evaluate presynaptic activity.

Since pHluorin is a pH-sensitive variant of GFP with a pK of 7.1, this fluorescent tag works well

as an SV exo- and endocytosis reporter (Sankaranarayanan et al., 2000). pHluorin and GFP share

a lot of similarities in terms of their excitation and emission spectra. At 475 nm, pHluorin's

excitation reaches its maximum, whereas at 508 nm, it reaches its maximum emission. The

pHluorin moiety is fused to the lumenal part of Synaptobrevin2 to examine SV recycling.

When pHluorin is at rest, it does not absorb 488 nm light because of the acidic intravesicular pH.

When SVs merge with the plasma membrane during stimulation, the fluorescence signal

increases 20-fold, and freshly exocytosed pHluorin that is exposed to extracellular neutral pH is

dequenched. After compensatory endocytosis and subsequent reacidification of SVs, the

pHluorin signal is re-quenched, resulting in a drop in fluorescence signal. By superfusing the

25
 Material and
Methods
pHluorin-tagged SV proteins with an acid solution, the surface-stranded percentage may be

measured.

This neutralizes any pHluorin molecules that may have escaped into the extracellular

space. In order to dissipate pH gradients across membranes and therefore unquench all

internalized pHluorin molecules, it is possible to use superfusion with an NH4Cl-

containing solution to quantify the complete internalized pool of pHluorin-labelled proteins

(Figure 2.2).

Figure 2.2. pHluorin-based assay theory of operation. (A) I - When pHluorin is at rest,

the acidic pH inside SVs quenches it. II - When pHlurion is promoted, a neutral external

pH dequenches it. To compensate for compensatory endocytosis and reacidification,

pHluorin is quenched in steps III and IV before being re-quenched. Superfusion with an

acidic solution can be used to estimate pHluorin's surface fraction. Using NH4Cl

superfusion, the previously buried pHluorin molecular pool is now visible. An adjusted

version of the original by Sankaranarayanan and colleagues (Sankarayanan and

colleagues, 2000). (B) Average Syb2-pHluorin response to a 20 Hz 200-AP stimulation

train. The kinetic reaction has phases that are classified based on (A).

26
 Material and
Methods

2.6.1. Preparation of lentiviral particles

For every 10 centimeter plate, one polystyrene tube was made. OPTIMEM was supplied in the

dose of 1.18 cc to each tube. Each tube received 23.6 l of Transit 293 reagent, which was mixed

before being incubated at root temperature for 10 minutes. The DNA was inserted after the

incubation period. 5 g of lentiviral construct, 2.5 g of pCMV R.8.2 Helper 2 (Pack), and 5 g of

pM D2.G Helper 1 (ENV) were carefully mixed together and incubated at room temperature.

During the incubation period, the media in all plates was replaced with 10 ml of fresh DMEM

(the medium's name). Following the incubation period, the DNA was disseminated dropwise

throughout the entire plate before being incubated for 72 hours at 37 degrees Celsius and 5%

CO2.

2.6.2. Virus particle concentration:

PC12 cells were cultured on PDL- and collagen-coated coverslips (4 coverslips of cells were

required per viral particle solution). The cells were infected with viral particles the following

day: Well 1: 1yl virus particle solution; Well 2: 0.5l viral particle solution; Well 3: 0.25l virus

particle solution; and Well 4: 0.10l virus particle solution. For six days, the infected cells were

cultured at 37 degrees Celsius and 5% CO2. After 6 days, they were inspected microscopically:

10 photos were obtained per well (transmitted light + fluorescence), and all cells per image

section were counted first, followed by positively transduced cells. The fraction of transduced

cells that were positive was calculated as a percentage. The amount of viral particle solution

required to infect around 70 - 80 percent of cells was utilized in the following investigations to

infect hippocampal neurons or cell lines.

27
 Material and
Methods
2.6.3. Normal transduction protocol

On the first day, neurons are prepared by adding 1ml of platinum medium.

Day 2: Make a new sixwell by pouring 1ml of GM medium into each well. Viruses were then

introduced, and the coverslips were transferred from the original plate to the new plate for 5 to 6

hours of incubation. After the GM transduction wash, 500yl GM was added to each well in the

original plate. After that, it was rinsed to remove 500l per well ahead of time. Later, 1ml of GM

was added once again. 1ml GM was removed, 1ml GM was added, and 1ml GM was removed

once again. The coverclips were then reattached to the plate in their original location.

On day 3, the medium was changed: 500l was removed from each well and 500l of GM 2M

ARAC was added to obtain the final concentration.

Then there was a weekly medium shift.

2. 9. Immunofluorescence ( this part you can also rewrite, I did immunoessays but I

am not sure yet which of them will be in Results part. This we can do at very end, no

stress)

To visualize the……, nanobodies (NBs) directed against ….were used.

28
 Material and
Methods

The..... was subjected to live cell immunostaining. Fixed and permeabilized neurons were used to

stain proteins like Bassoon (a marker for the active zone), Syb2, Syntaxin1a (for SVs), Rab5,

Vti1a, and others. For 20 minutes at room temperature, cells were fixed in PFA solution

containing 4 percent paraformaldehyde (PFA). After fixation with PFA, cells were treated for 20

minutes at room temperature with 100 mM glycin in PBS to reduce background. Cells were

permeabilized using a blocking solution containing Saponin (0.2%) for 1h at room temperature.

A primary mouse monoclonal antibody directed against Bassoon was used to treat the cells for 3

hours at room temperature (RT) (dilution 1:500 in blocking buffer, Synaptic Systems). The cells

were incubated for 1 hour at room temperature with the secondary antibody anti-....... (dilution

1:1000 in blocking buffer, Invitrogen) after being washed for 30 minutes with washing buffer.

Finally, three PBS washes were performed on the cells. An STED commercial microscope with a

100x oil immersion objective (NA..., Leica) was used to photograph the specimens.

The immunostaining solution is:

Bovine serum albumin (3%) in PBS, 0.2 percent Saponin (Sigma); blocking buffer (Sigma) 0.2

percent BSA and 0.05 percent saponin in PBS (the washing buffer)

2.10. Epifluorescence microscopy of living neurons (THE SAME)

Everything was done in a modified version of Tyrode's solution, without fail. An electric

field stimulated by 50 mA pulses of 1 ms delivered via a constant-current stimulus isolator

triggered neurons using platinum electrodes spaced 10 mm apart and delivered at a frequency

of 20 Hz (WPI A 385, World Precision Instruments). CNQX, Tocris Bioscience (10 M), and

AP5, Tocris Bioscience, were utilized to prevent the aberrant activity from recurring (50 M). A
29
 Material and
Methods
two-barrel glass tube perfusion system was operated by a piezo-controlled stepper device to

switch out the solution (SF778, Warner Instruments). NH4Cl was used in place of the 50 mM

NaCl to create the ammonium chloride solution (pH 7.4), and everything else was left the

same.

Researchers obtained images with an inverted Nikon Ti Eclipse microscope, CoolLED

pE-2 and CoolLED LED diodes, and a fiber-coupled laser box (Omicron). Fluorescence

emission was detected with a Nikon Apo, NA 1.2 water immersion objective, AHF

Analysentechnik quadband filter set, and an ORCA Flash, Hamamatsu CMOS camera with

Hokawo software (Hamamatsu). GFP was triggered using a 488 nm LED, while pHluorin was

ignited using a 561 nm laser (Phoxx, Omicron). the pHluorin experiments used an exposure

period of...ms and a sampling rate of... Hz, and the images were taken in 2x2 binning mode

(for the pHoenix experiments).

Photobleaching at 488 nm laser light was employed for one minute on.. (Jive, Cobolt, 200

mW output). You will need an optosplit (Cairn Research) and AHF Analysentechnik filter sets

525/45, BS 570 and 612/69 on your microscope to get the best results when performing dual-

color dispersion testing on your samples. Images were taken at a frequency of 10 Hz and an

exposure period of 70 ms.

This is the solution used for live-cell imaging, which is a modified Tyrode's solution

(25mM HEPES, 119.5mM NaCl, 2mM KH2, 2mM MgCl2, and 30mM glucose, pH 7.4)

with 2mM CaCl2.

30
 Material and
Methods

2.11. Data analysis

Custom-written macros in Igor Pro (Wavemetrics) were used for quantitative

analysis of pHluorin and pHoenix studies, as previously described (Wienisch and

Klingauf, 2006). The intensity of fluorescence changes upon stimulation in functional

boutons, which were discovered. An á-trous wavelet transformation was used to the

difference image, which was generated by subtracting the average of five photos taken

before and after stimulation (Olivo-Marin, 2002). Spots represent hypothetical functional

boutons in the generated picture mask. It was decided that only spots with a surface area

between 4 and 20 pixels would be considered for further investigation. To isolate

individual bouton fluorescence transients, the mask was layered over time lapse photos.

All estimated time courses were visually verified to ensure that they corresponded to the

particular boutons that were functional. For the sake of this analysis, only experiments

have to have at least 50 active boutons.

The picture stacks received were analyzed using custom-written macros in Igor

Pro (Wavemetrics, USA). The intensity of fluorescence in functioning synaptic boutons

was altered by electrical activation. We discovered this by utilizing an automated

detection method (Wienisch and Klingauf, 2006). A difference image was obtained by

removing five averaged images from the time series before and after stimulation. The à

trous wavelet was applied to the difference image with k = 5 and detection ld = 1.0 to

create a new image. It was discovered that presynaptic boutons of this approach were

between the sizes of 6 and 20 pixels in size and had a certain circularity (figure 2.8).

Overlaying a mask on the original image sequence yielded single bouton fluorescence

transients. Individual traces were normalized and visually examined to remove erroneous

and noisy traces before calculating an average response for all boutons selected using a

31
 Material and
Methods
mask.

32